CN1931877A - Prepn and use of CD20 antagonizing Chimeric antibody - Google Patents

Abstract

The present invention relates to preparation and use of TGLA chimeric antibody of specifically targeting CD20 molecule. Specifically, on the basis of obtaining human CD20 monoclonal antibody resisting hybridoma cell M3-4 and its antibody gene, CD20 chimeric antibody is prepared, experiment proves the functions of recognizing epitope characteristic and mediating target cell killing and one design scheme of antibody medicine molecule is provided.

Description

Preparation of a kind of CD 20 antagonizing Chimeric antibody and uses thereof

Technical field

The present invention relates to the preparation method of the chimeric antibody (called after TGLA) of a kind of selectively targeted CD20.

Background technology

CD20 is the distinctive sign in human B lymphocyte surface, is expressed in the B cell surface of normal or deterioration 95% or more, and the initial pre-B cell stage that is expressed in finishes during to B cell terminal differentiation plasmablast ^[1]Tangible internalization can not take place and come off in all normal B cells and most of malignant B cell surface in its high expression level, is treatment non-Hodgkin lymphoma (non-Hodgkin ' s Iymphoma, NHL) ideal target antigen.

From 1975, Kohler and Milstein described since the preparation monoclonal antibody for the first time, and people have spent a large amount of time to remove to study monoclonal antibody, so that be applied to the treatment of human diseases, yet make slow progress.Up to 1989, the anti-rejection when just having the monoclonal antibody-OKT3 of the anti-T cell of a strain to be approved for renal homotransplantation.Along with the development of Protocols in Molecular Biology, to 24 therapeutic antibodies medicine listings of in December, 2004 U.S. FDA approved, antibody drug accounts for protein drug more than 80% ^[2]Monoclonal antibody (mAb) but with advantages such as its specificity, the good mass production of homogeneity, be widely used in the diagnosis and the treatment of disease ^[3]

In recent years, the NHL sickness rate is soaring gradually, and human health in serious harm.Methods of treatment in the past can't be cured, and the patient is finally dead because of lymphadenomatous recurrence.The treatment that the research newtype drug is used for NHL becomes a kind of inexorable trend.Anti-CD-20 monoclonal antibody is the treatment plan that a kind of new effective inhibition tumour cell increases, and the status in treatment NHL will progressively be improved ^[4]

At present, the research of anti-CD20 antibodies and application development are rapid.IDEC-C2B8 has another name called Rituximab, and commodity are called Mabthera, and 1997 by FDA approval listing.It is a human mouse chimeric antibody, comprises the variable region of mouse source anti-CD-20 monoclonal antibody 2B8 (Ibritumomab) and the constant region of humanized IgG 1 heavy chain and κ chain, is used for the treatment of B cell lymphoma ^[5]In February, 2002, FDA has ratified first radioimmunoassay medicine---Zevalin, connects isotropic substance by mouse IgG1-κ monoclonal antibody 2B8 ⁹⁰Y is used for the treatment of the B cell NHL of recurrent or intractable low grade of malignancy/folliculus or conversion, comprising the intractable folliculus NHL of Mabthera ^[6]On June 27th, 2003, FDA approval Bexxar (Tositumomab and ¹³¹I Tositumomab) is used for the treatment of cancer cells and or not shifts, Mabthera is had resistance, the CD20 that recurs again after the chemotherapy ⁺, folliculus NHL.It is by the mouse resource monoclonal antibody---anti-B1 monoclonal antibody (Tositumomab, IgG2a-λ) and radio isotope ¹³¹The I covalent coupling forms ^[7]

Multi-center clinical trial is the result show: these three kinds of independent uses of antibody of listing have at present all obtained good curative effect.Wherein Mabthera and chemotherapeutics CHOP (endoxan, Dx, vincristine(VCR), prednisone) unite low grade of malignancy of use treatment or folliculus NHL, and effect is better than the effect of independent use ^[8]Bexxar and chemotherapy drugs in combination use collaborative result of treatment.Zevalin and Bexxar are used for treating has the patient of resistance that good result is arranged to Mabthera treatment ^[6,9]Use the expense height of anti-CD20 antibodies treatment NHL, the reaction of HAMA and HACA has also taken place in part patient, how to make treatment plan more perfect, also needs further exploration.

Anti-CD-20 monoclonal antibody just is being widely used in the clinical treatment B cell lymphoma at present, but the domestic commercially produced product that does not also have the CD 20 antagonizing Chimeric antibody of independent intellectual property right at present, the therapeutic antibodies of Shi Yonging all derives from abroad clinically, costs an arm and a leg.

Summary of the invention

As recombinant antigen, adopt cell-fusion techniques to prepare a kind of mouse resource monoclonal antibody (IgG1/ κ hypotype) hybridoma cell line M3-4 that secretes anti-CD20 with clone's antigens c D20cDNA transfection mouse source property NIH3T3 cell.MTT and PI dyeing, light microscopic, Electronic Speculum result show that M3-4 has the function that suppresses B lymphoma cell propagation and directly induce its apoptosis, and this is the basis that it can be used for lymphoma treating.For overcoming mouse source antibody M3-4 application limit, angle from hybridoma by the method for RT-PCR and get its variable region gene, made up the expression vector C3-4H and the C3-4L of CD 20 antagonizing Chimeric antibody, obtain CD 20 antagonizing Chimeric antibody TGLA.

Embodiment

1, material

293T cell, DMEM (the Gibco BRL company) cultivation of going down to posterity that contains 10%FCS of 293T cell.

Daudi and Raji RPMI-1640 (the Gibco BRL company) cultivation of going down to posterity that contains 10%FCS.

Add the penicillin of 100U and the Streptomycin sulphate of 100U in the substratum.

AMV reverse transcription test kit and pGEM ^-T Easy is available from promega company.

The carrier for expression of eukaryon pCMV163 of chimeric antibody.

Restriction enzyme is a Biolabs company product.

RTaq archaeal dna polymerase, T ₄Dna ligase, dNTP, dna molecular amount standard DL2000 are available from Takara company.

DNA glue reclaims test kit (OMEGA biotechnology company); Trizol and Lipofectamine ^TM2000 (Invitrogen); Hexadecyl trimethyl ammonium bromide (CTAB), OPD (Sigma company).

Goat anti-human igg (H+L) and horseradish peroxidase-labeled goat anti-mouse IgG (CALTAG Laboratories); The goat-anti people Fc of FITC mark and ECL chemical luminous substrate detection kit (Pierce company); Foetal calf serum (Beijing Heng Shengma of unit biotechnology research institute).

The rabbit complement is by the epi chamber preparation of 307 hospitals, and people's complement is an AB serum of taking from the normal people;

Positive control antibody: humanization chimeric antibody (Mabthera) is available from Roche Holding Ag;

Primer synthesizes in Beijing AudioCodes biotechnology limited liability company;

Determined dna sequence is rich inferior biotechnology limited liability company in Shanghai;

Mouse fibroblast cell is NIH3T3, and mouse myeloma cell line SP2/0 is provided by Institute of Basic Medical Sciences, A Cademy of Military Medical Sciences, molecular immune chamber;

Pure lines Balb/c (4-6 age in week) female mice is available from Military Medical Science Institute's animal center.

2, method

2.1 immune Balb/c mouse

Select 4 of the female Balb/c mouse in age in 4-6 week for use, with 1 * 10 ⁷CD20 ⁺The NIH3T3 cell to the mouse peritoneal injecting immune, per three all immunity once, altogether immunity is 3 times.Take mouse vein blood for the third time after the immunity, indirect immunofluorescence is surveyed the anti-CD20 antibodies production, merges first three day, and in kind booster immunization is once again.

2.2 the evaluation of monoclonal antibody and preparation

Get immune mouse spleen cell and SP2/0 cytogamy, the positive colony cell of selectivity culture system screening, subclone screens, and finally obtains the hybridoma cell strain (M3-4) of the monoclonal antibody of stably excreting anti-humen CD 20; Centrifugal 5 minutes of 1200 rev/mins in cell is abandoned supernatant, washes 3 times with physiological saline, and cell count is adjusted into 6 * 10 ⁶/ ml, every mouse peritoneal injection 0.5ml.After about 10 days, obtain the ascites that is rich in CD20 monoclonal antibody (M3-4), behind affinity purification, carry out the biological activity analysis.

2.3 the antigen molecular of immuno-precipitation identification of M 3-4 identification

With Daudi (antigenic positive cell) and K562 (antigenic negative cells) with containing Ca ²⁺And Mg ²⁺The PBS washing lotion give a baby a bath on the third day after its birth time, add 30 minutes pair cell surface moleculars of Biotin ice bath vibration and carry out biotinylation, wash 3 times, abandon supernatant, remove unconjugated Biotin.Add lysis liquid, ice bath pair cell cracking in 20 minutes, 10000 rev/mins, 4 ℃ centrifugal 10 minutes, add in the cracking supernatant liquor on the hybridoma behind the cleer and peaceful ProteinA-Sephorose coprecipitation, immune complex is added the sample preparation liquid that contains mercaptoethanol to be boiled 5 minutes, carry out the SDS-PAGE protein electrophoresis, be transferred to nitrocellulose filter, 37 ℃ of sealings of 5% skim-milk 1 hour, 0.2%PBS-T washes film 3 times, the Avidin that adds the HRP mark reacted 1 hour, PBS-T washes 3 times, uses enhanced chemoluminescence (ECL) detection reagent and membrane interaction in the darkroom, to the radioautograph of X-ray sheet.On film, add DAB solution 10ml and 30%H again ₂O210 μ l develops the color, and occurs using H behind the clear band ₂The O stopped reaction.

2.4 the specificity of flow cytometry (FCM) identification of M 3-4 reacting cells pedigree

Get the B cell (Daudi that is in vegetative period respectively, Raji, Nalm-6), T cell (Molt-4, Jurkat, HPB-ALL), mononuclearcell (U937), myeloma cell (SKO-007), erythroleukemia cell (K562), the grain be cell (HL-60, KG1-a), 12 strain cells such as tonsilla cell, normal people's peripheral blood mononuclear cell (PBMC), normal people's BMNC is with the positive contrast of standard CD 20-mAb (being given by the 5th leukocyte differentiation antigen international conference), with the negative contrast of PBS, survey the atopic of M3-4 monoclonal antibody and each cell strain with FCM.

2.5FCM detect the competitive inhibitory effect of M3-4 monoclonal antibody to standard CD 20-FITC monoclonal antibody

Add anti-CD20-FITC monoclonal antibody 0,1,2,5, the 10 μ l of standard in the Daudi cell respectively, ice bath reaction 20 minutes, FCM detects positive cell percentage just to determine the consumption with the anti-CD20-FITC of standard of Daudi cell complete reaction.At the M3-4 monoclonal antibody that adds different amounts on the basis of this consumption in the Daudi cell, can FCM detects to the anti-CD20-FITC monoclonal antibody effect of competing of standard.

2.6FCM detect the film fluorescence of transfectional cell

Get 2 * 10 ⁵Be in the NIH-3T3 clone of logarithmic phase, to insert the pcDNA3.1 plasmid and the liposome cotransfection NIH-3T3 cell of people CD20 gene, PBS washes 3 times, add hybridoma supernatant to be measured and carry out indirect immunofluorescence, with the positive contrast of standard CD 20-McAb, with the specificity of the negative contrast checking of empty carrier M3-4; Detect the reactivity of hybridoma supernatant with FCM.

2.7 design of primers, antibody gene angle and get, expression vector establishment and evaluation

(1) design of primers

TGLA heavy chain primer

Fd primer (upstream): 5 ' AGGTCCAGCTTCTCGAGTCAGG3 '

Fd primer (downstream): 5 ' GTTCTGACTAGTGGGCACTCTGGGCTC3 '

TGLA light chain primer:

K primer (upstream): 5 ' CCAGTTCCGAGCTCCAGATGACCCAGTCTCCA3 '

K primer (downstream): 5 ' GCGCCGTCTAGAATTAACACTCATTCCTGTTGAA3 '

(2) total RNA extracts

According to the total RNA extraction agent of Trizol specification sheets, from the M3-4 hybridoma of secretion IDEC-C2B8, extract total RNA.

(3) cDNA is synthetic

With total RNA is template, oligo (dT) ₁₅Be primer, carry out reverse transcription according to AMV ThermoScript II specification sheets, total reaction volume is 20 μ l.

(4) vector construction

M3-4 heavy chain, chain variable region gene increase respectively, Pvu II and BstE II double digestion heavy chain variable region gene, EcoRV and Xho I double digestion chain variable region gene are connected with light chain expression vector pCMV-VL with the heavy chain expression carrier pCMV-VH that cuts through same enzyme respectively.

Linked system is 15 μ l: 1 μ l carrier, 1 μ l enzyme cut back to close fragment (ratio that guarantees fragment and carrier is between 1: 3 to 1: 10), T ₄Dna ligase 0.5 μ l connects damping fluid 1.5 μ l, adds water and supplies 15 μ l, and 16 ℃ of connections are spent the night, and gets 7.5 μ l and connects product, transformed into escherichia coli XL1-Blue.

Operation is carried out according to molecular cloning method.The picking resistance is selected positive colony, and carries out enzyme and cut evaluation, and the carrier for expression of eukaryon M3-4/H and each 3 of the M3-4/L that select dual evaluation to be the male CD 20 antagonizing Chimeric antibody deliver to the order-checking of Bo Ya Bioisystech Co., Ltd.

Heavy, the chain variable region gene of amplification antibody is connected with heavy chain expression carrier pCMV-VHL expression vector respectively.Linked system is 15 μ l: 1 μ l carrier, 1 μ l enzyme cut back to close fragment (ratio that guarantees fragment and carrier is between 1: 3 to 1: 10), T ₄Dna ligase 0.5 μ l connects damping fluid 1.5 μ l, adds water and supplies 15 μ l.

16 ℃ of connections are spent the night, and get 7.5 μ l and connect product, transformed into escherichia coli XL1-Blue.

Operation is carried out according to molecular cloning method.

Resistance is selected positive colony, and carries out enzyme and cut evaluation, and each 5 of carrier for expression of eukaryon TGLAH, TGLAL selecting dual evaluation to be the male CD 20 antagonizing Chimeric antibody deliver to the order-checking of Bo Ya Bioisystech Co., Ltd.

2.8 transfection and evaluation

(1) transient transfection

To contain the DMEM substratum of 10% FCS, at 37 ℃, 5%CO ₂Cultivate the 293T cell under the condition to logarithmic phase.Adjust cell concn to 2 * 10 with the DMEM substratum that does not contain antibiotic 10%FCS ⁵, in 24 orifice plates, add 500 μ l cell suspensions, continue to cultivate 24 hours.

(2) RT-PCR: collect after the transfection 60 hours 293T cell, PBS gives a baby a bath on the third day after its birth time, extracts total RNA by the working instructions of Trizol reagent.OD260/OD280 measures total RNA purity, 1% agarose electrophoresis.Amplification back testing goal gene transcription.

2.9Western blot

After the expression supernatant of chimeric antibody and empty carrier transfectional cell supernatant separated with 12% SDS-PAGE, the 100V electricity changeed 50 minutes to nitrocellulose filter (NC).With 5% skim-milk sealing 1 hour, goat anti-human igg (H+L) (1: 400) the antibody room temperature oscillatory reaction of adding HRP mark 1 hour, PBS-T washes film 3 times, each 10 minutes.(enhanced chemiluminescence, ECL) method detects the goat anti-human igg (H+L) of bonded HRP mark, thereby determines to express target protein specificity in the supernatant to adopt the enhanced chemoluminescence.

2.10 indirect immunofluorescence

Chimeric antibody is expressed supernatant and empty carrier transfectional cell supernatant and CD20 ⁺Bone-marrow-derived lymphocyte be that the Daudi cell was hatched 20 minutes jointly, with GAH-IgG-Fc-FITC antibody test cell surface bonded chimeric antibody molecule, establish simultaneously and do not add two anti-negative controls.Observe down and the flow cytometer detection by inverted fluorescence microscope, judge chimeric antibody and Daudi cell bonded situation.

2.11 competitive inhibition experiment

TGLA with the FITC mark combines with target cell Daudi earlier, selects TGLA-FITC 2.5 being at war with property of μ g/ pipe inhibition experiment.The Mabthera and the TGLA-FITC that get different concns are pre-mixed even back (Mabthera: TGLA=4: 1; 8: 1; 16: 1; 40: 1; 100: 1), with Daudi (3 * 10 ⁵Individual/pipe) room temperature vibration hatched 20 minutes, and with the unconjugated excessive antibodies of 2%FCS-PBS flush away, 400 μ L fix with 1% Paraformaldehyde 96, and the cells were tested by flow cytometry positive percentage is analyzed the competitive inhibition of Mabthera and TGLA.

2.12CDC Effect Evaluation

Get the Daudi, the Raji cell that are in logarithmic phase, wash 1 time, cell is resuspended in 10%FCS-RPMI 1640 substratum, adjust cell concn to 3 * 10 with 10%FCS-RPMI 1640 substratum ⁵Individual/ml, be seeded in 96 orifice plates with every hole 100 μ l.Adding is to the TGLA6.25～50 μ g/ml of times gradient dilution, and hatched 20 minutes for 37 ℃ in 10 μ l/ holes.Add 37 ℃ in complement (1: 20) 10 μ l/ holes and hatch the cytotoxic activity that detects the dependence of TGLA complement after 20 minutes with mtt assay.

3, result

3.1 the generation of anti-CD-20 monoclonal antibody M3-4

Through merging, screening and cloning repeatedly, the final hybridoma cell strain M3-4 that obtains strain secretion anti-humen CD 20 antibody, antibody titer is 1: 4000 in indirect immunofluorescence detection ascites, external continuous passage (＞30 generation) and energy stably excreting monoclonal antibody, after frozen half a year, above cell strain was recovered, the reaction of cell conditioned medium and Daudi cell was still positive.

3.2 M3-4 discerns antigenic molecular weight

Show that through immunoprecipitation DAB colour developing result M3-4 identification bone-marrow-derived lymphocyte Daudi cell surface molecule amount is about the membrane antigen of 33kD, and not with the K562 cell response, discern antigenic molecular weight identical (Fig. 3 .1) with standard CD 20-McAb.

3.3 the specificity of M3-4 is identified

Indirect immunofluorescence proves, standard CD 20-mAb and M3-4 and pcDNA3.1/CD20 ⁺Produce film fluorescence after the NIH-3T3 cell response of transfection, do not occur and have film fluorescence with the cell response of transfection empty carrier.M3-4 and Daudi, the Raji cell response is positive, be negative with cell responses such as Nalm-6, HPB-ALL, K562, HL-60, all meet the scope (table 3.1 of bibliographical information with the positive rate of tonsilla, peripheral blood and BMNC reaction, Fig. 3 .2), this result shows that the M3-4 of acquisition is at the antigenic specific antibody of people CD20.

The reactivity of table 3.1 M3-4 and each clone and normal people's mononuclearcell (positive %)

	The standard IDEC-C2B8	M3-4
			Daudi Raji Nalm-6 Molt-4 Jurkat HPB-ALL U 937 SKO 007 K562 HL-60 KG1-a Tonsillar cells pcDNA3.1 pcDNA3.1/CD20 PBMC Bone marrow	97.44 99.70 1.21 1.31 1.82 2.55 1.35 2.25 0.97 12.83 1.55 58.67 - + 8.03 1.85	97.68 98.97 1.33 0.99 1.73 0.97 1.76 1.94 2.81 4.45 0.89 62.0 - + 10.59 1.51

3.4 the M3-4 monoclonal antibody is to the competitive inhibitory effect of standard CD 20-FITC monoclonal antibody

Can find out by Fig. 3 .3, can reach with the CD20 molecular reaction of Daudi cell surface with standard CD 20-FITC monoclonal antibody 2 μ l saturated, so amount is as the consumption of the anti-CD20-FITC monoclonal antibody of standard in the competition inhibition test.The M3-4 that in the competition inhibition test, adds different amounts, anti-CD20-FITC produces corresponding restraining effect to standard, and restraining effect strengthens along with the increase of M3-4 add-on, and when adding the M3-4 of 200 μ g, positive cell percentage drops to 19.72% (Fig. 3 .4) by 65.70%.

3.5 M3-4 induces the apoptotic FCM of Daudi to detect

Daudi cell and M3-4 hatch after the per-cent (40.48%) that PI dyeing records its apoptosis cells apparently higher than its control group (10.36%), and negative cells HPB-ALL adds (16.28%) back (12.79%) no change (Fig. 3 .5) before the M3-4.

3.6 M3-4 monoclonal antibody V _HAnd V _LThe clone of gene and sequential analysis

The total RNA of hybridoma cell line M3-4 with Trizol reagent extracts 28s, 18s and 5s 3 bands clearly occur through the agarose gel electrophoresis evaluation.Behind synthetic the 1st chain cDNA, utilize the universal primer PCR amplification to obtain VH-CH ₁-CH ₂And V _L-C _LGene.Respectively with pGEM ^-T Easy filters out recombinant plasmid after connecting, and finishes the structure of pGEM-3-4H and pGEM-3-4L sequencing vector.Obtain angling the gene order information of getting through determined dna sequence, analytical results shows that the gene of acquisition all meets mouse antibodies variable region skeleton construction ^[10]

Table 3.2 has provided light, the heavy chain variable region gene and the protein sequence of M3-4 monoclonal antibody.

3.7 chimeric antibody TGLA Construction of eukaryotic and evaluation

The anti-CD20 antibodies that obtains is light, heavy chain variable region gene is building up to respectively on the pCMV-VHL163, cuts through PCR, enzyme and measures correctly, obtains TGLA chimeric antibody expression vector TGLAHL/pCMV-VHL163 (Fig. 3 .6).

3.8 the chimeric antibody TGLA of transient transfection identifies and purifying

TGLAHL/pCMV-VHL163 transient transfection 293T cell is used the ELISA method and is detected anti-body contg in the cell conditioned medium, and detects the expression (Fig. 3 .7) of the horizontal antibody gene of mRNA with RT-PCR after 72 hours after the transfection; It is the chimeric antibody of 150kD that non-reduced SDS-PAGE result confirms to have in the transfection supernatant molecular weight, consistent with the Mabthera result (Fig. 3 .8a); Get transient transfection chimeric antibody TGLA supernatant through ProteinA-Sephroase4B affinity purification (Fig. 3 .8b), acquisition can be carried out the TGLA antibody that biological activity is analyzed.

3.9 chimeric antibody TGLA in conjunction with activity identification

Respectively with expression supernatant, empty carrier transfectional cell supernatant and the CD20 of chimeric antibody TGLA ⁺Bone-marrow-derived lymphocyte is that the Daudi cell is hatched jointly, utilizes GAH-IgG-Fc-FITC to detect cell surface bonded chimeric antibody molecule.The fluorescence microscope result shows that the TGLA culture supernatant can combine (Fig. 3 .9) with target cell; Flow cytometry TGLA and target cell bonded positive rate are 97.67%.The TGLA chimeric antibody confirms further that to the immunoprecipitation result of Daudi cell TGLA antibody is that the CD20 molecule of 33kD has specific recognition function (Fig. 3 .10) to molecular weight.

3.10 the TGLA chimeric antibody combines the CD20 target site with CD20 antibody (Mabthera) competition

The function of antibody institute bonded epitope and antibody is closely related.Competitive inhibition test shows can compete when the Mabthera consumption is 40 times of TGLA and suppresses TGLA 54.64%, and the Mabthera consumption increases to 100 times and competes inhibiting rates and reach 87.43%.Experimental result is shown in Fig. 3 .11.

3.11 TGLA chimeric antibody avidity

With Daudi is target cell, and the avidity of measuring the TGLA chimeric antibody is 5.16 * 10 ^-9M (Fig. 3 .12).

3.12 the CDC effect of TGLA chimeric antibody

With Daudi and Raji cell is target cell, with Jurkat (the sick cell of people T leukemic lymphoblastoid) cell is non-target control cells, measure the CDC activity (rabbit complement) of TGLA, experimental result shows: TGLA can activate the rabbit complement and kill and wound target cell, lethal effect and antibody dosage are proportionate, the T leukemic lymphoblastoid cell that no CD20 is expressed does not have killing activity, and the target killing effect of TGLA antibody is to have specificity (Fig. 3 .13).

Reference

1.Chang KL，Arber DA，Weiss LM.CD20：A Review.Applied Immunohistochem.1996.4：1

2.Kosmas C，Stamatopoulos K，Stavroyianni N，et al.Anti-CD20-based therapy of B cell Iymphoma：state of art.Leukemia.2002，16：2004-2015.

3.Breedveld FC.Therapeutic monoclonal antibodies.Lancet.2000，335-740.

4. Wang Yu is firm, and .CD20 antigen and therapeutic anti-CD20 antibodies are doubly put forth energy in Shen. Chinese tumor biotherapy magazine .2005.12 (1): 76-79.

5.Ghetie MA，Bright H，Vitetta ES.Homodimers but not monomers of Rituxan(chimeric anti-CD20)induce apoptosis in human B-Iymphoma cells and synergize with a chemotherapeutic agent and animmunotoxin.Blood，2001，97(5)：1392-1398.

6.Krasner C，Joyce RM.Zevalin：90yttrium Iabeled anti-CD20(ibritumomab tiuxetan)，a new treatmentfor non-Hodgkin′s Iymphoma.Curr Pharm Biotechnol，2001，2(4)：341-349.

7.Vose JM.Bexxar：novel radioimmunotherapy for the treatment of low-grade and transformedlow-grade non-Hodgkin′s Iymphoma.Oncologist，2004，9(2)：160-172.

8.van der Kolk LE，Grillo-Lopez AJ，Baars JW，et al.Treatment of relapsed B-cell non-Hodgkin′sIymphoma with a combination of chimeric anti-CD20 monoclonal antibodies(rituximab)and G-CSF：finalreport on safety and efficacy[J].Leukemia，2003，17(8)：1658-1664.

9.Cheson BD.Radioimmunotherapy of non-Hodgkin Iymphomas[J].Blood，2003，101(2)：391-397.

Claims (5)

1, the hybridoma M3-4 cell and the antibody weight chain-ordering thereof of secretion anti-CD-20 monoclonal antibody

2, sequence of CD 20 antagonizing Chimeric antibody weight chain variable region gene and preparation method thereof

3, the separation antibody of claim 1,2 or its antigen-binding portion thereof;

4, claim 1,2,3 has antibody or its antigen-binding portion thereof of following feature:

(A) have heavy chain CDR1, CDR2, CDR3 territory; This territory comprises the aminoacid sequence of SEQ ID NO:1, or by in the position 1,4,5,7 or 10 amino acid replace or replace by the amino acid of position 1,3,4,8,12;

(B) have light chain CDR1, CDR2, CDR3 territory, this territory comprises the aminoacid sequence of SEQ ID NO:2, or by in the position 2,3,4,6,7,9,10 amino-acid substitution or by in the position 3,6,10,11,12 amino acid replace

5, claim 1-4 any one the preparation of TGLA chimeric antibody or antibody and ¹³¹The I-TGLA chimeric antibody to non-Hodgkin lymphoma (non-Hodgkin ' s lymphoma, NHL), Mabthera treatment has after resistance, the chemotherapy CD20 of recurrence again ⁺The NHL clinical treatment of folliculus type.

Images