CN1928117A - Method of synchronous distinguishing newcastle disease virus and vaccine virus and identifying virulence and genotype - Google Patents

Abstract

The present invention discloses molecular biological method and automatic analysis software for distinguishing wild virus strain and vaccine virus strain of new castle disease virus (NDV), and identifying the toxicity and genotype simultaneously. The NDV is RT-PCR amplified with one pair of specific degenerate primers to obtain one multipurpose NDV segment for direct sequencing of the PCR product. One automatic analysis software is composed for comparing the homology of the sequence to the standard vaccine sequence so as to distinguish wild virus strain and vaccine virus strain, analyze the toxicity by means of the F gene cracking site and judge the genotype through developing tree analysis. The present invention has short detecting period, reliable detection result and capacity of obtaining several detection results simultaneously, and is suitable for use in fowl product inspector and quarantiner.

Description

Synchronous distinguishing newcastle disease virus and vaccine virus are identified virulence and genotypic method

Technical field

The present invention relates to a kind of energy synchronous distinguishing newcastle disease virus and vaccine virus, identify its virulence and genotypic molecular biology method and supporting automated analysis software thereof.

Background technology

Newcastle disease (ND) is a kind of deadly infectious disease of bird.Because its propagation is rapid, popular extensively, M ﹠ M is high, cause the aviculture loss serious, and the country of outburst newcastle disease, its bird product international trade is forbidden and is limited, caused the bigger loss of aviculture.International Office of Epizootics classifies it as category-A transmissible disease, and China classifies it as class epidemic prevention object, and the inspection and quarantine system classifies it class Quarantine Objects of port quarantine as.

New city eqpidemic disease (ND) is a kind of acute infectious disease that is caused by Avian pneumo-encephalitis virus (NDV), and nineteen twenty-six is broken out first in the new city of Indonesia and Britain, so name Avian pneumo-encephalitis virus (Alexander DJ, 1982).It belongs to Paramyxoviridae (Paramyxoviridae), the member of Rubulavirus (Rubulavirus) family (Rima BK et al., 1995).Genome is a sub-thread strand RNA, comprises about 15kb base, and six albumen: 3 '-NP-P-M-F-HN-L-5 ' encode.

According to the seriousness difference of the caused clinical symptom of infection ability and infection back, NDV can be divided into strong poison (velogenic), poison (mesogenic) and weak poison (lentogenic) three classes (AlexanderD J, 1997).NDV virulent strain infectivity is very strong, usually to cause that lytic infection is feature; And the infectivity of NDV low virulent strain and virulence are very weak, generally do not have the acute infection illness, in fact, comprise a little less than many strains of La Sota etc. malicious NDV usually on producing by with the malicious vaccine of laboring.

F albumen is the main factor (Chen L et al., 2001) that merges viral lipoprotein cyst membrane and host cell surface coating, is the main determining factor (Glickman et al., 1988) of virus virulence.F albumen is at first with inertia precursor F ₀Form synthetic, in the virus multiplication process, produce the F that connects by disulfide linkage through the host cell proteins enzymic hydrolysis ₁-F ₂Two segment (NH ₂-F _2-S-S-F ₁-COOH) after, show fusion-activity, thereby make virus have infectivity.Cracking site is positioned at the 112-117 amino acids, and it is the key of decision cracking ability that its amino acid is formed, thereby also is the key that influences virus virulence.Consisting of of virulent strain cracking zone domain amino acid ¹¹²R/K-R-Q-K/R-R-F ¹¹⁷, promptly two pairs of basic aminoacidss that separated by Q are formed, so the cracking site of virulent strain is easy to be discerned and cracking by ubiquitous host protein lytic enzyme furin.Low virulent strain then is ¹¹²G/E-K/R-Q-G/E-R-L ¹¹⁷, be difficult for identification, so cracking do not take place in low virulent strain in most cells by host protein lytic enzyme furin, and with nonactive precursor F ₀Proteic form is delivered to filial generation, and infection activity reduces or forfeiture.This is the amino acid composition in F gene cracking site district and the molecular basis of the strong and weak dependency of NDV virulence.Li Z etc. (1998) are (2002) such as the analysis of basis reorganization NDV virus and Yu with the low virulent strain to the point mutation analysis of shearing site and Peeters (1999) etc. provides direct evidence to the analysis of the shearing site of virulence transition type street strain for this reason.But this is not whole factors of virulence decision, HN albumen yet relevant with virus virulence (Toyoda et al., 1989).

According to the difference of F gene order, the phylogeny of NDV is analyzed, can be divided into I-VII totally 7 genotype (Shan SH et al., 2003 to NDV; Liu XF et al., 2003), this has disclosed the epidemiological features of NDV on molecular level.

Newcastle disease is still one of poultry diease that China's distribution is the widest, harm is the most serious at present, and the best way of control ND is vaccination.In the production, in, the general deactivation of strong toxic vaccine strain is used, and uses with the malicious form of living the toxic vaccine strain (as poisoning vaccine I system) in weak poison (as La Sota) and the part.The malicious vaccine of living uses upward more convenient; And the immune protective effect that the inactivated vaccine and the malicious vaccine mixing of living are used is better.But generally the malicious vaccine of the work of Shi Yonging will be residual, and during this made that the import and export of bird product are quarantined, the recall rate of newcastle disease live virus was up to 10%-20%.For the Avian pneumo-encephalitis virus that is separated to, can not distinguish malicious vaccine of the residual work of immunization or the wild poison that infects fully owing to there is method at present, and the higher wild poison of toxicity may cause the propagation and the outburst of newcastle disease, so OIE (Anon, 2000) regulation must be carried out loaded down with trivial details to the Avian pneumo-encephalitis virus that is separated in importing and exporting, (10-40 days) consuming time, the toxicity test of expensive routine (comprising ICPI, MDT or IVPI).The high recall rate of Avian pneumo-encephalitis virus and very long sense cycle have influenced the foreign exchange earning of poultry product greatly.

For solving this technical barrier, developed some at present and distinguished RT-PCR method (He Dongsheng etc., 2000 of strong poison of newcastle disease and weak poison fast; Shan SH et al., 2003).But its theoretical basis is based upon strong poison of minority and the difference of weak malicious nucleotide sequence at guiding region minority Nucleotide, substantially do not relate to the morbific molecular basis of Avian pneumo-encephalitis virus, theoretical basis is not very abundant, and the sequence quantity of design of primers reference, the quantity of checking sample is all on the low side, and actual to apply difficulty bigger.

Along with development of molecular biology, the particularly automatization of gene sequencing technology, commercialization and cost degradation (being no more than 60 yuan/reaction) in export quarantine, relatively come identifying virus to become possibility by gene sequencing.The NDV fingerprint sequence of the one section about 400bp that finds among the present invention can not only be as the molecule marker of distinguishing newcastle disease virus and vaccine virus, and this sequence also can be used for gene type, and comprises the cracking site of F gene, can infer the genotype and the virulence of virus.Information biology and development of computer make loaded down with trivial details sequential analysis work of later stage to finish automatically by writing relevant program.

Summary of the invention

The objective of the invention is to go up the difference diagnosis difficult problem that newcastle disease virus infects and attenuated live vaccines is residual in order to solve to produce, by the RT-PCR-sequencing technologies, with the multifunction automatic analysis software of exploitation, distinguish newcastle disease virus and vaccine virus, and finish wild virulence and genotypic mensuration synchronously.

RT-PCR-sequence measurement of the present invention and automated analysis software reach by following measure:

1.F gene fragment 22-420 sequence is the most frequently used malicious vaccine virus of work as the discovery La Sota that distinguishes newcastle disease virus and vaccine virus molecule marker, so we get La Sota (AF077761) sequence as standard, use Vector NTI 8.0 to analyze other NDV sequence (from GenBank) and its homology (table 1), and carry out ASSOCIATE STATISTICS analysis (table 2) with SPSS (10.0).The result shows, F gene fragment (22-420) and F gene (ORF), and the NDV whole genome sequence has high correlation, and relation conefficient reaches 0.969 and 0.966.Therefore can be used as the molecule marker of distinguishing newcastle disease virus and vaccine virus.

Table each strain of 1:NDV and La Sota (AF077761) homology are relatively

Numbering	The gene sequence number	NDV sheet segment limit			Strain isolated
						F gene 22-420 fragment	F gene ORF (1662nt)	Full-length gene group (about 15186nt)
		Homology (%)	Homology (%)	Homology (%)
						A
1	Y18898	100	99.9	99.8	Clone 30 (the cDNA sequencing result of La Sota)
						2	AY225110	100	99.8	94.4	HB92 isolate V4(La Sota)
3	AF375823	99.2	99.2	99.0	B1(La Sota)
						4	AF309418	99.0	98.9	98.9	B1(La Sota)
5	NC_002617	99.0	98.9	98.9	B1(La Sota)
						6	AF431744	81.7	84.5	83.2	ZJ1
7	NC_005036	81.0	84.4	83.1	SF02(Goose)
						B
8	AF534997	100	99.9		ZJ/2000
						9	AY359876	100	99.9		NDVCUL97
10	AF079323	100	99.4		DB5
						11	AF079324	99.7	99.8		PNDV1
12	AF099661	99.7	99.6
						13	AF400614	99.0	98.9		NDV-JL-1/97
14	M24696	98.7	98.8		La Sota/46
						15	M24695	98.2	98.9		BI/47(La Sota)
16	M24698	96.2	97.4		TEX/48
						17	M24697	96.0	97.4		BEA/45
18	M24703	96.0	97.4		ITA/45
						19	M24694	88.5	90.6		ULS/67
20	M24692	87.0	89.7		D26/76
						21	AY427817	87.0	89.1		Heb02
22	AF217084	86.5	89.9		Strain：Queensland， isolate：V4
						23	M24693	86.2	89.5		Que/66
24	M21881	85.2	90.1		Australia-Victoria
						25	M24700	85.0	90.0		AUS/32
26	AY341061	84.5	89.2		LuoY
						27	AF163440	84.5	89.0		F48E9
28	M17710	84.5	89.0
						29	AF048763	84.5	87.8		AF2240
30	M24702	84.2	89.2		HER/33
						31	M18456	84.2	88.9		Miyadera
32	M24701	84.2	88.9		MIY/51
						33	M33855	84.0	88.7
34	AF079172	84.0	88.9		F48E9

35	AY508514	84.0	89.0		F48E9
						36	AF079322	83.7	93.1		DB3
37	AF109885	82.5	85.2		GB 1168/84
						38	AY253912	81.7	84.7		YN-PA01
39	AF358787	81.7	84.6		Ch/99
						40	AF456438	81.7	84.5		ZJ/1/00/Go
41	AY325909	81.7	83.2		YN-C2
						42	AF456442	81.5	84.9		JS/5/01/Go
43	AF358788	81.5	84.7		Ch/2000
						44	AY337464	81.5	84.7		From goose
45	AF400615	81.2	91.7		NDV-JL-2/97
						46	AY325799	81.2	84.5		YN-C1
47	AF364835	81.0	84.7		Ch/98-3
						48	AF358785	80.5	84.4		Ch/98-1
49	AF358786	80.2	84.4		TW/2000
						50	AY338284	79.4	84.1		Y98
51	AY325798	79.4	83.2		Pigeon paramyxovirus-1，YN-P1

Table 2:F gene fragment (22-420), the dependency statistical study of F gene (ORF) and NDV genome sequence homology

		F gene (ORF)	Genome
				T gene fragment (22-420)	The two tails of the correlation coefficient r probability sample number that accompanies	0.969 ** 0.000 51	0.966 ** 0.000 7
F gene (0RF)	The two tails of the correlation coefficient r probability sample number that accompanies	/	0.966 ** 0.000

Dependency is remarkable on the * .0.01 level

2. the design of amplification newcastle disease F gene fragment 22-420 degenerated primer:

P+：5’ATG GGC ICC AIA ICT TCT ACC 3’

P-：5’CAT TGG TTG CIG CAA TGC TCT C 3’

The primer explanation:

(1) P+The corresponding NDV-F gene of primer 1-21 fragment sequence; P-The corresponding NDV-F gene of primer 466-487 fragment sequence;

(2) P+Primer design is with reference to 194 NDV F gene sequences (AF309418, AF077761, AY225110 including among the GenBank, NC_002617, Y18898, AF431744, AF375823, NC_005036, M24693, M24692, M21881, M18456, M17710, AY508514, AY427817, AY359876, AY341061, AY338284, AY337464, AY325909, AY325799, AY253912, AF1634400, AF534997, AF456442, AF456438, AF400615, AF400614, AF364835, AF358788, AF358787, AF358786, AF217084, AF109885, AF099661, AF079324, AF079323, AF079322, AF079172, AF048763, AF358785, AF325798. AF001105, AF001106, AF001107, AF001108, AF001109, AF001110, AF001111, AF001112, AF001113, AF001114, AF001115, AF001116, AF001117, AF001118, AF001119, AF001120, AF001121, AF001122, AF001123, AF001124, AF001125, AF001126, AF001127, AF001128, AF001129, AF001130, AF001131, AF001132, AF001133, AF0011314, AF001135, AF091623, AF109876, AF109877, AF109878, AF109879, AF109880, AF109881, AF109882, AF109883, AF109884, AF109886, AF109887, AF263615, AF378245, AF378246, AF378247, AF378248, AF378249, AF378250, AF378251, AF378252, AF378253, AF378254, AF378255, AF378256, AF378257, AF378258, AF378259, AF378260, AF400616, AF401999, AF456435, AF456436, AF456437, AF456438, AF456439, AF456440, AF456441, AF456442, AF456443, AF456444, AF520592, AY135740, AY135741, AY135742, AY135743, AY135744, AY135745, AY135746, AY135747, AY135748, AY135749, AY135750, AY135751, AY135752, AY135753, AY135754, AY135755, AY135756, AY135757, AY135758, AY135759, AY289194, AJ306304, AJ306305, Y19012, Y19015, Y19017, AY117021, AY117022, AY117023, AY117024, AY117025, AY150125, AY150126, AY150127, AY150128, AY150129, AY150130, AY150131, AY150132, AY150133, AY150134, AY150135, AY150136, AY150137, AY150138, AY150139, AY150140, AY150141, AY150142, AY150143, AY150144, AY150145, AY150146, AY150147, AY150148, AY150149, AY150150, AY150151, AY150152, AY150154, AY150155, AY150156, AY150157, AY150158, AY150159, AY150160, AY150161, AY150162, AY150163, AY150164, AY150165, AY151383, AY151384, AY151385, AY170136, AY170137, AY170138, AY170139, AY170140, AY190518, AY252120.), the homology comparison result is referring to Fig. 1.

(3) P-Design reference 75 NDV F gene sequences (AF309418, AF077761, AY225110, NC_002617 that include among the GenBank, Y18898, AF431744, AF375823, NC_005036.M24693, M24692, M21881, M18456, M17710, AY508514, AY427817, AY359876, AY341061, AY338284, AY337464, AY325909, AY325799, AY253912, AF1634400, AF534997, AF456442, AF456438, AF400615, AF400614, AF364835, AF358788, AF358787, AF358786, AF217084, AF109885, AF099661, AF079324, AF079323, AF079322, AF079172, AF048763, AF358785, AF325798, AF378245, AF378246, AF378247, AF378248, AF378249, AF378250, AF378251, AF378252, AF378253, AF378254, AF378255, AF378256, AF378257, AF378258, AF378259, AF378260, AF400616, AF401999, AF456435, AF456436, AF456437, AF456438, AF456439, AF456440, AF456441, AF456442, AF456443, AF456444, AJ306304, AJ306305, Y19012, Y19015, Y19017), the homology comparison result is referring to Fig. 2.

(4) I represents inosine, can with A, T, G, C complementary (molecular cloning second edition p543) increase the degeneracy of primer, P+In introduced 3 I, P-In introduced 1 I.

(5) because of NDV is a minus-stranded rna virus, select for use P+Do RT reaction primer;

(6) unreliable because of sequencing near primer 2 0-30nt, select for use P-Do sequencing primer.

3. the extracting of viral nucleic acid RNA

(1) getting vaccine virus dry powder (8mg) dissolves with 100 μ l PBS; Or get allantoic fluid 100 μ l. to be detected

(2) add 900 μ l TRIzol reagent (Gibco-BRL company), mixing, room temperature 5min;

(3) add 0.2ml or an amount of chloroform, room temperature left standstill 3 minutes behind the vibration mixing;

(4) 12000g, 4 ℃, centrifugal 15 minutes;

(5) carefully draw supernatant to new 1.5ml centrifuge tube;

(6) add 0.5ml or an amount of Virahol, room temperature was placed 10 minutes behind the concussion mixing;

(7) 12000g, 4 ℃, centrifugal 10 minutes;

(8) 75% washing with alcohol of abandoning supernatant adding 0.5ml once;

(9) 12000g, 4 ℃, centrifugal 5min;

(10) abandoning supernatant, precipitation are put 37 ℃ of oven dry 10min;

(11) add 20 μ l RNase free ddH ₂The O dissolving.

4.RT-PCR amplification

The A.RT reaction:

(1) adds 2 μ l P+(10pmol/ μ l) is in the nucleic acid of 10 μ l;

(2) 100 ℃ of insulation 3min;

(3) insert 5min in the ice fast;

(4) add 5X AMV RTase buffer 4 μ l, dNTP mixture (10mM) 2 μ l, Ribonuclease inhibitor1 μ l (TaKaRa company), AMV RTase (5U/ μ l) 1 μ l (TaKaRa company).Stir gently;

(5) room temperature 10min;

(6) move into 42 ℃ of water bath with thermostatic control insulations 1 hour;

(7) reaction solution all is used for the PCR reaction.

The B.PCR reaction:

(8) add

10X PCR Buffer(Mg ²⁺free) 20μl；

MgCl ₂(25mM) 12μl；

dNTP(2.5mM) 16μl；

P+(10pmol/μl) 8μl；

P-(10pmol/μl) 8μl；

RTaq (5U/ μ l) 1 μ l; (TaKaRa company)

RT product 20 μ l;

ddH ₂O 115μl

Total 200μl

(9) 100 μ l are sub-packed in 2 thin-walled tubes behind the mixing; The PCR reaction.

(10) PCR reaction conditions:

94℃ 4mins

72℃ 10mins

(11) get 15 μ l detected through gel electrophoresis (product is 480bp greatly down).

5.PCR product directly checks order

After getting 170 μ l PCR products (remaining 15 μ l-20 ℃ deposits) and sending biotech company rubber tapping to reclaim, carry out the PCR product and check order directly that (the purpose band is positioned at 480bp, uses P-As sequencing primer).

6.F the mensuration of gene fragment 22-420 sequence variations parameter

Choose the same lot number of same producer, different lot numbers, La Sota vaccine and variant and mixed vaccine totally 22 strains that different manufacturers is produced, carry out the nucleic acid extracting with aforesaid method, RT-PCR amplification and order-checking, and analyze itself and the nucleotide difference of standard La Sota (AF077761), acquisition F gene of NDV strain fragment 22-420 sequence variations parameter, result such as table 3 with biosoftware Vector NTI 8.0.Also chosen the same lot number of same producer simultaneously, the mesogenic living vaccine (I system) that different lot numbers, different manufacturers are produced totally 5 strain amplifications and order-checking verifies that discovery has only the variation of 1 Nucleotide, and the result who obtains with La Sota is consistent.

The mensuration of table 3. various La Sota vaccine strain and standard La Sota (AF077761) F gene fragment 22-420 sequence variations number:

Nucleotide diversity is counted the hundreds of proportions by subtraction of vaccine strain

0 19 86.4％

1 2 9.1％

4 1 4.5％

As shown in Table 3, the sequence major part (86.4%) of F gene fragment 22-420 is variation not, has only minority (4.5%) that the variation of 4 Nucleotide is arranged.This variation is from the error of the sudden change and the operation of gene, and the variation parameter of mensuration is used to set the threshold value of newcastle disease virus and vaccine virus differentiation.

7.NDV the mensuration of standard living vaccine F gene fragment 22-420 sequence library

Collect various newcastle diseases commonly used malicious vaccine alive both at home and abroad, analyze, be classified as 4 classes according to homology with aforesaid method mensuration sequence and with biosoftware Vector NTI 8.0.Its standard sequence is referring to table 4.The further feature of four class standard newcastle diseases malicious vaccine alive is referring to table 5 and table 6.

Table 4. is NDV standard living vaccine F gene fragment 22-420 sequence library both at home and abroad:

The vaccine title	Sequence (F gene fragment 22-420)
		La Sota	AAGAACCCAGCACCTATGATGCTGACTATCCGGGTTGCGCTGGTACTGAGTTGCATCTGTCCGGCAAACTCCATTGATGGC AGGCCTCTTGCAGCTGCAGGAATTGTGGTTACAGGAGACAAAGCCGTCAACATATACACCTCATCCCAGACAGGATCAATC ATAGTTAAGCTCCTCCCGAATCTGCCCAAGGATAAGGAGGCATGTGCGAAAGCCCCCTTGGATGCATACAACAGGACATTG ACCACTTTGCTCACCCCCCTTGGTGACTCTATCCGTAGGATACAAGAGTCTGTGACTACATCTGGAGGGGGGAGACAGGGG CGCCTTATAGGCGCCATTATTGGCGGTGTGGCTCTTGGGGTTGCAACTGCCGCACAAATAACAGCGGCCGCAGCT
Avinew	AGGATCCCAGTACCTCTTATGCTGACCGTCCGAGTCATGTTGGCACTGAGTTGCGTCTGTCCGACCAGCGCCCTTGATGGC AGGCCTCTTGCAGCTGCAGGGATTGTGGTAACAGGAGACAAAGCAGTCAACATATACACCTCATCTCAGACAGGGTCAATC ATAATCAAGTTACTCCCAAATATGCCCAAGGATAAAGAGGCGTGTGCAAAAGCCCCGTTGGAGGCATACAACAGGACATTG ACTACTTTGCTCACCCCCCTTGGTGATTCTATCCGTAGGATACAAGAGTCTGTGACCACGTCCGGAGGAGGGAAACAGGGA CGTCTTATAGGCGCCATTATCGGTGGTGTAGCTCTCGGGGTTGCAACCGCTGCACAGATAACAGCAGCCTCGGCT
		V.H.	AGGATCCCAGTACCTCTGATGCTGACCGTCCGATTTGTGCTGGCACTGAGTTGCATCTGTCCGACTAGCTCCCTTGATGGC AGGCCTCTTGCAGCTGCAGGGATTGTGGTAACAGGAGACAAAGCAGTCAACATATACACCTCATCTCAGACAGGGTCAATC ATAGTCAAGTTACTCCCAAATATGCCCAAAGATAAAGAGGCGTGTGCAAAAGCCCCGTTGGAGGCGTACAACAGGACATTG ACCACTTTGCTCACCCCCCTTGGTGATTCTATCCGTAGGATACAAGAGTCCGTGACCACATCTGGAGGAGGGAAACAAGGA CGCCTTATAGGCGCCATTATCGGTGGTGCAGCTCTCGGGGTTGCAACCGCTGCACAGATAACAGCAGCCTCGGCT
Newcastle disease I system	AGGATCCCAGTACCTCTAATGCTGACCATACGGATCACGCTGGCACTGAGTTATGTCCGTCTGACAAGTTCTCTTGATGGC AGGCCTCTTGCAGCCGCAGGGATCGTGGTAACAGGGGATAAAGCAGTTAACATATACACCTCATCCCAGACAGGGTCAATC ATAGTCAAGTTACTCCCAAATATGCCCAAGGACAAAGAGGCATGTGCAAAAGCCCCATTGGAGGCTTACAACAGGACACTG ACTACTTTGCTTACCCCCCTTGGTGATTCTATCCGCAGGATACAAGAGTCTGTGACTACATCCGGAGGAAGGAGACAGAGA CGCTTTATAGGTGCCATTATTGGCAGTGTAGCTCTAGGGGTTGCAACAGCTGCACAGATAACGGCAGCCTCGGCT

Table 5.The feature of domestic and international NDV standard malicious vaccine alive

The vaccine title	Virulence	F gene cracking site aminoacid sequence	Genotype	Out of Memory
					La Sota	Weak poison	112GRQGRL	II	Comprise La Sota and variant thereof the system (B59, N79, B1)
Avinew	Weak poison	112GRQGRL	I	With newcastle disease V4-Queensland (AF217084) strain is that sequence is consistent
					V.H.	Weak poison	112GRQGRL	I	With newcastle disease Tol (AY39035) strain be that sequence differs a base
Newcastle disease I system	Poison	112RRQRRF	III	It is newcastle disease Mukteswar strain system

The homology of table 6. four class standard vaccine sequences and the difference number of Nucleotide.

8. the exploitation of multifunction automatic analysis software

(1) foundation of 3 databases of software analysis use

In order to distinguish newcastle disease virus and vaccine virus, measure and set up the standard vaccine sequence library, referring to table 4; In order to measure the virulence of Avian pneumo-encephalitis virus, reference (Collins MS et al., 1993; Luo Jun etc., 2002) set up in, strong malicious cracking site sequence library (table 7); In order to measure the genotype of Avian pneumo-encephalitis virus, reference (Lomniczi B, 1998; Shan SH et al., 2003) set up 7 kinds of genotype standard strain sequence libraries (table 8).

In the table 7., strong malicious cracking site aminoacid sequence storehouse

F gene cracking site sequence	Virulence is inferred	Out of Memory
			112R/K-R/K-X-K/R-K/R-F 117	Strong poison or poisoning	X represents arbitrary amino acid, strong malicious Avian pneumo-encephalitis virus in the major part,
112G-K/R-X-K/R-R/K-F 117	Strong poison or poisoning	X represents arbitrary amino acid, some dove Avian pneumo-encephalitis virus
			Other sequence	Poison or weak poison	Weak malicious Avian pneumo-encephalitis virus, and mutating experiment evidence

Seven kinds of genotype standard strains of table 8. sequence library (F gene fragment 22-389)

Strain name	Accession numbe	Genotype
			Ulster	D00243	I
V4/66	AF217084	I
			Beaudette/C45	X04719	II
La Sota/46	M24696	II
			Miyadera/51	M18456	III
Aus Victoria/32	M21881	III
			F48E9	AY508514	III
Herts/33	M24702	IV
			Italien	M17710	IV
CA1085/71	AF001106	V
			NY70181	AF001105	V
Warwick/66	Z12111	VI
			GB1168	AF109885	VI
Taiwan95	U62620	VII
			QY97	AF162714	VII

Table 9: wild poison is distinguished the combination criterion of wild virulence (X represents the vaccine title that homology is the highest) with vaccine virus

(2) setting of the schema of software analysis and combination criterion

The software analysis schema is referring to Fig. 3.Because of P-is a sequencing primer, acquisition be complementary sequence, need to analyze after the counter-rotating.The purpose of joining with standard sequence La Sota homology connection is to treat order-checking row location, accurately cuts out target sequence.The fragment 22-420 that obtains is used for the differentiation of newcastle disease virus and vaccine virus; The fragment 334-351 F gene cracking site aminoacid sequence (112-117) of encoding is used to infer virus virulence; Fragment 22-389 is used for the gene type analysis, infers the genotype of virus.Discover that the sudden change on the virolysis site may produce bigger influence (Li Z et al., 1998 to virus virulence; Peeters BPHet al., 1999; Yu SQ, 2002), thus software must distinguish virulence may enhanced vaccine variant, this just need take all factors into consideration viral nucleic acid variation parameter to be checked and virulence is inferred parameter, sets up and makes up decision condition.Simultaneously, the judgement that is in threshold boundaries is judged by accident easily, sets up doubtful vaccine virus can reduce the probability of probability of miscarriage of justice.Combination criterion is referring to table 9.

(3) writing of software:

Software adopts C++builder 6.0 to write, and the auxiliary tone of homology connection is grown tree analysis (gene type) and called free shareware phylip software package with free shareware Clustal W (1.83) multiple sequence alignment software package in the program.

(4) software uses the step brief introduction:

Software master interface is referring to Fig. 4.Click " load sequence " button, list entries (Fig. 5); Click " Detect " button, after selection result was preserved the position, software was analyzed automatically, and exported result (Fig. 6) with the form of form.Click " Vaccine manager " button, enter " Vaccine setup " dialog box, under the situation of not revising source routine, can make amendment to the standard vaccine storehouse easily, add and deletion (Fig. 7)." Options " button can be revised the threshold value (Fig. 8) of wild poison and vaccine virus differentiation.

9. method specificity, the detection of susceptibility and reliability:

(1) method specific detection.Choose clinical symptom and the closely similar bird flu of newcastle disease disease, duck hepatitis virus, avian infectious bronchitis virus, coccidia virus, Marek ' s virus, infections chicken cloacal bursa virus, the negative control that virus-free allantoic fluid detects as RT-PCR, the positive detection sample has then been chosen some type strain F48E9 (strong poison) of NDV, La Sota (weak poison), N79 (weak poison), Muktastwar (poisoning), B59 (weak poison), Clone 30 (weak poison) etc.Result such as Fig. 9.

All negative controls all do not amplify band at the 480bp place, and all positive detection samples all amplify the purpose fragment at the 480bp place, prove that present method has higher specificity.The minority positive also amplifies an assorted band at the 300bp place, consider it is the rubber tapping order-checking, and the existence of assorted band can not produce any influence to the result.

(2) the present invention has only detected the sensitivity of RT-PCR.Consider as long as RT-PCR can amplify the purpose fragment, just can obtain enough products for further order-checking, so the key of the inventive method is the sensitivity of RT-PCR by constantly increasing.Collection standard Avian pneumo-encephalitis virus F48E9 and La Sota allantoic fluid are measured its virus titer ELD with the Reed-Muench method respectively ₅₀, and carry out 10 times of gradient dilutions, carry out RT-PCR amplification, result such as Figure 10 behind the extraction nucleic acid.It is 10 that RT-PCR detects F48E9 sensitivity ^1.5ELD ₅₀/ ml, detecting La Sota is 10 ^1.7ELD ₅₀/ ml.

(3) detection of method reliability.Choose F48E9, Komorov, La Sota, Mukteswar, N79, Roakin, V.H, newcastle disease I system, Avinew, B1, B59, standard newcastle disease strains such as Clone 30 detect result such as Figure 11 with method of the present invention.Because N79, B1, B59, Clone 30 are variant systems of La Sota, so detected result shows that it is a La Sota vaccine, coincide with the fact; Newcastle disease I system is a Mukteswar strain system, so the Mukteswar detected result is a living vaccine for mesogenic I, coincide with the fact.12 strain standard newcastle disease strain detected results and Given information are in full accord, show that method of the present invention has high reliability.

The invention has the beneficial effects as follows: can be accurate, (3 days) are special fast, distinguish newcastle disease virus and vaccine virus easily, and can measure its virulence and genotype synchronously.The multifunctional analysis software operation of exploitation is easy, and parameter (standard vaccine sequence library and differentiation threshold value) can conveniently be revised, and upgrading has very big handiness.The present invention is suitable for the bird inspection and quarantine department and bird breed factory promotes the use of.To the foreign exchange earning of bird product, the monitoring and warning of newcastle disease has very high using value.

Description of drawings

Different N DV strain was the result (Vector NTI8.0) that the sequence homology connection is joined when Fig. 1 was the P+ design.Consensus represents conserved sequence.

Different N DV strain was the result (Vector NTI8.0) that the sequence homology connection is joined when Fig. 2 was the P-design.Consensus represents conserved sequence.

Fig. 3 is the software design schema.

Because of P-is a sequencing primer, acquisition be complementary sequence, need to analyze after the counter-rotating.The purpose of joining with standard sequence La Sota homology connection is to treat order-checking row location, accurately cuts out target sequence.The fragment 22-420 that obtains is used for the differentiation of newcastle disease virus and vaccine virus; The fragment 334-351 F gene cracking site aminoacid sequence (112-117) of encoding is used to infer virus virulence; Fragment 22-389 is used for the gene type analysis, infers the genotype of virus.

Fig. 4 is automated analysis software-new city vaccine virus despot's 2004 the main interface of analysis.

" Load sequence " button is imported sequence to be measured, and the result is analyzed and exported to " Detect " button software automatically." Vaccine Manager " button is made amendment to the standard vaccine sequence library that software includes, and adds deletion." Options " button is made amendment to vaccine and wild contaminated area branch threshold value." Close " close software." candidate Sequences " shows sequence title to be analyzed." Origin Sequence " original series of display analysis." detect result " display analysis result.

Fig. 5 is the software interface after the sequence input,

Fig. 6 is software detection interface as a result.

The hyperlink of click details can show the detailed content in the testing process.

Fig. 7 is the window that the standard vaccine sequence library is revised.

" Add " adds new vaccine, and " Edit " makes amendment to existing vaccine information, and the existing vaccine of " Delete " deletion, " OK " are preserved and revised the result, and the result is revised in " Cancel " cancellation.

Fig. 8 is the modification window that newcastle disease virus and vaccine virus are distinguished threshold value.

" Max Vaccine mutation count " is the maximum variance of vaccine, and " Max Doubt Vaccine MutationCount " is the maximum variance of doubtful vaccine.

Fig. 9 is a RT-PCR specificity experimental result.

1.100bp DNA Ladder Marker (TaKaRa); 2. allantoic fluid; 3. bird flu H5; 4. bird flu H9; 5. duck hepatitis virus (DHV); 6. chicken infectious bronchitis living vaccine (H120) (Shanghai Songjiang biologics factory); 7. fryer coccidiosis living vaccine (Shandong animal health product factory); 8.Marek ' s Disease Vaccine Serotype 3, Live Virus (Merial SELECT INC); 9. infectious bursal disease bivalent live vaccine (Yi Kang of Liaoning Province biological factory); 10.F48E9; 11.La Sota; 12.Muktaswar; 13.B59; 14.N79; 15.Clone 30; 16.100bp DNA LadderMarker (TaKaRa). all positive sample amplified band all occurs at the 480bp place.Negative control does not have amplified band.The part positive sample impurity removal band that also increases at the 300bp place because of the present invention adopts the rubber tapping order-checking, can not produce any influence to the result.

Figure 10 is RT-PCR sensitivity experiment result.

1.100bp DNA Ladder Marker (TaKaRa); 2.10 ^3.5ELD ₅₀/ ml F48E9 allantoic fluid; 3.10 ^2.5ELD ₅₀/ ml F48E9 allantoic fluid; 4.10 ^1.5ELD ₅₀/ ml F48E9 allantoic fluid; 5.10 ^0.5ELD ₅₀/ ml F48E9 allantoic fluid; 6.10 ^3.7ELD ₅₀/ ml LaSota allantoic fluid; 7.10 ^2.7ELD ₅₀/ ml La Sota allantoic fluid; 8.10 ^1.7ELD ₅₀/ ml La Sota allantoic fluid; 9.10 ^0.7ELD ₅₀/ ml La Sota allantoic fluid; 10.10 ^-0.3ELD ₅₀/ ml La Sota allantoic fluid.

Figure 11. be the reliability demonstration result of novel method bioassay standard newcastle disease strain.

Because N79, B1, B59, Clone 30 are variant systems of La Sota, so detected result shows that it is a La Sota vaccine, coincide with the fact; Newcastle disease I system is a Mukteswar strain system, so the Mukteswar detected result is a living vaccine for mesogenic I, coincide with the fact.12 strain standard newcastle disease strain detected results and Given information are in full accord.

Figure 12. part is separated the electrophorogram of newcastle disease strain RT-PCR product among the embodiment 1.

1.100bp DNA Ladder Marker (TaKaRa); 2. allantoic fluid; 3. isolating newcastle disease virus in the goose; 4. isolating newcastle disease virus in the pigeon; 5. isolating newcastle disease virus in the chicken; 6. isolating newcastle disease virus in the ostrich.

Embodiment 1-separates the detection of newcastle disease strain

1. Bing Du separation and evaluation.

According to the method for " diagnostic test and vaccine manual of standards " (International Office of Epizootics writes, 1996), from goose, pigeon, chicken is isolated 51 strain Avian pneumo-encephalitis virus in the ostrich.

2. the extracting of viral nucleic acid RNA

(1) gets allantoic fluid 100 μ l. to be detected

(2) add 900 μ l TRIzol reagent (Gibco-BRL company), mixing, room temperature 5min;

(3) add 0.2ml or an amount of chloroform, room temperature left standstill 3 minutes behind the vibration mixing;

(4) 12000g, 4 ℃, centrifugal 15 minutes;

(5) carefully draw supernatant to new 1.5ml centrifuge tube;

(6) add 0.5ml or an amount of Virahol, room temperature was placed 10 minutes behind the concussion mixing;

(7) 12000g, 4 ℃, centrifugal 10 minutes;

(8) 75% washing with alcohol of abandoning supernatant adding 0.5ml once;

(9) 12000g, 4 ℃, centrifugal 5min;

(10) abandoning supernatant, precipitation are put 37 ℃ of oven dry 10min;

(11) add 20 μ l RNase free ddH ₂The O dissolving.

2.RT-PCR amplification and PCR product directly check order:

Wherein: P+: 5 ' ATG GGC ICC AIA ICT TCT ACC 3 '

P-：5’CAT TGG TTG CIG CAA TGC TCT C3’

The A.RT reaction:

(1) adds 2 μ l P+(10pmol/ μ l) is in the nucleic acid of 10 μ l;

(2) 100 ℃ of insulation 3min;

(3) insert 5min in the ice fast;

(4) add 5X AMV RTase buffer 4 μ l, dNTP mixture (10mM) 2 μ l, Ribonuclease inhibitor1 μ l (TaKaRa company), AMV RTase (5U/ μ l) 1 μ l (TaKaRa company).Stir gently;

(5) room temperature 10min;

(6) move into 42 ℃ of water bath with thermostatic control insulations 1 hour;

(7) reaction solution all is used for the PCR reaction.

The B.PCR reaction:

(8) add

10X PCR Buffer(Mg ²⁺free) 20μl；

MgCl ₂(25mM) 12μl；

dNTP(2.5mM) 16μl；

P+(10pmol/μl) 8μl；

P-(10pmol/μl) 8μl；

RTaq (5U/ μ l) 1 μ l; (TaKaRa company)

RT product 20 μ l;

ddH ₂O 115μl

Total 200μl

(9) 100 μ l are sub-packed in 2 thin-walled tubes behind the mixing; The PCR reaction.

(10) PCR reaction conditions:

94℃ 4mins

72℃ 10mins

(11) (product is 480bp greatly down, Figure 12) to get 15 μ l detected through gel electrophoresis

The C.PCR product directly checks order

(12) get 170 μ l PCR products (remaining 15 μ l-20 ℃ deposits) and send biotech company rubber tapping to reclaim after, carry out the PCR product and check order directly that (the purpose band is positioned at 480bp, uses P-As sequencing primer).

3. with newcastle disease poison despot sequence is analyzed:

(1) E-mail collects the sequencing result of company;

(2) start newcastle disease poison despot software, enter and analyze main interface.

(3) click " load sequence " button, list entries;

(4) click " Detect " button, software requires selection result to preserve the position earlier, and after determining, the result is promptly analyzed and export to software automatically.

4. result's statistics is as table 10.In the 51 strain isolated strains, vaccine accounts for 58.8%; Doubtful vaccine is 3.9%; Wild poison does not detect V.H and newcastle disease I system for mainly being La Sota in the 37.3%. vaccine; In the wild poison mainly is gene VII type, gene VI type and gene II type.

Table 10.51 strain isolated strain RT-PCR-order-checking and software analysis result

	Vaccine		Doubtful vaccine		Wild poison
								LaSota	Avinew	La Sota	Avinew	Gene II type	Gene VI type	Gene VII type
	The hundreds of proportions by subtraction of strain	28 54.9％	2 3.9％	1 2.0％	1 2.0％	2 3.9％	5 9.8％								12 23.5％
Total per-cent								58.8％		3.9％		37.3％

The main reference document

He Dongsheng, Qin Zhifeng, Liu Fuan. the differential diagnosis of Avian pneumo-encephalitis virus Phylogenetic Analysis and strong and weak strain. animal medicine progress .2000.21 (2): 27-31.

Luo Jun, Gong Xia etc. the detection and the discriminating of Avian pneumo-encephalitis virus (fowl I type paramyxovirus). animal and veterinary logical flood 2002.3:10-13. International Office of Epizootics in Shanghai writes. diagnostic test and vaccine manual of standards [M] .1996,140-146.

Alexander DJ.(1982)Avian paramyxoviruses-other than Newcastle disease virus.World Poultry Sciences.38：97-104.

Alexander，D.J.(1997)Newcastle disease and other avian Paramyxoviridae infections.In Diseases of poultry，10th edn，pp.541-569.Edited by B.W.Calnek.Ames：Iowa State University Press.Anon.(2000)Newcastle disease.International Health Code，9 ^th Edn.Office International des Epizootes.

http://www.oie.int/eng/en index.htm.

Chen L.，Gorman JJ.，McKimm-Breschkin J.，et al.(2001)The structure of the fusion glycoprotein of Newcastledisease virus suggests a novel paradigm for the molecular mechanism of menbrane fusion.Structure..9：255-266.

Collins MS，Bashiruddin JB，Alexander DJ.1993.Deduced amino acid sequences at the fusion protein cleavagesite of Newcastle disease viruses showing variation in antigenicity and pathogenicity.Arch Virol.128(3-4)，363-70.

Glickman R L，Syddal R J，lorio R M，Sheehan J P，Bratt M A.(1988)Quantitative basic residue requirements inthe cleavage activation site of the fusion glycoprotein as a determinant of virulence for Newcastle diseasevirus.Journal of Virology.62：354-356.

Li Z.，Sergel T.，Razvi E.，et al.(1998)Effect of cleavage mutants on syncytium formation directed by thewild-type fusion protein of Newcastle disease virus.Journal of Virology，72：3789-3795.

Liu XF， Wan HQ， Ni XX， Wu YT， Liu WB.(2003).Pathotypical and genotypical characterization of strains ofNewcastle disease virus isolated from outbreaks in chicken and goose flocks in some regions of Chinaduring 1985-2001.Arch Virol.148(7)，1387-403.

Lomniczi，B.，Wehmann，E.，Herczeg，J.，Ballagi-Pordany，A.，kaleta，E.F.，Werner，O.，Meulemans，G.，Jorgensen，P.H.，Manté，A.P.，Gielkens，A.L.J.，Capua，I.&Damoser，J.(1998)Newcastle disease outbreaks inrecent years in Western Europe were caused by old(VI)and a novel genotype(VII).Archives of Virology.143：49-64.

Peeters BPH.，de Leeuw OS.，Koch G.，et al.(1999)Rescue of Newcastle disease virus from cloned cDNA：evidence that cleavability of the fusion protein is a major determinant for virulence.Journal of Virology，73：5001-5009.

Rima，BK.，Alexander，DJ.，Billeter，MA.，Collins，PL.，Kingsbury，DW.，Lipkind，MA.，Nagai，Y.，Orvell C.，Pringle，CR.&ter Meulen，V.(1995)The Paramyxoviridae.In Virus Taxonomy.Sixth Report of theInternational Committee on Taxonomy of Viruses，pp.268-274.Edited by F.A.Murphy，C.M.Fauquet，&D.H.Summers.Vienna & New York：Springer-Verlag.

Shan SH，Shao CG，Zou J et al.(2003)lsolation and identification of genotype VII Newcastle disease virus(NDV)from an import pigeon.Chinese Journal of Virology.19(4)，360-364.

Toyoda T.，Sakaguchi T.，Hirota H.，et al.(1989)Newcastle Disease Virus Evolution.II.Lack of GeneRecombination in Generating Virulent and Avirulent Strains.Virology.169，273-282.

Yu，S.Q.，Kishida，N.，Ito，H.，Kida，H.，Otsuki，K.，Kawaoka，Y.&Ito，T.(2002)Generation of VelogenicNewcastle Disease Viruses from a Nonpathogenic Wateffowl lsolate by Passaging in Chickens.Virology.301：206-211

Claims (10)

1. one kind is used for newcastle disease virus and vaccine virus difference diagnosis, the detection method that virulence and genotype are measured synchronously, comprise the extracting of viral nucleic acid, the RT-PCR amplification, the PCR product send biotech firm's rubber tapping order-checking, the information biology software analysis of sequence, in it is characterized in that detecting, adopted one section to can be used as molecule marker, and contain F gene cracking site and the segmental multi-usage newcastle disease virus gene of gene type sequence, amplify the purpose fragment by a pair of special degenerated primer, write specific information biology software sequencing result is analyzed.

2. newcastle disease virus according to claim 1 and vaccine virus difference diagnosis, the detection method that virulence and genotype are measured synchronously is characterized in that this multi-usage newcastle disease virus gene sequence is F gene of NDV strain fragment 22-420.

3. newcastle disease virus according to claim 1 and vaccine virus difference diagnosis, the detection method that virulence and genotype are measured synchronously is characterized in that two special degeneracy amplimer sequences are:

P+：5’ATG GGC ICC AIA ICT TCT ACC 3’

P-：5’CAT TGG TTG CIG CAA TGC TCT C 3’

4. newcastle disease virus according to claim 1 and vaccine virus difference diagnosis, the detection method that virulence and genotype are measured synchronously is characterized in that P+Be used for the RT amplification, P-Be used for the order-checking of PCR product, the pcr amplification product size is 487bp.

5. newcastle disease virus according to claim 1 and vaccine virus difference diagnosis, the detection method that virulence and genotype are measured synchronously, it is characterized in that this specific information biology software comprises newcastle disease commonly used malicious vaccine F gene fragment 22-420 sequence library alive both at home and abroad, its title, feature and sequence are:

(a) La Sota:F gene cracking site aminoacid sequence is GRQGRL, weak poison, gene II type, nucleotide sequence are AAGAACCCAGCACCTATGATGCTGACTATCCGGGTTGCGCTGGTACTGAGTTGCAT CTGTCCGGCAAACTCCATTGATGGCAGGCCTCTTGCAGCTGCAGGAATTGTGGTTA CAGGAGACAAAGCCGTCAACATATACACCTCATCCCAGACAGGATCAATCATAGTT AAGCTCCTCCCGAATCTGCCCAAGGATAAGGAGGCATGTGCGAAAGCCCCCTTGGA TGCATACAACAGGACATTGACCACTTTGCTCACCCCCCTTGGTGACTCTATCCGTA GGATACAAGAGTCTGTGACTACATCTGGAGGGGGGAGACAGGGGCGCCTTATAGGC GCCATTATTGGCGGTGTGGCTCTTGGGGTTGCAACTGCCGCACAAATAACAGCGGC CGCAGCT

(b) Avinew:F gene cracking site aminoacid sequence is GRQGRL, weak poison, gene I type, nucleotide sequence are AGGATCCCAGTACCTCTTATGCTGACCGTCCGAGTCATGTTGGCACTGAGTTGCGT CTGTCCGACCAGCGCCCTTGATGGCAGGCCTCTTGCAGCTGCAGGGATTGTGGTAA CAGGAGACAAAGCAGTCAACATATACACCTCATCTCAGACAGGGTCAATCATAATC AAGTTACTCCCAAATATGCCCAAGGATAAAGAGGCGTGTGCAAAAGCCCCGTTGGA GGCATACAACAGGACATTGACTACTTTGCTCACCCCCCTTGGTGATTCTATCCGTA GGATACAAGAGTCTGTGACCACGTCCGGAGGAGGGAAACAGGGACGTCTTATAGGC GCCATTATCGGTGGTGTAGCTCTCGGGGTTGCAACCGCTGCACAGATAACAGCAGC CTCGGCT

(C) V.H.:F gene cracking site aminoacid sequence is GRQGRL, weak poison, gene I type, nucleotide sequence are AGGATCCCAGTACCTCTGATGCTGACCGTCCGATTTGTGCTGGCACTGAGTTGCAT CTGTCCGACTAGCTCCCTTGATGGCAGGCCTCTTGCAGCTGCAGGGATTGTGGTAA CAGGAGACAAAGCAGTCAACATATACACCTCATCTCAGACAGGGTCAATCATAGTC AAGTTACTCCCAAATATGCCCAAAGATAAAGAGGCGTGTGCAAAAGCCCCGTTGGA GGCGTACAACAGGACATTGACCACTTTGCTCACCCCCCTTGGTGATTCTATCCGTA GGATACAAGAGTCCGTGACCACATCTGGAGGAGGGAAACAAGGACGCCTTATAGGC GCCATTATCGGTGGTGCAGCTCTCGGGGTTGCAACCGCTGCACAGATAACAGCAGC CTCGGCT

(d) newcastle disease I system: F gene cracking site aminoacid sequence is RRQRRF, poison, gene III type, nucleotide sequence are AGGATCCCAGTACCTCTAATGCTGACCATACGGATCACGCTGGCACTGAGTTATGT CCGTCTGACAAGTTCTCTTGATGGCAGGCCTCTTGCAGCCGCAGGGATCGTGGTAA CAGGGGATAAAGCAGTTAACATATACACCTCATCCCAGACAGGGTCAATCATAGTC AAGTTACTCCCAAATATGCCCAAGGACAAAGAGGCATGTGCAAAAGCCCCATTGGA GGCTTACAACAGGACACTGACTACTTTGCTTACCCCCCTTGGTGATTCTATCCGCA GGATACAAGAGTCTGTGACTACATCCGGAGGAAGGAGACAGAGACGCTTTATAGGT GCCATTATTGGCAGTGTAGCTCTAGGGGTTGCAACAGCTGCACAGATAACGGCAGC CTCGGCT

6. newcastle disease virus according to claim 1 and vaccine virus difference diagnosis, the detection method that virulence and genotype are measured synchronously is characterized in that the threshold value of this specific information biology software differentiation newcastle disease virus and vaccine virus is:

(a) vaccine virus: with the few nucleotide of the highest standard newcastle disease living vaccine of homology variation be 0-4;

(b) doubtful vaccine virus: with the few nucleotide of the highest standard newcastle disease living vaccine of homology variation be 5-7;

(c) wild poison: with the few nucleotide of the highest standard newcastle disease living vaccine variation of homology greater than 7.

7. newcastle disease virus according to claim 1 and vaccine virus difference diagnosis, the detection method that virulence and genotype are measured synchronously, it is characterized in that this specific information biology software is by joining with standard Avian pneumo-encephalitis virus sequence homology connection, strain sequence to be measured is positioned, cut out the purpose fragment.

8. newcastle disease virus according to claim 1 and vaccine virus difference diagnosis, the detection method that virulence and genotype are measured synchronously, it is characterized in that this specific information biology software cutting F gene fragment 22-420, fragment 334-351, fragment 22-389 is respectively applied for the mensuration of nucleic acid variance, the judgement and the genotypic mensuration of peptide section virulence feature.

9. newcastle disease virus according to claim 1 and vaccine virus difference diagnosis, the detection method that virulence and genotype are measured synchronously, it is characterized in that this specific information biology software by setting the combination decision condition, solves vaccine virus and identifies the relation of judging contradiction with virulence.

10. newcastle disease virus according to claim 1 and vaccine virus difference diagnosis, the detection method that virulence and genotype are measured synchronously is characterized in that in the combination decision condition of the information biology software set that this is specific,

A) F gene cracking site sequence be in strong malicious sequence signature, and the virus to be measured that the nucleic acid variance is in the attenuated vaccine poison threshold range is accredited as doubtful vaccine virus, and is strong in the virulence;

B) F gene cracking site sequence can't be translated,, and the virus to be measured that the nucleic acid variance is in the attenuated vaccine poison threshold range is accredited as doubtful vaccine virus, virulence can't be measured;

C) the nucleic acid variance is in the virus to be measured in the poisoning vaccine virus threshold range, and no matter F gene cracking site sequence feature why all is accredited as vaccine virus, in the virulence;

D) other situation, the seedling poison is identified with the virulence result of determination and is carried out simple combination according to nucleic acid variance parameter and F gene cracking site sequence virulence parameter.

Images