CN1882553A - Phenylacetic acid derivative, process for producing the same, and use - Google Patents

Phenylacetic acid derivative, process for producing the same, and use Download PDF

Info

Publication number
CN1882553A
CN1882553A CN 200480033842 CN200480033842A CN1882553A CN 1882553 A CN1882553 A CN 1882553A CN 200480033842 CN200480033842 CN 200480033842 CN 200480033842 A CN200480033842 A CN 200480033842A CN 1882553 A CN1882553 A CN 1882553A
Authority
CN
China
Prior art keywords
phenyl
acetate
compound
oxyethyl group
methyl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 200480033842
Other languages
Chinese (zh)
Inventor
楠田晋也
中山孝介
田嵨久男
坂元孝彦
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ono Pharmaceutical Co Ltd
Original Assignee
Ono Pharmaceutical Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ono Pharmaceutical Co Ltd filed Critical Ono Pharmaceutical Co Ltd
Publication of CN1882553A publication Critical patent/CN1882553A/en
Pending legal-status Critical Current

Links

Landscapes

  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to the compound represented by formula (I) (wherein R 1 and R 2 is hydrogen atom, C1-8 alkyl etc.; R 3 is C1-8 alkyl which may be substituted with 1 to 3 halogen atom(s), phenyl; R 4 is hydrogen atom etc. ; R 5 and R 6 is hydrogen atom, CI-8 alkyl etc.; X is sulfur atom or oxygen atom etc.; ringA is cyclic group which may have a substituent(s).), or a salt thereof Toxicity of the compound represented by formula (I) is very low, and it is safe enough to use as a pharmaceutical agent and since it has PPAR ' agonistic activity, it is useful as preventive and/or therapeutic agent for glucose lipid metabolic disorder, hypertension, circulatory diseases etc.

Description

Phenylacetic acid derivatives, its production method and purposes
Technical field
The present invention relates to can be used for treating phenylacetic acid derivatives, its preparation and its purposes of hyperlipemia etc.
Background technology
Recently, with adipocyte differentiation in sign genetic expression induce in the relevant transcription factor research, peroxisome proliferation-activated receptors (below be abbreviated as PPAR) arouses attention, it is a kind of of intranuclear receptor.From the cDNA of various animal cloning PPAR, find multiple isoform gene, particularly in Mammals known have three kinds of isoform types (α, δ, γ) (referring to J.Steroid Biochem.Molec.Biol., 51, 157 (1994); Gene Expression., 4, 281 (1995); Biochem Biophys.Res.Commun., 224, 431 (1996); Mol.Endocrinology., 6,1634 (1992)).And then, known PPAR γ isoform is mainly expressed in fatty tissue, immunocyte, suprarenal gland, spleen, small intestine, and PPAR α isoform is mainly expressed in fatty tissue, liver, retina, and PPAR δ isoform is generally expressed, there is not tissue specificity (referring to Endocrinology. 137, 354 (1996)).
In passing, tetrahydrothiazole derivates, for example pioglitazone, Xi Gelie ketone, rosiglitazone, troglitazone etc. are the medicines that becomes known for treating non insulin dependent diabetes (NIDDM), are to be used to improve the hyperglycemic Hypoylycemic agents of diabetic subject.They also effectively improve or correct hyperinsulinemia, improve glucose tolerance and blood lipid reducing, so they are considered to the medicine that improves insulin resistance (insulin resistance) quite likely.
In addition, one of intracellular target protein of these tetrahydrothiazole derivates is PPAR γ just, and conclude they strengthen the transcriptional activity of PPAR γ (referring to Endocrinology., 137, 4189 (1996); Cell., 83, 803 (1995); Cell., 83, 813 (1995); J. Biol.Chem., 270, 12953 (1995)).Therefore, the PPAR γ activator (agonist) that strengthens its transcriptional activity is considered to Hypoylycemic agents likely and/or lipid-lowering agent.In addition, because expression (the Genes ﹠amp of the known promotion of PPAR gamma agonist PPAR γ albumen itself; Development., 10, 974 (1996)), the medicine and the PPAR γ activator that increase the expression of PPAR γ albumen itself also are considered to useful clinically.Intracellular receptor PPAR γ relate to adipocyte differentiation (referring to J.Biol.Chem., 272, 5637 (1997) and Cell., 83, 803 (1995)).The tetrahydrothiazole derivates of this acceptor of known activation promotes the adipocyte differentiation.Recently, it is reported that tetrahydrothiazole derivates increases body fat, cause the people to increase weight, the obesity that becomes (referring to Lancet., 349, 952 (1997)).In view of these, PPAR γ activator (agonist) and can increase PPAR γ that protein itself expresses and express conditioning agent and have hypoglycemic effect, reducing blood-fat effect, expection can be used as and prevent and/or treat such as the glucose lipid metabolic disturbance (medicine of diabetes, hyperlipidaemia (hypercholesterolemia, low HDL (high-density lipoprotein (HDL))-cholesteremia, height-LDL (low-density lipoprotein)-cholesteremia, hypertriglyceridaemia etc.), atherosclerosis, cardiovascular disorder, hypertension, circulatory diseases etc. for example.
In addition, shellfish specialization compound (fibrate compound) (for example chlorine Bei Te (chlogibrate)) is known lipid-lowering agent.One of intracellular target protein of shellfish specialization compound also conclude be PPAR α (referring to Nature., 347, 645 (1990); J.Steroid Biochem.Molec.Biol., 51, 157 (1994); Biochemistry., 32, 5598 (1993)).Therefore in view of these facts, the PPAR alpha modulators is considered to have the reducing blood-fat effect, expects that they can be used as the medicine that prevents and/or treats hyperlipidaemia etc.
In addition, it is reported that recently PPAR α possesses anti-obesity activity (referring to WO 97/36579).In addition, it is reported the metabolism stimulatory effect of lipid (cholesterol, HDL, LDL and triglyceride level etc.) be subjected to the inducing of PPAR alfa agonists (referring to J.Lipid Res., 39, 17 (1998)).That is to say, it is reported that they have the effect of high density lipoprotein increasing (HDL) cholesterol and the effect of reduction low-density lipoprotein (LDL) cholesterol, vldl (VLDL) cholesterol and triglyceride level.It is reported that also the bezafibrate administration improves composition, hypertension and the insulin resistance of lipid acid in blood, it be shellfish specialization compound a kind of (referring to Diabetes., 46, 348 (1997)).Therefore, owing to activate the agonist of PPAR α and promote the PPAR alpha modulators of PPAR α albumen expression itself to have the reducing blood-fat effect, they are medicines that treat and/or prevent lipidosis (for example hyperlipidaemia (hypercholesterolemia, low-the HDL-cholesteremia, height-LDL-cholesteremia, hypertriglyceridaemia etc.), atherosclerosis, cardiovascular disorder, obesity, metabolism syndrome etc.), hypertension, circulatory diseases etc. likely.
On the contrary, PPAR δ is called as PPAR β sometimes, perhaps is also referred to as NUC1 in the mankind.Up to now, about the activity of PPAR δ, the transcriptional activity (referring to WO 9604130) that hNUC1B (structure is different from the PPAR hypotype of people NUC1 on an amino acid) suppresses people PPAR α and Thyroid Hormone Receptors was disclosed.Recently, it is reported and found PPAR δ albumen is possessed high-affinity and may significantly activate the compound (being agonist) of PPAR δ, they have the active and non-HDL cholesterol levels-reduction effect of HDL (high-density lipoprotein (HDL)) cholesterol levels-rising (referring to WO 9728149, WO 0100603, Proc.Natl.Acad.Sci.USA. 98, 5306 (2001)).The result is that scavenger cell is introduced oxidized LDL, their foam occurs, and they are deposited in the blood vessel endothelium, cause the lipid metabolism disease.Therefore, the agonist that can activate PPAR δ reduces foam cell by HDL cholesterol levels-rising effect and LDL cholesterol levels-reduction effect, expects that therefore they can be used for preventing and/or treating lipidosis (for example hyperlipidaemia (hypercholesterolemia, low-the HDL-cholesteremia, height-LDL-cholesteremia, hypertriglyceridaemia etc.), atherosclerosis, cardiovascular disorder, obesity, metabolism syndrome etc.), hypertension, circulatory diseases etc.
Recently, it is reported that the activation of PPAR δ increases oxidation of fatty acids, especially in skeletal muscle (referring to Proc.Natl.Acad.Sci.USA., 100, 15924 (2003)).This also points out the PPAR delta agonists to can be used for improving lipidosis and treatment is fat.
The activation of PPAR δ not only has influence to lipidosis, and promotes Keratinocytic cytodifferentiation, participates in skin texture keeping as the organism barrier function.Someone observe in PPAR δ-deficient mice of handling with TPA (12-O-myristoyl phorbol-13-acetic ester) hyperplasia that skin takes place sexually revise (referring to Mol.Cell Biol., 20, 5119 (2000)).In addition, the someone show it to skin inflammation have anti-inflammatory activity (referring to J.Invest.Dermatol., 122, 971 (2004)).Therefore, the PPAR delta agonists can be used for preventing and/or treating inflammatory disease of the skin (for example dermatitis (atopic dermatitis etc.), erythralgia, itch etc.), and expection has the effect of wound (for example burn, wound etc.) treatment adjuvant drug.In addition, the someone observe in PPAR δ-deficient mice take place the corpus callosum myelin coat obstacle (referring to Mol.Cell Biol., 20, 5119 (2000)), the PPAR delta agonists has the possibility that prevents and/or treats the agent use as some sacred disease.
But, it is reported that the some drugs in the PPAR gamma agonist causes hepatopathy, need careful use as medicine.In addition, the liver toxicity side effect derives from the thiazolidine structure by inference, but does not report that any structure compound really avoids liver toxicity.Seeking to avoid toxic structure is very useful for exploitation PPAR agonist.
On the contrary, the compound of representing by formula (A)
(A wherein 1AIt is C1-4 alkylidene group etc.; A 2ABe-O-; A 3ABe CH etc.; NA is 1 to 5; R 1ABe halogen atom, trihalogenmethyl, three halogen methoxyl groups etc.; R 2ABe C1-4 alkyl, trihalogenmethyl etc.; Cyc1 ABe 1, the inferior thiazolyl, 1 of 3-, the inferior  azoles of 3-base etc.; Cyc2 ABe carbocyclic ring, heterocycle etc.; R 3ABe hydrogen atom, C1-8 alkyl etc.; R 4ABe-A 4A-CR 8AR 9A-COOR 7A(A wherein 4AIt is singly-bound; R 7A, R 8A, R 9ABe hydrogen atom, C1-4 alkyl) etc.) the known PPAR of can be used as conditioning agent (referring to WO9946232).
Summary of the invention
Problem of the present invention is the PPAR agonist of exploitation safety, and they can be used as preventing and/or treating of hyperlipidaemia etc., and have reduced side effect.
At the problems referred to above, the inventor has carried out further research, found that the compound of being represented by following formula (I) in by the compound of above-mentioned formula (A) representative has extremely low toxicity, and they especially can avoid liver toxicity, thereby have finished the present invention.
That is to say, the present invention relates to following:
1. by the compound of formula (I) representative
R wherein 1And R 2Represent hydrogen atom independently of one another, C1-8 alkyl, halogen atom, C1-4 alkoxyl group, nitro, trihalogenmethyl, three halogen methoxyl groups, three halogen methylthio groups, cyano group, C1-4 alkylthio or NR 7R 8(R wherein 7And R 8Represent hydrogen atom or C1-4 alkyl independently of one another); R 3Representative can be by the C1-8 alkyl or the phenyl of 1-3 halogen atom replacement; R 4Represent hydrogen atom or C1-8 alkyl; R 5And R 6Represent hydrogen atom or C1-4 alkyl, perhaps R independently of one another 5And R 6Can constitute carbocyclic ring with they adjacent carbon atoms; On behalf of sulphur atom, Sauerstoffatom, X maybe can have one or more substituent nitrogen-atoms; Ring A representative can have one or more substituent cyclic groups,
Its salt or its solvate or its prodrug,
2. according to above-mentioned 1 compound, wherein the cyclic group by ring A representative is 4-(trifluoromethyl) phenyl, 4-(trifluoromethoxy) phenyl, 4-(trifluoromethyl) piperidines-1-base, 2,2-two fluoro-1,3-benzodioxole-5-base, 4-Phenylpiperidine-1-base, 4-phenylpiperazine-1-base, 1,3-dihydro-2H-isoindole-2-base, 4-(4-chloro-phenyl-) piperazine-1-base or 3,4-dihydro-1H-isoquinoline 99.9-2-base
3. according to above-mentioned 2 compound, wherein the cyclic group by ring A representative is 4-(trifluoromethyl) piperidines-1-base, 2,2-two fluoro-1, and 3-benzodioxole-5-base or 3,4-dihydro-1H-isoquinoline 99.9-2-base,
4. according to above-mentioned 1 compound, wherein this compound is
(1) [3-(2-{5-methyl-2-[4-(trifluoromethyl) piperidines-1-yl]-1,3-thiazoles-4-yl } oxyethyl group) phenyl] acetate,
(2) [3-(2-{5-sec.-propyl-2-[4-(trifluoromethyl) phenyl]-1,3- azoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate,
(3) [3-(2-{5-ethyl-2-[4-(trifluoromethyl) piperidines-1-yl]-1,3-thiazoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate,
(4) [3-(2-{5-sec.-propyl-2-[4-(trifluoromethoxy) phenyl]-1,3- azoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate,
(5) (3-{2-[2-(2,2-two-fluoro-1,3-benzodioxole-5-yl)-5-sec.-propyl-1,3- azoles-4-yl] oxyethyl group }-the 4-aminomethyl phenyl) acetate,
(6) [3-(2-{5-ethyl-2-[4-(trifluoromethoxy) phenyl]-1,3- azoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate,
(7) (3-{2-[2-(2,2-two-fluoro-1,3-benzodioxole-5-yl)-5-methyl isophthalic acid, 3- azoles-4-yl] oxyethyl group }-the 4-aminomethyl phenyl) acetate,
(8) [2-fluoro-3-(2-{5-methyl-2-[4-(trifluoromethyl) piperidines-1-yl]-1,3-thiazoles-4-yl } oxyethyl group) phenyl] acetate,
(9) (2-fluoro-3-{2-[5-methyl-2-(4-Phenylpiperidine-1-yl)-1,3-thiazoles-4-yl] oxyethyl group } phenyl) acetate,
(10) (3-{2-[5-methyl-2-(4-phenylpiperazine-1-yl)-1,3-thiazoles-4-yl] oxyethyl group } phenyl) acetate,
(11) (3-{2-[2-(1,3-dihydro-2H-isoindole-2-yl)-5-methyl isophthalic acid, 3-thiazole-4-yl] oxyethyl group }-the 2-fluorophenyl) acetate,
(12) [3-(2-{2-[4-(4-chloro-phenyl-) piperazine-1-yl]-5-methyl isophthalic acid, 3-thiazole-4-yl } oxyethyl group)-the 2-fluorophenyl] acetate or
(13) (3-{2-[2-(3,4-dihydro-1H-isoquinoline 99.9-2-yl)-5-methyl isophthalic acid, 3-thiazole-4-yl] oxyethyl group }-the 4-aminomethyl phenyl) acetate,
5. pharmaceutical composition comprises compound, its salt or its solvate or its prodrug by formula (I) representative according to above-mentioned 1,
6. according to above-mentioned 5 pharmaceutical composition, wherein this pharmaceutical composition be PPAR-disease mediated prevent and/or treat agent,
7. according to above-mentioned 6 pharmaceutical composition, wherein PPAR is PPAR δ,
8. according to above-mentioned 7 pharmaceutical composition, wherein PPAR δ-disease mediated is hyperlipidaemia or obesity,
9. medicine, comprise according to above-mentioned 1 be selected from following material by compound, its salt or its solvate of formula (I) representative or its prodrug and one or more: MTP inhibitor, HMG-CoA reductase inhibitor, inhibitor for squalene synthetic enzyme, fibrate (fibrate drug), ACAT inhibitor, 5-lipoxidase inhibitor, cholesterol absorption inhibitor, bile acide absorption inhibitor, Na +/ bile acid transport protein inhibitor (Na +/ bile acid transporter inhibitor), ldl receptor activator, ldl receptor expression toughener, steapsin inhibitor, probucol preparation (probucol formulation), niacin preparation and cetp inhibitors,
10. prevent and/or treat the disease mediated method of Mammals PPAR-, comprise to Mammals give significant quantity according to above-mentioned 1 by compound, its salt or its solvate of formula (I) representative or its prodrug and
11. according to above-mentioned 1 by compound, its salt or its solvate of formula (I) representative or its prodrug preparation PPAR-disease mediated prevent and/or treat purposes in the agent.
By R 1, R 2And R 4The C1-8 alkyl of representative is represented straight chain and branched-chain alkyl, for example methyl, ethyl, n-propyl, sec.-propyl, normal-butyl, isobutyl-, sec-butyl, the tertiary butyl, amyl group, hexyl, heptyl, octyl group etc.
By R 1And R 2The halogen atom of representative is represented fluorine, chlorine, bromine, iodine.
By R 1And R 2The C1-4 alkoxyl group of representative is represented straight chain and branched alkoxy, for example methoxyl group, oxyethyl group, positive propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, tert.-butoxy etc.
By R 1And R 2The trihalogenmethyl of representative is represented for example by iodine atom (one or more), bromine atoms (one or more), fluorine atom (one or more) or the trisubstituted methyl of chlorine atom (one or more).
By R 1And R 2Three halogen methoxyl groups of representative are represented for example by iodine atom (one or more), bromine atoms (one or more), fluorine atom (one or more) or the trisubstituted methoxyl group of chlorine atom (one or more).
By R 1And R 2Three halogen methylthio groups of representative are represented for example by iodine atom (one or more), bromine atoms (one or more), fluorine atom (one or more) or the trisubstituted methylthio group of chlorine atom (one or more).
By R 1And R 2The C1-4 alkylthio of representative is represented straight chain and branched alkane sulfenyl, for example methylthio group, ethylmercapto group, positive rosickyite base, iprotiazem base, positive butylthio, isobutyl sulfenyl, secondary butylthio, uncle's butylthio etc.
By R 5, R 6, R 7And R 8The C1-4 alkyl of representative is represented straight chain and branched-chain alkyl, for example methyl, ethyl, n-propyl, sec.-propyl, normal-butyl, isobutyl-, sec-butyl, the tertiary butyl etc.
By R 3" C1-8 alkyl " in " the C1-8 alkyl that can be replaced by 1-3 halogen atom " of representative represents straight chain and branched-chain alkyl, for example methyl, ethyl, n-propyl, sec.-propyl, normal-butyl, isobutyl-, sec-butyl, the tertiary butyl, amyl group, hexyl, heptyl, octyl group etc.
Halogen atom in " the C1-8 alkyl that can be replaced by 1-3 halogen atom " is represented fluorine, chlorine, bromine, iodine.
R 5And R 6Can for example represent C3-10 saturated carbon ring etc. with the carbocyclic ring that they adjacent carbon atoms constitute.The C3-10 saturated carbon ring is representative ring propane, tetramethylene, suberane, hexanaphthene, suberane, cyclooctane, cyclononane, cyclodecane, cyclopentenes, tetrahydrobenzene, cyclopentadiene, cyclohexadiene etc. for example.
For example represent carbocyclic ring or heterocycle etc. by " cyclic group " in " cyclic group that can have substituting group (one or more) " of ring A representative.Carbocyclic ring for example represent C3-15 single-, two-or three-aromatic carbocyclic and bridging carbocyclic ring etc.The C3-15 list-, two-or three-aromatic carbocyclic and bridging carbocyclic ring representative ring propane for example, tetramethylene, pentamethylene, hexanaphthene, suberane, cyclooctane, cyclononane, cyclodecane, cyclopentenes, tetrahydrobenzene, cyclopentadiene, cyclohexadiene, benzene, pentalene, indenes, naphthalene, Azulene, fluorenes, luxuriant and rich with fragrance, anthracene, acenaphthylene, biphenylene, the perhydro pentalene, indane (indane), the perhydro-indenes, dialin, tetraline, the perhydro-naphthalene, the perhydro-Azulene, the perhydro-fluorenes, perhydrophenanthrene, perhydroanthracene, the perhydro acenaphthylene, the perhydro phenylene, two pentamethylene, bicyclohexane, bicycloheptane ([2.2.1] bicycloheptane), bicyclooctane, bicyclononane, two cyclodecane, diamantane etc.Heterocycle for example represent 4-18 unit single-, two-or three-aromatic heterocycle, it can be partially or completely saturated, contains 1 to 4 nitrogen-atoms, 1 to 2 Sauerstoffatom and/or sulphur atom.4-18 unit list-, two-or three-aromatic heterocycle (it can be partially or completely saturated, contain 1 to 4 nitrogen-atoms, 1 to 2 Sauerstoffatom and/or sulphur atom), for example represent the pyrroles, imidazoles, triazole, tetrazolium, pyrazoles, pyridine, pyrazine, pyrimidine, pyridazine, azatropylidene, diazepine, furans, pyrans, oxa-Zhuo (oxepine), thiophene, thiapyran, thia Zhuo (thiepine), the  azoles, different  azoles, thiazole, isothiazole, furazan, the  diazole, the  piperazine, the  diazine, oxygen azatropylidene (oxazepine), oxygen diazepine (oxadizazepine), thiadiazoles, thiazine, thiadiazine, sulphur azatropylidene (thiazepine), the sulphur diazepine, indoles, isoindole, indolizine, cumarone, isobenzofuran, thionaphthene, different thionaphthene, indazole, quinoline, isoquinoline 99.9, quinolizine, purine, phthalazines, pteridine, naphthyridines, quinoxaline, quinazoline, cinnolines, pyrrolopyridine, benzoxazol, benzothiazole, benzoglyoxaline, chromene, benzo oxa-Zhuo, benzo oxygen azatropylidene, benzo oxygen diazepine, benzo thia Zhuo, benzothiazepines, the benzimidazole thiophanate diazepine, benzazepine, benzodiazepine, the benzo furazan, diazosulfide, benzotriazole, carbazole, β-Ka Lin, acridine, azophenlyene, dibenzofuran, xanthenes, dibenzothiophen, thiodiphenylamine, fen  piperazine, fen  thiophene, phenanthridines, phenanthroline, perimidine, the pyrido naphthyridines, Pyrazoloisoquinolinederivatives, the pyrazolo naphthyridines, the Mi Dingbing indoles, azetidine, pyrroline, tetramethyleneimine, tetrahydroglyoxaline, imidazolidine, triazoline, triazolidine, the tetrazolium quinoline, tetrazolium alkane, pyrazoline, pyrazolidine, dihydropyridine, tetrahydropyridine, piperidines, the dihydro pyrazine, the tetrahydrochysene pyrazine, piperazine, dihydro-pyrimidin, tetrahydropyrimidine, the perhydro pyrimidine, dihydrogen dazin, tetrahydro pyridazine, the perhydro pyridazine, the dihydro azatropylidene, the tetrahydrochysene azatropylidene, the perhydro azatropylidene, the dihydro diazepine, the tetrahydrochysene diazepine, the perhydro diazepine, trimethylene oxide, dihydrofuran, tetrahydrofuran (THF), dihydropyrane, tetrahydropyrans, dihydro oxa-Zhuo, tetrahydrochysene oxa-Zhuo, perhydro oxa-Zhuo, Thietane (thietane), dihydro-thiophene, tetramethylene sulfide, the dihydro thiapyran, tetrahydric thiapyran, dihydro thia Zhuo, tetrahydrochysene thia Zhuo, perhydro thia Zhuo, dihydro  azoles, tetrahydrochysene  azoles ( azoles alkane), the different  azoles of dihydro, the different  azoles of tetrahydrochysene (different  azoles alkane), thiazoline, thiazolidine (thiazolidine), dihydro isothiazole, tetrahydrochysene isothiazole (isothiazolidine), the dihydro furazan, the tetrahydrochysene furazan, dihydro  diazole, tetrahydrochysene  diazole ( diazole alkane), dihydro  piperazine, tetrahydrochysene  piperazine, dihydro  diazine, tetrahydrochysene  diazine, two hydrogen-oxygen azatropylidenes, tetrahydrochysene oxygen azatropylidene, perhydro oxygen azatropylidene, two hydrogen-oxygen diazepines, tetrahydrochysene oxygen diazepine, perhydro oxygen diazepine, thiodiazoline, thiodiazolidine (thiadiazolidine), the dihydro thiazine, the tetrahydrochysene thiazine, the dihydro thiadiazine, the tetrahydrochysene thiadiazine, dihydro sulphur azatropylidene, tetrahydrochysene sulphur azatropylidene, perhydro sulphur azatropylidene, dihydro sulphur diazepine, tetrahydrochysene sulphur diazepine, perhydro sulphur diazepine, morpholine, parathiazan, oxathiane, indoline (indoline), isoindoline (xylylenimine (for example 1,3-dihydro-2H-isoindole etc.)), Dihydrobenzofuranes, the perhydro cumarone, dihydroisobenzofuran, the perhydro isobenzofuran, the dihydrobenzo thiophene, the perhydro thionaphthene, the different thionaphthene of dihydro, the different thionaphthene of perhydro, dihydro-indazol, the perhydro indazole, dihydroquinoline, tetrahydroquinoline, the perhydro quinoline, dihydro-isoquinoline, tetrahydroisoquinoline (for example 3,4-dihydro-1H-isoquinoline 99.9 etc.), perhydro isoquinoline 99.9, the dihydro phthalazines, the tetrahydrochysene phthalazines, the perhydro phthalazines, dihydronaphthridine, Tetrahydronaphthyridderivates, the perhydro naphthyridines, dihydro-quinoxaline, tetrahydroquinoxaline, the perhydro quinoxaline, dihydroquinazoline, tetrahydro quinazoline, the perhydro quinazoline, Pyrrolidine and pyridine, the dihydro cinnolines, the tetrahydrochysene cinnolines, the perhydro cinnolines, the benzo oxathiane, dihydrobenzo  piperazine, the dihydrobenzo thiazine, pyrazine and morpholine, dihydrobenzo  azoles, the perhydro benzoxazol, dihydro-benzothiazole, the perhydro benzothiazole, the dihydrobenzo imidazoles, the perhydro benzoglyoxaline, the dihydrobenzo azatropylidene, the tetrahydro benzo azatropylidene, the dihydrobenzo diazepine, the tetrahydro benzo diazepine, benzo Dioxepane (benzodioxepane), dihydrobenzo oxygen azatropylidene, tetrahydro benzo oxygen azatropylidene, the dihydro carbazole, tetrahydro carbazole, the perhydro carbazole, acridan, tetrahydro acridine, the perhydro acridine, the dihydro dibenzofuran, the dihydro dibenzothiophen, the tetrahydrochysene dibenzofuran, the tetrahydrochysene dibenzothiophen, the perhydro dibenzofuran, the perhydro dibenzothiophen, tetrahydropyridine and naphthyridines, tetrahydrochysene-β-Ka Lin, the dihydro Azepinoindole, six hydrogen Azepinoindoles, tetrahydro-pyrazole and isoquinoline 99.9, tetrahydro-pyrazole and naphthyridines, dihydro azatropylidene and indazole, six hydrogen azatropylidene and indazoles, dihydro-pyrazolo pyrido azatropylidene, six hydrogen Pyrazolopyridine and azatropylidenes, the tetrahydropyrimidine diindyl, dihydro thiazine diindyl, tetrahydrochysene thiazine diindyl, dihydro  Oxazinobenzazole, tetrahydrochysene  Oxazinobenzazole, dioxolane, two  alkane, benzodioxole (for example 1,3-benzodioxole etc.), benzo two  alkane, chromene, chroman or the like.
By " substituting group " in " cyclic group that can have substituting group (one or more) " of ring A representative C1-8 alkyl (straight chain and branched-chain alkyl are for example arranged, methyl for example, ethyl, n-propyl, sec.-propyl, normal-butyl, isobutyl-, sec-butyl, the tertiary butyl, amyl group, hexyl, heptyl, octyl group etc.), halogen atom (fluorine, chlorine, bromine, iodine), C1-4 alkoxyl group (straight chain and branched alkoxy, for example methoxyl group, oxyethyl group, positive propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, tert.-butoxy etc.), nitro, trihalogenmethyl is (for example by iodine atom (one or more), bromine atoms (one or more), fluorine atom (one or more) or chlorine atom trisubstituted methyl such as (one or more)), three halogen methoxyl groups are (for example by iodine atom (one or more), bromine atoms (one or more), fluorine atom (one or more) or chlorine atom trisubstituted methoxyl groups such as (one or more)), three halogen methylthio groups are (for example by iodine atom (one or more), bromine atoms (one or more), fluorine atom (one or more) or chlorine atom trisubstituted methylthio groups such as (one or more)), cyano group, C1-4 alkylthio (methylthio group for example, ethylmercapto group, positive rosickyite base, the iprotiazem base, positive butylthio, the isobutyl sulfenyl, secondary butylthio, uncle's butylthio etc.), NR 9R 10(R wherein 9And R 10Be hydrogen atom or C1-4 alkyl (straight chain and branched-chain alkyl, for example methyl, ethyl, n-propyl, sec.-propyl, normal-butyl, isobutyl-, sec-butyl, the tertiary butyl etc.) independently of one another), can have substituting group (one or more) carbocyclic ring, can have heterocycle of substituting group (one or more) or the like.These optional substituting groups can be substituted in 1-5 commutable position.As carbocyclic ring in substituent " carbocyclic ring that can have substituting group (one or more) " and " heterocycle that can have substituting group (one or more) " and heterocycle have with by the carbocyclic ring implication identical in the cyclic group of ring A representative with heterocycle.For example represent C1-8 alkyl (straight chain and branched-chain alkyl as the substituting group in substituent " can have substituent carbocyclic ring " and " can have substituent heterocycle ", methyl for example, ethyl, n-propyl, sec.-propyl, normal-butyl, isobutyl-, sec-butyl, the tertiary butyl, amyl group, hexyl, heptyl, octyl group etc.), halogen atom (fluorine, chlorine, bromine, iodine), C1-4 alkoxyl group (straight chain and branched alkoxy, for example methoxyl group, oxyethyl group, positive propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, tert.-butoxy etc.), nitro, trihalogenmethyl is (for example by iodine atom (one or more), bromine atoms (one or more), fluorine atom (one or more) or chlorine atom trisubstituted methyl such as (one or more)), three halogen methoxyl groups are (for example by iodine atom (one or more), bromine atoms (one or more), fluorine atom (one or more) or chlorine atom trisubstituted methoxyl groups such as (one or more)), three halogen methylthio groups are (for example by iodine atom (one or more), bromine atoms (one or more), fluorine atom (one or more) or chlorine atom trisubstituted methylthio groups such as (one or more)), cyano group, C1-4 alkylthio (methylthio group for example, ethylmercapto group, positive rosickyite base, the iprotiazem base, positive butylthio, the isobutyl sulfenyl, secondary butylthio, uncle's butylthio etc.), NR 11R 12(R wherein 11And R 12Be hydrogen atom or C1-4 alkyl (straight chain and branched-chain alkyl, for example methyl, ethyl, n-propyl, sec.-propyl, normal-butyl, isobutyl-, sec-butyl, the tertiary butyl etc.) independently of one another) or the like.These optional substituting groups can be substituted in 1-5 commutable position.
For example represent C1-8 alkyl (straight chain and branched-chain alkyl, for example methyl, ethyl, n-propyl, sec.-propyl, normal-butyl, isobutyl-, sec-butyl, the tertiary butyl, amyl group, hexyl, heptyl, octyl group etc.), arylalkyl (for example benzyl, styroyl), phenyl, alkoxy carbonyl (tertbutyloxycarbonyl) or the like by the substituting group in " nitrogen-atoms that can have substituting group (one or more) " of X representative.
Unless otherwise specified, comprise all isomer in the present invention.For example, alkyl, thiazolinyl, alkynyl, alkoxyl group, alkylthio, alkylidene group, alkenylene and the alkynylene person that represents the straight or branched.In addition, the isomer that also comprise isomer on two keys, ring, the fused rings (E-, Z-, cis-, trans-isomer) in the present invention, generates from unsymmetrical carbon (R-, S-isomer, α-, beta configuration, enantiomorph, diastereomer), optically active isomer (D-, L-, d-, l-isomer), polar compound (strong polar compound, low-pole compound), equilibrium compound, rotational isomer, its arbitrary proportion mixture and racemic mixture of generating by chromatographic separation.
Salt by the compound of formula (I) representative comprises all pharmaceutically acceptable persons.As pharmaceutical salts, nontoxic water-soluble salt is preferred.The salt that is fit to for example comprises basic metal (potassium for example, sodium, lithium etc.) salt, alkaline-earth metal (calcium for example, magnesium etc.) salt, ammonium salt (tetramethyl ammonium for example, 4-butyl ammonium etc.), organic amine (triethylamine for example, methylamine, dimethylamine, cyclopentamine, benzylamine, phenylethylamine, piperidines, Monoethanolamine MEA BASF, diethanolamine, trihydroxymethylaminomethane, Methionin, arginine, N-methyl D-glycosamine etc.) pharmacologically acceptable salts, acid salt (the salt of mineral acid (hydrochloride for example, hydrobromate, hydriodate, vitriol, phosphoric acid salt, nitrate etc.) and organic acid salt (acetate for example, trifluoroacetate, lactic acid salt, tartrate, oxalate, fumarate, maleate, benzoate, Citrate trianion, mesylate, esilate, benzene sulfonate, tosylate, isethionate, glucuronate, gluconate etc.)).
Represent by the nitrogen-atoms of the compound of formula (I) representative oxidized by the N-oxide compound of the compound of formula (I) representative.The N-oxide compound can be above-mentioned alkali (soil) metal-salt, ammonium salt, organic amine salt and acid salt in addition.
For example comprise solvate of hydrate, alcohol (for example ethanol etc.) or the like by the solvate that is fit to of the compound of formula (I) representative.Solvate preferably nontoxic with water miscible.In addition, the solvate of The compounds of this invention comprises the solvate of alkali (soil) metal-salt, ammonium salt, organic amine salt, acid salt and the N-oxide compound etc. of The compounds of this invention.
The compounds of this invention is converted into above-mentioned salt, above-mentioned N-oxide compound, above-mentioned solvate by currently known methods.
The compound of representing in vivo to obtain the compound represented by formula (I) by the prodrug of the compound of formula (I) representative with reactions such as enzyme, hydrochloric acid in gastric juice.Prodrug by the compound of formula (I) representative comprises, when the compound by formula (I) representative has amino, prodrug be this amino by the compound of acidylate, alkylation, phosphorylation (for example by the amino of the compound of formula (I) representative by eicosane acidifying, alanylization, penta aminocarboxylization, (5-methyl-2-oxo-1,3-dioxolane-4-yl) methoxycarbonylization, tetrahydrofuran ization, pyrrolidyl methylate, the compound of oxy acid methyl neopentylization, acetoxy-methylization, tert-butylation etc.); When the compound by formula (I) representative had hydroxyl, prodrug was this hydroxyl by the compound of acidylate, alkylation, phosphorylation, boration (for example the hydroxyl by the compound of formula (I) representative is acetylation, the compound of palmitoylation, propionylization, pivalylization, succinylation, fumarylization, alanylization, dimethylamino methyl carbonylation etc.); When the compound by formula (I) representative has carboxyl, prodrug is esterified, the amidated compound of this carboxyl (for example by the carboxyl of the compound of formula (I) representative by the compound of ethyl esterification, sec.-propyl esterification, phenyl esterification, carboxymethyl esterification, dimethylamino methyl esterification, oxy acid methyl neopentyl esterification, the esterification of oxyethyl group carbon acyloxy ethyl, the esterification of phthalyl base, (5-methyl-2-oxo-1,3-Dioxol-4-yl) methyl-esterified, the esterification of cyclohexyloxy carbonyl ethyl, methyl nitrosoureaization etc.); Or the like.These compounds can prepare by currently known methods.In addition, the prodrug by the compound of formula (I) representative can be hydrate or non-hydrate.In addition, can be converted into compound by formula (I) representative by the prodrug of the compound of formula (I) representative under physiological condition, this is described in " the Development of Medicine " vol.7 " Molecular Design " published in 1991 Hirokawa shoten p.p.163-198.And then, can be (for example by the compound of formula (I) representative with isotropic substance 3H, 14C, 35S, 125I etc.) mark or the like.
Among the present invention, PPAR agonist and antagonist comprise all modes of action, just PPAR α, γ, δ, α+γ, α+δ, γ+δ and α+γ+delta agonists and antagonist.In addition, the preferred mode of action of the present invention is the PPAR delta agonists.
In the The compounds of this invention by formula (I) representative, each is by ring A, X, R 1, R 2And R 3The definition of representative is preferred.Preferred group and preferred circular row below, but all symbols used herein all have above-mentioned identical meanings.
About R 1Or R 2, hydrogen atom, C1-8 alkyl or halogen atom are preferred.Hydrogen atom, methyl, ethyl or fluorine atom are preferred.
About R 3, C1-5 alkyl, the C1-2 alkyl or the phenyl that are replaced by 1 to 3 halogen atom are preferred.Methyl, ethyl, propyl group, sec.-propyl, butyl, the tertiary butyl, amyl group, phenyl or 2,2, the 2-trifluoroethyl is preferred.
About R 4, hydrogen atom or C1-4 alkyl are preferred.Hydrogen atom, methyl or ethyl are preferred.
About R 5And R 6, hydrogen atom or C1-4 alkyl are preferred.Hydrogen atom, methyl or ethyl are preferred.Hydrogen atom is particularly preferred.
About R 5And R 6The carbocyclic ring that can constitute with they adjacent carbon atoms, the C3-7 saturated carbon ring is preferred.Cyclopropane, tetramethylene or pentamethylene are preferred.
About X, sulphur atom or Sauerstoffatom are preferred.Sulphur atom is preferred.
About carbocyclic ring by ring A representative, C3-10 is single-or two-carbocyclic ring be preferred.Cyclopropane, tetramethylene, pentamethylene, hexanaphthene, suberane, cyclooctane, cyclononane, cyclodecane or benzene are preferred.Benzene is particularly preferred.
About heterocycle by ring A representative, 5-10 unit is single-or two-aromatic heterocycle be preferred, it can be partially or completely saturated, contains 1 to 2 nitrogen-atoms, 1 to 2 Sauerstoffatom and/or sulphur atom.Piperidines, piperazine, 1,3-benzodioxole, 1,3-dihydro-2H-isoindole, 3,4-dihydro-1H-isoquinoline 99.9 or 3,6-dihydro-2H-pyridine is preferred.Piperidines or piperazine are particularly preferred.
About the substituting group in " cyclic group that can have substituting group (one or more) " represented by ring A, halogen atom, trihalogenmethyl, three halogen methoxyl groups, three halogen methylthio groups, phenyl, the pyridyl that can have substituting group (one or more), thienyl or the furyl that can have a substituting group (one or more) (wherein about substituting group, halogen atom, C1-4 alkyl, C1-4 alkoxyl group) are preferred.Fluorine atom, trifluoromethyl, trifluoromethoxy, trifluoromethylthio, phenyl, pyridine-2-base, 4-chloro-phenyl-, 4-fluorophenyl, 3-fluorophenyl, thiophene-2-base (thiophen-2-yl), thiene-3-yl-, furans-2-base, 4-aminomethyl phenyl, 4-p-methoxy-phenyl or 5-5-flumethiazine-2-base are preferred.
The preparation method of The compounds of this invention:
Can unite currently known methods by the The compounds of this invention of formula (I) representative is prepared, method shown in for example following method or the embodiment, it is the suitable improvement of following method: " Comprehensive OrganicTransformations:A Guide to Functional Group Preparations; 2nd Edition " Richard C.Larock, Wiley ﹠amp; Sons Inc, 1999 " or the like.And then, in following each preparation process, can use the salt of each composition.About these salt, use the described salt of salt as above-mentioned formula (I).
Compound by formula (I) representative can make the compound by formula (II) representative by the preparation of Mitsunobu method
Figure A20048003384200171
Wherein all symbols have and as above define identical implication,
With compound reaction by formula (III) representative,
R wherein 13Be C1-8 alkyl or carboxy protective group, other symbols have and as above define identical implication,
Obtain compound by formula (I-1) representative
Figure A20048003384200173
Wherein all symbols have and as above define identical implication,
If necessary, succeeded by the protective reaction that carries out carboxy protective group.
This Mitsunobu reaction is known.It is performed such, for example under following condition, react: in organic solvent (for example methylene dichloride, diethyl ether, tetrahydrofuran (THF), acetonitrile, benzene, toluene etc.) with corresponding alkylol cpd, azo-compound (for example diethylazodicarboxylate (DEAD), diisopropyl azo-2-carboxylic acid, 1,1 '-(azo dicarbapentaborane) two piperidines (ADDP), 1, two (the N of 1 '-azo, dinethylformamide) etc.) and under the existence of phosphine compound (for example the triphenyl phosphine of triphenyl phosphine, three fourth phosphines, three methylphosphines, polymkeric substance carrying etc.), under 0 to 60 ℃ temperature.
Carboxy protective group for example comprises methyl, ethyl, allyl group, the tertiary butyl, three chloroethyls, benzyl (Bn), phenacyl, right-methoxy-benzyl, trityl, 2-chlorine trityl or in conjunction with solid phase carrier of its group or the like.Carboxy protective group is not limited to above-mentioned group especially, as long as it can easily and optionally stay.For example, can use Protective Groups in Organic Synthesis, (T.W.Greene, John Wiley ﹠amp; Sons Inc, 1999) described those.
The protective reaction of carboxyl is known, and it comprises
(1) basic hydrolysis,
(2) protective reaction under acidic conditions,
(3) by the protective reaction of hydrogenolytic cleavage,
(4) protective reaction of silyl,
(5) protective reaction of use metal,
(6) protective reaction of use metal complexes, or the like.
These methods specifically describe as follows.
(1) protective reaction by alkaline hydrolysis for example carries out under the following conditions; in organic solvent (for example methyl alcohol, tetrahydrofuran (THF) or two  alkane etc.); use the oxyhydroxide (for example hydrated barta or calcium hydroxide etc.) or the carbonate (for example yellow soda ash or salt of wormwood etc.) of alkali-metal oxyhydroxide (for example sodium hydroxide, potassium hydroxide or lithium hydroxide etc.), alkaline-earth metal; perhaps its aqueous solution; perhaps its mixture is under 0 to 40 ℃ temperature.
(2) protective reaction under acidic conditions for example carries out under the following conditions; in organic solvent (for example methylene dichloride, chloroform, two  alkane, ethyl acetate or phenylmethylether etc.); in organic acid (for example acetate, trifluoroacetic acid, methylsulfonic acid or tosic acid etc.) or mineral acid (for example hydrochloric acid or sulfuric acid etc.); perhaps its mixture (for example hydrogen bromide/acetate etc.) is under 0 to 100 ℃ temperature.
(3) protective reaction by hydrogenolytic cleavage for example carries out under the following conditions; (ether (tetrahydrofuran (THF) for example for example in solvent; two  alkane; glycol dimethyl ether (DME) or diethyl ether etc.); alcohol (for example methyl alcohol or ethanol etc.); benzene class (for example benzene or toluene etc.); ketone (for example acetone or methylethylketone etc.); nitrile (for example acetonitrile etc.); acid amides (for example DMF etc.); water; ethyl acetate; acetate; perhaps mixed solvent of two kinds etc. in them at least); (palladium-carbon for example in the presence of catalyzer; palladium black; palladium hydroxide-carbon; platinum oxide or Raney nickel etc.); under normal pressure or pressurized hydrogen atmosphere; perhaps in the presence of ammonium formiate, under 0 to 200 ℃ temperature.
(4) protective reaction of silyl for example carries out under the following conditions, in water-compatibility organic solvent (for example tetrahydrofuran (THF) or acetonitrile etc.), uses tetrabutyl ammonium fluoride, under 0 to 40 ℃ temperature.
(5) use the protective reaction of metal for example to carry out under the following conditions; (for example acetate, pH 4.2-7.2 buffered soln in acid solvent; perhaps mixture of its solution and tetrahydrofuran (THF) organic solvent etc.); in the presence of zinc powder; if necessary; sonic treatment is under 0 to 40 ℃ temperature.
(6) use the protective reaction of metal complexes for example to carry out under the following conditions; at organic solvent (methylene dichloride for example; DMF; THF; ethyl acetate; acetonitrile; two  alkane; ethanol etc.); in water or its mixture; at trapping reagent (tri-butyl tin hydride for example; triethyl silicane; methone; morpholine; diethylamine; tetramethyleneimine etc.); organic acid (acetate for example; formic acid; 2 ethyl hexanoic acid etc.) and/or organic acid salt (2 ethyl hexanoic acid sodium for example; 2 ethyl hexanoic acid potassium etc.) under the existence; be with or without phosphonate reagent in the presence of (for example triphenyl phosphine etc.); use metal complexes (four (triphenyl phosphine) palladium (0) for example; two (triphenyl phosphine) palladiums (II) of dichloro; acid chloride (II); chlorination three (triphenyl phosphine) rhodium (I) etc.), under 0 to 40 ℃ temperature.
In addition, the protective reaction except that aforesaid method for example can be by T.W.Greene, Protective Groups in Organic Synthesis, and Wiley, New York, 1999 described processes are carried out.As those skilled in the art understand easily, can prepare The compounds of this invention easily by selecting to use these protective reactions.
As starting raw material or reagent by formula (II) or (III) compound of representative be that itself is known, perhaps can prepare easily by described method of the following example or currently known methods, for example " ComprehensiveOrganic Transformations:A Guide to Functional Group Preparations; 2ndEdition (Richard C.Larock, John Wiley ﹠amp; Sons Inc, 1999) " described method.
In each reaction in this manual, as will utilizing water-bath, oil bath, sand-bath or microwave to carry out with the reaction of heating for understood by one of ordinary skill in the art.
In each reaction in this manual, can use the solid phase carrying reagent that correspondingly is carried on high polymer (for example polystyrene, polyacrylamide, polypropylene, polyoxyethylene glycol etc.).
In each reaction in this manual, reaction product can be by usual mode purifying, for example by normal pressure or underpressure distillation, perhaps by silica gel or Magnesium Silicate q-agent high performance liquid chromatography, thin-layer chromatography or column chromatography, ion exchange resin, scavenger resin is perhaps by washing or recrystallization or the like.Purifying can carry out in each step of reaction or after some step of reaction.
Pharmacologically active:
About the pharmacological testing except that embodiment is described, particularly the animal in-vivo measurement for example has following method.Can measure the blood sugar decreasing effect and the lipid-lowering effect of The compounds of this invention by following method.
Hypoglycemic and lipid-lowering effect (1):
Measure body weight and the glucose level of KKAy/Ta Jcl mouse, mouse is divided into several groups based on glucose level.In six days after second day, to mouse the feed particle that comprises The compounds of this invention or particle through grinding.Behind the repetitively administered, measure body weight and the food intake of mouse, average food intake is converted into dosage.In addition, measurement of glucose levels, plasma triglyceride (TG) level, plasma insulin, non-esterified fatty acid (NEFA), GOT and GPT level.
Pointed out possibility from reducing as the medicine that is used to prevent and/or treat diabetes, hyperlipidaemia, atherosclerosis etc. through the effect of plasma glucose, plasma insulin, NEFA or the plasma tg of the KKAy/Ta mouse fully fed.
Hypoglycemic and lipid-lowering effect (2):
Measure Zucker fa/fa rat (kind: Crj-[ZUC]-fa/fa) and the thin type rat of normal control animal (kind: Crj-[ZUC]-lean) body weight, glucose level, NEFA, TG and HbAlc level.These rats are divided into several groups based on HbAlc level and body weight.After second day, per os gives The compounds of this invention repeatedly.In addition, give vehicle to contrast.
After repetitively administered begins, calculate average food intake, measuring blood, NEFA, TG and HbAlc level.In addition, carry out oral glucose tolerance test (OGTT), to estimate the effect of improving to the glucose intolerance.Carrying out the fasting of the last angel rat of OGTT.Second day,, feeding back 60 and 120 minutes, measure plasma insulin, NEFA, TG, GOT, GPT and liver wet weights then to the rat 2g/5ml/kg glucose solution of feeding.
Pointed out possibility from reducing as the medicine that is used to prevent and/or treat diabetes, hyperlipidaemia, atherosclerosis etc. through the effect of plasma glucose, plasma insulin, NEFA, HbAlc level or the plasma tg of the Zucker fa/fa rat fully fed.And the effect of improving of the reduction effect of fasting plasma glucose and glucose intolerance has been pointed out possibility as the medicine that is used to prevent and/or treat diabetes during OGTT.
Hypercholesterolemia and lipid-lowering effect (3):
To the SD rat hypercholesterolemia diet (the CRF-1 solid particulate is mixed with 5.5% peanut oil, 1.5% cholesterol, 0.5% cholic acid, Oriental Bio Service) of feeding, measure the body weight of the rat that loses food then, measure following various parameter level.The measurement project is LDL, HDL, TG level, NEFA and TC level.Rat is divided into several groups based on the HDL level.From second day to the 6th day, force the aaerosol solution of orally give compound in vehicle (0.5% methylated cellulose aqueous solution) once a day, continue feeding of hypercholesterolemia diet.After last administration finishes, measure blood plasma lipide (TG, HDL, LDL, NEFA, TC level).
From the effect of the plasma tg, TC level and the LDL level that reduce fasting SD rat, pointed out possibility as the medicine that is used to prevent and/or treat hyperlipidaemia, atherosclerosis etc.
Hypoglycemic and lipid-lowering effect (4):
On the test operation facility, the Cynomolgus monkey is carried out medical inspection, make it custom.Measure the body weight of animal, animal be divided into several groups, utilize nutrition conduit and syringe to give vehicle in the nose repeatedly or the drug solution that comprises 3 to 100mg/kg/ days The compounds of this invention to stomach, once a day.After the administration, collect blood sample, carry out above-mentioned blood test (measuring RBC number, hematocrit, content of hemoglobin, platelet count and leukocyte count) and blood biochemical test (measuring GOT, GPT, alkaline phosphatase, gross protein, blood urea nitrogen, creatinine, creatinine kinases, total bilirubin, blood sugar, total cholesterol, HDL, LDL and TG).In addition, before the administration of The compounds of this invention begins and administration the 14th day after beginning, 1,2 and 3 hour (one hour picked-up time) collection blood sample after 1,2 and 4 hour and the diet of feeding after the administration, measuring blood, total cholesterol, HDL, LDL and TG.
Pointed out the effect of the plasma tg, TC level and the LDL level that reduce the normal cynomolgus monkey of fasting to have the possibility that prevents and/or treats agent as hyperlipidaemia and atherosclerosis etc.Also observe eating the inhibition effect that back TG rises.In addition, the inhibition effect of having pointed out diet to feed back blood sugar has the possibility that prevents and/or treats agent as diabetes.In addition, can estimate whether compound toxicity takes place change from other biochemical blood parameters.
Toxicity:
Toxicity by the compound of formula (I) representative is low-down, and using as pharmaceutical cpd is safe enough.
Be applied to pharmaceutical preparations:
Because the present invention is by the compound of formula (I) representative, its salt, its solvate or its prodrug have PPAR δ agonist activity, HDL cholesterol rising effect for example, LDL cleans up the increase effect, lipid, especially cholesterol carries accelerating effect and back transfer accelerating effect, the macrophage foam cell formation cell generates retarding effect, cholesterol biosynthesizing retarding effect, expection is used to prevent and/or treat and glucose/lipidosis diseases associated (diabetes for example as medicine, hyperlipidaemia (hypercholesterolemia, low-the HDL-cholesteremia, height-LDL-cholesteremia, hypertriglyceridaemia etc.), atherosclerosis, cardiovascular disorder, fat, metabolism syndrome (metabolic syndrome) etc.), hypertension, circulatory diseases, dermatitis sexual dysfunction etc.
By the compound of formula (I) representative or its salt, its solvate or its prodrug can with the other drug Combined Preparation, purpose is:
1) additional and/or enhancing prevents and/or treats effect,
2) improve the kinetics and the absorption of compound, reduce dosage, and/or
3) alleviate the side effect of compound.
Compound, its salt, its solvate or its prodrug and other drug prepared product by formula (I) representative can be by the form administrations of preparation, and described preparation mixes these components in a kind of prepared product, perhaps can administration in independent prepared product.Under the situation of these pharmaceutical preparations administration in independent prepared product, they can be simultaneously or in the different time administration.Under latter instance, can administration before the other drug prepared product by compound, its salt, its solvate or its prodrug of formula (I) representative.Select as an alternative, the other drug prepared product can be in compound, its salt, its solvate or its prodrug administration before by formula (I) representative.The medication of these pharmaceutical preparations can be identical or different.
The other drug prepared product can be a micromolecular compound.In addition, they can be macromolecular protein, polypeptide, polynucleotide (DNA, RNA and gene), antisense sequences (antisense), attractive substance, antibody or vaccine etc.Can correspondingly select the standard of the dosage of other drug prepared product as clinical dosage.In addition, the compositely proportional of The compounds of this invention and other drug prepared product can be correspondingly selected according to age of administration object and body weight, medication, administration time, object disease, symptom, combination etc.For example, the other drug prepared product can use 0.01 to 100 weight part, for 1 weight part The compounds of this invention.The other drug prepared product can be united one or more any composition administrations by suitable proportion.
The disease that aforesaid combination prepared product performance prevents and/or treats effect is not specifically limited, but can be by compound, its salt, its solvate or its prodrug of formula (I) representative prevent and/or treat that effect is compensated and/or enhanced those.
About other compensation and/or strengthen medicine by the reducing blood-fat effect of compound, its salt, its solvate or its prodrug of formula (I) representative; lipid ameliopant just, they for example comprise MTP (microsomal triglyceride transfer protein) inhibitor, HMG-CoA reductase inhibitor, inhibitor for squalene synthetic enzyme, the special class of shellfish (the special acid of shellfish (fibric acid) derivative), ACAT (acyl-CoA: cholesterol O-acyltransferase) inhibitor, 5-lipoxidase inhibitor, cholesterol absorption inhibitor, bile acide absorption inhibitor, ileum Na +/ bile acid transport albumen (IBAT) inhibitor, ldl receptor activator/expression facilitator, steapsin inhibitor, probucol preparation, niacin preparation, cholesteryl ester transfer protein (CETP) inhibitor, other anti-hypercholesterolemiccompounds therapeutical agents or the like.
The example of MTP inhibitor comprises BMS-201038, BMS-212122, BMS-200150, GW-328713, R-103757 etc.The example of HMG-CoA reductase inhibitor comprises that atorvastatin (atorvastatin), fluvastatin (fulvastatin), lovastatin (lovastatin), pyrrole cut down his spit of fland (pitavastatin), Pravastatin (pravastatin), rosuvastatin (rosuvastatin),, Simvastatin (simvastatin) etc.The example of ACAT inhibitor comprises F-12511, F-1394, CI-1011, AC-233 (melinamide) etc.The example of inhibitor for squalene synthetic enzyme comprises TAK-475 etc.The example of the special class of shellfish comprises gemfibrozil, chlorine Bei Te, bezafibrate, fenofibrate, crin Bei Te, simfibrate (simfibrate) etc.The example of ACAT inhibitor comprises Cl-1101, FCE27677, RP73163 etc.The example of cholesterol absorption inhibitor replaces shellfish (ezetimibe), soysterol etc. according to the pool.The example of bile acide absorption inhibitor comprises Colestyramine, colesevelam (colesevelam), colestimide etc.The example of ldl receptor activator/expression facilitator comprises MD-700, LY295427 etc.The example of steapsin inhibitor comprises orlistat (orlistat) etc.The special class of known shellfish is relevant with rhabdomyolysis sometimes with the combination of HMG-CoA reductase inhibitor, and this combination is patients with renal failure and impaired renal function patient's taboo.Improve in the combination of medicine at The compounds of this invention, its salt, its solvate or its prodrug and above-mentioned lipid, have the possibility of correcting the abnormal lipids metabolism and not forming rhabdomyolysis.About with the medicinal composition of The compounds of this invention, its salt, its solvate or the combination of its prodrug, HMG-CoA reductase inhibitor, the special class of shellfish (the special acid derivative of shellfish), cholesterol absorption inhibitor, bile acide absorption inhibitor, steapsin inhibitor, niacin preparation are preferred.
About other compensation and/or strengthen compound by formula (I) representative, its salt, the medicine of the result of treatment of the blood sugar decreasing effect of its solvate or its prodrug and enhancing diabetic complication, Remedies for diabetes just, they for example comprise sulfonylurea type Hypoylycemic agents, the biguanides prepared product, alpha-glucosidase inhibitor, Semilente Insulin secretion accelerator (fast-acting insulin secretion accelerator), the Regular Insulin prepared product, dipeptidyl peptidase (DPP) 4 inhibitor, the GLP-1 agonist, β-3 adrenoceptor activator, diabetes complicated Remedies or the like.
The example of sulfonylurea type Hypoylycemic agents comprises acetohexamide, Glyburide, gliclazide, glyclopyramide (glyclopyramide), P-607, tolazamide, tolbutamide and glimepiride etc.The example of biguanides prepared product comprises Ziavetine and Walaphage etc.The example of alpha-glucosidase inhibitor comprises acarbose and voglibose etc.The example of Semilente Insulin secretion accelerator comprises Nateglinide (nateglinide) and repaglinide (repaglinide).The example of DPP4 inhibitor comprises NVP-DPP728A etc.The example of GLP-1 agonist comprises exendin 4 etc.The example of β-3 adrenoceptor activator comprises AJ-9677, BMS-210285, CP-331679, KUL-1248, LY-362884, L-750335, CP331648 etc.The example of diabetes complicated Remedies comprises epalrestat, zenarestat, fidarestat (fidarestat), zopolrestat, AS-3201, SG-210 etc.
About other compensation and/or strengthen medicine by the anti-obesity effect of compound, its salt, its solvate or its prodrug of formula (I) representative, antiobesity agent just, they for example comprise appetite-inhibiting agent, steapsin inhibitor, β-3 adrenoceptor activator, thrombotonin norepinephrine dopamine reuptake inhibitor or the like.The example of appetite-inhibiting agent comprises RMETHU LEPTIN (leptin), SaH-42548, amphetamine, desoxyephedrine etc.The example of steapsin inhibitor comprises orlistat etc.The example of β-3 adrenoceptor activator comprises AJ-9677, BMS-210285, CP-331679, KUL-1248, LY-362884, L-750335, CP-331648 etc.The example of thrombotonin norepinephrine dopamine reuptake inhibitor comprises sibutramine (sibutramine) etc.
Weight ratio by compound, its salt, its solvate or its prodrug and the other drug of formula (I) representative is not specifically limited.
Two or more other drugs can Combined Preparation arbitrarily.
Compensation and/or the other drug prepared product that prevents and/or treats effect that strengthens by compound, its salt, its solvate or its prodrug of formula (I) representative not only comprise those that have been found that so far, and be included on the above-mentioned mechanism based with found those.
In order to use, under normal circumstances give these compounds to whole human body or part, oral or parenteral by The compounds of this invention, its salt, its solvate or its prodrug of formula (I) representative or by compound, its salt, its solvate or its prodrug of formula (I) representative and the combination of other drug prepared product.
The dosage of these compounds depends on patient's age, body weight and symptom, therapeutic value, medication, treatment time etc.But in practice, these compounds are oral administrations, once a day or several times, once measure every adult from 1mg to 1000mg, or administered parenterally, once a day or several times, once measure every adult from 1mg to 100mg, perhaps to the intravenously successive administration, 1 hour to 24 hours every day.
Self-evident, the dosage of these compounds can be less than above-mentioned value, perhaps may need to exceed above-mentioned scope, because dosage is different because of above-mentioned different syndromes.
By The compounds of this invention, its salt, its solvate or its prodrug of formula (I) representative or by compound, its salt, its solvate or its prodrug of formula (I) representative and other drug prepared product be combined in administration the time, use solid or liquid oral form to medicament, injection, external application agent, administered parenterally suppository, eye drops or inhalation etc.
Peroral solid dosage form comprises tablet, pill, capsule, pulvis and granule for the example of medicament.The example of capsule comprises hard capsule and soft capsule.
In a kind of like this solid formulation for oral administration, to use one or more activeconstituentss, separately or be mixed with vehicle (for example lactose, mannitol, glucose, Microcrystalline Cellulose, starch etc.), tackiness agent (for example hydroxypropylcellulose, polyvinylpyrrolidone, positive silicoaluminate magnesium etc.), disintegrating agent (for example fiber hydroxyethanoic acid calcium (calcium fidrinoglcolate) etc.), glidant (for example Magnesium Stearate etc.), stablizer, dissolution aids (for example L-glutamic acid, aspartic acid etc.) or the like by the prepared product form of usual method preparation.Solid formulation can be surrounded by Drug coating (for example white sugar, gelatin, hydroxypropylcellulose, hydroxypropylmethylcellulose phthalate etc.) or two-layer or multilayer.Select as an alternative, solid formulation can be by absorbable material, for example gelatin encapsulate.
The example of oral administration liquid agent comprises the pharmaceutically acceptable aqueous solution, suspension, emulsion, syrup and elixir.In a kind of like this liquid agent, one or more activeconstituentss are dissolved, suspend or are emulsified in the thinner commonly used (for example purified water, ethanol, its mixture etc.).In addition, a kind of like this liquid agent can comprise wetting agent, suspension agent, emulsifying agent, sweeting agent, correctives, sanitas, buffer reagent etc.
The administered parenterally agent can be for example ointment, gel, creme, Wet-dressing agent, paste, liniment, sprays (nebula), inhalation, sprays (spray), aerosol, eye drops, nasal douche etc.These preparations contain one or more activeconstituentss separately, are prepared by any known process or common prescription.
Ointment is by known or common prescription preparation arbitrarily.For example, one or more activeconstituentss are ground or are dissolved in the matrix, with a kind of like this ointment of preparation.Ointment base is selected from material known or commonly used.In detail, can use higher fatty acid or high-grade aliphatic ester (hexanodioic acid for example, tetradecanoic acid, palmitinic acid, stearic acid, oleic acid, adipic acid ester, myristinate, cetylate, stearate, oleic acid ester etc.), wax (beeswax for example, spermaceti, ceresine etc.), tensio-active agent (for example Voranol EP 2001 phosphoric acid ester etc.), higher alcohols (hexadecanol for example, stearyl alcohol, cetostearyl alcohol (setostearyl alchol) etc.), silicone oil (for example dimethyl polysiloxane etc.), hydrocarbon (hydrophilic petrolatum for example, white vaseline, purifying lanolin, whiteruss etc.), glycol (ethylene glycol for example, glycol ether, propylene glycol, polyoxyethylene glycol, macrogol etc.), vegetables oil (Viscotrol C for example, sweet oil, sesame oil, turps), animal oil (ermine oil, elgen, squalane, squalene), water, absorb accelerator and fash preventive, use or use its two or more combination separately.Matrix can further comprise wetting agent, sanitas, stablizer, antioxidant, spices etc.
Gel is by known or common prescription preparation arbitrarily.For example, one or more activeconstituentss are dissolved in matrix, with a kind of like this gel of preparation.Gel matrix is selected from material known or commonly used.For example, use lower alcohol (for example ethanol, Virahol etc.), jelling agent (for example carboxymethyl cellulose, Natvosol, hydroxypropylcellulose, ethyl cellulose etc.), neutralizing agent (for example trolamine, diisopropanolamine (DIPA) etc.), tensio-active agent (for example polyethylene glycol mono stearate etc.), natural gum, water, absorption accelerator and fash preventive, use or use its two or more combination separately.Gel matrix can further comprise sanitas, antioxidant, spices etc.
Creme is by known or common prescription preparation arbitrarily.For example, one or more activeconstituentss are dissolved in matrix, with a kind of like this creme of preparation.Cream base is selected from material known or commonly used.For example, use high-grade aliphatic ester, lower alcohol, hydrocarbon, polyvalent alcohol (propylene glycol, 1 for example, 3-butyleneglycol etc.), higher alcohols (for example 2-hexyl decyl alcohol, hexadecanol etc.), emulsifying agent (for example Voranol EP 2001, fatty acid ester etc.), water, absorption accelerator and fash preventive, use or use its two or more combination separately.Cream base can further comprise sanitas, antioxidant, spices etc.
Wet-dressing agent is by known or common prescription preparation arbitrarily.For example, one or more activeconstituentss are dissolved in matrix, mediate mixture, be coated in then on the carrier, with a kind of like this Wet-dressing agent of preparation with preparation.Wet-dressing agent matrix is selected from material known or commonly used.For example, can use thickening material (for example polyacrylic acid, polyvinylpyrrolidone, gum arabic, starch, gelatin, methylcellulose gum etc.), wetting agent (for example urea, glycerine, propylene glycol etc.), weighting agent (for example kaolin, zinc oxide, talcum, calcium, magnesium etc.), water, dissolution aids, tackifier and fash preventive, use or use its two or more combination separately.Wet-dressing agent matrix can further comprise sanitas, antioxidant, spices etc.
Paste is by known or common prescription preparation arbitrarily.For example, one or more activeconstituentss are dissolved in matrix, mediate mixture, be coated in then on the carrier, with a kind of like this paste of preparation with preparation.Paste matrix is selected from material known or commonly used.For example, can use polymeric matrix, fat and oil, higher fatty acid, tackifier and fash preventive, use or use its two or more combination separately.Paste matrix can further comprise sanitas, antioxidant, spices etc.
Liniment is by known or common prescription preparation arbitrarily.For example, one or more activeconstituentss are dissolved, suspend or are emulsified in water, alcohol (for example ethanol, polyoxyethylene glycol etc.), higher fatty acid, glycerine, soap, emulsifying agent, the suspension agent etc., separately or its two or more combination, with a kind of like this liniment of preparation.Liniment can further comprise sanitas, antioxidant, spices etc.
Sprays (nebula), inhalation, sprays (spray) and aerosol can comprise thinner commonly used separately, comprise stablizer in addition, for example sodium bisulfite and the buffer reagent of isotonicity can be provided, for example isotonic agent (for example sodium-chlor, Trisodium Citrate or citric acid etc.).About the preparation process of sprays, can be referring to United States Patent (USP) 2,868,691 and 3,095,355.
The administered parenterally injection is by being used for solution, suspension or emulsion form dissolving or the solid injectable thing that suspends and dissolved solvent composition before use.Injection is preparation like this, one or more activeconstituentss of dissolving in solvent, suspension or emulsification.About solvent, can use distilled water for injection, physiological saline, vegetables oil, alcohol, for example propylene glycol, polyoxyethylene glycol and ethanol etc. use or use its combination separately.Injection can further comprise stablizer, dissolution aids (for example L-glutamic acid, aspartic acid, Polysolvate 80 (trade(brand)name) etc.), suspension agent, emulsifying agent, negative catalyst (soothing agent), buffer reagent, sanitas etc.In the end a step perhaps prepares injection by gnotobiosis with the injection sterilization.Select as an alternative, prepare the sterile solid agent in advance, for example lyophilized products is given sterility before use or is dissolved in aseptic distilled water for injection or other solvents.
The administered parenterally inhalation can be aerosol, suction powder or the form that sucks liquid.Can be dissolved or suspended in water or other the appropriate media sucking liquid in use.
These inhalations prepare by currently known methods.
For example, suck with liquid from following material preparation, be selected from sanitas (for example benzalkonium chloride, p-Hydroxybenzoate etc.), tinting material, buffer reagent (for example sodium phosphate, sodium acetate etc.), isotonic agent (for example sodium-chlor, concentrate glycerine etc.), thickening material (for example carboxyvinyl polymer etc.), absorption accelerator etc. as required rightly.
Suction, if necessary is selected from glidant (for example stearic acid and salt etc. thereof), tackiness agent (for example starch, dextrin etc.), vehicle (for example lactose, Mierocrystalline cellulose etc.), tinting material, sanitas (for example benzalkonium chloride, p-Hydroxybenzoate etc.) rightly, absorbs accelerator etc. from following material preparation with powder.
In order to suck liquid, under normal circumstances use atomizer (for example atomizer, spraying gun etc.).In order to suck powder, under normal circumstances use powder inhalator.
The example of other administered parenterally compositions comprises rectal administration suppository and vagina administration vaginal suppository, by usual formulation, comprises one or more activeconstituentss.
The invention effect
Because the present invention has PPAR δ agonist activity by the compound and the non-toxic salts thereof of formula (I) representative, HDL cholesterol rising effect for example, LDL cleans up (clearance) increases effect, lipid, especially cholesterol carry facilitation effect and back transfer facilitation effect and the cholesterol biosynthesizing suppresses effect, expection is used to prevent and/or treat and glucose/lipidosis diseases associated (diabetes for example as medicine, hyperlipidaemia (hypercholesterolemia, low-the HDL-cholesteremia, height-LDL-cholesteremia, hypertriglyceridaemia etc.), atherosclerosis, cardiovascular disorder, fat, metabolism syndrome etc.), hypertension, circulatory diseases, dermatitis sexual dysfunction (dermal inflammatory disorder) etc.
The best mode that carries out an invention
Explain the present invention in detail based on embodiment below, but the present invention is not limited to this.In chromatographic separation trifle and TLC trifle, the solvent in the bracket shows expansion or eluting solvent, and the ratio of solvent for use is represented with volume.NMR is 1H NMR measures, and the solvent shown in the NMR trifle in the bracket shows the solvent that is used in the mensuration.
The compound title that is used in the specification sheets is to utilize ACD/Name (trade mark, AdvancedChemistry Development Inc.) or ACD/Name batch (trade mark, Advanced ChemistryDevelopment Inc.) name, it is according to IUPAC rule or according to the computer program of IUPAC organic chemistry nomenclature name.
Embodiment 1
Methyl [3-(2-{5-ethyl-2-[4-(trifluoromethoxy) phenyl]-1,3- azoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetic ester:
Under argon atmospher, methylene dichloride (22mL) solution to methyl (3-hydroxy-4-methyl phenyl) acetic ester (1.00g) adds 2-{5-ethyl-2-[4-(trifluoromethoxy) phenyl]-1,3- azoles-4-yl } ethanol (2.00g), triphenyl phosphine (2.18g) and 1,1 '-(azo dicarbapentaborane) two piperidines (2.10g) at room temperature stir and spend the night.Concentrated reaction mixture, the gained resistates is through silica gel chromatography (hexane: ethyl acetate=4: 1), obtain title compound (2.38g), have following physical data.
TLC:Rf 0.62 (hexane: ethyl acetate=2: 1);
1H NMR(CDCl 3)：δ8.05-7.99(m，2H)，7.30-7.24(m，2H)，7.05(d，J＝7.5Hz，1H)，6.77-6.72(m，2H)，4.24(t，J＝6.5Hz，2H)，3.67(s，3H)，3.56(s，2H)，3.00(t，J＝6.5Hz，2H)，2.75(q，J＝7.5Hz，2H)，2.15(s，3H)，1.29(t，J＝7.5Hz，3H).
Embodiment 2
[3-(2-{5-ethyl-2-[4-(trifluoromethoxy) phenyl]-1,3- azoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate
The mixing solutions of compound (1.90g) in tetrahydrofuran (THF) (10mL) and methyl alcohol (10mL) to embodiment 1 preparation adds 2N aqueous sodium hydroxide solution (10mL), at room temperature stirs 30 minutes.Add 1N hydrochloric acid (25mL) to reaction mixture, use ethyl acetate extraction.Organic layer is washed with saturated brine, and through anhydrous magnesium sulfate drying, concentrated filtrate obtains title compound (3.66g) then, has following physical data.
TLC:Rf0.40 (chloroform: methyl alcohol=9: 1);
1H NMR(CDCl 3)：δ8.00(m，2H)，7.25(d，J＝8.1Hz，1H)，7.05(d，J＝8.1Hz，1H)，6.76-6.71(m，3H)，4.22(t，J＝6.6Hz，2H)，3.58(s，2H)，2.99(t，J＝6.6Hz，2H)，2.76(q，J＝7.5Hz，2H)，2.14(s，3H)，1.29(t，J＝7.5Hz，3H).
Embodiment 3-embodiment 27
By embodiment 1 and 2 described same process, use methyl (3-hydroxy-4-methyl phenyl) acetic ester or its corresponding alcohol derivate, and methyl (3-hydroxy-4-methyl phenyl) acetic ester and 2-{5-ethyl-2-[4-(trifluoromethoxy) phenyl]-1,3- azoles-4-yl } the corresponding alcohol derivate replacement of ethanol 2-{5-ethyl-2-[4-(trifluoromethoxy) phenyl]-1,3- azoles-4-yl } ethanol, obtain following The compounds of this invention.
Embodiment 3
[3-(2-{5-methyl-2-[4-(trifluoromethyl) piperidines-1-yl]-1,3-thiazoles-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf 0.49 (chloroform: methyl alcohol=10: 1);
1H NMR(CDCl 3)：δ7.24-7.17(m，1H)，6.87-6.77(m，3H)，4.16(t，J＝7.0Hz，2H)，4.00(brd，J＝13.0Hz，2H)，3.59(s，2H)，2.93(t，J＝7.0Hz，2H)，2.90(dt，J＝2.5，13.0Hz，2H)，2.29-2.12(m，1H)，2.24(s，3H)，1.93(brd，J＝13.0Hz，2H)，1.67(dq，J＝4.5，13.0Hz，2H).
Embodiment 4
[3-(2-{5-propyl group-2-[4-(trifluoromethyl) phenyl]-1,3- azoles-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf 0.52 (chloroform: methyl alcohol=10: 1);
1H NMR(CDCl 3)：δ8.08(d，J＝8.0Hz，2H)，7.67(d，J＝8.0Hz，2H)，7.22(td，J＝7.5，1.0Hz，1H)，6.82(m，3H)，4.23(t，J＝6.5Hz，2H)，3.60(s，2H)，2.99(t，J＝6.5Hz，2H)，2.70(t，J＝7.5Hz，2H)，1.74(sext，J＝7.5Hz，2H)，1.00(t，J＝7.5Hz，3H).
Embodiment 5
[3-(2-{5-sec.-propyl-2-[4-(trifluoromethyl) phenyl]-1,3- azoles-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf0.49 (chloroform: methyl alcohol=10: 1);
1H NMR(CDCl 3)：δ8.08(d，J＝8.0Hz，2H)，7.67(d，J＝8.0Hz，2H)，7.21(dt，J＝7.5，1.0Hz，1H)，6.82(m，3H)，4.22(t，J＝6.6Hz，2H)，3.60(s，2H)，3.17(sept，J＝7.0Hz，1H)，3.00(t，J＝6.5Hz，2H)，1.34(d，J＝7.0Hz，6H).
Embodiment 6
[4-methyl-3-(2-{5-propyl group-2-[4-(trifluoromethyl) phenyl]-1,3- azoles-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf0.50 (chloroform: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ12.22(brs，1H)，8.09(d，J＝8.4Hz，2H)，7.83(d，J＝8.4Hz，2H)，7.00(d，J＝7.5Hz，1H)，6.84(s，1H)，6.69(d，J＝7.5Hz，1H)，4.19(t，J＝6.3Hz，2H)，3.47(s，2H)，2.96(t，J＝6.3Hz，2H)，2.70(t，J＝7.2Hz，2H)，2.02(s，3H)，1.66-1.59(m，2H)，0.91(t，J＝7.2Hz，3H).
Embodiment 7
[3-(2-{5-sec.-propyl-2-[4-(trifluoromethyl) phenyl]-1,3- azoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate:
TLC:Rf 0.47 (chloroform: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ12.22(brs，1H)，8.10(d，J＝8.4Hz，2H)，7.84(d，J＝8.4Hz，2H)，7.00(d，J＝7.2Hz，1H)，6.84(d，J＝1.2Hz，1H)，6.68(dd，J＝7.2Hz，1.2Hz，1H)，4.20(t，J＝6.3Hz，2H)，3.46(s，2H)，3.27-3.13(m，1H)，2.97(t，J＝6.3Hz，2H)，2.03(s，3H)，1.26(d，J＝7.5Hz，6H).
Embodiment 8
[3-(2-{5-ethyl-2-[4-(trifluoromethyl) piperidines-1-yl]-1,3-thiazoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate:
TLC:Rf0.54 (chloroform: methyl alcohol=8: 1);
1H NMR(DMSO-d 6)：δ12.22(brs，1H)，7.01(d，J＝7.2Hz，1H)，6.81(s，1H)，6.69(d，J＝7.2Hz，1H)，4.12(t，J＝6.3Hz，2H)，3.98-3.78(m，2H)，3.47(s，2H)，3.06-2.76(m，4H)，2.63(q，J＝7.2Hz，2H)，2.54(m，1H)，2.04(s，3H)，1.94-1.76(m，2H)，1.60-1.44(m，2H)，1.12(t，J＝7.2Hz，3H).
Embodiment 9
[3-(2-{5-sec.-propyl-2-[4-(trifluoromethoxy) phenyl]-1,3- azoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate:
TLC:Rf 0.39 (chloroform: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ12.23(brs，1H)，8.04-7.99(m，2H)，7.48-7.45(m，2H)，7.00(d，J＝7.5Hz，1H)，6.84(s，1H)，6.70-6.67(m，1H)，4.19(t，J＝6.3Hz，2H)，3.46(s，2H)，3.22-3.13(m，1H)，2.95(t，J＝6.3Hz，2H)，2.03(s，3H)，1.25(d，J＝6.9Hz，6H).
Embodiment 10
[4-methyl-3-(2-{5-amyl group-2-[4-(trifluoromethyl) phenyl]-1,3- azoles-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf0.25 (chloroform: methyl alcohol=9: 1);
1H NMR (CDCl 3): δ 8.07 (d, J=8.1Hz, 2H), 7.65 (d, J=8.1Hz, 2H), 7.03 (d, J=7.5Hz, 1H), 6.75 (s, 1H), 6.74 (d, J=7.5Hz, 1H), 5.89 (bs, 1H), 4.22 (t, J=6.6Hz, 2H), 3.55 (s, 2H), 2.99 (t, J=6.6Hz, 2H), 2.71 (t, J=7.5Hz, 2H), 2.13 (s, 3H), 1.66 (quintet, J=7.5Hz, 2H), 1.35 (m, 4H), 0.90 (t, J=6.6Hz, 3H).
Embodiment 11
[4-methyl-3-(2-{5-phenyl-2-[4-(trifluoromethyl) phenyl]-1,3- azoles-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf 0.51 (chloroform: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ8.25(d，J＝8.4Hz，2H)，7.89(d，J＝8.4Hz，2H)，7.85(d，J＝7.5Hz，2H)，7.53(d，J＝7.5Hz，2H)，7.43(m，1H)，6.97(d，J＝7.5Hz，1H)，6.89(s，1H)，6.69(d，J＝7.5Hz，1H)，4.35(t，J＝6.0Hz，2H)，3.48(s，2H)，3.30(bs，1H)，3.29(t，J＝6.0Hz，2H)，1.91(s，3H).
Embodiment 12
[3-(2-{5-methyl-2-[4-(trifluoromethyl) phenyl]-1,3-thiazoles-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf0.45 (chloroform: methyl alcohol=8: 1);
1H NMR(DMSO-d 6)：δ12.27(brs，1H)，8.05(d，J＝8.4Hz，2H)，7.81(d，J＝8.4Hz，2H)，7.19(dd，J＝8.4，7.5Hz，1H)，6.88-6.74(m，3H)，4.28(t，J＝6.6Hz，2H)，3.50(s，2H)，3.14(t，J＝6.6Hz，2H)，2.46(s，3H).
Embodiment 13
[4-methyl-3-(2-{5-methyl-2-[4-(trifluoromethyl) phenyl]-1,3-thiazoles-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf 0.47 (chloroform: methyl alcohol=8: 1);
1H NMR(DMSO-d 6)：δ12.23(brs，1H)，8.05(d，J＝7.8Hz，2H)，7.81(d，J＝7.8Hz，2H)，7.01(d，J＝7.2Hz，1H)，6.86(s，1H)，6.70(d，J＝7.2Hz，1H)，4.27(t，J＝6.3Hz，2H)，3.48(s，2H)，3.16(t，J＝6.3Hz，2H)，2.46(s，3H)，2.02(s，3H).
Embodiment 14
[4-methyl-3-(2-{5-methyl-2-[4-(trifluoromethoxy) phenyl]-1,3- azoles-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf0.20 (chloroform: methyl alcohol=9: 1);
1H NMR(CDCl 3)：δ7.98(d，J＝9.0Hz，2H)，7.24(d，J＝9.0Hz，2H)，7.04(d，J＝8.1Hz，1H)，6.74(m，2H)，4.21(d，J＝6.3Hz，2H)，3.56(s，2H)，2.98(d，J＝6.3Hz，2H)，2.36(s，3H)，2.14(s，3H).
Embodiment 15
[3-(2-{5-sec.-propyl-2-[4-(trifluoromethoxy) phenyl]-1,3- azoles-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf 0.21 (chloroform: methyl alcohol=9: 1);
1H NMR (CDCl 3): δ 8.00 (m, 2H), 7.25 (d, J=8.1Hz, 2H), 7.19 (t, J=8.1Hz, 1H), 6.80 (m, 3H), 4.18 (t, J=6.6Hz, 2H), 3.56 (s, 2H), 3.14 (septets, J=6.9Hz, 1H), 2.97 (t, J=6.6Hz, 2H), 1.32 (d, J=6.9Hz, 6H).
Embodiment 16
[3-(2-{5-(2,2, the 2-trifluoroethyl)-2-[4-(trifluoromethyl) phenyl]-1,3- azoles-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf 0.30 (chloroform: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ12.29(brs，1H)，8.13(d，J＝8.4Hz，2H)，7.90(d，J＝8.4Hz，2H)，7.19(t，J＝7.2Hz，1H)，6.82-6.79(m，3H)，4.23-4.04(m，4H)，3.50(s，2H)，3.06(t，J＝6.3Hz，2H).
Embodiment 17
[3-(2-{5-propyl group-2-[4-(trifluoromethoxy) phenyl]-1,3- azoles-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf 0.27 (chloroform: methyl alcohol=9: 1);
1H NMR(CDCl 3)：δ8.00(m，2H)，7.27-7.18(m，3H)，6.86-6.78(m，3H)，4.21(t，J＝6.6Hz，2H)，3.59(s，2H)，2.97(t，J＝6.6Hz，2H)，2.68(t，J＝7.5Hz，2H)，1.74(sixtet，J＝7.5Hz，2H)，0.99(t，J＝7.5Hz，3H).
Embodiment 18
[4-methyl-3-(2-{5-propyl group-2-[4-(trifluoromethoxy) phenyl]-1,3- azoles-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf 0.21 (chloroform: methyl alcohol=9: 1);
1H NMR(CDCl 3)：δ8.00(m，2H)，7.24(m，2H)，7.05(d，J＝7.5Hz，1H)，6.77(s，1H)，6.75(d，J＝7.5Hz，1H)，4.23(t，J＝6.3Hz，2H)，3.58(s，2H)，2.99(t，J＝6.3Hz，2H)，2.69(t，J＝7.2Hz，2H)，2.14(s，3H)，1.71(sixtet，J＝7.2Hz，2H)，0.99(t，J＝7.5Hz，3H).
Embodiment 19
[3-(2-{5-butyl-2-[4-(trifluoromethoxy) phenyl]-1,3- azoles-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf 0.31 (chloroform: methyl alcohol=9: 1);
1H NMR (CDCl 3): δ 8.00 (m, 2H), 7.27-7.19 (m, 3H), 6.86-6.78 (m, 3H), 4.21 (t, J=6.6Hz, 2H), 3.59 (s, 2H), 2.97 (t, J=6.6Hz, 2H), 2.70 (t, J=7.5Hz, 2H), 1.66 (quintets, J=7.5Hz, 2H), 1.40 (sixtet, J=7.5Hz, 2H), 0.95 (t, J=7.5Hz, 3H).
Embodiment 20
[3-(2-{5-butyl-2-[4-(trifluoromethoxy) phenyl]-1,3- azoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate:
TLC:Rf 0.35 (chloroform: methyl alcohol=9: 1);
1H NMR (CDCl 3): δ 7.93 (d, J=8.7Hz, 2H), 7.17 (d, J=8.7Hz, 2H), 6.89 (d, J=7.5Hz, 1H), 6.68 (s, 1H), 6.61 (d, J=7.5Hz, 1H), 4.54 (bs, 1H), 4.11 (t, J=6.3Hz, 2H), 3.43 (s, 2H), 2.88 (t, J=6.3Hz, 2H), 2.66 (t, J=7.2Hz, 2H), 2.06 (s, 3H), 1.60 (quintet, J=7.2Hz, 2H), 1.36 (sixtet, J=7.2Hz, 2H), 0.92 (t, J=7.2Hz, 3H).
Embodiment 21
[4-ethyl-3-(2-{5-methyl-2-[4-(trifluoromethyl) phenyl]-1,3- azoles-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf 0.41 (chloroform: methyl alcohol=8: 1);
1H NMR(DMSO-d 6)：δ12.24(brs，1H)，8.09(d，J＝8.1Hz，2H)，7.84(d，J＝8.1Hz，2H)，7.00(d，J＝7.5Hz，1H)，6.85(s，1H)，6.72(d，J＝7.5Hz，1H)，4.19(t，J＝6.3Hz，2H)，3.48(s，2H)，2.96(t，J＝6.3Hz，2H)，2.44(q，J＝7.5Hz，2H)，2.38(s，3H)，0.98(t，J＝7.5Hz，3H).
Embodiment 22
(3-{2-[2-(2,2-two fluoro-1,3-benzodioxole-5-yl)-5-methyl isophthalic acid, 3- azoles-4-yl] oxyethyl group }-the 4-aminomethyl phenyl) acetate:
TLC:Rf 0.31 (chloroform: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ7.84(s，1H)，7.76(d，J＝8.4Hz，1H)，7.51(d，J＝8.4Hz，1H)，7.00(d，J＝7.5Hz，1H)，6.83(s，1H)，6.69(d，J＝7.5Hz，1H)，4.16(t，J＝6.3Hz，2H)，3.46(s，2H)，2.92(t，J＝6.3Hz，2H)，2.34(s，3H)，2.04(s，3H).
Embodiment 23
(3-{2-[2-(2,2-two fluoro-1,3-benzodioxole-5-yl)-5-propyl group-1,3- azoles-4-yl] oxyethyl group } phenyl) acetate:
TLC:Rf 0.30 (chloroform: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ7.85(s，1H)，7.77(dd，J＝8.1，0.9Hz，1H)，7.51(dd，J＝8.1，0.9Hz，1H)，7.18(dd，J＝7.5，7.5Hz，1H)，6.79(m，3H)，4.18(t，J＝6.6Hz，2H)，3.49(s，2H)，2.92(t，J＝6.6Hz，2H)，2.69(t，J＝7.2Hz，2H)，1.65(sixtet，J＝7.2Hz，2H)，0.93(t，J＝7.2Hz，3H).
Embodiment 24
(3-{2-[2-(2,2-two fluoro-1,3-benzodioxole-5-yl)-5-propyl group-1,3- azoles-4-yl] oxyethyl group }-the 4-aminomethyl phenyl) acetate:
TLC:Rf0.33 (chloroform: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ7.84(d，J＝1.5Hz，1H)，7.77(dd，J＝8.4，1.5Hz，1H)，7.51(d，J＝8.4Hz，1H)，7.01(d，J＝7.5Hz，1H)，6.85(s，1H)，6.70(d，J＝7.5Hz，1H)，4.19(t，J＝6.3Hz，2H)，3.48(s，2H)，2.94(t，J＝6.3Hz，2H)，2.68(t，J＝7.2Hz，2H)，2.30(s，3H)，1.64(sixtet，J＝7.2Hz，2H)，0.92(t，J＝7.2Hz，3H).
Embodiment 25
(3-{2-[2-(2,2-two fluoro-1,3-benzodioxole-5-yl)-5-sec.-propyl-1,3- azoles-4-yl] oxyethyl group } phenyl) acetate:
TLC:Rf 0.25 (chloroform: methyl alcohol=9: 1);
1H NMR (DMSO-d 6): δ 7.87 (d, J=0.9Hz, 1H), 7.78 (dd, J=8.4,0.9Hz, 1H), 7.52 (d, J=8.4Hz, 1H), 7.18 (dd, J=7.8,7.8Hz, 1H), 6.79 (m, 3H), 4.17 (t, J=6.6Hz, 2H), 3.50 (s, 2H), 3.18 (septet, J=6.9Hz, 2H), 2.93 (t, J=6.6Hz, 2H), 1.27 (d, J=6.9Hz, 2H).
Embodiment 26
(3-{2-[2-(2,2-two fluoro-1,3-benzodioxole-5-yl)-5-sec.-propyl-1,3- azoles-4-yl] oxyethyl group }-the 4-aminomethyl phenyl) acetate:
TLC:Rf 0.37 (chloroform: methyl alcohol=9: 1);
1H NMR (DMSO-d 6): δ 7.87 (d, J=1.8Hz, 1H), 7.78 (dd, J=8.4,1.8Hz, 1H), 7.52 (d, J=8.4Hz, 1H), 7.01 (d, J=7.5Hz, 1H), 6.84 (s, 1H), 6.69 (d, J=7.5Hz, 1H), 4.19 (t, J=6.3Hz, 2H), 3.48 (s, 2H), 3.18 (septets, J=6.9Hz, 1H), 2.95 (t, J=6.3Hz, 2H), 2.04 (s, 3H), 1.26 (d, J=6.9Hz, 6H).
Embodiment 27
(3-{2-[2-(2,2-two fluoro-1,3-benzodioxole-5-yl)-5-ethyl-1,3- azoles-4-yl] oxyethyl group }-the 4-aminomethyl phenyl) acetate:
TLC:Rf0.26 (chloroform: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ7.86(d，J＝1.8Hz，1H)，7.78(dd，J＝8.4，1.8Hz，1H)，7.52(d，J＝8.4Hz，1H)，7.01(d，J＝7.5Hz，1H)，6.84(s，1H)，6.69(d，J＝7.5Hz，1H)，4.18(t，J＝6.3Hz，2H)，3.48(s，2H)，2.94(t，J＝6.3Hz，2H)，2.73(q，J＝7.5Hz，2H)，2.04(s，3H)，1.21(t，J＝7.5Hz，3H).
Embodiment 28
4-(trifluoromethyl) piperidine hydrochlorate:
Under argon atmospher, methyl alcohol (80mL) solution adding concentrated hydrochloric acid (16mL) and platinum oxide (510mg) to 4-(trifluoromethyl) pyridine (9.33g) stirred three days under the room temperature hydrogen pressure.Reaction mixture is filtered concentrated filtrate with C salt (trade(brand)name).Add saturated sodium bicarbonate aqueous solution to resistates, use ethyl acetate extraction.Organic layer is washed with saturated brine,, filter then through anhydrous magnesium sulfate drying.Add 4N hydrogenchloride/ethyl acetate solution (50mL) to filtrate, concentrate then, obtain title compound (13.0g), have following physical data.
TLC:Rf0.13 (chloroform: methyl alcohol=10: 1);
1H NMR(CDCl 3)：δ1.72(dd，J＝13.0，4.0Hz，1H)，1.81(dd，J＝13.0，4.0Hz，1H)，2.05-2.20(m，2H)，2.41-2.80(m，1H)，3.06(dt，J＝13.0，3.0Hz，2H)，3.40-3.60(m，2H).
Embodiment 29
4-(trifluoromethyl)-1-piperidines thioamides (4-(trifluoromethyl)-1-piperidinecarbothioamide):
Add triethylamine (2.9mL) and thio-carbonyldiimidazole (thiocarbodiimidazole) (3.80g) to the aaerosol solution of compound (3.80g) in tetrahydrofuran (THF) (25mL) of embodiment 28 preparation, stirring is at room temperature spent the night.Pour water into to reaction mixture, use ethyl acetate extraction.Organic layer is washed with saturated brine,, concentrate then, obtain brown oiliness thing through anhydrous magnesium sulfate drying.The mixing solutions of this oiliness thing in ethanol (30mL) and tetrahydrofuran (THF) (15mL) cooled off with frozen water, saturated with the ammonia bubble, at room temperature stir then and spend the night.Concentrated reaction mixture, the gained yellow solid washs with diethyl ether, and drying obtains title compound (2.19g), has following physical data.
TLC:Rf0.47 (chloroform: methyl alcohol=10: 1);
1H NMR(CDCl 3)：δ1.76-1.61(m，2H)，2.03-1.93(m，2H)，2.44-2.24(m，1H)，3.15-3.03(m，2H)，4.65(brd，J＝13.0Hz，2H)，5.83(brs，2H).
Embodiment 30
Methyl 5-methyl-2-[4-(trifluoromethyl) piperidines-1-yl]-1,3-thiazoles-4-yl } acetic ester:
Ethanol (10mL) solution to the compound (2.18g) of embodiment 29 preparation adds 4-bromo-3-oxopentanoic acid methyl esters (2.37g), at room temperature stirs and spends the night.Add entry and saturated sodium bicarbonate aqueous solution to reaction mixture, use ethyl acetate extraction.Organic layer is washed with saturated brine,, concentrate then through anhydrous magnesium sulfate drying.Resistates is through silica gel chromatography (hexane: ethyl acetate=4: 2 to 2: 1), obtain title compound (2.86g), have following physical data.
TLC:Rf 0.51 (hexane: ethyl acetate=2: 1);
1H NMR(CDCl 3)：δ1.67(dq，J＝5.0，13.0Hz，2H)，1.93(brd，J＝13.0Hz，2H)，2.23(s，3H)，2.31-2.11(m，1H)，2.89(dt，J＝2.5，13.0Hz，2H)，3.53(s，2H)，3.70(s，3H)，4.00(brd，J＝13.0Hz，2H).
Embodiment 31
2-{5-methyl-2-[4-(trifluoromethyl) piperidines-1-yl]-1,3-thiazoles-4-yl } ethanol:
Anhydrous tetrahydro furan (35mL) solution of lithium aluminum hydride (336mg) is cooled off with frozen water, drip anhydrous tetrahydro furan (5mL) solution of the compound (2.85g) of embodiment 30 preparations, at room temperature stirred 15 minutes.Reaction mixture is kept dripping saturated sodium sulfate (1.8mL) with the frozen water cooling, at room temperature stirred 1 hour.Add diethyl ether (20mL) to reaction mixture, stir,, filter with C salt then through anhydrous magnesium sulfate drying.Concentrated filtrate obtains title compound (2.46g), has following physical data.
TLC:Rf 0.24 (hexane: ethyl acetate=2: 1);
1H NMR(CDCl 3)：δ1.68(dq，J＝4.5，13.0Hz，2H)，2.00-1.90(m，2H)，2.21(s，3H)，2.33-2.13(m，1H)，2.67(t，J＝5.5Hz，2H)，2.92(dt，J＝3.0，13.0Hz，2H)，3.85(t，J＝5.5Hz，2H)，3.98(brd，J＝13.2Hz，2H)，4.29(br，1H).
Embodiment 32
Methyl [2-fluoro-3-(2-{5-methyl-2-[4-(trifluoromethyl) piperidines-1-yl]-1,3-thiazoles-4-yl } oxyethyl group) phenyl] acetic ester:
Figure A20048003384200371
Under argon atmospher, compound (227mg), methyl (2-fluoro-3-hydroxy phenyl) acetic ester (184mg) to embodiment 31 preparations drip diethylazodicarboxylate (435mg) with anhydrous methylene chloride (5mL) solution of triphenyl phosphine (262mg), at room temperature stir 4 hours.Concentrated reaction mixture, the gained resistates is through silica gel chromatography (hexane: ethyl acetate=9: 1 to 7: 3), obtain title compound (306mg), have following physical data.
TLC:Rf 0.64 (hexane: ethyl acetate=1: 2);
1H NMR(CDCl 3)：δ1.68(qd，J＝12.7，4.4Hz，2H)，1.94(d，J＝12.7Hz，2H)，2.13-2.28(m，1H)，2.26(s，3H)，2.89(td，J＝12.7，2.7Hz，2H)，2.98(t，J＝6.9Hz，2H)，3.65-3.68(m，2H)，3.70(s，3H)，4.01(d，J＝12.7Hz，2H)，4.25(t，J＝6.9Hz，2H)，6.74-6.83(m，1H)，6.85-7.02(m，2H).
Embodiment 33
[2-fluoro-3-(2-{5-methyl-2-[4-(trifluoromethyl) piperidines-1-yl]-1,3-thiazoles-4-yl } oxyethyl group) phenyl] acetate:
At room temperature, the mixture solution adding 5N aqueous sodium hydroxide solution (2.00mL) of compound (306mg) in methyl alcohol (5mL) and tetrahydrofuran (THF) (5mL) to embodiment 32 preparations stirred 2 hours.Reaction mixture is adjusted to pH 4 with 2N hydrochloric acid, and dilute with water filters separately gained crystal then.Crystal is washed with water, and drying obtains title compound (226mg), has following physical data.
TLC:Rf 0.60 (chloroform: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ1.47(qd，J＝12.7，4.4Hz，2H)，1.86(d，J＝11.5Hz，2H)，2.19(s，3H)，2.47-2.63(m，1H)，2.86(t，J＝6.7Hz，2H)，2.94(dt，J＝12.7，2.7Hz，2H)，3.57(d，J＝1.5Hz，2H)，3.86(d，J＝12.7Hz，2H)，4.20(t，J＝6.7Hz，2H)，6.80-6.87(m，1H)，6.97-7.09(m，2H)，12.20-12.70(brs，1H).
Embodiment 34-embodiment 34 (15)
By embodiment 32 and embodiment 33 same process, use compound or its corresponding alcohol derivate and methyl (2-fluoro-3-hydroxy phenyl) acetic ester or its corresponding alcohol derivate of embodiment 31 preparations, obtain following The compounds of this invention.
Embodiment 34
(3-{2-[2-(1,1 '-biphenyl-4-yl)-the 5-methyl isophthalic acid, 3- azoles-4-yl] oxyethyl group }-the 4-aminomethyl phenyl) acetate:
TLC:Rf 0.57 (methylene dichloride: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ2.06(s，3H)，2.35(s，3H)，2.94(t，J＝6.23Hz，2H)，3.49(s，2H)，4.19(t，J＝6.23Hz，2H)，6.71(d，J＝7.57Hz，1H)，6.86(s，1H)，7.02(d，J＝7.57Hz，1H)，7.38(t，J＝7.57Hz，1H)，7.47(t，J＝7.57Hz，2H)，7.70(d，J＝7.57Hz，2H)，7.78(d，J＝8.30Hz，2H)，7.98(d，J＝8.30Hz，2H)，12.25(s，1H).
Embodiment 34 (1)
(4-methyl-3-{2-[5-methyl-2-(4-Phenylpiperidine-1-yl)-1,3-thiazoles-4-yl] oxyethyl group } phenyl) acetate:
TLC:Rf 0.65 (methyl alcohol: methylene dichloride=1: 9);
1H NMR(DMSO-d 6)：δ12.23(brs，1H)，7.34-7.13(m，5H)，7.02(d，J＝7.5Hz，1H)，6.82(d，J＝1.2Hz，1H)，6.79(dd，J＝7.5，1.2Hz，1H)，4.12(t，J＝6.3Hz，2H)，3.96-3.83(m，2H)，3.48(s，2H)，2.99(dt，J＝12.3，2.7Hz，2H)，2.86(t，J＝6.3Hz，2H)，2.78-2.62(m，1H)，2.20(s，3H)，2.05(s，3H)，1.87-1.76(m，2H)，1.67(dq，J＝12.3，3.9Hz，2H).
Embodiment 34 (2)
(3-{2-[2-(4-chloro-phenyl-)-5-methyl isophthalic acid, 3- azoles-4-yl] oxyethyl group }-the 4-aminomethyl phenyl) acetate:
TLC:Rf 0.31 (chloroform: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ2.04(s，3H)，2.34(s，3H)，2.93(t，J＝6.3Hz，2H)，3.48(s，2H)，4.17(t，J＝6.3Hz，2H)，6.70(dd，J＝7.5，1.5Hz，1H)，6.84(d，J＝1.5Hz，1H)，7.01(dd，J＝7.5，0.7Hz，1H)，7.54(d，J＝9.0Hz，2H)，7.90(d，J＝9.0Hz，2H)，12.22(s，1H).
Embodiment 34 (3)
(2-fluoro-3-{2-[5-methyl-2-(4-Phenylpiperidine-1-yl)-1,3-thiazoles-4-yl] oxyethyl group } phenyl) acetate:
TLC:Rf0.54 (chloroform: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ1.67(qd，J＝12.3，4.2Hz，2H)，1.81(t，J＝12.3Hz，2H)，2.20(s，3H)，2.71(tt，J＝8.4，3.6Hz，1H)，2.87(t，J＝6.6Hz，2H)，3.00(td，J＝12.3，2.1Hz，2H)，3.58(s，2H)，3.90(d，J＝12.3Hz，2H)，4.21(t，J＝6.6Hz，2H)，6.73-6.89(m，1H)，6.93-7.13(m，2H)，7.13-7.35(m，5H)，12.37(s，1H).
Embodiment 34 (4)
(3-{2-[5-methyl-2-(4-phenylpiperazine-1-yl)-1,3-thiazoles-4-yl] oxyethyl group } phenyl) acetate:
TLC:Rf 0.54 (methyl alcohol: methylene dichloride=1: 9);
1H NMR(DMSO-d 6)：δ12.25(brs，1H)，7.28-7.13(m，3H)，6.96(d，J＝9.0Hz，2H)，6.86-6.75(m，4H)，4.14(t，J＝6.9Hz，2H)，3.51(s，2H)，3.48-3.39(m，4H)，3.26-3.15(m，4H)，2.86(t，J＝6.9Hz，2H)，2.21(s，3H).
Embodiment 34 (5)
[3-(2-{2-[4-(4-chloro-phenyl-) piperazine-1-yl]-the 5-methyl isophthalic acid, 3-thiazole-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf 0.51 (methyl alcohol: methylene dichloride=1: 9);
1H NMR(DMSO-d 6)：δ12.25(brs，1H)，7.24(d，J＝9.0Hz，2H)，7.19(t，J＝8.1Hz，1H)，6.97(d，J＝9.0Hz，2H)，6.84-6.75(m，3H)，4.14(t，J＝6.9Hz，2H)，3.51(s，2H)，3.48-3.39(m，4H)，3.27-3.15(m，4H)，2.86(t，J＝6.9Hz，2H)，2.21(s，3H).
Embodiment 34 (6)
[3-(2-{5-methyl-2-[4-(4-aminomethyl phenyl) piperazine-1-yl]-1,3-thiazoles-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf0.48 (methyl alcohol: methylene dichloride=1: 9);
1H NMR(DMSO-d 6)：δ12.26(brs，1H)，7.18(t，J＝8.1Hz，1H)，7.04(d，J＝8.4Hz，2H)，6.86(d，J＝8.4Hz，2H)，6.84-6.75(m，3H)，4.14(t，J＝6.9Hz，2H)，3.51(s，2H)，3.48-3.38(m，4H)，3.21-3.08(m，4H)，2.86(t，J＝6.9Hz，2H)，2.21(s，3H)，2.20(s，3H).
Embodiment 34 (7)
(3-{2-[2-(1,3-dihydro-2H-isoindole-2-yl)-5-methyl isophthalic acid, 3-thiazole-4-yl] oxyethyl group }-the 2-fluorophenyl) acetate:
TLC:Rf0.52 (chloroform: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ2.23(s，3H)，2.91(t，J＝6.6Hz，2H)，3.58(d，J＝0.9Hz，2H)，4.24(t，J＝6.6Hz，2H)，4.66(s，4H)，6.80-6.87(m，1H)，6.98-7.10(m，2H)，7.27-7.34(m，2H)，7.35-7.41(m，2H)，12.41(brs，1H).
Embodiment 34 (8)
[3-(2-{2-[4-(4-chloro-phenyl-) piperazine-1-yl]-the 5-methyl isophthalic acid, 3-thiazole-4-yl } oxyethyl group)-the 2-fluorophenyl] acetate:
TLC:Rf 0.56 (methyl alcohol: methylene dichloride=1: 9);
1H NMR(DMSO-d 6)：δ12.41(brs，1H)，7.24(d，J＝9.0Hz，2H)，7.09-6.92(m，4H)，6.88-6.78(m，1H)，4.21(t，J＝6.6Hz，2H)，3.57(d，J＝1.5Hz，2H)，3.48-3.37(m，4H)，3.28-3.16(m，4H)，2.88(t，J＝6.6Hz，2H)，2.21(s，3H).
Embodiment 34 (9)
[3-(2-{2-[4-(4-chloro-phenyl-) piperazine-1-yl]-the 5-methyl isophthalic acid, 3-thiazole-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate:
TLC:Rf0.48 (methyl alcohol: methylene dichloride=1: 9);
1H NMR(DMSO-d 6)：δ12.21(brs，1H)，7.24(d，J＝9.0Hz，2H)，7.01(d，J＝7.5Hz，1H)，6.97(d，J＝9.0Hz，2H)，6.81-6.78(d，J＝1.2Hz，1H)，6.69(dd，J＝7.5，1.2Hz，1H)，4.13(t，J＝6.6Hz，2H)，3.48(s，2H)，3.46-3.37(m，4H)，3.26-3.15(m，4H)，2.87(t，J＝6.6Hz，2H)，2.21(s，3H)，2.05(s，3H).
Embodiment 34 (10)
[3-(2-{2-[4-(4-chloro-phenyl-) piperidines-1-yl]-the 5-methyl isophthalic acid, 3-thiazole-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate:
TLC:Rf0.40 (chloroform: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ1.55-1.64(m，J＝12.5，4.0Hz，1H)，1.68(dd，J＝12.5，4.0Hz，1H)，1.74-1.87(m，2H)，2.05(s，3H)，2.20(s，3H)，2.73(tt，J＝12.5，3.5Hz，1H)，2.85(t，J＝6.5Hz，2H)，2.99(dt，J＝12.5，2.5Hz，2H)，3.48(s，2H)，3.89(brd，J＝12.5Hz，2H)，4.12(t，J＝6.5Hz，2H)，6.69(dd，J＝7.0，1.1Hz，1H)，6.82(d，J＝1.1Hz，1H)，7.02(d，J＝7.5Hz，1H)，7.27(d，J＝8.5Hz，2H)，7.34(d，J＝8.5Hz，2H)，12.20(brs，1H).
Embodiment 34 (11)
(3-{2-[2-(3,4-dihydro-1H-isoquinoline 99.9-2-yl)-5-methyl isophthalic acid, 3-thiazole-4-yl] oxyethyl group }-the 4-aminomethyl phenyl) acetate:
TLC:Rf 0.55 (methyl alcohol: methylene dichloride=1: 9);
1H NMR(DMSO-d 6)：δ12.20(brs，1H)，7.26-7.12(m，4H)，7.02(d，J＝7.5Hz，1H)，6.82(d，J＝1.5Hz，1H)，6.69(dd，J＝7.5，1.5Hz，1H)，4.51(s，2H)，4.14(t，J＝6.6Hz，2H)，3.61(t，J＝6.0Hz，2H)，3.48(s，2H)，2.95-2.82(m，4H)，2.22(s，3H)，2.05(s，3H).
Embodiment 34 (12)
(4-methyl-3-{2-[5-methyl-2-(4-phenyl-3,6-dihydro-2H-pyridine-1-yl)-1,3-thiazoles-4-yl] oxyethyl group } phenyl) acetate:
TLC:Rf0.52 (chloroform: methyl alcohol=9: 1);
1H NMR(CDCl 3)：δ2.15(s，3H)，2.27(s，3H)，2.61-2.68(m，2H)，2.98(t，J＝6.6Hz，2H)，3.58(s，2H)，3.68(t，J＝5.8Hz，2H)，4.02-4.07(m，2H)，4.20(t，J＝6.6Hz，2H)，6.06-6.11(m，1H)，6.72-6.79(m，2H)，7.05(d，J＝7.5Hz，1H)，7.21-7.43(m，5H).
Embodiment 34 (13)
[3-(2-{2-[4-(4-fluorophenyl) piperidines-1-yl]-the 5-methyl isophthalic acid, 3-thiazole-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate:
TLC:Rf0.38 (methyl alcohol: methylene dichloride=1: 9);
1H NMR(DMSO-d 6)：δ12.21(brs，1H)，7.27(dd，J＝8.7，5.7Hz，2H)，7.10(t，J＝8.7Hz，2H)，7.02(d，J＝7.5Hz，1H)，6.82(d，J＝1.2Hz，1H)，6.70(dd，J＝7.5，1.2Hz，1H)，4.12(t，J＝6.6Hz，2H)，3.96-3.82(m，2H)，3.48(s，2H)，2.98(t，J＝dt，12.3，2.4Hz，2H)，2.86(t，J＝6.6Hz，2H)，2.72(tt，J＝12.3，3.3Hz，1H)，2.20(s，3H)，2.05(s，3H)，1.87-1.73(m，2H)，1.64(dq，J＝12.3，4.2Hz，2H).
Embodiment 34 (14)
(4-methyl-3-{2-[5-methyl-2-(4-phenylpiperazine-1-yl)-1,3-thiazoles-4-yl] oxyethyl group } phenyl) acetate:
TLC:Rf0.54 (chloroform: methyl alcohol=9: 1);
1H NMR(CDCl 3)：δ2.14(s，3H)，2.26(s，3H)，2.96(t，J＝6.6Hz，2H)，3.21-3.27(m，4H)，3.49-3.58(m，6H)，4.17(t，J＝6.6Hz，2H)，6.72-6.76(m，2H)，6.86-6.97(m，3H)，7.04(dd，J＝8.1，0.7Hz，1H)，7.24-7.31(m，2H).
Embodiment 34 (15)
4-methyl-3-[2-(5-methyl-2-{4-[5-(trifluoromethyl) pyridine-2-yl] piperazine-1-yl }-1,3-thiazoles-4-yl) oxyethyl group] phenyl } acetate:
TLC:Rf 0.47 (methyl alcohol: methylene dichloride=1: 9);
1H NMR(CDCl 3)：δ8.44-8.38(m，1H)，7.65(dd，J＝9.0，2.4Hz，1H)，7.04(d，J＝7.2Hz，1H)，6.80-6.71(m，2H)，6.65(d，J＝9.0Hz，1H)，4.19(t，J＝6.6Hz，2H)，3.79-3.69(m，4H)，3.57(s，2H)，3.54-3.46(m，4H)，2.96(t，J＝6.6Hz，2H)，2.27(s，3H)，2.14(s，3H).
Embodiment 35
Methyl (3-{2-[2-(4-bromophenyl)-5-methyl isophthalic acid, 3- azoles-4-yl] oxyethyl group }-the 4-aminomethyl phenyl) acetic ester:
By embodiment 31 and embodiment 32 same process, use [2-(4-bromophenyl)-5-methyl isophthalic acid, 3- azoles-4-yl] acetic ester replaces the compound of embodiment 30 preparations and methyl (3-hydroxy-4-methyl phenyl) acetic ester to replace methyl (2-fluoro-3-hydroxy phenyl) acetic ester, obtain title compound, have following physical data.
TLC:Rf 0.48 (ethyl acetate: hexane=1: 2);
1H NMR(CDCl 3)：δ2.15(s，3H)，2.37(s，3H)，2.98(t，J＝6.3Hz，2H)，3.56(s，2H)，3.67(s，3H)，4.23(t，J＝6.3Hz，2H)，6.78-6.71(m，2H)，7.05(d，J＝7.8Hz，1H)，7.56(d，J＝8.7Hz，2H)，7.84(d，J＝8.7Hz，2H).
Embodiment 36
Methyl [4-methyl-3-(2-{5-methyl-2-[4-(pyridine-2-yl) phenyl]-1,3- azoles-4-yl } oxyethyl group) phenyl] acetic ester:
Under argon atmospher, compound (300mg), three normal-butyls (2-pyridyl) tin (273mg), lithium chloride (85mg) that embodiment 35 is prepared stirred 5 hours down at 115 ℃ with two  alkane (3mL) solution of four (triphenyl phosphine) palladium (39mg).Reaction mixture is cooled to room temperature, and dilute with water is used ethyl acetate extraction.With continuous water of organic layer and saturated brine washing,, concentrate then through anhydrous magnesium sulfate drying.Resistates is through silica gel chromatography (hexane: ethyl acetate=2: 1), obtain title compound (240mg), have following physical data.
TLC:Rf 0.09 (hexane: ethyl acetate=2: 1).
Embodiment 37
Methyl [3-(2-{2-[4-(furans-3-yl) phenyl]-the 5-methyl isophthalic acid, 3- azoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetic ester:
Figure A20048003384200432
Compound (300mg), 3-furyl borine acid (97mg), the yellow soda ash (92mg) of embodiment 35 preparations were stirred 2 hours down at 90 ℃ with the mixture of four (triphenyl phosphine) palladium (39mg) in glycol dimethyl ether (6mL) and water (2mL).With the reaction mixture dilute with water, use ethyl acetate extraction.With continuous water of organic layer and saturated brine washing,, concentrate then through anhydrous magnesium sulfate drying.Resistates is through silica gel chromatography (hexane: ethyl acetate=9: 1 to 4: 1), obtain title compound (260mg), have following physical data.
TLC:Rf 0.24 (hexane: ethyl acetate=2: 1).
Embodiment 38-embodiment 38 (1)
By embodiment 33 same process, use the compound of compound replacement embodiment 32 preparations of embodiment 36 and embodiment 37 preparations, obtain following The compounds of this invention.
Embodiment 38
[4-methyl-3-(2-{5-methyl-2-[4-(pyridine-2-yl) phenyl]-1,3- azoles-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf 0.38 (chloroform: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ2.05(s，3H)，2.37(s，3H)，2.95(t，J＝6.32Hz，2H)，3.45(s，2H)，4.18(t，J＝6.32Hz，2H)，6.69(d，J＝7.51Hz，1H)，6.86(s，1H)，7.01(d，J＝7.51Hz，1H)，7.38(ddd，J＝7.50，4.76，1.10Hz，1H)，7.90(ddd，J＝8.06，7.50，1.74Hz，1H)，8.01(d，J＝8.24Hz，2H)，8.01-8.05(m，1H)，8.22(d，J＝8.24Hz，2H)，8.68(ddd，J＝4.76，1.74，0.91Hz，1H).
Embodiment 38 (1)
[3-(2-{2-[4-(furans-3-yl) phenyl]-the 5-methyl isophthalic acid, 3- azoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate:
TLC:Rf 0.33 (chloroform: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ2.06(s，3H)，2.35(s，3H)，2.93(t，J＝6.32Hz，2H)，3.49(s，2H)，4.17(t，J＝6.32Hz，2H)，6.70(d，J＝7.51Hz，1H)，6.85(s，1H)，7.02(d，J＝7.51Hz，1H)，7.01-7.02(m，1H)，7.73(d，J＝8.24Hz，2H)，7.75-7.78(m，1H)，7.90(d，J＝8.24Hz，2H)，8.28(s，1H)，12.25(brs，1H).
Embodiment 39-embodiment 39 (8)
By embodiment 37 and embodiment 33 same process, use compound or its corresponding derivative of embodiment 35 preparations, use the acid of corresponding borine acid substitution 3-furyl borine, obtain following The compounds of this invention.
Embodiment 39
(3-{2-[2-(4 '-fluoro-1,1 '-biphenyl-4-yl)-the 5-methyl isophthalic acid, 3- azoles-4-yl] oxyethyl group }-the 4-aminomethyl phenyl) acetate:
TLC:Rf 0.54 (methyl alcohol: methylene dichloride=1: 9);
1H NMR(DMSO-d 6)：δ12.24(brs，1H)，7.97(d，J＝8.4Hz，2H)，7.77(d，J＝8.4Hz，2H)，7.76(dd，J＝8.7，5.7Hz，2H)，7.30(t，J＝8.7Hz，2H)，7.02(d，J＝7.5Hz，1H)，6.85(d，J＝1.2Hz，1H)，6.70(dd，J＝7.5，1.2Hz，1H)，4.18(t，J＝6.3Hz，2H)，3.49(s，2H)，2.94(t，J＝6.3Hz，2H)，2.35(s，3H)，2.05(s，3H).
Embodiment 39 (1)
(3-{2-[2-(3 '-fluoro-1,1 '-biphenyl-4-yl)-the 5-methyl isophthalic acid, 3- azoles-4-yl] oxyethyl group }-the 4-aminomethyl phenyl) acetate:
TLC:Rf 0.54 (methyl alcohol: methylene dichloride=1: 9);
1H NMR(DMSO-d 6)：δ12.25(brs，1H)，7.98(d，J＝8.7Hz，2H)，7.83(d，J＝8.7Hz，2H)，7.62-7.44(m，3H)，7.26-7.17(m，1H)，7.02(d，J＝7.8Hz，1H)，6.85(d，J＝1.2Hz，1H)，6.70(dd，J＝7.8，1.2Hz，1H)，4.18(t，J＝6.3Hz，2H)，3.49(s，2H)，2.94(t，J＝6.3Hz，2H)，2.36(s，3H)，2.06(s，3H).
Embodiment 39 (2)
[4-methyl-3-(2-{5-methyl-2-[4-thiophene-2-yl) phenyl]-1,3- azoles-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf0.37 (chloroform: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ2.05(s，3H)，2.35(s，3H)，2.93(t，J＝6.32Hz，2H)，3.47(s，2H)，4.17(t，J＝6.32Hz，2H)，6.70(dd，J＝7.51，1.28Hz，1H)，6.85(dd，J＝1.28，0.73Hz，1H)，7.01(dd，J＝7.51，0.73Hz，1H)，7.16(dd，J＝4.94，3.66Hz，1H)，7.60(dd，J＝4.94，1.10Hz，1H)，7.61(dd，J＝3.66，1.10Hz，1H)，7.77(d，J＝8.60Hz，2H)，7.92(d，J＝8.60Hz，2H).
Embodiment 39 (3)
[4-methyl-3-(2-{5-methyl-2-[4-(thiene-3-yl-) phenyl]-1,3- azoles-4-yl } oxyethyl group) phenyl] acetate:
TLC:Rf0.37 (chloroform: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ2.06(s，3H)，2.36(s，3H)，2.94(t，J＝6.32Hz，2H)，3.48(s，2H)，4.18(t，J＝6.32Hz，2H)，6.70(dd，J＝7.51，0.92Hz，1H)，6.85(d，J＝0.92Hz，1H)，7.02(d，J＝7.51Hz，1H)，7.61(dd，J＝5.13，1.46Hz，1H)，7.66(dd，J＝5.13，2.93Hz，1H)，7.84(d，J＝8.61Hz，2H)，7.93(d，J＝8.61Hz，2H)，7.99(dd，J＝2.93，1.46Hz，1H).
Embodiment 39 (4)
[3-(2-{2-[4-(furans-2-yl) phenyl]-the 5-methyl isophthalic acid, 3- azoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate:
TLC:Rf 0.33 (chloroform: methyl alcohol=9: 1);
1H NMR(DMSO-d 6)：δ2.05(s，3H)，2.35(s，3H)，2.93(t，J＝6.32Hz，2H)，3.48(s，2H)，4.18(t，J＝6.32Hz，2H)，6.62(dd，J＝3.48，1.83Hz，1H)，6.70(dd，J＝7.69，1.10Hz，1H)，6.85(d，J＝1.10Hz，1H)，7.02(d，J＝7.69Hz，1H)，7.06(d，J＝3.48Hz，1H)，7.80(d，J＝8.60Hz，2H)，7.79(d，J＝1.83Hz，1H)，7.94(d，J＝8.60Hz，2H)，12.24(brs，1H).
Embodiment 39 (5)
[3-(2-{2-[4-(furans-2-yl) phenyl]-5-sec.-propyl-1,3- azoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate:
TLC:Rf 0.35 (chloroform: methyl alcohol=9: 1);
1H NMR (CDCl 3): δ 1.33 (d, J=6.96Hz, 6H), 2.13-2.18 (m, 3H), 3.02 (t, J=6.50Hz, 2H), 3.15 (septet, J=6.96Hz, 1H), 3.58 (s, 2H), 4.24 (t, J=6.50Hz, 2H), 6.49 (dd, J=3.30,1.83Hz, 1H), 6.72 (d, J=3.30Hz, 1H), 6.76 (d, J=7.51Hz, 1H), 6.78 (s, 1H), 7.05 (d, J=7.51Hz, 1H), 7.49 (d, J=1.83Hz, 1H), 7.71 (d, J=8.42Hz, 2H), 7.98 (d, J=8.42Hz, 2H).
Embodiment 39 (6)
[3-(2-{5-sec.-propyl-2-[4-(thiophene-2-yl) phenyl]-1,3- azoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate:
TLC:Rf 0.35 (chloroform: methyl alcohol=9: 1);
1H NMR (CDCl 3): δ 1.33 (d, J=7.0Hz, 6H) 2.16 (s, 3H) 3.02 (t, J=6.6Hz, 2H) 3.15 (septet, J=7.0Hz, 1H) 3.58 (s, 2H) 4.24 (t, J=6.6Hz, 2H) 6.74-6.78 (m, 2H) 7.05 (d, J=7.5Hz, 1H) 7.09 (dd, J=4.8,3.3Hz, 1H) 7.31 (dd, J=4.8,1.2Hz, 1H) 7.37 (dd, J=3.3,1.2Hz, 1H) 7.65 (d, J=8.7Hz, 2H) 7.97 (d, J=8.7Hz, 2H).
Embodiment 39 (7)
(3-{2-[5-sec.-propyl-2-(4 '-methoxyl group-1,1 '-biphenyl-4-yl)-1,3- azoles-4-yl] oxyethyl group }-the 4-aminomethyl phenyl) acetate:
TLC:Rf 0.41 (chloroform: methyl alcohol=9: 1);
1H NMR (CDCl 3): δ 1.32 (d, J=6.9Hz, 6H) 2.16 (s, 3H) 3.02 (t, J=6.5Hz, 2H) 3.15 (septet, J=6.9Hz, 1H) 3.58 (s, 2H) 3.85 (s, 3H) 4.24 (t, J=6.5Hz, 2H) 6.74-6.78 (m, 2H) 6.98 (d, J=6.9Hz, 2H) 7.04 (d, J=7.5Hz, 1H) 7.56 (d, J=6.9Hz, 2H) 7.60 (d, J=8.7Hz, 2H) 8.01 (d, J=8.7Hz, 2H).
Embodiment 39 (8)
(3-{2-[5-sec.-propyl-2-(4 '-methyl isophthalic acid, 1 '-biphenyl-4-yl)-1,3- azoles-4-yl] oxyethyl group }-the 4-aminomethyl phenyl) acetate:
TLC:Rf0.61 (methyl alcohol: methylene dichloride=1: 9);
1H NMR (DMSO-d 6): δ 12.23 (brs, 1H), 7.97 (d, J=8.4Hz, 2H), 7.76 (d, J=8.4Hz, 2H), 7.61 (d, J=7.8Hz, 2H), 7.28 (d, J=7.8Hz, 2H), 7.01 (d, J=7.5Hz, 1H), 6.87 (d, J=1.2Hz, 1H), 6.70 (dd, J=7.5,1.2Hz, 1H), 4.21 (t, J=6.3Hz, 2H), 3.49 (s, 2H), 3.19 (septet, J=7.2Hz, 1H), 2.97 (t, J=6.3Hz, 2H), 2.34 (s, 3H), 2.06 (s, 3H), 1.27 (d, J=7.2Hz, 6H).
Biology embodiment
Following experiment confirm has the PPAR agonist activity by the The compounds of this invention of formula (I) representative.
The measurement of PPAR agonist activity:
(1) preparation of the material of the luciferase assay method of end user PPAR
Measurement of the present invention is to promote accuracy of measurement and improve the measurement sensitivity of method, and purpose is following evaluation The compounds of this invention.
That is to say, as the luciferase gene expression carrier under the control of thymidine kinase (TK) promotor, from pTK β (Chrontech Inc. with TK promotor, catalogue No.6179-1) TK promotor is (105/+51) under the control as minimum essential promoter activity, from PicaGene BasicVector 2 (trade(brand)names, Toyo Ink Inc., catalogue No.309-04821) excision luciferase structure gene is with preparation luciferase gene expression carrier pTK-Luc..In the upstream of TK promotor, insert multiple UAS sequence four times, it is the proteic response sequence of yeast basic transcription factor Gal4 (response sequence), to make up 4X UAS-TK-Luc. as reporter gene.Be employed enhancer sequence (SEQ ID NO:1) below.
SEQ ID NO:1: the enhancer sequence that repeats Gal4 albumen response sequence
5′-T(CGACGGAGTACTGTCCTCCG)×4 AGCT-3′
The carrier of chimeric receptor protein is expressed in preparation as described below, and wherein the ligand binding domains (binding domain) of the C-terminal of yeast Gal4 protein D NA binding domains and people PPAR α, γ or δ merges.That is to say, use PicaGene Basic Vector 2 (trade(brand)name, Toyo Ink Inc., catalogue No.309-04821) as the primary expression carrier, structure gene is replaced into chimeric receptor protein, and promotor and enhanser structural domain remain unchanged.
The DNA of coding people PPAR α, γ or 2-delta ligand binding domains and the DNA of coding Gal4 protein D NA binding domains merge, adaptive their the DNA downstream of coding the 1st to the 147th aminoacid sequence of framework, be inserted into PicaGene Basic Vector 2 (trade(brand)names, Toyo Ink Inc., catalogue No.309-04821) in the promotor/enhanser downstream in.Here, dna sequence dna is following arrangement, the N-terminal of people PPAR α, γ or 2-delta ligand binding domains is arranged as in regular turn and derives from the antigenic nuclear transposition of SV-40T-signal (translocation signal) Ala Pro Lys Lys Lys Arg LysVal Gly (SEQ ID NO:2), expresses chimeric protein with the quilt that obtains locating in the nuclear.On the other hand, the terminator codon that their C-terminal is arranged as influenza hemagglutinin epi-position Tyr Pro Tyr Asp Val Pro Asp TyrAla (SEQ ID NO:3) in regular turn and translates in this order is to detect the fusion rotein that is marked with epitope sequences of being expressed.
Contrast according to the described people PPAR of following document structure: people such as R.Mukherjee (referring to J.Sterod Biochem.Molec.Biol., 51, 157 (1994)), people such as M.E.Green, (referring to GeneExpression., 4, 281 (1995)), people such as A.Elbrecht (referring to Biochem Biophys.Res.Commun., 244, 431 (1996)) or people such as A.Schmidt (referring to Mol.Endocrinology., 6, 1634 (1992)), partly be the DNA of the following peptide of coding as the structure gene of people PPAR α, γ or 2-delta ligand binding domains:
People PPAR alpha ligands binding domains: Ser 167-Tyr 468
People PPAR γ ligand binding domains: Ser 176-Tyr 478
People PPAR 2-delta ligand binding domains: Ser 139-Tyr 441
(each people PPAR γ 1 ligand binding domains and people PPAR γ 2 ligand binding domains are Ser 204-Tyr 506, it is the sequence that is equal to each other).For the Fundamentals of Measurement transcriptional level, also prepared the expression vector that contains the proteic DNA binding domains of Gal4 that lacks the PPAR ligand binding domains, its 1st to the 147th aminoacid sequence in the Gal4 albumen of only encoding.
(2) people PPAR α, γ or δ luciferase assay method
Cultivate the CV-1 cell that is used as host cell by routine techniques.That is to say, under 37 ℃ of 5% carbon dioxide atmosphere, use DulbeccoShi modification Eagle substratum (DMEM) to cultivate the CV-1 cell, wherein be supplemented with 10% foetal calf serum (GIBCO BRL Inc., catalogue No.26140-061), 50U/ml penicillin G and 50 μ g/ml Vetstreps.
Also having under the transfection situation of Gal4-PPAR expression vector, to host cell introducing DNA, existing reporter gene 2 * 10 6Cell inoculation in the 10cm plate, with serum free medium washing once, succeeded by to wherein adding substratum (10ml).With reporter gene (10 μ g), Gal4-PPAR expression vector (0.5 μ g) and 50 μ l LipofectAMINE (GIBRO BRL Inc., catalogue No.18324-012) thorough mixing, join in the culture dish.They were cultivated 5-6 hour down at 37 ℃, contain the substratum of 20% dialysis foetal calf serum (GIBRO BRL Inc., catalogue No.26300-061) to wherein adding 10ml, then 37 ℃ of following overnight incubation.By trypsin treatment cell is disperseed, be seeded in once more in the 96-orifice plate, density is 8000 cells/100 μ l DMEM-10% serum/holes of dialysing.After cultivating some hrs, if cell attachment is in plastic ware, then contain the DMEM-10% dialysis serum of The compounds of this invention to wherein adding 100 μ l, its concentration is the twice of ultimate density.Continue down to cultivate 42 hours at 37 ℃, make cytolysis, instruct according to manufacturer and measure uciferase activity.
Kappa ring element (carbacyclin) activates PPAR δ, is restricted to the relative reactivity of measuring The compounds of this invention under 1 the condition but increase multiple at the situation transcriptional activation with ultimate density 30 μ M kappa ring elements.It is as shown in table 1 that the PPAR δ transcriptional activation of the compound of embodiment 33 preparations increases multiple.
Table 1
Ultimate density (μ M) The increase multiple of transcriptional activation
0.1 0.47
0.3 1.08
1.0 1.23
As a result, The compounds of this invention shows excellent PPAR δ agonist activity.
Reduce the effect of blood cholesterol levels and blood lipid:
To 7 age in week male mice feed that (the CRF-1 solid particulate is mixed with 5.5% peanut oil to the hypercholesterolemia diet, 1.5% cholesterol, 0.5% cholic acid, Oriental Bio Service) reaches six days, measure the body weight of the rat that loses food then, measure following various parameter level.The measurement project is LDL, HDL, TG level, NEFA and TC level.Based on the grouping of TC level, five every group, the mean value of other parameters does not have deviation with mouse.From second day to the 6th day, force the aaerosol solution of orally give compound in vehicle (0.5% methylated cellulose aqueous solution) once a day, continue feeding of hypercholesterolemia diet.After last administration finishes second day (administration begin after the 7th day) measures blood plasma lipide (TG, HDL, LDL, NEFA, TC level).
Be defined as calculating under 100% the condition relative reactivity of The compounds of this invention at vehicle administration group numerical value.It is as shown in table 2 that the HDL cholesterol rising effect of the compound of embodiment 33 preparations and LDL cholesterol reduce effect.
Table 2
Dosage mg/kg HDL cholesterol rising effect The LDL cholesterol reduces effect
3 150.0 82.5
10 162.7 75.7
30 157.3 72.3
As a result, The compounds of this invention depends on dosage ground rising HDL and reduces LDL.Therefore, The compounds of this invention can be used for the therapeutical agent of hyperlipidaemia.
Preparation embodiment
The prepared product embodiment that utilizes the present invention to operate is as follows.
Preparation embodiment 1:
Mix following component according to a conventional method, punching press obtains 10000, and every contains the 10mg activeconstituents.
[3-(2-{5-ethyl-2-[4-(trifluoromethoxy) phenyl]-1,3- azoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate (100g);
Calcium carboxymethylcellulose (disintegrating agent) (20g);
Magnesium Stearate (lubricant) (10g);
Microcrystalline Cellulose (870g).
Preparation embodiment 2:
After mixing following component by ordinary method, gained solution is filtered with dustproof filter, every 5ml can respectively uses the autoclave heat sterilization in ampoule, obtain 10000 injection ampoules, and every contains the 20mg activeconstituents.
[3-(2-{5-ethyl-2-[4-(trifluoromethoxy) phenyl]-1,3- azoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate (200g);
N.F,USP MANNITOL (2kg);
Distilled water (50L).
Industrial applicibility
Toxicity by compound, its salt or its solvate or its pro-drug of formula (I) representative is low-down, and using as drug ingedient is safe enough. In addition, because it is the PPAR activator, can be used as the agent that prevents and/or treats of hyperlipidemia etc.
Sequence table
＜110〉ONO Pharmaceutical Co., Ltd.
＜120〉phenylacetic acid derivatives, its production method and purposes
<130>ONF-5150PCT
<150>JP 2003-330616
<151>2003-09-22
<150>JP 2004-231546
<151>2004-08-06
<160>3
<170>PatentIn Ver.3.1
<210>1
<211>85
<212>DNA
＜213〉artificial sequence
<220>
＜223〉comprise the enhancer sequence of four multiple Gal4 albumen response sequences
<400>1
tcgacggagt actgtcctcc gcgacggagt actgtcctcc gcgacggagt actgtcctcc 60
gcgacggagt actgtcctcc gagct 85
<210>2
<211>9
<212>PRT
＜213〉the unknown
<220>
＜223〉derived from the antigenic nuclear localization signal of SV-40 T-(localozation signal)
<400>2
Ala Pro Lys Lys Lys Arg Lys Val Gly
1 5
<210>3
<211>9
<212>PRT
＜213〉influenza virus
<220>
＜223〉hemagglutinin epi-position
<400>3
Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
1 5

Claims (11)

1. by the compound of formula (I) representative, its salt or its solvate or prodrug,
R wherein 1And R 2Represent hydrogen atom, C1-8 alkyl, halogen atom, C1-4 alkoxyl group, nitro, trihalogenmethyl, three halogen methoxyl groups, three halogen methylthio groups, cyano group, C1-4 alkylthio or NR independently of one another 7R 8, R wherein 7And R 8Represent hydrogen atom or C1-4 alkyl independently of one another;
R 3Representative can be by the C1-8 alkyl or the phenyl of 1-3 halogen atom replacement;
R 4Represent hydrogen atom or C1-8 alkyl;
R 5And R 6Represent hydrogen atom or C1-4 alkyl, perhaps R independently of one another 5And R 6Can constitute carbocyclic ring with they adjacent carbon atoms;
X represents sulphur atom, Sauerstoffatom or can have one or more substituent nitrogen-atoms;
Ring A representative can have substituent cyclic group.
2. according to the compound of claim 1, its salt or its solvate or prodrug, wherein the cyclic group by ring A representative is 4-(trifluoromethyl) phenyl, 4-(trifluoromethoxy) phenyl, 4-(trifluoromethyl) piperidines-1-base, 2,2-two fluoro-1,3-benzodioxole-5-base, 4-Phenylpiperidine-1-base, 4-phenylpiperazine-1-base, 1,3-dihydro-2H-isoindole-2-base, 4-(4-chloro-phenyl-) piperazine-1-base or 3,4-dihydro-1H-isoquinoline 99.9-2-base.
3. according to the compound of claim 2, its salt or its solvate or prodrug, wherein the cyclic group by ring A representative is 4-(trifluoromethyl) piperidines-1-base, 2,2-two fluoro-1,3-benzodioxole-5-base or 3,4-dihydro-1H-isoquinoline 99.9-2-base.
4. according to the compound of claim 1, its salt or its solvate or prodrug, wherein this compound is
(1) [3-(2-{5-methyl-2-[4-(trifluoromethyl) piperidines-1-yl]-1,3-thiazoles-4-yl } oxyethyl group) phenyl] acetate,
(2) [3-(2-{5-sec.-propyl-2-[4-(trifluoromethyl) phenyl]-1,3- azoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate,
(3) [3-(2-{5-ethyl-2-[4-(trifluoromethyl) piperidines-1-yl]-1,3-thiazoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate,
(4) [3-(2-{5-sec.-propyl-2-[4-(trifluoromethoxy) phenyl]-1,3- azoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate,
(5) (3-{2-[2-(2,2-two fluoro-1,3-benzodioxole-5-yl)-5-sec.-propyl-1,3- azoles-4-yl] oxyethyl group }-the 4-aminomethyl phenyl) acetate,
(6) [3-(2-{5-ethyl-2-[4-(trifluoromethoxy) phenyl]-1,3- azoles-4-yl } oxyethyl group)-the 4-aminomethyl phenyl] acetate,
(7) (3-{2-[2-(2,2-two fluoro-1,3-benzodioxole-5-yl)-5-methyl isophthalic acid, 3- azoles-4-yl] oxyethyl group }-the 4-aminomethyl phenyl) acetate,
(8) [2-fluoro-3-(2-{5-methyl-2-[4-(trifluoromethyl) piperidines-1-yl]-1,3-thiazoles-4-yl } oxyethyl group) phenyl] acetate,
(9) (2-fluoro-3-{2-[5-methyl-2-(4-Phenylpiperidine-1-yl)-1,3-thiazoles-4-yl] oxyethyl group } phenyl) acetate,
(10) (3-{2-[5-methyl-2-(4-phenylpiperazine-1-yl)-1,3-thiazoles-4-yl] oxyethyl group } phenyl) acetate,
(11) (3-{2-[2-(1,3-dihydro-2H-isoindole-2-yl)-5-methyl isophthalic acid, 3-thiazole-4-yl] oxyethyl group }-the 2-fluorophenyl) acetate,
(12) [3-(2-{2-[4-(4-chloro-phenyl-) piperazine-1-yl]-5-methyl isophthalic acid, 3-thiazole-4-yl } oxyethyl group)-the 2-fluorophenyl] acetate or
(13) (3-{2-[2-(3,4-dihydro-1H-isoquinoline 99.9-2-yl)-5-methyl isophthalic acid, 3-thiazole-4-yl] oxyethyl group }-the 4-aminomethyl phenyl) acetate.
5. pharmaceutical composition comprises compound, its salt or its solvate or its prodrug by formula (I) representative according to claim 1.
6. according to the pharmaceutical composition of claim 5, wherein this pharmaceutical composition be PPAR-disease mediated prevent and/or treat agent.
7. according to the pharmaceutical composition of claim 6, wherein PPAR is PPAR δ.
8. according to the pharmaceutical composition of claim 7, wherein PPAR δ-disease mediated is hyperlipemia or obesity.
9. medicine, comprise and be selected from following material by compound, its salt or its solvate of formula (I) representative or its prodrug and one or more: MTP inhibitor, HMG-CoA reductase inhibitor, inhibitor for squalene synthetic enzyme, fibrate, ACAT inhibitor, 5-lipoxidase inhibitor, cholesterol absorption inhibitor, bile acide absorption inhibitor, Na according to claim 1 +/ bile acid transport protein inhibitor, ldl receptor activator, ldl receptor expression toughener, steapsin inhibitor, probucol preparation, niacin preparation and cetp inhibitors.
10. prevent and/or treat the disease mediated method of Mammals PPAR-, comprise compound, its salt or its solvate or its prodrug that Mammals are given significant quantity by formula (I) representative according to claim 1.
11. according to claim 1 by compound, its salt or its solvate of formula (I) representative or its prodrug preparation PPAR-disease mediated prevent and/or treat purposes in the agent.
CN 200480033842 2003-09-22 2004-09-21 Phenylacetic acid derivative, process for producing the same, and use Pending CN1882553A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
JP2003330616 2003-09-22
JP330616/2003 2003-09-22
JP231546/2004 2004-08-06

Publications (1)

Publication Number Publication Date
CN1882553A true CN1882553A (en) 2006-12-20

Family

ID=37520179

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 200480033842 Pending CN1882553A (en) 2003-09-22 2004-09-21 Phenylacetic acid derivative, process for producing the same, and use

Country Status (1)

Country Link
CN (1) CN1882553A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102285933A (en) * 2010-06-18 2011-12-21 浙江海正药业股份有限公司 Compound with excitation effect on subtype peroxisome proliferator-activated receptors (PPAR) and preparation method as well as application thereof
CN103539760A (en) * 2013-10-23 2014-01-29 东南大学 Phenoxy phenylacetic acid endothelin antagonist, and preparation method and application thereof
CN109562101A (en) * 2016-05-12 2019-04-02 日本化学药品株式会社 Wound healing agent

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102285933A (en) * 2010-06-18 2011-12-21 浙江海正药业股份有限公司 Compound with excitation effect on subtype peroxisome proliferator-activated receptors (PPAR) and preparation method as well as application thereof
CN102933580A (en) * 2010-06-18 2013-02-13 浙江海正药业股份有限公司 Compounds having activating effect on subtypes of peroxisome proliferator-activated receptors and its preparation method and uses
CN102933580B (en) * 2010-06-18 2015-07-01 浙江海正药业股份有限公司 Compounds having activating effect on subtypes of peroxisome proliferator-activated receptors and its preparation method and uses
CN102285933B (en) * 2010-06-18 2016-03-09 浙江海正药业股份有限公司 A kind of have the compound of agonism, its preparation method and application to hypotype peroxisome proliferator-activated receptor
CN103539760A (en) * 2013-10-23 2014-01-29 东南大学 Phenoxy phenylacetic acid endothelin antagonist, and preparation method and application thereof
CN103539760B (en) * 2013-10-23 2016-04-13 东南大学 (phenoxy) phenylacetic acid class endothelin antagonist and preparation method thereof and application
CN109562101A (en) * 2016-05-12 2019-04-02 日本化学药品株式会社 Wound healing agent

Similar Documents

Publication Publication Date Title
CN1189467C (en) Pharmaceutically active sulfonamide derivatives
CN100338044C (en) HIV protease inhibitors, compositions containing the same, their pharmaceutical uses and materials for their synthesis
CN1165308C (en) Compositions and method for reducing respiratory depression and attendant side effects of mu opioid compounds
CN1259307C (en) Acylated indanyl amines and their use as pharmaceuticals
CN1296346C (en) Acylated 6,7,8,9-tetrahydro-5H-benzocycloheptenyl amines and their use as pharmaceutical
CN1254465C (en) Calcilytic compounds
CN1048986C (en) Heterocyclic compounds and their preparation and use
CN1054850C (en) Piperazine compounds used in therapy
CN1659151A (en) 11-beta-hydroxysteroid dehydrogenase 1 inhibitors useful for the treatment of diabetes, obesity and dyslipidemia
CN1913778A (en) Aminocyclopentyl pyridopyrazinone modulators of chemokine receptor activity
CN1678578A (en) Indoles having anti-diabetic activity
CN1751038A (en) Substituted aryl and heteroaryl derivatives as modulators of glucose metabolism and the prophylaxis and treatment of disorders thereof
CN1956975A (en) Amino cyclopentyl heterocyclic and carbocyclic modulators of chemokine receptor activity
CN1816546A (en) Benzenesulfonylamino compounds and pharmaceutical compositions containing these compounds
CN1914180A (en) Indazole derivatives as inhibitors of hormone-sensitive lipases
CN1276790A (en) Carboxamidothiazole derivs., preparation, pharmaceutical composition contg. them
CN1284944A (en) Integrin receptor antagonists
CN1529692A (en) N-arylphenylacetamide derivatives and medicinal compositions containing same
CN1902177A (en) Novel piperidine derivative
CN1524082A (en) Beta-amino tetrahydroimidazo (1,2-a) pyrazines and ahydrotrioazolo (4,3-a) pyrazines as dipeptidyl idase inhibitors for the treatment or prevention of diabetes
CN1275982A (en) Novel heterocyclic compounds process for their preparation and pharmaceutical compositions containing them and their use in the treatment of diabetes and related diseases
CN1617850A (en) Dibenzylamine compound and medicinal use thereof
CN1826120A (en) Compounds for inflammation and immune-related uses
CN1434803A (en) Cyclic lactams as inhibitors os A-alpha protein production
CN1270585A (en) Substituted 1,2,3,4-tetrahydronaphthalene derivatives

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication