CN1936004B - Medicinal plant radix euphorbiae pekinensis 3-hydroxy-3-methyl glutaryl coenzyme A reductase protein coding sequence - Google Patents
Medicinal plant radix euphorbiae pekinensis 3-hydroxy-3-methyl glutaryl coenzyme A reductase protein coding sequence Download PDFInfo
- Publication number
- CN1936004B CN1936004B CN2006101257969A CN200610125796A CN1936004B CN 1936004 B CN1936004 B CN 1936004B CN 2006101257969 A CN2006101257969 A CN 2006101257969A CN 200610125796 A CN200610125796 A CN 200610125796A CN 1936004 B CN1936004 B CN 1936004B
- Authority
- CN
- China
- Prior art keywords
- hmgr
- sequence
- medicinal plant
- radix euphorbiae
- plant radix
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Peptides Or Proteins (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention relates to medicine using plant spurge Ep-Hmgr protein coding sequence. The separated DNA molecule includes nucleotide sequence of polypeptide of plant spurge Ep-Hmgr protein activity that has at least 70% homology of the nucleotide sequence of 81-1832 in SEQ ID NO.3, or the sequence could take crossbreeding with the nucleotide sequence of 81-1832 in SEQ ID NO.3 at 40-55 degree centigrade. The invention is a reductase of 3-hydroxyl-3-methyl glutaryl coenzyme a to improve the secondary metabolism product or the precursor content of medicine using plant spurge.
Description
Technical field
The present invention relates to molecular biology, gene engineering technology field.Particularly, the present invention relates to a kind of Ep-Hmgr albumen (medicinal plant radix euphorbiae pekinensis 3-hydroxy-3-methyl glutaryl CoA reductase protein of in medicinal plant radix euphorbiae pekinensis, expressing, Euphorbia pekinensis 3-hydroxy-3-methylglutaryl-CoA Reductase, EpHMGR) and nucleotide sequence.
Background technology
Medicinal plant radix euphorbiae pekinensis (Euphorbia pekinensis) has another name called RADIX EUPHORBIAE PEKINENSIS, general's grass, Herba Peristrophes etc., belongs to Euphorbiaceae on plant taxonomy, is per nnial herb.Complete stool contains milk.Modern medicine study finds that the root of medicinal plant radix euphorbiae pekinensis has multiple pharmacological effect, as cause rush down, diuresis, step-down etc.Clinical acute and chronic nephritic edema and advanced schistosomiasis ascites or other liver cirrhosis ascites of generally being used for the treatment of.Discover that the medicinal plant radix euphorbiae pekinensis root contains triterpenes components euphorbon, alkaloid, euphorbia A, B, C.In addition gummy, resin etc.These all are secondary metabolite.Modern science discovers that secondary metabolite is a natural active matter, is that to solve the Western medicine toxic side effect that the present world faces big, and difficult diseases such as cancer, acquired immune deficiency syndrome (AIDS) such as can't cure at a new way of a difficult problem.
In recent years, the secondary metabolism of many vegetable materials be studies have shown that HMGR is key enzyme in the mevalonate pathway.3-hydroxy-3-methylglutaric acid list acyl CoA (HMGCoA) generates mevalonic acid (MVA) under the effect of HMGR in mevalonate pathway.Because this reaction is a non-reversible process, so HMGR is considered to first rate-limiting enzyme in this approach.By improving the activity or the content of 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme, the content of secondary metabolite or its precursor in the raising medicinal plant radix euphorbiae pekinensis that can be indirect.
In analysis to existing document, " Plant Cell (vegetable cell); 1992; 4 (10): 1333-1344 " reported and cloned the 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene from potato, announced the sequence of the 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene of rubber tree etc. on the NCBI website.But medicinal plant radix euphorbiae pekinensis Ep-Hmgr protein sequence and nucleotide sequence thereof report is not arranged as yet so far.
Before the present invention comes forth, any medicinal plant radix euphorbiae pekinensis Ep-Hmgr protein sequence and nucleotide sequence of mentioning in the present patent application thereof that disclose or reported do not arranged as yet.
Summary of the invention
The objective of the invention is to overcome deficiency of the prior art, a kind of medicinal plant radix euphorbiae pekinensis Ep-Hmgr albumen coded sequence is provided.Make it comprise said gene Fusion gene construct, carry the new recombinant expression vector of this construct, by said expression vector transformed plant cells, and the transgenic plant and the offspring thereof of the said gene that produces by transformant, comprise plant seed and plant tissue, the transgenic plant that obtained will have the secondary metabolite content that significantly improves.
The present invention is achieved by the following technical solutions, the present invention isolated dna molecular comprise: coding has the nucleotide sequence of polypeptide of medicinal plant radix euphorbiae pekinensis Ep-Hmgr protein-active, shows at least 70% homology from the nucleotides sequence of Nucleotide 81-1832 position among described nucleotide sequence and the SEQ ID NO.3; Perhaps described nucleotide sequence can be under 40-55 ℃ of condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of Nucleotide 81-1832 position.
Preferably, described sequence encoding has the polypeptide of the aminoacid sequence shown in the SEQ ID NO.3.More preferably, described sequence has among the SEQ ID NO.3 nucleotide sequence from Nucleotide 81-1832 position.
The isolated medicinal plant radix euphorbiae pekinensis Ep-Hmgr of the present invention protein polypeptide, it comprises: have polypeptide or its conservative property variation polypeptide or its active fragments of SEQ ID NO.3 aminoacid sequence, or its reactive derivative.Preferably, this polypeptide is to have SEQ ID NO.3 polypeptide of sequence.
In the present invention, " isolating ", " purifying " DNA are meant, this DNA or fragment have been arranged in the sequence of its both sides and have separated under native state, refer to that also this DNA or fragment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.
In the present invention, term " medicinal plant radix euphorbiae pekinensis Ep-Hmgr albumen (or polypeptide) encoding sequence " refer to the encode nucleotide sequence of polypeptide with medicinal plant radix euphorbiae pekinensis Ep-Hmgr protein-active is as 81-1832 position nucleotide sequence and degenerate sequence thereof among the SEQ ID NO.3.This degenerate sequence is meant, is arranged in the encoder block 81-1832 position Nucleotide of SEQ ID NO.3 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, thus with SEQ ID NO.3 in 81-1832 position nucleotide sequence homology be low to moderate about 70% the degenerate sequence described sequence of SEQ ID NO.3 of also encoding out.This term also comprises can be under the moderate stringent condition, better under the height stringent condition with SEQ ID NO.3 in from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 81-1832 position.This term also comprise with SEQ ID NO.3 in from the homology of nucleotide sequence at least 70% of Nucleotide 81-1832 position, preferably at least 80%, more preferably at least 90%, at least 95% nucleotide sequence best.
This term also comprises encoding to have the variant form of open reading frame sequence among the proteic SEQ ID NO.3 with natural medicinal plant radix euphorbiae pekinensis Ep-Hmgr albumen identical function.These variant forms comprise (but being not limited to): several (are generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and several (are generally in 60 to hold interpolation 5 ' and/or 3 ', preferably being in 30, more preferably is in 10, is in 5 best) Nucleotide.
In the present invention, term " medicinal plant radix euphorbiae pekinensis Ep-Hmgr albumen or polypeptide " refers to have the SEQ ID NO.3 polypeptide of sequence of medicinal plant radix euphorbiae pekinensis Ep-Hmgr protein-active.This term also comprises the variant form that has with the SEQ ID NO.4 sequence of natural medicinal plant root of Beijing euphorbia Ep-Hmgr albumen identical function.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of medicinal plant radix euphorbiae pekinensis Ep-Hmgr and reactive derivative.
The variant form of medicinal plant radix euphorbiae pekinensis Ep-Hmgr protein polypeptide of the present invention comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low stringent condition can with the coded albumen of the DNA of medicinal plant radix euphorbiae pekinensis Ep-Hmgr protein D NA hybridization and the polypeptide or the albumen that utilize the serum of medicinal plant radix euphorbiae pekinensis Ep-Hmgr protein polypeptide to obtain.
In the present invention, " medicinal plant radix euphorbiae pekinensis Ep-Hmgr albumen conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO.3, have 10 at the most, preferably at the most 8, more preferably 5 amino acid similar performances or close amino acid are replaced and are formed polypeptide at the most.These conservative property variation polypeptide are preferably replaced according to table 1 and are produced.
Table 1
| Initial residue | Representational replacement | The preferred replacement |
| Ala(A) | Val；Leu；Ile | Val |
| Arg(R) | Lys；Gln；Asn | Lys |
| Asn(N) | Gln；His；Lys；Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro；Ala | Ala |
| His(H) | Asn；Gln；Lys；Arg | Arg |
| Ile(I) | Leu；Val；Met；Ala；Phe | Leu |
| Leu(L) | Ile；Val；Met；Ala；Phe | Ile |
| Lys(K) | Arg；Gln；Asn | Arg |
| Met(M) | Leu；Phe；Ile | Leu |
| Phe(F) | Leu；Val；Ile；Ala；Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr；Phe | Tyr |
| Tyr(Y) | Trp；Phe；Thr；Ser | Phe |
| Val(V) | Ile；Leu；Met；Phe；Ala | Leu |
Table 2
Query: the nucleotide sequence of medicinal plant radix euphorbiae pekinensis Ep-Hmgr
Sbjct: the nucleotide sequence (AF429388) of para rubber tree Hb-Hmgr
Table 2 is that the homology of the nucleotide sequence of medicinal plant radix euphorbiae pekinensis Ep-Hmgr of the present invention and para rubber tree (Para rubber tree) Ps-Hmgr compares (GAP) table.
Table 3
Query: medicinal plant radix euphorbiae pekinensis Ep-Hmgr aminoacid sequence
Sbjct: para rubber tree Hb-Hmgr aminoacid sequence (AAQ63055.1)
Table 3 is that the homology of the aminoacid sequence of proteic aminoacid sequence of medicinal plant radix euphorbiae pekinensis Ep-Hmgr of the present invention and para rubber tree Hb-Hmgr compares (FASTA) table.Wherein, identical amino acid marks with the amino acid monocase between two sequences.
Invention also comprises the analogue of medicinal plant radix euphorbiae pekinensis Ep-Hmgr albumen or polypeptide.The difference of these analogues and natural 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its proteolysis performance or optimized solubility property by modifying.
In the present invention, can select various carrier known in the art for use, the carrier as commercially available comprises plasmid, clay etc.When producing medicinal plant radix euphorbiae pekinensis Ep-Hmgr protein polypeptide of the present invention, medicinal plant radix euphorbiae pekinensis Ep-Hmgr albumen coded sequence operationally can be connected in expression regulation sequence, thereby form medicinal plant radix euphorbiae pekinensis Ep-Hmgr protein expression vector.
As used herein, " operationally being connected in " refer to a kind of like this situation, and promptly some part of linear DNA sequence can influence the activity of same other parts of linear DNA sequence.For example, if signal peptide DNA as precursor expression and participate in the secretion of polypeptide, signal peptide (secretion leader sequence) DNA operationally is connected in polypeptid DNA so; If transcribing of promotor control sequence, it is operationally to be connected in encoding sequence so; When if ribosome bind site is placed in the position that can make its translation, it is operationally to be connected in encoding sequence so.Generally, " operationally being connected in " means adjacent, then means in reading frame adjacent for the secretion leader sequence.
Whether and quantity the expression of also available Northern blotting technical Analysis medicinal plant radix euphorbiae pekinensis Ep-Hmgr protein gene product promptly analyzes the existence of the proteic rna transcription thing of medicinal plant radix euphorbiae pekinensis Ep-Hmgr in cell.
In addition, can be used as the nucleic acid molecule of probe among the present invention, this molecule has 8-100 continuous nucleotide of medicinal plant radix euphorbiae pekinensis Ep-Hmgr albumen nucleotide coding sequence usually, preferably has 15-50 continuous nucleotide.This probe can be used for whether existing in the test sample the proteic nucleic acid molecule of coding medicinal plant radix euphorbiae pekinensis Ep-Hmgr.
The present invention relates to whether exist in the test sample method of medicinal plant radix euphorbiae pekinensis Ep-Hmgr pyrenoids nucleotide sequence, it comprises with above-mentioned probe and sample and hybridizing whether detection probes combination has taken place then.Preferably, this sample is the product behind the pcr amplification, and wherein the pcr amplification primer is corresponding to medicinal plant radix euphorbiae pekinensis Ep-Hmgr albumen nucleotide coding sequence, and can be positioned at the both sides or the centre of this encoding sequence.Primer length is generally 15-50 Nucleotide.
In addition, according to medicinal plant radix euphorbiae pekinensis Ep-Hmgr pyrenoids nucleotide sequence of the present invention and aminoacid sequence, can be on the homology basis of nucleic acid homology or marking protein, screening medicinal plant radix euphorbiae pekinensis Ep-Hmgr albumen homology gene or homologous protein.
In order to obtain the dot matrix of the medicinal plant radix euphorbiae pekinensis cDNAs relevant with medicinal plant radix euphorbiae pekinensis Ep-Hmgr protein gene, can screen medicinal plant radix euphorbiae pekinensis cDNA library with dna probe, these probes are under low stringent condition, use
32P to medicinal plant radix euphorbiae pekinensis Ep-Hmgr proteic all or part of do the radioactivity mark and.The cDNA library that most is suitable for screening is the library from medicinal plant radix euphorbiae pekinensis.Structure is that biology field is well-known from the method in the cDNA library of interested cell or tissue.In addition, many such cDNA libraries also can buy, for example available from Clontech, and Stratagene, Palo Alto, Cal..This screening method can be discerned the nucleotide sequence with the proteic gene family of medicinal plant radix euphorbiae pekinensis Ep-Hmgr.
Medicinal plant radix euphorbiae pekinensis Ep-Hmgr pyrenoids thuja acid full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.
Except producing with recombination method, the also available solid phase technique of the proteic fragment of the present invention is produced (people such as Stewart, (1969) Solid-Phase Peptide Synthesis, WH Freeman Co., San Francisco by direct peptide synthesis; Merrifield J. (1963) J.Am Chem.Soc 85:2149-2154).Can carry out by hand or automatically at external synthetic protein.For example, can (Foster City CA) synthesizes peptide automatically with the 431A type peptide synthesizer of Applied Biosystems.Can distinguish proteic each fragment of chemosynthesis the present invention, be connected to produce the molecule of total length with chemical process then.
Utilize medicinal plant radix euphorbiae pekinensis Ep-Hmgr albumen of the present invention,, can filter out with medicinal plant radix euphorbiae pekinensis Ep-Hmgr albumen interactional material takes place, perhaps acceptor, inhibitor or short of money dose etc. by various conventional screening methods.Medicinal plant radix euphorbiae pekinensis Ep-Hmgr protein gene of the present invention can be used for improving the content of secondary metabolite in the medicinal plant radix euphorbiae pekinensis or its precursor by genetic engineering technique; and these secondary metabolites have huge using value clinically, and are helpful to the protection people's healthy growth.Thereby the present invention has great application prospect.
Embodiment
Below in conjunction with the concrete testing data in laboratory and in conjunction with specific embodiments, further set forth the present invention.These embodiment only are used to the present invention is described and are not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, for example the Sambrook equimolecular is cloned: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1
The clone of medicinal plant radix euphorbiae pekinensis Ep-Hmgr protein gene
1. separate tissue (isolation)
The medicinal plant radix euphorbiae pekinensis root origin is in Medicinal Plant Biological Technology Key Laboratory, Jiangsu, take material after, place the freezing preservation of liquid nitrogen immediately.
2.RNA separation (RNA isolation)
Get portion of tissue, grind, add the 1.5mL EP pipe that fills lysate, fully after the vibration, move in the glass homogenizer again with mortar.Move to after the homogenate in the 1.5mL EP pipe, and extracted total RNA (TRIzol Reagents, GIBCO BRL, USA).Identify total RNA quality with the denaturing formaldehyde gel electrophoresis, on spectrophotometer, measure rna content then.
3. the full-length clone of gene (Cloning of Full-length cDNA)
According to the amino acid conserved sequence of some plant Hmgr, the design degenerate primer utilizes homologous genes clone principle, adopts Smart-RACE method (Clonetech test kit) to carry out the cDNA full-length clone, divides three phases to carry out:
(1)3’-RACE
PCR (UPM+F2) obtains EPF2 ' (1061bp), reclaim, be connected on the pGEMT-Easy carrier, with SP6 or T7 as universal primer, adopt thing fluorescent mark (Big-Dye, Perkin-Elmer, method USA) of stopping, (Perkin-Elmer checks order on USA) at ABI 377 sequenators.Sequencing result GCG software package (Wisconsingroup, USA) BLAST in and the existing database of FASTA software search (Genebank+EMBL), the homology of Hmgr gene of knowing its nucleotide sequence and proteins encoded and known xylophyta such as rubber tree (Hevea brasiliensis) etc. is very high, so think that tentatively it is a Hmgr gene.
(2)5’-RACE
According to 3 ' RACE result, design reverse special primer R2, obtain EPR2 ' (1397bp) (process is with (1)) through PCR (UPM+R2).Reclaim, be connected on the T-Easy carrier, with SP6 or T7 as universal primer, adopt stop the thing fluorescent mark (Big-Dye, Perkin-Elmer, method USA), (Perkin-Elmer checks order on USA) at ABI 377 sequenators.
(3) with 5 ' RACE sequencing result and 3 ' RACE sequencing result than preface and splice, obtain the full length fragment sequence information, and design a pair of special primer and carry out pcr amplification Ep-Hmgr coding region (DF1+DR1) and obtain Ep-Hmgr coding region (1752bp) (process with (1)).
The gene that result's proof of BLAST newly obtains from medicinal plant radix euphorbiae pekinensis really is a plant Hmgr gene.By being used in combination above-mentioned 3 kinds of methods, obtained the complete encoding sequence of candidate's medicinal plant radix euphorbiae pekinensis EpHMGR.Obtain on the total length basis of (comprising complete open reading frame at least) in splicing, further EpHMGRF1:5 '-CCTCCAACTCATAAACACGCAT-3 ' (SEQ ID NO.1) is a forward primer to the design primer, oligonucleotide EpHMGRR1:5 '-GTTTGTACAACAACATATG-3 ' (SEQ ID NO.2) is a reverse primer, with total RNA is template, carry out the RT-PCR amplification, the PCR condition of EpHMGRFl/EpHMGRR2 be 94 ℃ 5 minutes, carried out 35 circulations in 2 minutes with 94 ℃ 1 minute, 58 ℃ 1 minute and 72 ℃ thereupon, extended 10 minutes with 72 ℃ at last.The electrophoresis detection pcr amplification product, the acquisition expanding fragment length is 2162bp.Clone, check order with pcr amplification product according to a conventional method then, obtain the sequence shown in the SEQ ID NO.3.
Embodiment 2
The sequence information and the homology analysis of medicinal plant radix euphorbiae pekinensis Ep-Hmgr protein gene
The length of the medicinal plant radix euphorbiae pekinensis Ep-Hmgr albumen full-length cDNA that the present invention is new is 2200bp, and detailed sequence is seen SEQ ID NO.3, and wherein open reading frame is positioned at 81-1832 position Nucleotide.Derive the proteic aminoacid sequence of medicinal plant radix euphorbiae pekinensis Ep-Hmgr according to full-length cDNA, totally 583 amino-acid residues, molecular weight 62710.33, pI are 6.51.Detailed sequence is seen SEQ ID NO.4.
Proteic full length cDNA sequence of medicinal plant radix euphorbiae pekinensis Ep-Hmgr and coded protein thereof are carried out Nucleotide and protein homology retrieval with blast program in Non-redundant GenBank+EMBL+DDBJ+PDB and Non-redundant GenBank CDStranslations+PDB+SwissProt+Superdate+PIR database, found that it and para rubber tree 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene (AF429388) have higher homology (subordinate list 2) on nucleotide level; On amino acid levels, it and para rubber tree 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme (GenBank Accession No.AAQ63055.1) has 83% homogeny and 90% similarity (seeing Table 3).This shows, all there are higher homology in medicinal plant radix euphorbiae pekinensis Ep-Hmgr albumen and para rubber tree 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme on nucleic acid still is protein level, so can think that medicinal plant radix euphorbiae pekinensis Ep-Hmgr albumen is also similar on function.
Embodiment 3
Medicinal plant radix euphorbiae pekinensis Ep-Hmgr albumen carries out prokaryotic expression and purification in intestinal bacteria
In this embodiment, the medicinal plant radix euphorbiae pekinensis Ep-Hmgr albumen coded sequence of total length or fragment are built into commercial protein merge among the expression vector, to express and purification of recombinant proteins.
Medicinal plant radix euphorbiae pekinensis Ep-Hmgr protein polypeptide is carried out prokaryotic expression with the form of fusion rotein in intestinal bacteria.
Construction of prokaryotic expression vector, and transformed into escherichia coli
According to the proteic aminoacid sequence of medicinal plant radix euphorbiae pekinensis Ep-Hmgr, the primer of design protein-coding region, and on positive anti-primer, introduce restriction endonuclease sites (this decides according to pET32a (+) carrier of selecting for use) respectively, so that construction of expression vector.Amplified production with acquisition among the embodiment 1 is a template, behind pcr amplification, medicinal plant radix euphorbiae pekinensis Ep-Hmgr protein gene is being guaranteed to be cloned into pET32a (+) carrier (Novagen) under the correct prerequisite of reading frame.Identify that good expression vector utilizes CaCl
2Method changes e. coli bl21 over to, and Screening and Identification obtains containing engineering bacteria BL21-pET32a (+)-3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme of pET32a (+)-3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme expression vector.
Express the isolation identification of the engineering bacteria of Trx-Ep-Hmgr recombinant protein
The BL21-pET32a (+) of picking list bacterium colony-Ep-Hmgr engineering bacteria contains jolting overnight incubation in the LB substratum of 100 μ g/mL penbritins in 3mL, draw nutrient solution by 1: 100 concentration and in new LB substratum (containing 100 μ g/mL penbritins), cultivated about 3 hours, to OD
600After reaching 0.5, adding IPTG continues at 37 ℃ to final concentration 1mmol/L and cultivated respectively 0,1,2,3 hours.It is centrifugal to get the different 1mL bacterium liquid of incubation time, in the bacterial precipitation thing, add lysate (2 * SDS sample-loading buffer, 50 μ L, distilled water 45 μ L, 3-mercaptoethanol 5 μ L), the suspendible bacterial precipitation, boiled in the boiling water bath 5 minutes, centrifugal 1 minute of 10000rpm, supernatant adds electrophoresis in the 12%SDS-PAGE glue.The bacterial strain that the protein content of dyeing back observation expection molecular weight size increases with the IPTG induction time is the engineering bacteria of expressing the Trx-3-Ep-Hmgr fusion rotein.
The extraction purifying of Trx-3-Ep-Hmgr fusion rotein
The proteic engineering bacteria BL21-pET32a of abduction delivering Trx-Ep-Hmgr amalgamation and expression (+)-Ep-Hmgr as stated above, collect thalline through centrifugation, and come the purifying inclusion body with BugBuster reagent and Benzonase nuclease according to the specification sheets of producer (Novagen).Inclusion body can with the dissolving damping fluid (50mM CAPS, pH 11.0,0.3%N-lauroylsarcosine) dissolve, (200mM Tris-HCl pH8.5) dialyses to use dialysis buffer liquid again.Use Histidine to carry out affinity chromatography then, and collect the Trx-Ep-Hmgr fusion rotein through elution buffer (1Mimidazole, 500mM NaCl, 20mM Tris-HCl pH 7.9) wash-out in conjunction with (HisBind) resin.Fusion rotein is the expressing protein of separable acquisition Ep-Hmgr after 20 ℃ of enzymes of enteropeptidase are cut 16 hours.
The vitality test of the 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme of purifying
Press (Mol.Cell.Biol such as Thorsness, 1989, method 9:5702-5712) is carried out the mensuration of enzyme activity to the 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme of expression and purification, and research 3-hydroxy-3-methylglutaryl-coenzyme A under its effect generates the ability of mevalonic acid.Reaction system contains 0.05M Tris-HCl (pH=7.5), 5mM DTT, 200mMNADPH, 300mM
14Acetyl-CoA of C mark (1mCi/mmol) and 20mM glucose 1-phosphate1-, every milliliter of 9.75mU glucose phosphate dehydrogenase is used for the regeneration of NADPH, and cumulative volume is 100uL.Reaction process is as follows: at first add 37 ℃ of water-baths of 400mg protein 15 minutes, make 3-hydroxy-3-methylglutaryl-coenzyme A change into mevalonic acid.Reacting final product separates on the Bio-Rex5 pillar with substrate material, and reacting final product can be washed from pillar.Measure with the liquid scintillation register
14The content of the reacting final product of C mark.The result shows that expressed proteins has the enzymic activity that the catalysis 3-hydroxy-3-methylglutaryl-coenzyme A generates mevalonic acid really.
Embodiment 4
Medicinal plant radix euphorbiae pekinensis Ep-Hmgr albumen carries out eukaryotic cell expression in tobacco
The structure that will contain the expression vector of goal gene (medicinal plant radix euphorbiae pekinensis Ep-Hmgr protein gene), according to the proteic full length sequence of medicinal plant radix euphorbiae pekinensis Ep-Hmgr (SEQ ID NO.3), design amplifies the primer that complete coding is read frame, and on the upstream and downstream primer, introduce restriction endonuclease sites (this is decided by the carrier of selecting for use) respectively, so that construction of expression vector.Amplified production with acquisition among the embodiment 1 is a template, behind pcr amplification, cDNA is cloned into intermediate carrier (as pBluescript) with medicinal plant radix euphorbiae pekinensis Ep-Hmgr protein gene, further be cloned into binary expression vector (as pBI121 and pCAMBIA1301), guaranteeing to identify good expression vector under the correct prerequisite of reading frame, again it is changed in the Agrobacterium, utilize leaf dish law technology transformation mode plant tobacco.
Utilize leaf dish method transformation of tobacco
1. select positive bacterium colony on the flat board with aseptic toothpick picking YEB, be inoculated in 2mL YEB liquid (Sm+, Kan+), 28 ℃, 200rpm shaking culture 24-36 hour;
2. under the room temperature 4, the centrifugal 10min of 000g;
3. abandon supernatant, thalline suspends with the 1/2MS liquid nutrient medium, is diluted to 5-20 times of original volume, makes the OD of bacterium liquid
600About=0.5;
4. get the aseptic blade of the tobacco about two weeks of growth, remove its main lobe arteries and veins, it is cut into about 1 square centimeter of square vanelets;
5. blade is put into the bacterium liquid for preparing, soaked 2-5min, on aseptic filter paper, blot bacterium liquid;
6. the blade through infecting is put on the MS substratum 28 ℃ of dark cultivations 48 hours;
7. blade is forwarded on the callus substratum (MS+6-BA 1.0mg/L+NAA 0.1mg/L+Kan 50mg/L+cb 250mg/L), the formation of 7-15 days visible callus is cultivated in 25-28 ℃ of illumination down;
8. visible differentiation bud grows after about 20 days, treat that bud is grown up after, downcut, place on the root media (1/2MS+NAA0.5mg/L+Kan 25mg/L) and carry out root culture, take root about 2-7 days;
9. after waiting well developed root system, plant is taken out, clean the solid medium that adheres to, move in the soil, just begun to treat to take off lens again behind the robust plant, cultivate in the greenhouse with lens cover several days with sterilized water.
Utilize Northern blotting to detect the expression of Ep-Hmgr albumen in transgenic tobacco plant
1.RNA extraction: treat the long RNA that extracts tobacco leaf during to 2-3 sheet leaf of transgene tobacco blade.With the plant of normal growth (condition is the same) in contrast, (GIBCO BRL USA) extracts and with reference to the preparation chapters and sections (Sambrook etc., 1989) of " molecular cloning " relevant RNA to utilize the TRIzol test kit.
2.RNA quantitatively: with reference to " molecular cloning " (Sambrook etc., 1989), spectrophotometric instrumentation OD
260Rna content calculates: 1OD
260=40 μ g/mL.
3. total RNA agarose gel electrophoresis separates: 1) get 6mL 25 * (doubly) electrophoretic buffer, add the 117mL sterilized water, mixing.2) take by weighing the 1.5g agarose, join in the above-mentioned solution, heating and melting in microwave oven changes in 55 ℃ of water-baths.3) in stink cupboard, get 26.8mL formaldehyde, join in 55 ℃ the gelating soln mixing.4) pour into rapidly in the glue plate, room temperature water placing flat 30 minutes treats that gelling is solid.5) RNA (20 μ g) that extracts is dissolved in the RNA denaturing soln, heated 10 minutes down, be placed on ice immediately then at 65 ℃.6) in sample, add 2uL 10 * sample-loading buffer, mixing.7) do not cover point sample under the condition of glue in electrophoresis liquid, 5V/cm voltage electrophoresis is about 5 hours.
4.RNA shift on the nylon membrane: 1) before the transfer, nylon membrane is soaked with 10 * SSC.2) moistening film is covered exactly on film, two filter paper identical with film size are put in 2 * SSC solution moistening, cover on film, get rid of bubble.3) put one on the filter paper and fold and the identical thieving paper of film size, put a sheet glass and a weight on thieving paper, horizontal positioned shifted 12-20 hour.4) after the transfer, film was toasted 2 hours in 80 ℃.
5. the detecting of hybridization signal on the film: 1) film is immersed in 5 * Dendart ' s, 0.1%SDS, 0.1mg/mL salmon sperm dna], 65 ℃ of following prehybridizations 2 hours.2) will use Gene Images
TMContents CDP-Star
TMThe sex change 5 minutes in boiling water of the probe of labellingmodule mark directly adds 1) hybridization solution in, in 65 ℃ of hybridization 16-24 hour.3) take out film, place film washing liquid I (1 * SSC, 1%SDS) in, in 65 ℃ of rinsings 3 times, each 15 minutes.Change over to film washing liquid II (0.1 * SSC, 1%SDS) in 65 ℃ of rinsings 3 times, each 15 minutes.4) use X-ray sheet compressing tablet 60-90 minute, development, photographic fixing (method is with reference to Roche DIG labeled test kit specification sheets) then.Northern hybridization shows: the Ep-Hmgr transcriptional level of transgene tobacco is obviously more much higher than the expression level of genetically modified control material not.
The Ep-Hmgr protein-active that contains in the transgenic tobacco plant of medicinal plant radix euphorbiae pekinensis 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene (Ep-Hmgr) is measured
1. proteic extraction: a) get the 500mg blade, add 1000uL 1 * PBS (KH
2PO
40.2g/L, Na
2HPO
41.15g/L, KCl 0.2g/L, NaCl 8g/L) in 50mL eppondorf pipe, grind; B) 13000rpm, 4 ℃ are centrifugal 10 minutes; C) get supernatant, standby.Annotate: above process is in carrying out on ice.
2. proteic quantitative: with reference to Bradford method (Bradford, 1976).Get the 2uL protein sample, add 1mL Bradford reagent, behind the mixing, spectrophotometric instrumentation OD
595Protein content calculates: 1OD
595=28.57 μ g.
3.Al-Hmgr protein-active is measured with reference to (Mol.Cell.Biol, 1989, methods 9:5702-5712) (the detail operations process is with example 3) such as Thorsness.The result shows that the Ep-Hmgr protease activity ratio in the transgenic tobacco plant does not have genetically modified contrast obviously much higher (P＜0.05).Thereby the proof medicinal plant radix euphorbiae pekinensis 3-hydroxy-3-methyl glutaryl CoA reductase gene of being cloned has the enzymic activity that the catalysis 3-hydroxy-3-methylglutaryl-coenzyme A generates mevalonic acid really once more, will can be used for utilizing transgenic technology to improve in the research and industrialization of secondary metabolite of plant.
Sequence that the present invention relates to and mark apportion are as follows:
(1) information of SEQ ID NO.1
(i) sequence signature:
(A) length: 20bp
(B) type: Nucleotide
(C) chain: strand
(D) topological framework: linearity
(ii). molecule type: oligonucleotide
(iii). sequence description: SEQ ID NO.1
CCTCCAACTCATAAACACGCAT
(2) information of SEQ ID NO.2
(i) sequence signature:
(A) length: 19bp
(B) type: Nucleotide
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
(iii) sequence description: SEQ ID NO.2
GTTTGTACAACAACATATG
(3) information of SEQ ID NO.3
(i) sequence signature:
(A) length: 2198bp
(B) type: Nucleotide
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: Nucleotide
(iii) sequence description: SEQ ID NO.3
acgcggggcc tccaactcat aaacacgcat tcaaacacct cctctactct cttccttcca
60
cctcctcctc ctccaccacc atg gat tcc acc aaa tcg cgg cgg ccg atc cgc
113
cac ctc cac cac caa aaa cgc atc tcc gaa gag gtt gac gac cac cgc 161
tgt ctc tca ccg cct ctc aaa gcc tcc gac gct ctc cct ctc cct ttg 209
tat cta acc aat gcc gtt ttc ttc acc ctc ttt ttc tcc gtc gcc tat 257
tac ctc ctc cac cgg tgg agg gac aag atc cgt aac tcc act cct ctc 305
cac gtc gtt act ctc tct gaa atc gcc gcc att gtt tcg ctc att gcc 353
tca ttc atc tat ttg ctt gga ttc ttc ggg atc ggt ttt gtc cag tct 401
ctc atc gcg cgc ccc tcg cat gac acg tgg gac ctt gac gat gcg gat 449
cgg agt tac ctc att gat gga gat cac cgc ctc gtc act tgc tct ccg 497
gcg aag gtt gct ccg gtg aat tct cct cct ccg gcg aaa atg tcc gtt 545
ccg gaa ccg atc gtt tcg cct cta gcc tcc gag gag gat gag gaa atc 593
gtc aaa tcg gtt gtc aat ggg acg att cct tcg tat tct ctt gaa tcg 641
aag ctc ggg gac tgt aag aga gcg gct gag att cgg cgg gag gct tta 689
cag agg atg acg ggg agg tct ttg gag ggt ttg cct gtt gag gga ttc 737
gat yac gag tcg att tta ggt cag tgc tgt gaa atg ccg gtt gga tat 785
gtg cag att ccg gtt gga att gcc ggt ccg ttg ctg ctg gat ggg cga 833
gag tac tct gtt ccg atg gcg act acc gag ggc tgt ttg gtg gct agc 881
act aac aga ggg tgt aag gcg att cat ctg tcc ggt ggt gcc gac agt 929
gtc ctg ttg aag gat ggc atg aca aga gct ccc gtt gtt cgg ttc aca 977
tcg gtg agg agg gct gct gaa ttg aag ttt ttc tta gag agt cct gag 1025
aat ttc gat agc tta tcc gtc gtt ttc aat agg tcc agt gga ttt gca 1073
aag ctc cta aac ata caa tgc act cta gcc ggg agg aat cta tat atg 1121
aga ttc acc tgc ttc act ggt gat gca atg ggg atg aac atg gtt tcc 1169
aaa ggg gtc caa aac gtc ctt gag ttc ctt caa agt gat ttc cct gac 1217
atg gat gtt ctg ggc atc tca gga aat tat tgt tcc gac aaa aag cca 1265
gcc gca gtg aac tgg att gaa gga cga ggc aaa tgg gtt gtc tgt gag 1313
gcg att atc aag gaa gag gtg gtg aag aag gtg ttg aag act agt gtt 1361
gct gca cta gtg gag ctg aac atg gtc aag aat ctg gct ggt tca gct 1409
gtt gct ggg tct ctt ggt gga ttc aat gca cat gct gct aac ata gtc 1457
tct gca gtt ttc att gcc act ggc cag gat cca gcc cag aat gtt gag 1505
agc tct cac tgc atg acc atg atg gaa gct gtc aat gat gga aag gat 1553
ctc cac atc tct gta acc atg ccc tcg att gag gtg ggc acg gtt gga 1601
gga ggt act cag cta gca tca cag tca gct tgc ctg aac ttg ctt ggt 1649
gta aaa gga gca aat aaa gaa tca cca gga gca aac gca agg caa ctc 1697
gcc acc ata gta gct ggt tca gtt ctt gct gga gaa ctc tct cta atg 1745
tct gcc att gca gca ggg caa ctg gtc aag agc cac ctg aag tac aat 1793
aga tcg agc aaa gac gtg tcc agc ttt gca tca tct taa ataaggcggc 1842
cgagatgact cgtggacaga gacagagaga gagagaaggg gaagaagatg aagaagtctg
1902
agtatgtaca cccatgtgag atttaaatct taaagctttt taaattagct ttaaagctgc
1962
tccaaatcca atcatggaga taaagagaag aattaggtac ataaatttga atctccattt
2022
atgttggtga gagatcacat gtgagcaaaa ggtcacctcc actagcttag taagttgttt
2082
ctggttgtaa tgttattttg tctcctaaaa tttgttaatg tttagttgct ttcctctatt
2142
cttgcaatac atatgttgtt gtacaaacaa aaaaaaaaaa aaaaaaaaaa aaaaaa
2198
(4) information of SEQ ID NO.4
(i) sequence signature:
(A) length: 583 amino acid
(B) type: amino acid
(C) chain: strand
(D) topological framework: linearity
(ii). molecule type: polypeptide
(iii). sequence description: SEQ ID NO.4
Met Asp Ser Thr Lys Ser Arg Arg Pro Ile Arg His Leu His His Gln
1 5 10 15
Lys Arg Ile Ser Glu Glu Val Asp Asp His Arg Cys Leu Ser Pro Pro
20 25 30
Leu Lys Ala Ser Asp Ala Leu Pro Leu Pro Leu Tyr Leu Thr Asn Ala
35 40 45
Val Phe Phe Thr Leu Phe Phe Ser Val Ala Tyr Tyr Leu Leu His Arg
50 55 60
Trp Arg Asp Lys Ile Arg Asn Ser Thr Pro Leu His Val Val Thr Leu
65 70 75 80
Ser Glu Ile Ala Ala Ile Val Ser Leu Ile Ala Ser Phe Ile Tyr Leu
85 90 95
Leu Gly Phe Phe Gly Ile Gly Phe Val Gln Ser Leu Ile Ala Arg Pro
100 105 110
Ser His Asp Thr Trp Asp Leu Asp Asp Ala Asp ArgSer Tyr Leu Ile
115 120 125
Asp Gly Asp His Arg Leu Val Thr Cys Ser Pro Ala Lys Val Ala Pro
130 135 140
Val Asn Ser Pro Pro Pro Ala Lys Met Ser Val Pro Glu Pro Ile Val
145 150 155 160
Ser Pro Leu Ala Ser Glu Glu Asp Glu Glu Ile Val Lys Ser Val Val
165 170 175
Asn Gly Thr Ile Pro Ser Tyr Ser Leu Glu Ser Lys Leu Gly Asp Cys
180 185 190
Lys Arg Ala Ala Glu Ile Arg Arg Glu Ala Leu Gln Arg Met Thr Gly
195 200 205
Arg Ser Leu Glu Gly Leu Pro Val Glu Gly Phe Asp Xaa Glu Ser Ile
210 215 220
Leu Gly Gln Cys Cys Glu Met Pro Val Gly Tyr Val Gln Ile Pro Val
225 230 235 240
Gly Ile Ala Gly Pro Leu Leu Leu Asp Gly Arg Glu Tyr Ser Val Pro
245 250 255
Met Ala Thr Thr Glu Gly Cys Leu Val Ala Ser Thr Asn Arg Gly Cys
260 265 270
Lys Ala Ile His Leu Ser Gly Gly Ala Asp Ser Val Leu Leu Lys Asp
275 280 285
Gly Met Thr Arg Ala Pro Val Val Arg Phe Thr Ser Val Arg Arg Ala
290 295 300
Ala Glu Leu Lys Phe Phe Leu Glu Ser Pro Glu Asn Phe Asp Ser Leu
305 310 315 320
Ser Val Val Phe Asn Arg Ser Ser Gly Phe Ala Lys Leu Leu Asn Ile
325 330 335
Gln Cys Thr Leu Ala Gly Arg Asn Leu Tyr Met Arg Phe Thr Cys Phe
340 345 350
Thr Gly Asp Ala Met Gly Met Asn Met Val Ser Lys Gly Val Gln Asn
355 360 365
Val Leu Glu Phe Leu Gln Ser Asp Phe Pro Asp Met Asp Val Leu Gly
370 375 380
Ile Ser Gly Asn Tyr Cys Ser Asp Lys Lys Pro Ala Ala Val Asn Trp
385 390 395 400
Ile Glu Gly Arg Gly Lys Trp Val Val Cys Glu Ala Ile Ile Lys Glu
405 410 415
Glu Val Val Lys Lys Val Leu Lys Thr Ser Val Ala Ala Leu Val Glu
420 425 430
Leu Asn Met Val Lys Asn Leu Ala Gly Ser Ala Val Ala Gly Ser Leu
435 440 445
Gly Gly Phe Asn Ala His Ala Ala Asn Ile Val Ser Ala Val Phe Ile
450 455 460
Ala Thr Gly Gln Asp Pro Ala Gln Asn Val Glu Ser Ser His Cys Met
465 470 475 480
Thr Met Met Glu Ala Val Asn Asp Gly Lys Asp Leu His Ile Ser Val
485 490 495
Thr Met Pro Ser Ile Glu Val Gly Thr Val Gly Gly Gly Thr Gln Leu
500 505 510
Ala Ser Gln Ser Ala Cys Leu Asn Leu Leu Gly Val Lys Gly Ala Asn
515 520 525
Lys Glu Ser Pro Gly Ala Asn Ala Arg Gln Leu Ala Thr Ile Val Ala
530 535 540
Gly Ser Val Leu Ala Gly Glu Leu Ser Leu Met Ser Ala Ile Ala Ala
545 550 555 560
Gly Gln Leu Val Lys Ser His Leu Lys Tyr Asn Arg Ser Ser Lys Asp
565 570 575
Val Ser Ser Phe Ala Ser Ser
580
Claims (3)
1. the nucleotide sequence of medicinal plant radix euphorbiae pekinensis 3-hydroxy-3 methyl glutaryl coenzyme A reductase protein is characterized in that described nucleotide sequence is made of the Nucleotide of 81-1832 position among the SEQ ID NO.3.
2. the aminoacid sequence of medicinal plant radix euphorbiae pekinensis 3-hydroxy-3 methyl glutaryl coenzyme A reductase protein according to claim 1 is characterized in that described aminoacid sequence is the aminoacid sequence shown in the SEQ ID NO.4.
3. the nucleotide sequence transformed host cells of medicinal plant radix euphorbiae pekinensis 3-hydroxy-3 methyl glutaryl coenzyme A reductase protein according to claim 1 is characterized in that described host cell is an eukaryotic cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2006101257969A CN1936004B (en) | 2006-08-28 | 2006-08-28 | Medicinal plant radix euphorbiae pekinensis 3-hydroxy-3-methyl glutaryl coenzyme A reductase protein coding sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2006101257969A CN1936004B (en) | 2006-08-28 | 2006-08-28 | Medicinal plant radix euphorbiae pekinensis 3-hydroxy-3-methyl glutaryl coenzyme A reductase protein coding sequence |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1936004A CN1936004A (en) | 2007-03-28 |
| CN1936004B true CN1936004B (en) | 2010-09-08 |
Family
ID=37953747
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2006101257969A Expired - Fee Related CN1936004B (en) | 2006-08-28 | 2006-08-28 | Medicinal plant radix euphorbiae pekinensis 3-hydroxy-3-methyl glutaryl coenzyme A reductase protein coding sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1936004B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1760363A (en) * | 2004-10-14 | 2006-04-19 | 蒋继宏 | Coded sequence of reductase enzyme protein of eucommia 3-hydroxy-3-coenzyme of methyl glutaryl A |
| CN1769436A (en) * | 2004-11-02 | 2006-05-10 | 蒋继宏 | Nanjing bass 3-hydroxyl-3-methyl glutaryl coenzyme A reductase protein encoding sequence |
-
2006
- 2006-08-28 CN CN2006101257969A patent/CN1936004B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1760363A (en) * | 2004-10-14 | 2006-04-19 | 蒋继宏 | Coded sequence of reductase enzyme protein of eucommia 3-hydroxy-3-coenzyme of methyl glutaryl A |
| CN1769436A (en) * | 2004-11-02 | 2006-05-10 | 蒋继宏 | Nanjing bass 3-hydroxyl-3-methyl glutaryl coenzyme A reductase protein encoding sequence |
Non-Patent Citations (1)
| Title |
|---|
| hallahan,D.L, et al.genes involved in the biosynthesis of isopentenyldiphosphatein the rubber tree hevea brasiliensis.GenBank.2001,全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1936004A (en) | 2007-03-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101798579A (en) | Jatropha curcas farnesyl pyrophosphate synthase protein encoding sequence and application thereof in plants | |
| CN101012462B (en) | Davilpepper tryptophan decarboxylase protein coded sequence | |
| CN101250544B (en) | Salvia 3-hydroxy-3-methylglutaryl A reductase gene and its coding protein and application | |
| CN100360664C (en) | Nanjing bass 3-hydroxyl-3-methyl glutaryl coenzyme A reductase protein encoding sequence | |
| CN102604975A (en) | Squalene synthase gene of Panax japonicus and application of the gene | |
| CN101250543B (en) | Japan snakeroot strictosidine synthase gene and its coding protein and application | |
| CN1760363B (en) | Coded sequence of reductase enzyme protein of eucommia 3-hydroxy-3-coenzyme of methyl glutaryl A | |
| CN101250541B (en) | Salvia 1-deoxidation xylulose-5-phosphate synthase gene 1 and its coding protein and application | |
| CN1936004B (en) | Medicinal plant radix euphorbiae pekinensis 3-hydroxy-3-methyl glutaryl coenzyme A reductase protein coding sequence | |
| CN104388446B (en) | Pinellia ternate squalene synthase gene as well as coded protein and application thereof | |
| CN102304530B (en) | Inonotus obliquus 3-hydroxy-3-methylglutaryl CoA reductase gene, protein of code thereof and application thereof | |
| CN100406559C (en) | Lechang michelia 3-hydroxy-3-methy glutaryl CoA reductase protein coding sequence | |
| CN101736019B (en) | Jatropha curcas geranylgertanyl diphosphate synthase (JcGGPPs) protein and coding gene thereof | |
| CN101250545B (en) | Scopoloa acutangula 1,4-tetramethylenediamine-nitrogen-methyltransferase 1 and its coding protein and application | |
| CN101168740B (en) | Scopoloa acutangula tropinone reductase I gene and its coding protein and application | |
| CN101475947B (en) | Salvia 1-deoxy-D-xylulose-5-phosphate synthetase II gene, and encoding protein and use thereof | |
| CN102399798B (en) | Inonotus obliquus squalene synthase gene and its coded protein and use | |
| CN101250542B (en) | Salvia 3-hydroxy-3-methylglutaryl A synthase gene and its coding protein and application | |
| CN101168739A (en) | Scopoloa acutangula tropinone reductase II gene and its coding protein and application | |
| CN101250540B (en) | Camptotheca acuminata 3-hydroxy-3-methylglutaryl A synthase gene and its coding protein and application | |
| CN101538575A (en) | Scopolia acutangula hyoscyamine 6 Beta-hydroxylase gene, protein encoded thereby and application thereof | |
| CN1995355B (en) | Southernwood 1-hydroxy-2-methyl-2-(E)- cyclobutenyl 4-diphosphoric acid reductase protein encoding sequence | |
| CN101597609A (en) | Monstera deliciosa agglutinin gene and encoded protein matter and application | |
| CN104450752A (en) | Pinellia Ternata (Thunb.) Breit farnesyl diphosphatesynthase (PtFPS) gene and protein coded by same, as well as application | |
| CN101748141A (en) | 3-hydroxyl-3-mathylglutaryl-CoA reductase albumen of barbadosnut and encoding gene thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20100908 Termination date: 20140828 |
|
| EXPY | Termination of patent right or utility model |