CN1919871A - B7. 1-CD19scFv fusion gene engineering albumen for treating B lymphocyte leukemia and lymph tumour and use thereof - Google Patents

Abstract

The invention discloses a B7.1-CD19scFv merge gene engineering protein and usage to treat B lymphocyte leukosis, lymph tumor, which comprises the following parts: human B7.1 external cell area, antihuman CD19 monoclonal antibody heavy chain and light chain variable area gene.

Description

Be used for the treatment of bone-marrow-derived lymphocyte leukemia, lymphadenomatous B7.1-CD19scFv fusion gene engineering albumen and uses thereof

Technical field

The present invention relates to a kind of fusion gene engineering albumen, in particular for treatment bone-marrow-derived lymphocyte leukemia, lymphadenomatous B7.1-CD19scFv fusion gene engineering albumen and uses thereof.

Background technology

The cell-mediated immune response of tumour-specific T is the main means that body is removed tumour cell, and in normal immune response, T cells with antigenic specificity needs the stimulation of at least two signals just can breed and resist former generation immunne response.First signal is an antigen-specific, by TXi Baoshouti (TCR) and the antigenic MHC-I of binding specificity or the mediation of II quasi-molecule, second signal is the costimulatory molecules (as the B7 molecule) and T cell surface molecule (as CD28) reaction mediation by antigen presenting cell (APC) or other cell surface.Tumour cell is by reducing the immunosurveillance that participates in T cell recognition and antigen reactive developed by molecule, reduces approach escape bodies such as immunogenicity.Second signal deletion will cause the T cell to produce " immunity is incompetent ", thereby stop clone's property amplification of tumor specific cytotoxicity T cell (CTL).

Discover, tumor cell surface costimulatory molecules B7.1 (CD80) expresses reduction, the disappearance of this costimulatory molecules signal may be tumour cell escape immunosurveillance thereby can not cause immune response and the mechanism of activation tumour-specific T cell, change the B7.1 gene over to tumour cell with transgenic method, can improve the immunogenicity of tumour cell, cause the immune response that T is cell-mediated, make body not only can remove B7.1 ⁺Tumour cell, and can remove the primary tumor cell that does not have transfection B7.1.Discover that kidney tumor cell is that RCC-1 does not express B7.1, can not stimulate self T cell external, the RCC-1 cell behind the transfection B7.1 can be induced very strong self ctl response.These experimental results show that the expression of B7.1 has the potential of inducing tumor-specific immune response and immunotherapy of tumors.

The clinical treatment of acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL) and B cell lymphoma, mainly based on chemotherapy, curative effect is relatively poor at present, though can obtain temporary transient alleviation, lifetime is shorter.Therefore, reduce leukemic case fatality rate, improving Lymphocytic leukemia and lymphadenomatous methods of treatment is the emphasis that world medicine is being captured.Acute lymphoblastic leukemia (ALL) is the malignant clone proliferative disease, can cause a large amount of immature precursor lymphocytes body inner accumulated and infiltration, account for 20% of all children acutes leukemic 85% and adult's acute leukemia, accounting for 25% in all leukemia, is a kind of very common blood system malignant tumour.According to leukemia cell's immunophenotype, ALL patient can be divided into B-ALL or T-ALL two classes, wherein B cell ALL (B-ALL) ALL accounts for 70-80%.

Children ALL patient's clinical prognosis has obtained obvious improvement in recent years.But adult ALL patient's clinical efficacy is still relatively poor, and great majority can not obtain long-term disease free survival.Therefore carry out with comprehensive means such as chemotherapy, stem cell transplantation, immunotherapy and biotherapies in the ascendant with the research that improves patient's late result.Using gene engineering antibody carry out immunotherapy of tumors be current research focus it, the clinical application of biotechnology antibody-like Mabthera is that new situation has been started in the biological immune treatment of tumour, studies show that combined utilization Mabthera and chemotherapy can obviously improve B-ALL and B cell lymphoma (B-NHL) patient's clinical prognosis.The anti-CD19 of mouse source property * anti-CD3 single chain bispecific antibody has also entered clinical experimental stage.Show that immunotherapy is one of important means of treatment malignant lymphatic system illness.

Studies show that the immune costimulatory molecules B7.1 in ALL leukemia cell surface expresses and reduces, in addition lack as, cause the leukemia cell not killed and wounded by cytotoxic T cell (CTL) identification effectively.Because common expression of HLA-DR of B cell ALL and CD19 surface antigen, therefore, we start with from immunotherapy, utilize gene engineering method to make up, express the anti-CD19 single-chain antibody of B7.1-scFv and (see the applicant's patent application, 200410072713.5), utilize the surface markers of CD19 surface antigen, B7.1 is attached to ALL leukemia cell surface, make it to become antigen presenting cell as ALL leukemia cell.Immunotherapy mechanism with further discussion neoplastic hematologic disorder.

Summary of the invention

Technical problem to be solved by this invention is, a kind of bone-marrow-derived lymphocyte leukemia, lymphadenomatous B7.1-CD19scFv fusion gene engineering albumen of being used for the treatment of is provided, obtain a kind of new, can with bone-marrow-derived lymphocyte leukemia, lymphoma cell bonded activity expression product, and have special biologic activity.

In order to solve the problems of the technologies described above, the technical solution used in the present invention is: a kind of bone-marrow-derived lymphocyte leukemia, lymphadenomatous B7.1-CD19scFv fusion gene engineering albumen of being used for the treatment of, form by the expressed aminoacid sequence of the anti-B7.1 extracellular region gene shown in the SEQ ID NO.2 and anti-CD19 monoclonal antibody variable region of heavy chain and the expressed aminoacid sequence of chain variable region gene, and comprise and CD19 and CD28 specificity bonded active fragments.

Be used for the treatment of bone-marrow-derived lymphocyte leukemia, lymphadenomatous B7.1-CD19scFv fusion gene engineering albumen, the nucleotide sequence of aminoacid sequence is shown in SEQ ID NO.1 shown in the described SEQID NO.2.

The carrier that contains the nucleotide sequence of above-mentioned fusion gene engineering albumen contains the pMD-18T carrier of the cDNA of the nucleotide sequence shown in the SEQ ID NO.1.

Constructed carrier is pET22b (+).

The application in the medicine of preparation treatment acute and chronic B cell lymphocyte leukemia, B cell lymphoma of described B7.1-CD19scFv fusion gene engineering albumen or described carrier.

The invention has the beneficial effects as follows: the present invention has successfully prepared the B7.1-CD19scFv fusion gene engineering albumen; This albumen can combine with bone-marrow-derived lymphocyte leukemia, lymphoma cell binding specificity effectively; Can effectively mediate tumour cell in experiment in vitro stimulates the T cell activation, and secretion helps the cytokine of antineoplastic immune, promotes clone's property propagation of activation T, finally causes activating T cell specific killing tumour cell; Prolong the lifetime of tumor-bearing mice in animal body in the experiment effectively, have significant immunotherapy effect.This fusion rotein is used for clinical, will have therapeutic action to bone-marrow-derived lymphocyte leukemia, lymphoma.

Description of drawings

Fig. 1 is a pcr amplification B7.1 gene extracellular region fragment (M:Marker).

Fig. 2 is the anti-CD19-ScFv gene fragment agarose gel electrophoresis (M:Marker) of pcr amplification.

Fig. 3 is the B7.1-CD19scFv gene fragment agarose gel electrophoresis (M:Marker) of pcr amplification.

Fig. 4 a is a B7.1-CD19scFv gene nucleotide series synoptic diagram.

Fig. 4 b is expression vector pET22b (+)-B7.1-CD19scFv protein expression vector synoptic diagram.

Fig. 5 is comparison and the optimization that Rosetta (DE3)-pET22b (+)-B7.1-CD19scFv expresses.

Fig. 6 is that the Western blot of B7.1-CD19scFv analyzes (M:Marker).

Fig. 7 is cell soluble fractions 10%SDS-PAGE electrophoresis (M:Marker) behind different concns imidazoles (mmol/L) wash-out behind the B7.1-CD19scFv abduction delivering.

Fig. 8 is that B7.1-CD19 ScFv binding curve and Scatchard analyze.

Fig. 9 a suppresses experiment negative control group (AB serum+mouse IgG) for competitive immunization fluorescence.

Fig. 9 b suppresses experiment positive controls (HI19a+PBS) for competitive immunization fluorescence.

Fig. 9 c suppresses experimental group (B7.1-CD19-ScFv+HI19a) for competitive immunization fluorescence

Positive control group of Fig. 9 d and experimental group FACS overlay chart.

Figure 10 a is the T analysis of cell proliferation of B7.1-CD19scFv mediation.

Figure 10 b is the T cell proliferation rate of B7.1-CD19scFv mediation.

Figure 11 discharges for the cell IFN-γ of B7.1-CD19scFv mediation T.

Figure 12 is the CTL cytotoxic activity of B7.1-CD19scFv mediation.

Figure 13 is the therapeutic action research of B7.1-CD19scFv to the NOD/SCID tumor-bearing mice.

Embodiment

Below in conjunction with the drawings and specific embodiments to of the present inventionly be used for the treatment of the bone-marrow-derived lymphocyte leukemia, lymphadenomatous B7.1-CD19scFv fusion gene engineering albumen is described in further detail:

One, human from cell-surface antigens B7.1 gene clone

1. from the GenBank database of u.s. national library of medicine website (http://www.ncbi.nlm.nih.gov/entrez), search people B7.1 differentiation antigen cDNA sequence, by primer-design software primer 3 design primers.

The primer of amplification B7.1 extracellular region:

primer-sen：5’-ccg gaattcggtgttatccacgtgac-3’

EcoRI

antisen：5’-ccc aagctttgtattccagttgaagg-3’

Hind?III

2.RT-PCR amplifying human B7.1 gene

2.1 from the bone-marrow-derived lymphocyte of expressing B7.1, extract total RNA.

(1) get well-grown, can continuous release the hybridoma about 10 of anti-CD19 monoclonal antibody ⁶, add 1ml Trizol, the piping and druming mixing, room temperature left standstill 5 minutes.

(2) add the 0.2ml chloroform, thermal agitation 15 seconds, room temperature left standstill 2-3 minute.

(3) 12000rpm, 4 ℃, centrifugal 15 minutes.

(4) get supernatant, add 0.5ml Virahol room temperature and left standstill 15 minutes.

(5) 12000rpm, 4 ℃, centrifugal 15 minutes.

(6) abandon supernatant, the ethanol that adds 1ml75% is washed 7500rpm, 4 ℃, centrifugal 5 minutes.

(7) abandon supernatant, precipitation is dried, and adds the water dissolution RNA precipitation that 30 μ LDEPC handle, and surveys OD ₂₆₀, OD ₂₈₀Value is calculated OD ₂₆₀/ OD ₂₈₀Ratio, content and the purity of RNA in the estimation sample.Sample places-80 ℃ of preservations.

2.2 reverse transcription cDNA.

RT-PCR reverse transcription 20 μ l reaction systems:

1. following component is added in the little centrifuge tube of a nuclease free.

Random primer (Oligo (dT) _12-18) (500 μ l/ml) 1 μ l

Total RNA 2 μ g

10mM?dNTP?Mix 1μl

Mend H ₂O to 12 μ l

2. 65 ℃ of water-baths place on ice after 5 minutes fast, add following reagent in pipe

5×First-Strand?Bμffer 4μl

0.1M?DTT 2μl

RNase?Inhibitor(40μnits/μl) 1μl

3. mixing was hatched 2 minutes for 42 ℃.

4. add 1 μ l (200 μ nits) MMLV reversed transcriptive enzyme reversed transcriptive enzyme, 42 ℃ of mixings 50 minutes.

5. 70 ℃ of deactivations are 15 minutes, reactant be stored in-20 ℃ standby.

2.3PCR amplifying human B7.1 gene

Reaction system is 50 μ l

10×buffer 5μl

2.5mM?dNTPs 4μl

50mM?MgSO4 1μl

Primer?Sense(20pmol/μl) 1μl

Anti-sense(20pmol/μl) 1μl

Taq enzyme (5units/ μ l) 0.5 μ l

cDNA 1μl

ddH ₂O 36.5μl

50μl

Amplification condition: 94 ℃ of pre-sex change 5 minutes, 94 ℃ 30 seconds, 55 ℃ 1 minute, 72 ℃ 30 seconds, circulate 30 times, last 72 ℃ were extended 10 minutes.

3.PCR the phenol of product: chloroform extracting and purifying

In the 1.5ml Eppendorf tube PCR product is diluted to 400ul, adds the saturated phenol of equal-volume Tris: (v: v=1: 1), content makes it to become emulsion to chloroform in the mixing pipe, usefulness Eppendorf centrifuge centrifugal 1 minute in room temperature 12000rpm.With liquid-transfering gun water is transferred in another centrifuge tube.Discard two-phase interface and organic phase.Extracting is once once more to add isopyknic chloroform.Add 2 times of dehydrated alcohols, 0.1 times of volume 3M sodium-acetate, deposited 1 hour in-20 ℃, 4 ℃ centrifugal, and 12000rpm 5 minutes, abandons supernatant.Precipitation 1ml70% washing with alcohol; Centrifugal back is static to the ethanol volatilization, and sample is dissolved in 20ulddH ₂O.Get the 1ul sample in 1% agarose electrophoresis detection by quantitative.

4. the order-checking of recombinant plasmid

With the PCR product behind the purifying, connect in the pMD-18T carrier, through enzyme cut confirm to insert fragment correct after, positive bacterium colony 3ml is served the sea gives birth to worker bio-engineering corporation and carry out determined dna sequence, the sequence of announcing in sequencing result and the GenBank database is relatively more correct with the confirmation sequence.

The structure of two .B7.1-CD19scFv expressed sequences

1. design of primers:

According to the restriction enzyme mapping of prokaryotic expression carrier pET22b (+) and the cDNA sequence redesign primer of anti human CD 19 scFv and people B7.1 antigen extracellular region, introduce the His6 gene order at the N of fusion gene end.The interlinker dna sequence dna of recombinant protein is synthetic by Bo Ya biotech firm.Anti human CD 19 scFv can buy (Union Stem Cell ﹠ Gene Engineering Co.,Ltd) in market.

1) primer of amplification B7.1 extracellular region

primer-sen：5’-catg ccatggat catcatcatcatcatcatggtgttatccacgtgac-3’

NcoI (His) ₆

antisen：5’cgc ggatcctgtattccagttgaagg-3’

BamHI

2) primer of amplification anti human CD 19 scFv

primer-sen：5’-ccg gaattcgacattgtgctcacccagtctcca-3’

EcoRI

antisen：5’-ccc aagcttgtgaggagactgtgagagtggtgcc-3’

Hind?III

3) dna sequence dna of B7.1 and CD19scFv interlinker

linker?1(sense?chain)：

gatcccagaatgcgctattagttcgttacaccaagaaagtaccccaagtgtcaactg

linker?2(antisense?chain)：

aattcagttgacacttggggtactttcttggtgtaacgaactaatagcgcattctgg

2.PCR amplification

100 μ l reaction systems (in ice bath, mixing each reaction solution)

Template (having made up plasmid) 1 μ l (＜1ng)

10 * PCR reaction buffer (contains Mg ²⁺) 10 μ l

Upstream primer 2 μ l (25pmol)

Downstream primer 2 μ l (25pmol)

DNTP (every kind of each 2.5mM of dNTP) 8 μ l

Pyrobest ^TMArchaeal dna polymerase (5U/ μ l) 1 μ l

Distilled water is mended to final volume 100 μ l

Reaction conditions: 94 ℃ of pre-sex change 5min, 94 ℃ of 30sec of sex change, 57 ℃ of 1min of annealing, 72 ℃ of 1min of extension; 30 circulations: last 72 ℃ are extended 7min.Get 5 μ l samples, 1% agarose gel electrophoresis detects amplification.

The results are shown in Figure 1, Fig. 2, Fig. 3.

The structure of (3.pET22b+)-B7.1-CD19 scFv recombinant protein expression vector

The pET22b empty carrier is connected into interlinker after with BamHI and EcoRI double digestion and purifying.Constitute general plasmid.Again gained PCR product is connected into the corresponding restriction enzyme site of general plasmid respectively behind NcoI and BamHI, EcoRI and HindIII double digestion, is assembled into pET22b (+)-B7.1-CD19scFv recombinant protein expression vector.

The results are shown in Figure 4.

4.B7.1-CD19scFv a small amount of abduction delivering and the evaluation of engineered protein

PpET22b (+) B7.1-CD19scFv recombinant protein expression vector after the assembling is transformed DH5 α bacterium, the correct bacterial strain of order-checking reading frame of learning from else's experience prepares plasmid in a small amount, transforms Rosetta (DE3), (two resistance LB of inoculation same culture conditions, 3mL), 37 ℃ of shaking culture are to OD ₆₀₀Be about 0.6, add inductor IPTG (final concentration 1mM) at a pipe and continue to induce that another pipe is induced contrast as non-, continues to cultivate 3～4 hours.Respectively get the centrifugal back of 200 μ l bacterium liquid and add 100 μ LSDS-PAGE sample-loading buffers in the precipitation thalline, with each cellular constituent 20 μ l, 100 ℃ of water-baths 5 minutes are carried out SDS-PAGE electrophoresis protein electrophoresis and are analyzed (gel strength 10%).Further with Western blot checking, concrete grammar reference molecule clone is (His) on anti-and the anti-B7.1-CD19scFv recombinant protein with anti-His-tag antibody (IgG) wherein ₆The label combination is carried out Western blot reaction experiment proof recombinant plasmid pET22b (+)-B7.1-CD19scFv and induced expression of recombinant proteins through IPTG in intestinal bacteria, and the 1398bp fragment expression goes out the band (His) of about 65Kd ₆Recombinant protein.

The results are shown in Figure 5, Fig. 6.

Three, a large amount of abduction deliverings of B7.1-CD19scFv engineered protein

1) from the fresh picking mono-clonal the plate flat board of drawing, insert 5ml and contain in the SOC substratum of 200 μ g/ml penbritins and 34 μ g/ml paraxin, 37 ℃, the 250rpm shaking culture is to OD ₆₀₀Be 0.2～0.6.

2) (1000g 5min), removes supernatant to centrifugal collection thalline, is resuspended in the fresh SOC substratum that contains 200 μ g/ml penbritins and 34 μ g/ml paraxin of 200ml, and 37 ℃, 250rpm shaking culture are to OD ₆₀₀Be 0.2～0.6.

3) (1000g 10min), removes supernatant to centrifugal collection thalline, is resuspended in the fresh SOC substratum that contains 300 μ g/ml penbritins and 34 μ g/ml paraxin of 2000ml, and 37 ℃, 250rpm shaking culture are to OD ₆₀₀Be 0.2～0.6.

4) with the centrifugal collection thalline of 250ml plastics Centrifuge Cup (1000g, 10min), remove supernatant, be resuspended in the fresh TB substratum that contains 300 μ g/ml penbritins and 34 μ g/ml paraxin of 2000ml, add inductor IPTG (final concentration 1mM), 37 ℃, 250rpm shaking culture 3.5h.

5) with 250ml plastics Centrifuge Cup centrifugal collection thalline (4000g, 10min).

Four, the purifying of B7.1-CD19scFv engineered protein and ultrafiltration and concentration

1) bacterial sediment of collecting is resuspended in 50mmol/LTris-HCl, 100mmol/LNaCl, the pH8.0 dissolving of 1/30 volume of culture precooling.Ultrasonication bacterium behind the multigelation 3 times (ultrasonic 30 seconds/cooling 1 minute/150 watts/8 times), 4 ℃, centrifugal 20 minutes of 14000g.

2) supernatant is transferred in the new pipe of another, with 0.45 μ m membrane filtration.

3) use 10ml binding buffer liquid balance columns behind the deionization washing post with 10ml.

4) the supernatant upper prop after will filtering, the adjustment flow velocity is 10ml/h.

5) wash post with the binding buffer liquid of 10ml.

6) wash post with the lavation buffer solution (10mM imidazoles) of 10ml.

7) elutriant that contains the 25mM imidazoles with 10ml is washed post.

8) with the elution buffer eluted protein successively of 5ml concentration higher (10mM, 25mM, 50mM, 75mM, 100mM, 150mM and 200mM).

9) albumen with 20 μ l equal portions carries out the 10%SDS-PAGE electrophoresis, proteic distribution of analysis purposes and purity.

10) elutriant with purity of protein＞90% dilutes with PBS, and by 10, the albumen ultra-filtration membrane of 000MW dilutes the concentration＜1mM of desalination to NaCl repeatedly, and protein concentrate to 150 μ g/ml.

11) with the membrane filtration degerming of spissated albumen by 0.22 μ m, packing and frozen with-20 ℃.

The results are shown in Figure 7.

Five, B7.1-CD19scFv engineered protein determination of activity---the mensuration of binding constant

1) adding 100 μ l CD19 expression male leukemia cell in 96 hole enzyme plates is the NALM-6 cell pyrolysis liquid, and 37 ℃ of bags were by 2 hours;

2) get rid of coating buffer, wash 3 times, add and get rid of deblocking liquid after confining liquid (PBS contains 3% bovine serum albumin, 10% sheep blood serum) seals 2h, PBS washing 3 times with PBS (containing 0.05%Tween-20).

3) same form two holes add the B7.1-CD19scFv of 1: 3 doubling dilution of 100 μ l, and the bovine serum albumin solution with 3% compares, and hatch 2h for 37 ℃.

4) remove behind the reaction solution with PBS washing three times, add anti-His-tag monoclonal antibody (dilution in 1: 2000,0.1 μ g/ml) and hatch 2h for 37 ℃.

5) get rid of first antibody solution, the PBS back of giving a baby a bath on the third day after its birth time adds horseradish peroxidase sheep anti-mouse igg (dilution in 1: 1000), hatches 2h for 37 ℃.

6) get rid of dereaction liquid, after PBS gives a baby a bath on the third day after its birth time, add colour developing liquid (OPD, H ₂O ₂) react about 10 minutes with 2N H ₂SO ₄Termination reaction, (Vamed Engineering Austria) measures each hole OD with microplate reader _492nmLight absorption value.The absorbance value of each B7.1-CD19scFv concentration is got average.

7) dissociation constant is calculated: with data substitution Δ A=Δ A _MAX* L/ (Kd+L) is Δ A=-Kd * Δ A/L-Δ A _MAX(Δ A is OD value poor of experimental group and control group, and L is the concentration of the B7.1-CD19scFv of the reorganization that adds.Regression analysis, computational solution is from constant K d value.

The results are shown in Figure 8.

Six, the B7.1-CD19scFv engineered protein is got the NALM-6 cell, is made 1 * 10 in conjunction with determination of activity-competition inhibition test ⁶/ ml cell suspension, application of sample is in 40 porocyte culture plates, 5 * 10 ⁵Cells/well.Negative control group adds 100 μ ll people AB serum, hatches 1h for 4 ℃, 3000rpm, and 4 ℃ of centrifugal 8min abandon supernatant liquor, and PBS washes cell 2 times, adds mouse source property IgG20 μ l (1mg/ml); Positive controls adds anti-CD19 monoclonal antibody HI19a working fluid 20 μ l in the sealing of people AB serum after 1 hour; Test group adds 100 μ l B7.1-CD19ScFv earlier after adding the sealing of people AB serum, hatch 1h for 4 ℃, 3000rpm, 4 ℃ of centrifugal 8min, abandon supernatant liquor, PBS washes cell 2 times, adds anti-CD19 monoclonal antibody HI19a 20 μ l (1mg/ml) again, hatches 1h for 4 ℃, 3000rpm, 4 ℃ of centrifugal 8min abandon supernatant liquor, and PBS washes cell 2 times.Three groups of cells are resuspended in respectively among the PBS, add 20 μ l sheep anti-mouse igg-FITC two and resist, and hatch 45min for 4 ℃, the unconjugated fluorescence antibody of PBS flush away, and flow cytometer detects monoclonal antibody HI19a and NALM-6 clone bonded positive rate.

The results are shown in Figure 9.

Seven, mtt assay is measured B7.1-CD19scFv promotion T cell-proliferation activity

1) therefrom healthy donor peripheral blood is got at the painstaking effort station, joins the detection of type test kit through HLA and is HLA*0201 ⁺The person is used for experiment.Ficoll separates, and obtains mononuclearcell (MNCs), and the plastic culture bottle is adherent to spend the night, and obtains the lymphocyte of suspension growth.RPMI-1640 washing 2 times is with 1640 adjustment target cell concentration to 1 * 10 that contain 10%FCS ⁶/ ml.Experimental group and each hole of corresponding control group add 200 μ l (2 * 10 ⁵/ hole).

2) 2500cGy caesium source (C _S137) irradiation NALM-6 cell (HLA*0201 ⁺), RPMI-1640 washing 2 times is with 1640 adjustment target cell concentration to 2.5 * 10 that contain 10%FCS ⁶, experimental group and each hole of corresponding control group add 20 μ l (5 * 10 ⁴/ hole).

3) each hole of experimental group (three multiple holes) adds the B7.1-CD19scFv of 1: 2 doubling dilution of 20 μ l, and its final concentration is respectively 6,3,1.5,0.75 μ g/ml.

4) control group (three multiple hole) is 240 μ l peripheral blood mononuclear cell or through NALM-6 (the CD19 positive, CD80 feminine gender, the HLA*0201 of caesium source irradiation ⁺) cell.

5) at 37 ℃, cultivate 58h under the 5%CO2 saturated humidity condition, add MTT (concentration is 5mg/ml, Fluka company product) 20 μ l, 37 ℃, 4h abandons supernatant, adds dimethyl sulfoxide (DMSO) (DMSO) 200 μ l mixings.The absorbancy (A) that detects the 570nm place with microplate reader is worth, and PI calculates with following formula:

PI=(A _{Experimental port}-A _{The NALM-6 cell hole})/A _{The lymphocyte hole}

The results are shown in Figure 10a and Figure 10 b.

Eight, it is active that the ELISA method is measured B7.1-CD19scFv promotion human T-cell IFN-γ release

ELISA test kit (available from brilliant U.S. biological) is pressed the test kit description operation.

1) preparation of sample to be tested, with embodiment seven steps 1 and step 2 preparation lymphocyte and NALM-6 cell, PBS group, CD19scFv (40 μ g/ml) group and B7.1-CD19scFv organize (80 μ g/ml) by PBLC: NALM-6=5: 1 cultivates 96h altogether, the centrifugal collection supernatant of difference is as sample to be measured.

2) concentrated cleaning solution, standard substance, standard substance diluent, sealing lath are taken out room temperature temperature in advance from refrigerator.

3) preparation standard product: add the standard substance diluent to the freeze-drying standard substance, treat thoroughly dissolving after, leave standstill 15min mixing (concentration is that 10000pg/ props up), be diluted to 2000,1000,500,250,125,62.5,31.25 and 0pg/ml).

4) concentrated cleaning solution is diluted (1: 20) with distilled water.

5) except that blank well, the standard substance with sample or different concns add in the respective aperture respectively, seal reacting hole with the shrouding gummed paper, and 37 ℃ of incubators are hatched 90min.

6) prepare the biotinylated antibody working fluid: with biotinylated antibody diluted concentrated biological elementization antibody (1: 200).

7) wash plate 5 times, 350 μ l/ holes.

8) except that blank well, add biotinylated antibody working fluid 100 μ l/ holes, seal reacting hole with the shrouding gummed paper, 37 ℃ of incubators are hatched 60min.

9) prepare the enzyme conjugates working fluid: concentrate enzyme conjugates (1: 200) with the enzyme conjugates diluted.

10) wash plate 5 times, 350 μ l/ holes.

11) add developer 100 μ l/ holes, 37 ℃ of lucifuges are hatched 8～10min (looking the colour developing depth grasps flexibly).

12) add stop buffer 100 μ l/ holes, microplate reader 450nm wavelength measurement absorption value (OD450) in the 5min behind the mixing.

13) draw typical curve, on typical curve, find its concentration by the OD value of sample.

The results are shown in Figure 11.

Nine, the extracorporeal biology activity of B7.1-CD19scFv engineered protein (CTL activity)

1) lymphocytic preparation: therefrom healthy donor peripheral blood is got at the painstaking effort station, joins the detection of type test kit through HLA and is HLA*0201 ⁺The person is used for experiment.Ficoll separates, and obtains mononuclearcell (MNCs), and the plastic culture bottle is adherent to spend the night, and obtains the lymphocyte of suspension growth.

2) lymphocytic induce propagation, the activation

A.2500cGy caesium source (Cs ₁₃₇) irradiation NALM-6 cell, RPMI-1640 is standby after washing 2 times.

The NALM-6 that b.PBS group, CD19scFv group and B7.1-CD19scFv group are got step a preparation respectively is thin by 2.4 * 10 ⁶

C. add 1ml PBS, CD19scFv (40 μ g/ml) and B7.1-CD19scFv (80 μ g/ml) respectively in each group.

D. add 1.2 * 10 respectively in each group ⁷Lymphocyte adds 10 μ l recombinant human il-2s (500,000 U/ml), adjusts and respectively organizes final volume to 10ml (CD19scFv final concentration 4 μ g/ml, 80CD-CD19scFv final concentration 8 μ g/ml recombinant human il-2 final concentration 50U/ml).

E. put 37 ℃, 5%CO2, the saturated humidity incubator is hatched 108h.The centrifugal 15min of 800rpm collects lymphocyte, and RPMI-1640 washing 2 times is adjusted target cell concentration to 5 * 10 with 1640 ⁶/ ml.

3) target cell preparation: the centrifugal 10min of 1000rpm collects NALM-6 and MCF-7 (CD19 feminine gender, the HLA*0201 of logarithmic phase ⁺), RPMI-1640 washing 2 times is adjusted target cell concentration to 5 * 10 with 1640 ⁵/ ml.

4) 96 orifice plates are provided with following control group and experimental group (three multiple holes) at the bottom of U:

A. the effector cell discharges naturally

B. experimental group: imitate in different: the target ratio (50: 1,25: 1,12.5: 1 and 6.3: 1) add effector cell 20 μ l, target cell 80 μ l are in 96 well culture plates.

C. target cell discharges naturally

D. target cell is maximum discharges

E. volume correction

F. nutrient solution background

Put 37 ℃, 5%CO ₂, the saturated humidity incubator is hatched 4h.Shift to an earlier date 45 minutes and add 10 μ l, 10 * cell pyrolysis liquid in maximum release of target cell and volume correction hole.The centrifugal 4min of 1000rpm.

5) lactate dehydrogenase activity is measured

Method is with reference to Promega company product (CytoTox 96Non-Radioactive CytotoxityAssay) specification sheets.

A. transferase 45 0 μ l step 4 culture supernatant is to another new enzyme plate in 96 hole

B. the Assay Buffer that thaws gets 12ml Buffer dissolving LDH substrate

C. add 50 μ l LDH substrate to 96 hole enzyme plates, room temperature lucifuge reaction 20min

D. every hole adds 50 μ l 1M citric acid stop buffers and stops enzymatic reaction

E. microplate reader 492nm measures absorbancy (A ₄₉₂)

6) CTL is active calculates: calculate each group (3 multiple hole) mean light absorbency (A ₄₉₂), by the percentage of following formula calculating CTL cracking target cell.

The results are shown in Figure 12.

Ten, biologic activity in the body of B7.1-CD19scFv engineered protein

1) laboratory animal is prepared:

From Institute of Experimental Animals, Chinese Academy of Medical Sciences buy 20 4 the week age NOD/SCID mouse.The NOD/SCID mouse is accepted 150cGy caesium source (Cs137) irradiation after raising a week, is divided into A, B, C and D group at random, 5 every group.

2) lymphocyte preparation:

Therefrom healthy donor peripheral blood (HLA*0201 is got at the painstaking effort station ⁺), Ficoll separates, and obtains mononuclearcell (PBMCs), and the plastic culture bottle is adherent to spend the night, and obtains the lymphocyte (PLCs) of suspension growth.

3) respectively organize the NOD/SCID mouse is injected 200 μ l respectively by eye vein sinus the mixed suspension of following PBS:

A group: 3 * 10 ⁴The NALM-6 cell.

B group: 3 * 10 ⁴NALM-6 cell and 1 * 10 ⁷Injection immediately after PLCs is mixed.

C group: 3 * 10 ⁴The NALM-6 cell, 1 * 10 ⁷Injection immediately after PLCs and 7.5 μ g CD19scFv are mixed,

12h and 36h restock are injected 7.5 μ g CD19scFv (the CD19scFv total dose is 7.5 μ g * 3).

D group: 3 * 10 ⁴The NALM-6 cell, 1 * 10 ⁷Injection immediately after PLCs and 15 μ g B7.1-CD19scFv are mixed, 12h and 36h restock are injected 15 μ g B7.1-CD19scFv (the B7.1-CD19scFv total dose is 15 μ g * 3).

4) body weight change of close observation laboratory animal, symptom occurs and lifetime, curve plotting.Dissect dead mouse, the liver of weighing, spleen weight are to the capable experiment of liver, spleen, lung, marrow and spinal cord pathologic finding.

The results are shown in Figure 13.

SEQUENCE LISTING (sequence table)

＜110〉Inst. of Hematology, Chinese Academy of Medical Sciences

＜120〉be used for the treatment of bone-marrow-derived lymphocyte leukemia, lymphadenomatous B7.1-CD19scFv fusion gene engineering albumen and

Purposes

<160>2

<170>Patent?In?version?3.1

<210>1

<211>1398

<212>DNA

＜213〉people and mouse

<220>

＜221〉B7.1-CD19scFv gene

<222>(1)..(1398)

<400>1

ggtgttatcc?acgtgaccaa?ggaagtgaaa?gaagtggcaa?cgctgtcctg?tggtcacaat 60

gtttctgttg?aagagctggc?acaaactcgc?atctactggc?aaaaggaaaa?gaaaatggtg 120

ctgactatga?tgtctgggga?catgaatata?tggcccgagt?acaagaaccg?gaccatcttt 180

gatatcacta?ataacctctc?cattgtgatc?ctggctctgc?gcccatctga?cgagggcaca 240

tacgagtgtg?ttgttctgaa?gtatgaaaaa?gacgctttca?agcgggaaca?cctggctgaa 300

gtgacgttat?cagtcaaagc?tgacttccct?acacctagta?tatctgactt?tgaaattcca 360

acttctaata?ttagaaggat?aatttgctca?acctctggag?gttttccaga?gcctcacctc 420

tcctggttgg?aaaatggaga?agaattaaat?gccatcaaca?caacagtttc?ccaagatcct 480

gaaactgagc?tctatgctgt?tagcagcaaa?ctggatttca?atatgacaac?caaccacagc 540

ttcatgtgtc?tcatcaagta?tggacattta?agagtgaatc?agaccttcaa?ctggaataca 600

ggatcccaga?atgcgctatt?agttcgttac?accaagaaag?taccccaagt?gtcaactgaa 660

ttcgacattg?tgctcaccca?gtctccaaaa?ttcatgtcca?catcagtagg?agacagggtc 720

agcgtcacct?gcaaggccag?tcagaatgtg?ggtactaatg?tagcctggta?tcaacagaaa 780

ccaggacaat?ctcctaaacc?actgatttac?tcggcaacct?accggaacag?tggagtccct 840

gatcgcttca?caggcagtgg?atctgggaca?gatttcactc?tcaccatcac?taacgtgcag 900

tctaaagact?tggcagacta?tttctgtcaa?caatataaca?ggtatccgta?cacgtccgga 960

ggggggacca?agctggaaat?aaaacggggt?ggtggtggtt?ctggcggcgg?cggctccggt 1020

ggtggtggtt?ctcaggtcca?gctgcagcag?tctggggctg?agctggtgag?gcctgggtcc 1080

tcagtgaaga?tttcctgcaa?ggcttctggc?tatgcattca?gtagctactg?gatgaactgg 1140

gtgaagcaga?ggcctggaca?gggtcttgag?tggattggac?agatttatcc?tggagatggt 1200

gatactaact?acaatggaaa?gttcaagggt?caagccacac?tgactgcaga?caaatcctcc 1260

agcacagcct?acatgcagct?cagcggcctg?acatctgagg?actctgcggt?ctatttctgt 1320

gcaagaaaga?ctattagttc?ggtagtagat?ttctactttg?actactgggg?ccaaggcacc 1380

actctcacag?tctcctca 1398

<210>2

<211>466

<212>PRT

＜213〉people and mouse

<220>

<221>B7.1-CD19scFv?PEPTIDE

<222>(1)..(466)

<400>2

Gly?Val?Ile?His?Val?Thr?Lys?Glu?Val?Lys?Glu?Val?Ala?Thr?Leu?Ser

1 5 10 15

Cys?Gly?His?Asn?Val?Ser?Val?Glu?Glu?Leu?Ala?Gln?Thr?Arg?Ile?Tyr

20 25 30

Trp?Gln?Lys?Glu?Lys?Lys?Met?Val?Leu?Thr?Met?Met?Ser?Gly?Asp?Met

35 40 45

Asn?Ile?Trp?Pro?Glu?Tyr?Lys?Asn?Arg?Thr?Ile?Phe?Asp?Ile?Thr?Asn

50 55 60

Asn?Leu?Ser?Ile?Val?Ile?Leu?Ala?Leu?Arg?Pro?Ser?Asp?Glu?Gly?Thr

65 70 75 80

Tyr?Glu?Cys?Val?Val?Leu?Lys?Tyr?Glu?Lys?Asp?Ala?Phe?Lys?Arg?Glu

85 90 95

His?Leu?Ala?Glu?Val?Thr?Leu?Ser?Val?Lys?Ala?Asp?Phe?Pro?Thr?Pro

100 105 110

Ser?Ile?Ser?Asp?Phe?Glu?Ile?Pro?Thr?Ser?Asn?Ile?Arg?Arg?Ile?Ile

115 125 125

Cys?Ser?Thr?Ser?Gly?Gly?Phe?Pro?Glu?Pro?His?Leu?Ser?Trp?Leu?Glu

130 135 140

Asn?Gly?Glu?Glu?Leu?Asn?Ala?Ile?Asn?Thr?Thr?Val?Ser?Gln?Asp?Pro

145 150 155 160

Glu?Thr?Glu?Leu?Tyr?Ala?Val?Ser?Ser?Lys?Leu?Asp?Phe?Asn?Met?Thr

165 170 175

Thr?Asn?His?Ser?Phe?Met?Cys?Leu?Ile?Lys?Tyr?Gly?His?Leu?Arg?Val

180 185 190

Asn?Gln?Thr?Phe?Asn?Trp?Asn?Thr?Gly?Ser?Gln?Asn?Ala?Leu?Leu?Val

195 200 205

Arg?Tyr?Thr?Lys?Lys?Val?Pro?Gln?Val?Ser?Thr?Glu?Phe?Asp?Ile?Val

210 215 220

Leu?Thr?Gln?Ser?Pro?Lys?Phe?Met?Ser?Thr?Ser?Val?Gly?Asp?Arg?Val

225 230 235 240

Ser?Val?Thr?Cys?Lys?Ala?Ser?Gln?Asn?Val?Gly?Thr?Asn?Val?Ala?Trp

245 250 255

Tyr?Gln?Gln?Lys?Pro?Gly?Gln?Ser?Pro?Lys?Pro?Leu?Ile?Tyr?Ser?Ala

260 265 270

Thr?Tyr?Arg?Asn?Ser?Gly?Val?Pro?Asp?Arg?Phe?Thr?Gly?Ser?Gly?Ser

275 280 285

Gly?Thr?Asp?Phe?Thr?Leu?Thr?Ile?Thr?Asn?Val?Gln?Ser?Lys?Asp?Leu

290 295 300

Ala?Asp?Tyr?Phe?Cys?Gln?Gln?Tyr?Asn?Arg?Tyr?Pro?Tyr?Thr?Ser?Gly

305 310 315 320

Gly?Gly?Thr?Lys?Leu?Glu?Ile?Lys?Arg?Gly?Gly?Gly?Gly?Ser?Gly?Gly

325 330 335

Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Gln?Val?Gln?Leu?Gln?Gln?Ser?Gly

340 345 350

Ala?Glu?Leu?Val?Arg?Pro?Gly?Ser?Ser?Val?Lys?Ile?Ser?Cys?Lys?Ala

355 360 365

Ser?Gly?Tyr?Ala?Phe?Ser?Ser?Tyr?Trp?Met?Asn?Trp?Val?Lys?Gln?Arg

370 375 380

Pro?Gly?Gln?Gly?Leu?Glu?Trp?Ile?Gly?Gln?Ile?Tyr?Pro?Gly?Asp?Gly

385 390 395 400

Asp?Thr?Asn?Tyr?Asn?Gly?Lys?Phe?Lys?Gly?Gln?Ala?Thr?Leu?Thr?Ala

405 410 415

Asp?Lys?Ser?Ser?Ser?Thr?Ala?Tyr?Met?Gln?Leu?Ser?Gly?Leu?Thr?Ser

420 425 430

Glu?Asp?Ser?Ala?Val?Tyr?Phe?Cys?Ala?Arg?Lys?Thr?Ile?Ser?Ser?Val

435 440 445

Val?Asp?Phe?Tyr?Phe?Asp?Tyr?Trp?Gly?Gln?Gly?Thr?Thr?Leu?Thr?Val

450 455 460

Ser?Ser

465

Claims (5)

1, a kind of bone-marrow-derived lymphocyte leukemia, lymphadenomatous B7.1-CD19scFv fusion gene engineering albumen of being used for the treatment of, it is characterized in that forming, and comprise and CD19 and CD28 specificity bonded active fragments by the expressed aminoacid sequence of the anti-B7.1 extracellular region gene shown in the SEQ ID NO.2 and anti-CD19 monoclonal antibody variable region of heavy chain and the expressed aminoacid sequence of chain variable region gene.

2, bone-marrow-derived lymphocyte leukemia, the lymphadenomatous B7.1-CD19scFv fusion gene engineering albumen of being used for the treatment of according to claim 1, the nucleotide sequence that it is characterized in that aminoacid sequence shown in the described SEQ ID NO.2 is shown in SEQ ID NO.1.

3, the carrier that contains the nucleotide sequence of coding claim 1 described fusion gene engineering albumen is characterized in that containing the pMD-18T carrier of the cDNA of the nucleotide sequence shown in the SEQ ID NO.1.

4, carrier according to claim 3 is characterized in that constructed carrier is pET22b (+).

5, according to the application of each described carrier in each described B7.1-CD19scFv fusion gene engineering albumen or the claim 3,4 in the claim 1,2 in the medicine of preparation treatment acute and chronic B cell lymphocyte leukemia, B cell lymphoma.

Images