CN1879890A - Use of methioninase in anti-methionine and anti-homocysteine chemotherapy - Google Patents

Abstract

The present invention relates to expression modules that encode and express high levels of recombinant methioninase, recombinant methioninase produced using high-level expression modules, compositions containing recombinant methioninase produced using high-level expression modules, methods for purifying recombinant methioninase produced using high-level expression modules, chemically modified forms of recombinant methioninase, and methods of using recombinant methioninase produced using high-level expression modules in antimethionine and antihomocysteine therapy.

Description

The application of methioninase in the chemistry treatment of anti-methionine and anti-homocysteine

The application be submitted on June 7th, 1996, application number is 200410078709.x, denomination of invention dividing an application for the application of " application of methioninase in the chemistry treatment of anti-methionine and anti-homocysteine ".

Technical field

The present invention relates to the methioninase composition, the purification process of methioninase is attached to the method for polymer such as PEG (polyethylene glycol) to methioninase, the method for use methioninase in the chemistry treatment of anti-ammonia egg acid and anti-homocysteine. Say that more specifically method of the present invention comprises methioninase in treatment of cancer, the use in cardiovascular disease therapies and tumour radiography and the diagnosis. The invention still further relates to restructuring DNA technology. The present invention provides the expression model of coding methioninase especially.

Background technology

Refer to use take the treatment medicine as main cancer therapy and can selectively suppress or kill cancer cell, but the function of normal tissue does not cause the medicine of the damage that exceeds acceptable scope. The difficult point of routine treatment is to treat the toxicity of medicine normal tissue.

Have now found that many tumours all have absolute demand to methionine in various cell types and the tumor tissues commented on. Wherein said cell and tumor tissues comprise tumour and leukaemia and the lymthoma in colon, mammary gland, prostate, ovary, kidney, larynx melanin knurl, sarcoma, lung, brain, stomach and the bladder. Now clearly when the methionine in the grown cultures base is replaced by homocysteine, tumour be defined as dependence to methionine without the growth ability. For example, referring to Chello etc.,Cancer Res.， 33: 1898-1904,1973; And Hoffman,Anticancer Res.，5：1-30，1985。

Shown that now removing methionine (methionine depletion) can optionally make the tumour cell that relies on methionine enter synchronously the S/G of this cell in the cycle₂Late period, Hoffman etc.,Proc.Natl. Ad.Acad.Sci.USA.77: 7306-7310,1980. Unite to use and remove methionine, then and be exposed to anti-mitosis agent, be the chemotherapy of anti-methionine, tumour cell optionally removed that the result causes strong ground of the cultivation thing hyperplasia of normal cell from the common cultivation thing of normal and tumour cell. Stern etc.,J.Natl.Cancer Inst.，76：629-639，1986。

But, in order in body, to carry out the methionine dependence chemotherapy, a kind of method of effectively removing the methionine of circulation from serum must be arranged, at present also nobody described a kind of like this method of removing methionine, and namely this kind method content that can reduce the methionine of body-internal-circulation is enough in antitumor treatment effectively it.

Now being purified into a kind of enzyme that can degrade methionine from various bacterial origins is methioninase, and it is reported that this kind of enzyme can slow down the speed of tumor cell in vitro hyperplasia. Kreis etc.,Cancer Res.， 33: 1862-1865 and 1866-1869,1973; Tanaka etc.,FEBS Letters.66: 307-311 1976; Ito etc.,J.Biochem.，79: 1263-1272,1976 and Nakayama etc.,Agric.Biol.Chem.， 48：2367-2369，1984。

Kreis etc.,Cancer Rs.，33: 1866-1869, described in 1973 and used isolated very impure methioninase preparation from clostridium sporogenes (Clostridium sporgenes), suppressed to move into the growth of the carcinosarcoma cell in the little mouse model with the amount in 1150 units/kg/skies. Although this enzyme has obviously reduced the growth of the former oncocyte of swelling, reported never that the T/C of diameter of tumor being led (processing the ratio with contrast) was reduced to below 50%, and also never reported to shifting knurl any effect is arranged. The author also points out not have other nonspecific interference can not predict the tumour-specific of methioninase, and the author does not comment on endotoxin in the pure preparation not or other components to the possibility of viewed effect role yet. Unique toxicological study of reporting is that the weight of animals does not alleviate and the general visual inspection of toxicity is negative after the treatment phase. In addition, the author has reported that this kind of enzyme has 4 hours serum half-life. This kind of enzyme preparation only has half purity and contains the endotoxin of significant quantity, and this is so that complicated to this result's explanation.

And Kreis can not be reduced to below 8% of control group to the content of serum methionine, and this may be owing to the high K of bud born of the same parents bacillus (Clostridium) enzyme_m(approximately 90mM). It is reported that the methioninase preparation is unstable and in to its purifying, can only obtain 2% recovery (productive rate).

Kreis etc.,Cancer Res.，33: 1866-1869, also reported that a kind of antineoplastic method namely uses the food that does not contain methionine as the method for removing methionine in 1973. But the author reports that this way of dining can not be as using the growth that effectively slows down cell the impure methioninase preparation, and can cause this kind of the weight of animals continuous decrease not wish the side effect that occurs. The author does not report that the associating use does not contain food and the methioninase treatment of methionine, and does not study synchronousization of cell.

Application formerly of the present invention has proposed effective tumour chemotherapy, provides a kind of antineoplastic useful effect without damage thereby these chemotherapy refer to the content that uses methioninase effectively to reduce methionine. The present invention has proposed treatment and diagnosis method and composition by providing a kind of high-purity RMETASE for the production of viable commercial quantity to improve these applications.

Summary of the invention

Have now found that, methioninase, no matter be the recombinant forms that does not contain endotoxin of the high-purity of the form of PEGization (PEGylated) or produce and purifying, can both remove the methionine content in the mammalian body harmlessly, can both effectively be used for the selective growth that suppresses tumour, and can optionally prevent tumour cell, the chemotherapy of itself and anti-mitosis is changed synchronously.

Find also now that when collaborative methionine removal method is the most effective when well several diverse ways substantially effectively reduce the content of methionine. These methods comprise that use does not contain the hungry method of methionine of the diet of methionine, use can be competed the competitive inhibition method of methionine that methionine utilizes the inhibitor of enzyme (methionine-utilizing enzyme) with methionine, is beneficial to chemistry treatment agent that specific tumors selecting cell cycle of being brought out by methionine removal method prevents and the combination of these methods.

So, the invention describes a kind of method of inhibition tumor cell growth, it comprise tumor cell group and treatment effectively the methioninase defined herein of amount contact one period that is enough to bring out the cell cycle arrest of cell among the cell group, and form static tumour cell. " contact " to such an extent as to a word refer to therapeutic combination of the present invention and target tumour put to get very approachingly can observe the effect that suppresses tumour, perhaps therapeutic combination of the present invention is placed in a kind of culture medium such as nutrition culture medium or the blood, to such an extent as to can make the methionine content in the culture medium be reduced to the level that can suppress the growth of tumour cell in the culture medium. The tumour cell that " static " tumour cell refers to grow and suppressed. This kind method can be used in external or body. Need not be directly with contacting of tumour cell, it can contact to realize with the nutrition culture medium that contains tumour cell in external or body. This kind contact also can contact blood circulation to finish with methioninase. This kind blood circulation can contain tumour cell or not contain tumour cell when tumour is the solid tumor that can not circulate. " growth of inhibition tumor cell " refers to take the growth that the compounds of this invention can reduce tumour, for example weigh with volume, compare with the tumour with this compounds for treating not, the volume of tumour can reduce by 10% to 100%, more preferably at least 34% to 79%, most preferably be and be reduced to 55% to 68%.

Methioninase is by removing methionine and be used as slowing down or stop a kind of antitumor dose of cell division. Use the competitive inhibitor of methionine can strengthen this kind effect. In addition, the specific cell toxin agent treatment validity that can by bring out cell cycle synchronisation increase the specific cell toxin agent in anti-mitosis agent or other cell cycles of methioninase with anti-mitosis agent and other cell cycles.

Methioninase also can reduce for the chemotherapy of removing homocysteine danger and the Cardiovarscular of cardiovascular disease. When methioninase also is used for the detection of superelevation resolution ground and diagnosing tumour, more sufficient confession [¹¹C] remove before the methionine in blood and the tumour [¹²C] methionine.

In a technical scheme, at first make tumour cell accept the content that the hungry step of methionine reduces methionine first. Can be without restriction follow the hungry method of egg to reduce toxicity to normal cell with height half dirty propylhomoserin, thereby increase the specificity for the treatment of.

The feature of other related fields of the present invention is with methionine removal method of the present invention tumour cell to be prevented in the S/G2 late period of cell in the cycle, then begins synchronously the processing in cell cycle and takes the agent of specific cell toxin such as the anti-mitosis agent in a kind of cell cycle and come optionally and effectively to kill tumour cell. Those of ordinary skills know the cell cycle specific cell toxin agent that the cell in concrete stage of cell cycle has toxicity. This kind method comprises the following steps:

(a) make and remove the static tumour cell that step produces by above-mentioned methionine and contact with the methionine of the consumption that can bring out the cell cycle, starting the cell cycle of the cell (cycling-cells) that the static tumour cell cycle of formation grows, and

(b) cell of cycle growth is contacted with the specific cell toxin agent in a certain amount of cell cycle. The cell toxin agent consumption of this kind cycle growth will be enough to suppress the mitosis of mitosis cell, the thus growth of inhibition tumor cell.

In a technical scheme, this kind method comprises the following steps:

(a) make the static tumour cell that is produced by above-mentioned methionine removal step contact to start the mitosis that a cell is arranged that forms static tumour cell with the methionine that can bring out cell cycle consumption, and

(b) the mitosis cell is contacted with a certain amount of anti-mitosis agent, the anti-mitosis agent of this kind consumption will be enough to suppress the mitosis of mitosis cell, the thus growth of inhibition tumor cell.

According to an aspect of the present invention, provide the method for a kind of patient's of diagnosis tumour, having comprised: a) removed in patient's body by take methioninase to the patient¹²The C methionine; B) by taking to the patient¹¹The C methionine comes to ample supply methionine in patient's body; And c) exists in the mensuration patient interior tumor cell¹¹The level that the C methionine raises.

Another feature of the present invention is to reduce the dangerous and Cardiovarscular of cardiovascular disease with the cysteine levels in the reduction patient body with methioninase.

The invention provides the method for carrying out diagnosing tumor and radiography by the administration methioninase to remove methionine.

Another characteristics are to remove the therapeutic combination for the treatment of method for methionine, it contains the effectively substantially isolated methioninase of amount for the treatment of, the specific activity that this kind methioninase has is that methioninase activity and every milligram of albumen of every milligram of about at least 10 to 40 units of (mg) albumen is less than about 1 to 100ng endotoxin, in preferred scheme, this therapeutic combination comprises that every milligram of albumen is less than the endotoxin of 10ng, with a kind of pharmaceutically suitable carrier.

Therapeutic combination of the present invention also comprises the methioninase that does not contain endotoxin, in a technical scheme, methioninase be use a kind of new effective method from the pseudomonasputida of under the fermentation condition of improvement, growing (Pseudomonas putida) in make. The present invention also provides a kind of method of pseudomonas putida bacterial strain of High-efficient Production methioninase of separation improving in this respect. In another scheme, methioninase is to be produced by the recombinant host of the expression model that contains the methioninase of encoding.

The form that methioninase composition of the present invention also can be modified with a kind of chemistry by methioninase being coupled to polymer such as polyethylene glycol (PEG) provides. The methioninase that the PEG that the present invention uses modifies has the activity of efficient removal methionine, the half-life of prolongation and reduced immunogenicity.

Methioninase composition of the present invention also can utilize a kind of expression vector as herein defined the form of the restructuring albumen produced of efficient expression vector provide. Employing efficiently expresses the methioninase that system produces and can come purifying to obtain not contain endotoxin and very pure methioninase composition with method described herein with being easy to, and said composition has the specific activity of about 10 to 40 unit/milligram methioninases.

The present invention also provides the carrier that contains the nucleic acid that can express the high content methioninase that must be out of sight. Now used this kind carrier such as those to use the carrier of t7 rna polymerase promoter, under suitable incubation conditions, produce about 1 to 4 gram methioninase/liter methioninase, its specific activity in rough tissue homogenate is about 2.6 to 5, can be expressed as 10% to 20% of about total cell protein.

The present invention also provides gene therapy method, i.e. use as herein described can be used for substituting the method for the clone's contain the methioninase composition methioninase gene. Cell in patient's body can be changed to express methioninase provides the treatment amount for patient's serum methioninase.

The invention still further relates to isolated nucleic acid molecule, the nucleotides sequence and the one or more nucleic acid sequence that can hold the two or more histidine residues of coding at C-or the N-of methioninase that provide among Fig. 8 are provided.

The invention still further relates to and use a kind of gene therapy of expressing the improvement of model.

Other features of the present invention, advantage and relevant scheme will be set forth as main take the specification that this paper was comprised.

The accompanying drawing summary

Fig. 1 be described in detail in 6 figures do not contain methionine, do not contain homocysteine or do not contain methionine and the homocysteine culture medium in the growth of tumor cell line.

Fig. 2 illustrates that in detail methioninase reduces the validity of people's lung neoplasm (H460) level of growth in mouse heterograft. The result of 5-FU and vincristine treatment also has been described in detail.

Fig. 3 illustrates that in detail methioninase, 5-FU and vincristine are to transplanting the body weight effect of human lung cancer (H460) mouse.

Fig. 4,5 and 6 shows the pharmacokinetics of taking methioninase and methionine after the methioninase to three patients. With the relative percentage of the active percentage of methioninase as the initial preparation activity of methioninase. With the percentage of methionine as the relative percentage of taking methionine before the methioninase.

Fig. 7 is the detailed explanation to methioninase-homocysteine metabolism circulation.

Fig. 8 provides nucleotides sequence and the corresponding amino acid sequence of the methioninase of the coding methioninase dna molecular of separating from pseudomonas putida.

The model of typical high expressed in Fig. 9 diagram carrier.

Figure 10 briefly explains the purification step sketch that obtains high-purity, do not contain the methioninase of endotoxin.

Figure 11 summarizes typical purity and the rate of recovery of RMETASE (rMETase) when using purification process as herein described.

Figure 12 provides the example that adopts the inventive method purifying rMETase product.

Figure 13 provides the activity figure of the rMETase of different dosage form.

Figure 14 provides the analysis data to the HPLC of PEG-rMETase.

Figure 15 shows the activity of minute period of the day from 11 p.m. to 1 a.m PECT-rMETase of different PEG and rMETase.

Figure 16 provides the pharmacokinetics of PEG-rMETase in the mouse body.

Figure 17 shows that rMETase is to the growth inhibition effect in the cultivation of KB3-1 cells in vitro.

Figure 18 provides the validity of the KB3-1 cell of the anti-naked mouse of rMETase.

Figure 19 provides the toxicity of heavily showing rMETase with nude mouse.

Figure 20 provides the rMETase toxicity of the naked mouse blood cell to having transplanted the KB3-1 cell.

Figure 21 provides the toxicity of rMETase to BALB/C mice.

Figure 22 provides the toxicity of rMETase to BALB/C mice.

Figure 23 provides the toxicity assessment to methioninase among the people patient.

Figure 24 provides the pharmacokinetics evaluation to methioninase among the people patient.

Figure 25 provides and has confirmed that rMETase is to the data of the growth inhibition of the H460 in the nude mouse and HT29.

Figure 26 provides the contrast to the sensitiveness of rMETase of external normal cell and human cancer cell.

These accompanying drawings are unnecessary to be drawn in proportion, and some feature of the present invention can represent in the ratio amplification and in order to know with concise and to the point form with sketch.

Summary of the invention

A. definition

" amino acid residue " refers to the formed amino acid of chemistry digestion (hydrolysis) polypeptide on the polypeptide peptide chain. Amino acid residue as herein described refers in particular to " L " optics isomeric forms. But as long as polypeptide has kept required function characteristic, the residue on " D " optics isomers can be replaced by any L-amino acid residue. NH₂-refer to be present in the N-terminal free amino of polypeptide. COOH refers to be present in the free carbonyl of polypeptide carbonyl end. This paper kept standard the polypeptide nomenclature (J.Biol.Chem.，243: and 3552-59,1969 is described, and by 37C.F.R.1.822 (b) (2)) adopt, be cited as reference paper here.

It should be noted that aminoterminal that this paper uses all represented amino acid residue sequences of general formula all is from left to right orientation to the general direction of carboxyl end. In addition, phrase " amino acid residue " widely is defined as comprises amino acid listed in the amino acid table and improvement and amino acid that be of little use, as be listed as in this paper and be cited as those amino acid among the 37CER 1.822 (b) (4) of reference paper. And, should be noted that at amino acid residue sequence and play top or terminal short-term represents to the peptide bond of another single or a plurality of amino acid residue sequences or to aminoterminal group such as NH₂Or acetyl group or carboxyl end groups group such as the covalent bond of COOH.

" restructuring DNA (rDNA) molecule " refers to connect two formed dna moleculars of dna fragmentation by operability. So recombinant DNA molecules is the dna molecular that contains the hybridization of at least two nucleotides sequences that common discovery is not together in nature. There is not the upper different rDNA that namely evolves of identical biological origin to be called " allos " rDNA.

" carrier " refers to the rDNA molecule that can independently copy and for accompanying section is copied in cell, the rDNA molecule of can be operably connected DNA section such as gene or polynucleotides. This paper expresses the gene of the one or more polypeptide of coding leading carrier is called " expression vector ". Important especially carrier can be expressed methioninase albumen of the present invention easily.

B. use methioninase as antitumor dose method

I. the removal of methionine

This paper come from tumour cell, tumor tissues with methioninase as antitumor dose in various modes or suffer from basically remove the mammiferous circulatory system of cancer methionine or below this paper described in detail think need to remove in the situation of methionine, remove methionine.

Be not less than about 35 μ m although existing method can be reduced to the methionine content in the body, also do not have at present a kind ofly can be reduced to the method that almost is lower than about 10 μ m to methionine content safe, easy and rapidly. Basically refer to use the conventional determining method of methionine can record at least methionine content and be lower than 10 μ m, preferably be less than 1 μ m, more preferably less than 0.1 μ m, preferably can not measure the content of methionine. Use certain methods at the aqueous solution, to comprise in body fluids such as blood, blood plasma and the serum determining methionine. A method that illustrates is to use the anti-phase FPLC method of methionine reference material.

In body, in the mammiferous circulation, need to remove under the vitro conditions of methionine at tissue culture or other biological culture medium, and at manipulation in vitro biological fluid, cell or tissue and then put back in body method, can both remove in the body of mammalian subject.

The removal of carrying out methionine from circulation, culture medium, biological fluid or cell is the amount that enters the methionine that will treat thing in order to reduce, therefore it is included in lower the material that will remove of condition of removing methionine and contacts with the methioninase of the present invention of removal methionine amount, degrades to be touched methionine in the material.

Because tumour cell depends on the methionine in their nutrition culture mediums, thus can remove the nutrition source of these cells, and needn't remove these cells itself. Therefore, in body, use the present invention, methioninase is contacted with the nutrient media of tumor cell group. In this kind scheme, medium can be the body fluid that blood, lymph liquid, cerebrospinal fluid etc. need to remove methionine.

The amount of removing methionine can change in wide range according to the difference of using, and depends on that generally the amount of the methionine that exists in the material, required removal speed and this material are for the tolerance that is exposed to methioninase. Use various chemistry known in the art and biochemical method can monitor the content of the methionine in the material with being easy to and from this material, remove the speed of methionine. This paper has also described the example of removing the methionine amount, and wherein in every milliliter of substance to be processed, the scope of methioninase is 0.001 to 100 unit (U), preferably approximately is 0.01 to 10U, and more preferably about 0.1 changes in the scope of 5U methioninase.

The condition of removing methionine is buffering liquid and the temperature condition that the biologically active with methioninase adapts, and comprises temperature, salt and the pH condition of the mitigation that adapts with this enzyme. Although preferred physiology condition, the example of condition comprise 4-40 degree centigrade (℃) about, the ion intensity with respect to 0.05 to 0.2M NaCl and about 5 to 9 pH.

In a preferred scheme, the present invention has imagined and uses methioninase as antitumor dose method, so it comprises that the methioninase that tumor cell group and treatment are effectively measured contacts one period that is enough to bring out the cell cycle arrest of the cell in the colony, and forms static tumour cell.

As described herein, owing to various reasons, include but not limited to, optionally slow down the growth of tumour, the period by the cell of stagnating the phase being kept an elongated segment and kill tumour cell and before the chemistry treatment of following, prepare tumor cell group etc. as the cell cycle synchronisation take the method that produces cell death, all need to make tumour cell to be in the cell cycle arrest phase.

Bring out the required time of cell cycle arrest and depended on several factors by contacting with methioninase, as with this cell or contain the amount of the methioninase that the culture medium of this cell contacts, the amount of methionine, the specific activity of enzyme, the reaction condition of temperature and other influences reaction speed and parameter of being easy to control by the implementer etc. Be about 10 minutes to 30 days typical period, preferred about 1 hour to 20 days, and more preferably about 1 to 10 day.

The stagnation in cell cycle is a kind of like this state, and wherein cell neither divides also and do not circulate by whole periodic processes, and each stage is called respectively G₀、G ₁、G ₂With the S phase. As confirming that by the accumulation with respect to normal tranquillization cell DNA in case it is believed that the removal methionine, the cell cycle can stop at S/G₂Stop late period. Measure by various Histological methods, method that can the identification of cell cycle arrest, and can cultivate thing evaluation with cell, the method as be shown in the examples comprises the dna content of measuring the cell group.

The tumour that this methods for the treatment of can be used for comprises the malignant cell of any malignant cell type as finding in solid tumor or blood tumour. The example of solid tumor includes but not limited to the tumour of following organ: pancreas, colon, caecum, stomach, brain, head, neck, ovary, kidney, larynx, sarcoma, lung, bladder, melanoma, prostate and breast. The example of blood tumour comprises marrow tumour, T or B cell malignancies, leukaemia, lymthoma, blastocyte knurl, myeloma etc.

In a scheme, by in the vein or intraperitoneal injection administration patient effectively amount a kind of contain the composition that can tolerate on the physiology of methioninase of the present invention and finish contact in the body, the methionine source of removing thus the tumour cell that is present in patient's body-internal-circulation. Also can be by methioninase be finished the contact of methioninase to the administration of organizing that contains tumour cell.

The treatment of methioninase effectively amount is to reach that the methionine in tumor tissues or the patient's circulation is namely removed in required effect and therefore the premeasuring of calculating makes tumour cell stop division.

So the dosage scope of taking methioninase of the present invention is to be enough to produce the dosage scope that required effect namely reduces tumour cell division and the disease in cell cycle. This dosage is not so large as to cause disadvantageous side effect, such as the too high symptom of viscous, pulmonary edema, congestive heart failure etc. To change along with patient's the different of age, health, sex and disease degree by dosage, this is that those of ordinary skills can determine.

If there is the complication doctor can adjust this dosage.

The effective amount of the treatment of methioninase of the present invention generally is a kind of like this dosage, be enough to make blood vessel interior (blood plasma) or local methioninase concentration to reach every milliliter of about 0.001 to 100 unit (U) when namely taking the composition that can tolerate on a kind of physiology, preferably more than 0.1U, more preferably every milliliter more than the 1U methioninase. Common dosage is to be as the criterion with body weight to take, and at approximately 5-1000U/kg/ days, preferably approximately 5-100U/kg/ days, more preferably about 10-50U/kg/ days, most preferably in about 20-40U/kg/ days the scope.

In a preferred method, used methioninase is substantially free of endotoxin, further discusses as this paper. Particularly preferably be the methioninase that is substantially free of endotoxin that uses the restructuring body to produce.

This methioninase can be by injection or is failed gradually and annotate one period through the enteron aisle external administration. Methioninase also can be by in the vein, in the artery, in the peritonaeum, in oral cavity, muscle, in subcutaneous, the chamber, through skin, percutaneous drug delivery, can transport by the wriggling mode, perhaps be injected directly into the tissue that contains tumour cell or come administration by the pump that links to each other with the conduit that contains potential bio-sensing device or methionine.

The common intravenous administration of therapeutic combination that contains methioninase is such as injection units dosage. Term " UD " refers to be suitable for the physically discrete unit of curee's single dose when being used for the specification of therapeutic combination of the present invention, active material and required diluent that each unit contains the premeasuring that can produce required treatment effect are carrier or excipient (vehicle).

Said composition is in the mode consistent with formulation and a kind ofly treats effective amount administration. The amount of giving depends on the object for the treatment of, ability and the required treatment effective degree of this objective system to using active component. Need the accurate measuring of the active component of administration to determine in doctor's judgement and all be that each individuality is unique. But, herein disclosed is the suitable dosage scope that system uses, it depends on the approach of administration. Also carefully considered suitable initial administration and strengthened the method that dosage is injected that the feature of this kind method is the dosage that initial administration is then injected again at the interval of one or more hour or administration repeats. This paper describes the example of multiple dosing, it particularly preferably continues to keep serum or organizes the high content of methioninase and continue on the contrary the low content keeping serum or organize methionine. On the other hand, also carefully considered to be enough to the concentration in the blood in the body is maintained to the continuous intravenous injection of the special range of interior therapeutic.

II. the removal method of methionine

In realizing method of the present invention, by can be the material that contains methionine also can be with one or more methionine removal steps of adding with removal methionine that above-described methioninase contact the time. And the present invention has considered to remove the various treatment steps of methionine, and this paper can further describe.

A. the hungry method of methionine

For example, methionine content around can reducing first with the hungry step of methionine, wherein should the hunger step comprise that tumour cell is contacted one period with the nutrients that does not contain methionine be the methionine hunger period, this step can be with before methioninase contacts step or carry out in the process. The culture medium that the hungry step of methionine can be included in external use shortage methionine is low content or the culture medium that does not have methionine, and perhaps the interior use of body does not contain the diet of methionine. The culture medium that does not contain methionine is known in field of tissue culture. An example of this culture medium is the basic culture medium (lacking methionine and chlorination choline) that contains the Eagle of nonessential amino acid, as obtaining from GIBCO. The amino acid diet that lacks methionine also can obtain with commercial sources, comprises from Teklad, TD 92077 diet that Inc. obtains.

The time of the hungry step of methionine can change on a large scale according to the difference of concrete application, and it is to be enough to make cell to cultivate thing, and the methionine concentration of tissue or blood vessel drops to reduced levels and stops the time that this level further descends. The typical time can be from about 6 hours to 2 months, and preferably approximately 1 day to 2 weeks.

Because methionine is a kind of essential amino acid, should be understood that in the use of many inventive method all to a certain extent normal cell is had toxicity. But, as described herein, normal cell and tumour cell be the precursor homocysteine of metabolism methionine differently, and homocysteine can replenish the shortage of methionine in the normal cell like this, does not save again tumour cell to the dependence of methionine simultaneously.

So, in a relevant scheme, the present invention has considered a kind of method of using the nutrients (culture medium or diet) that lacks methionine, and it can add precursor such as homocysteine or its similar thing of the used methionine of normal cell, and essential nutritional supplementation is provided. With about 5 to 200 μ M preferably approximately the concentration of 10 to 100 μ M in the nutrition culture medium, add homocysteine.

The precursor that is used for the preferred methionine of this scheme comprises L-homocysteine-thiolactone, homocysteine and 4-methyl sulphur-2-oxy butyrate.

So, in a scheme, the present invention includes and feed the step of one period of mammal with the diet of methionine deficiency and remove methionine in the blood vessel. This kind diet can be chosen wantonly and comprise that methionine precursor is as the fill-in of methionine. On the other hand, this kind methionine precursor also can be taken by injection or other approach of knowing. As the homocysteine of diet supplement preferred every day of dosage be every day every kg body weight about 5 to about 1000mg homocysteine.

The method of administration of homocysteine is generally the same with the approach that adds methioninase, and it depends on the target tissue that transports this fill-in arrival.

B. the competitive inhibitor of methionine ester

According to the observation described in the embodiment, we further find to use the competitive inhibitor of methioninase to can be used to the effect that collaborative property enhancing methionine as herein described is removed method. So the present invention considers that using the hungry step of methionine also to comprise contacts one period that is enough to utilize with methionine enzyme inhibition Methionine metabolism to tumour cell with the competitive inhibitor of a certain amount of methionine. Be used for instructing the methioninase of competitive inhibitor to comprise the SAM decarboxylase, methionine t-RNA synzyme and methionine adenosyltransferase.

Suppress the required time of methioninase preferably at methionine hunger period itself.

The competition of the competitive inhibitor of methionine and methionine utilizes the substrate of enzyme as methionine, and the effect of the normal metabolism that may produce by the endogenous methionine of direct competitive, that is to say the metabolism that suppresses methionine. Need the place of methionine and methionine cometabolism, this competitiveness inhibitor to play a part to reduce Methionine metabolism at cell, thereby need higher methionine concentration to produce the identical effect of effect of observing when not having inhibitor.

The competitive inhibitor of methionine can be any methionine derivative with typical competitive inhibitor function. General competitive inhibitor comprises the alkyl derivative (being the alkyl thionine) of methionine, wherein the methyl of methionine (being methionine) can be replaced by ethyl (second methyllanthionine), replaced (rosickyite propylhomoserin) by propyl group, replaced (fourth methyllanthionine) by butyl, perhaps replaced (penta methyllanthionine) by amyl group.

Also consider ring leucine and halogen are used as the competitive inhibitor of the methionine that can utilize for methionine. General halogen for methionine be selected from fluoro methionine, chlorine for methionine, bromine for methionine and iodo methionine. So the competitive inhibitor of the methionine of considering is selected from and comprises alkyl thionine, ring leucine and halogen for some materials of methionine, wherein said alkyl thionine is not methionine.

The amount that competitiveness is suppressed the competitive inhibitor of the effective methionine of methionine is the amount that can produce the effect of reduction in the valid density of methionine. This kind amount generally is to surpass one mole with respect to the methionine that exists, and this is as shown among the embodiment. The scope that suppresses dosage generally is with respect to methionine concentration in the culture medium that has the methionine of being competed, and surpasses 10 to 1000 times of moles, preferably surpasses at least 20 times of moles, more preferably surpasses at least 50 times of moles. As shown here, when using inhibitor in body, dosage generally is every kilogram of about 5-30mg of the weight of animals, preferably approximately 25mg/kg.

The amount of required inhibitor can depend on the amount of the endogenous methionine that exists when taking this inhibitor in the time of effectively. Can confirm the relation between the valid density of methionine concentration and inhibitor by shown in an embodiment dose titration result, and can limit by the typical reaction speed theory of competitive inhibitor. The typical amounts of inhibitor is to about 1mM from about 10 μ M.

And, can predict effective consumption of inhibitor by vitro tissue cultivation method described herein, this kind method comprises and at first adopts any method described herein to set up effective condition in removing the specific tumor tissue of methionine, then measures the valid density of inhibitor.

Use various indicator to comprise that the indicator described in the embodiment can monitor the metabolism of using the competitive inhibitor of methionine to suppress methionine. These indicator are included in fed in the mouse that does not contain the methionine diet, measured the dna content of tissue culture, stopped and strengthening the indicator of inhibition tumor tissue growth as the cell cycle. Other indicator also are very clearly for those of ordinary skills.

C. use multiple methionine to remove the synergy of method-anti-methionine amic therapy method

In a scheme, in order to utilize the synergy that occurs when using two or more different methionine to remove method, the present invention considers that use often is called the multiple methionine removal method of anti-methionine amic therapy method.

Methionine removal method described herein comprises that (1) use does not contain the hungry method of methionine of culture medium (external) or the diet (in the body) of methionine, (2) be exposed to methioninase and remove endogenous property methionine with the method that adopts enzyme, (3) reduce the valid density of endogenous methionine with the competitive inhibitor of methionine, particularly with the combination of above-mentioned (1) and (2) method, wherein the content of methionine reduces, and (4) increase selective to tumour cell of any a kind of in other three kinds of methionine removal methods with the precursor of methionine and homocysteine described herein.

So, concerning the removal of methionine, can use any a kind of combination of above-mentioned defined method, comprise (1)+(2), (1)+(3), (2)+(3), any a kind of the adding (4) of (1)+(2)+(3) and these four kinds of combinations, carried out the chemotherapy of anti-methionine described herein.

Concerning removing to greatest extent methionine and its metabolite, particularly preferably use does not contain methionine but contains competitive inhibitor and the methioninase that methionine precursor also uses methionine simultaneously.

III. the tumour treatment that strengthens anti-mitosis agent acts in another scheme, the present invention considers in method with methionine removal method as herein described increases (enhancing) the selective of the used antimitotic drug of the effectiveness of therapy and selective, particularly treatment of cancer that routinize.

Methionine remove main purpose that step and conventional anti-mitosis therapy be combined be utilize such a case namely before mitosis methionine remove method can be optionally and stop specifically the hyperplasia of tumour cell, like this in case use again the ample supply methionine to cell, tissue, culture medium or vascular system, static cell can begin the cell cycle synchronously, so that the consistent hyperplasia of cell group and be subject to easily the effect of cell cycle specificity chemotherapy. Stagnate the phase in order to make tumour cell enter cell, can use the cell toxin agent in any cell cycle. This kind medicament is known for those of ordinary skills. In a preferred scheme, the cell toxin agent in this cell cycle is a kind of anti-mitosis agent.

So in a preferred scheme, the present invention considers a kind of anti-tumor chemotherapeutic method, it comprises that removing step with methionine as herein described forms static tumour cell, then with other step:

(a) static tumour cell and the methionine that brings out cell cycle consumption are contacted to start the mitosis of static tumour cell, be formed with a somatoblast, and

(b) the mitosis cell is contacted with a certain amount of anti-mitosis agent, this kind consumption is enough to suppress the mitosis of mitosis cell, thus the growth of inhibition tumor cell.

Methionine, methionine salt and function equivalent thereof with the cell periodic function that starts static cell are called the cell cycle bring out agent, and can use together or on the other hand in the tumor cell group of having removed methionine as starting cell cycle in one or more static cells and the reagent of mitosis.

The amount of bringing out the cell cycle that the cell cycle is brought out agent is to start at least (10%) in the tumor cell group of having removed methionine, preferred great majority, the more preferably consumption in the cell cycle at least 90% the static cell. Using-system label that learn or metabolism can be measured startup and the degree in cell cycle with being easy to. Concerning methionine, bring out the consumption in cell cycle generally at the scope of about 1 little mole (μ M) to about 2.5 milli moles (mM), preferably approximately 10 to 250 μ M. When the ample supply methionine, can be used for attack still any tumour cell in the S phase to the specificity medicine of S phase equally.

The cell cycle is brought out agent contacts (use) with static tumour cell approach can change, but general and described herein to take the used approach of methioninase or competitive inhibitor identical.

Make static tumour cell and cell cycle bring out the arrangement of time that agent contacts and can change according to tumour and the different of other considerations with period, this kind consideration can decide by method for tissue culture as described herein according to experience. Cycle is brought out agent can have a release agent almost to add simultaneously before anti-mitosis agent or with anti-. Specifically anti-ly there is a release agent to work rapidly and bringing out of cell cycle is slowly the time when being measured to, added before anti-mitosis agent that to bring out agent be favourable. These parameters depend on the particular type of tumour, the position of tissue, the selection of anti-mitosis agent etc. And, using methods for the treatment of before vivo medicine-feeding, can measure the selection of variable such as the selection of time, dosage and the medicine of optimization by various methods with being easy to. Preferred optimal method is to use tissue described herein to cultivate the example of mensuration system.

Bringing out the cell cycle of static tumour cell depended in the selection that contacts a kind of arrangement of time of anti-mitosis agent. The cycle whenever generally can both be the cells contacting of anti-mitosis agent and mitosis, and make cell become the mitosis cell at once. Concerning some tumor cell group, this kind situation can occur rapidly after agent is brought out in adding, brings out agent and anti-mitosis agent so that can or be close to add simultaneously to the while in the static tumour cell. On the other hand, bring out agent in adding and can add anti-mitosis agent after about 1 hour to 30 days, but preferred within a day or two days of bringing out.

Anti-mitosis agent used herein can be for the cell hyperplasia, any reagent that silk separates or the cell cycle has the mechanism on cell toxicity basis is arranged with other special preparations of cell cycle. So anti-mitosis agent can comprise the i.e. anti-metabolism agent of various compounds, or other have in the compound of toxicity any one to division (mitosis) cell. It is inhibition to the cell mitogenic isolating active that the preferred clinical pharmacology that is used for the anti-mitosis agent of the inventive method is learned, the inhibition that, alkanisation agent synthetic to nucleic acid, antibiotic, alkaloid etc. are antitumor dose. Improve constantly with regard to the pharmacology field, should be understood that the present invention is not limited at present known anti-mitosis agent and other cell cycle specific preparations, but comprise compound and other reagent with necessary activity that uses known equivalent, new discovery or exploitation.

The example of alkanisation agent comprises endoxan (CTX; Cyclophosphamide), Chlorambucil (CHL; Pain can be rather), suitable chlorine ammonia platinum (CisP; Chlorine ammonia platinum), diformazan sulfonic acid butanediol diester (busulfan), Phe mustargen, carmustine (BCNU), chain urea bacterium element, the close amine of triethylene (TEM), mitomycin C and other alkanisation agent.

The example of anti-metabolite comprises methotrexate (MTX), sufficient leaf second glucoside (VP16; Podophyllum emodi var chinense ethylidene glucoside), 6-MP (6MP), 6-thiocquanine (6GT), cytosine arabinoside (Ara-C), 5 FU 5 fluorouracil (5FU), nitrence azoles ammonia (DTIC) and other anti-metabolism agent.

The example of antibiotic comprises pay-off wire bacterium element D, adriamycin (DEX; Inferior Baudrillard mycin), many promises mycin (daunorubicin), bleomycin, mithramycin and other antibiotic.

The example of alkaloid comprises Vinca alkaloids such as vincristine (VCR), vincaleukoblastinum etc.

Other antitumor dose comprises Japanese yew phenol and derivative thereof, Cell growth inhibition agent glucocorticoid such as dexamethasone (DEX; Dexamethasone) and cortex steroid class such as prednisone, nucleosides enzyme inhibitor such as hydroxyl urea, amino acid are removed enzyme such as asparagus fern acid amides enzyme and other panoramic antitumor dose.

Synthetic and the preparation of above-mentioned anti-mitosis agent (cytotoxic agent) all is that people are known, in various firsthand information description is arranged, so just no longer repeat here. Firsthand information example synthetic and the preparation mentioned reagent comprise " physician's desktop with reference to " (Physicians Desk Reference), Barnhart, eds., Medical Econom ics Company, Inc., Oradell, N.J., 1992; " Merck index " (Merck Index), the 11st edition, Merck ﹠ Co., 1989.

Using the agent of above-mentioned cell toxin in embolic chemotherapy generally is the obvious characteristic of field of cancer treatment, uses them here, also relates to monitoring tolerance and validity and control method of administration and dosage. For example, the actual dose of this cell toxin agent can react to change according to the patient's who cultivates who measures with existing method for tissue culture cell. General this dosage will reduce than lacking synchronous employed amount of cell cycle, and this is as shown in the specification of the present invention.

The exemplary dosage of effective cell toxin agent can be in the scope that manufacturer is recommended, and can be reduced at the most concentration or the consumption of an about magnitude by vitro reactions or the represented dosage of animal model reaction. So, this actual dosage will depend on doctor's judgement, the vitro responses of the tissue sample that patient's health and the validity of methods for the treatment of, this kind validity are cultivated with the malignant cell of initial cultivation or tissue or in suitable animal model viewed reaction be as the criterion.

IV. gene therapy

In another scheme, according to the contact method of methioninase of the present invention, the present invention considers at tissue or is treated in the tissue lymphocyte on every side and expresses methioninase with rDNA. For obtaining this result, can expect by the expression of the methioninase expressing gene that can control and thus, the methioninase gene outcome of generation and be used for the contact step methioninase is provided.

As previously described, at present known have a large amount of suitable expression vectors to can be used to express the methioninase that can use. In a scheme, the expression of methioninase gene can be controlled. So an expression vector has the second nucleotides sequence of article one sequence that can be operably connected to the coding methioninase, this has also defined the means of regulating the methionine enzyme gene expression. An example of this kind regulating measure is inducible promoter, and promoter most preferably is tumour-specific. With the expression model of a kind of promoter of tumour-specific control methionine enzyme gene expression, these express models is useful especially to gene therapy as herein described.

The promoter that one class can be brought out has reaction to the component that can add in the culture medium, or is penetrated in the host's cell that contains gene with being easy to and expresses the methioninase gene. The promoter of other class is tumor-specific promoters as mentioned above, for example carcinomebryonic antigen (CEA) promoter.

So the present invention also considers a kind of removal method of the methionine that methioninase is contacted with tumor cell group, it comprises the following steps:

(i) in vivo or outside the live body, a kind of expression vector is imported tumour cell or imports the lymphocyte that infiltrates tumour or the cell that its bone marrow precursors cell forms the transfection of methioninase gene, wherein this expression vector has the coding methioninase and can regulate the nucleotides sequence of the expression of methioninase, and has the nucleotides sequence that the means of regulating the methioninase expression can be provided;

(ii) the cells contacting of the tumour cell in the body and the transfection of methioninase gene; With

(iii) in the nucleotides sequence of the cells of transfection coding methioninase, in the cell of this transfection, produce thus methioninase and the methioninase that produces is contacted with tumour cell. For those of ordinary skills " importing " refer to any known method of in one way expression vector being inserted target cell, wherein this target cell can be expressed gene entrained in this expression vector. This kind insertion can be carried out in body or outside the live body. Can finish this kind " importing " by the method for for example transfection, conversion or virus infections.

No matter use various known transfection methods can realize tumour cell, be to adhere in cell or the suspension or the infection of the cell in the body. After this, the cell of transfection (if using the outer transfection method of live body) is imported the host again and makes this transfectional cell be positioned at natural, near relevant, the tissue that will treat, thus the cell of transfection is contacted with the tumour cell that will treat. Use various means can realize methioninase is imported the cell of transfection, but generally need to have selective mark to exist.

In a scheme, the instrument that regulatory gene is expressed is the promoter of bringing out that the reagent that can add in the culture medium is replied. The promoter white such as metallothionein. On the other hand, the promoter that can bring out can be tumor-specific promoters. This kind promoter works to the expression of the target methioninase of tumour cell.

The cell of wanting transfection can be that tumour cell sample or normal immunocyte are as infiltrating the cell of tumour, as infiltrating lymphocyte or the bone marrow precursors cell of marrow such as stem cell or the original cell of hematopoiesis of tumour. These cells can be in bodies or are external.

Embodiment 9 has described the separation of the nucleic acid molecule of coding methioninase. This embodiment has also described and has been used for the generation that the expression vector of methioninase is produced in batches glycolysis. Skilled those skilled in the art can use clone's methioninase gene with being easy to, as providing in pAC-1, make the expression cassette that is applicable to the said gene therapy.

C. therapeutic combination

In another scheme, the present invention considers therapeutic combination, and it contains treatment effectively basically methioninase and the medicine acceptable carrier isolated, that preferably produce with the restructuring body method of amount.

L-Methionine enzyme (L-Methionine-α-deaminizating-γ-sulfydryl methane-lyase or methioninase) is for methyl be used for degrading a kind of enzyme of methionine by deaminizating effect and desulfurization. The activity of methioninase can the amount of formed α-batanone acid salt record when being determined at the methionine cracking at least. The methioninase of a unit (U) is defined as under the standard test condition amount that produced the enzyme of 1 milli mole α-batanone acid salt from methionine in every minute, such as Ito etc., " biochemical magazine " (J.Biochem.)， 79: 1263-1272,1976; And Soda, " the biochemical analysis " (Analyt.Biochem.)， 25: 228-235, described in 1968.

Methioninase can be comprised directly and being separated by the Bacteria Culture base by the preparation of many sources, is perhaps expressed by the recombinant DNA molecules of encoding proteins acid zymoprotein, for example is described in example 9 and example 12.

The bacterial origin of methioninase comprises pseudomonas putida (Pseudomona Dutida), and the false monad (Pseudomonas ovalis) of ovum shape and Aeromonas bacterium belong to the potential source of (Aeromonas) and any other methioninase. The pseudomonasputida bacterial strain can commercial sources obtain from ATCC, and enter hiding of it number is respectively ATCC 8209 and ATCC 7955. Other bacteriums generally also can obtain from academic research institution. Now described and used various method purifying methioninases. For example, referring to Kreis etc., " cancer research " (Cancer Res.)，33: 1862-1865,1973; Tanaka etc., " European biochemistry association federation communication " (FEBS Letters)，66: 307-311,1976; Ito etc., " biochemical magazine " (J.Biochem.)，79: 1263-1272,1976; Nakayama etc., " agriculture biochemistry " (Agric.Biol.Chem.)，48: 2367-2369,1984 and Soda, " the biochemical analysis " (Analyt.Biochem.)，25: 228-235,1968. But these methods all do not obtain the methioninase that does not contain endotoxin of high-purity. The invention provides two kinds of methods that are used for the purifying methioninase, this methioninase does not almost contain endotoxin like this.

A kind of preferred methioninase has the specific activity of every milligram of about 10 to 50 units of albumen (U). This paper describes the exemplary formulations of purifying methioninase, said preparation has about 10 to about 50U/mg specific activity, in embodiment 12, uses the prepared methioninase of expression vector pAC-1 to have the specific activity of about 20.1U/mg.

A kind of preferred methioninase preferably separates substantially. Separate substantially referring to this enzyme by weight in respect of at least 50% purity, preferred at least 90% purity, more preferably at least 99% purity or be uniform basically. When analyzing in electrophoretic medium such as polyacrylamide gel electrophoresis (PAGE), preferred albumen is uniform substantially. Evenly referring on PAGE only has single mensuration band.

Owing to when contacting by intravenous injection or intraperitoneal administration and with mammal physiology, do not wish that the side effect relevant with endotoxin arranged, so preferably methioninase is to be substantially free of endotoxin such as bacillary lipopolysaccharides. Being substantially free of here refers to that every milligram of (mg) methioninase albumen to being less than about 10ng endotoxin, preferably is less than 1ng endotoxin/mg methioninase, the preferred 0.1ng endotoxin/mg methioninase that is less than. Measuring endotoxin is known in the treatment field, uses various methods can carry out measuring endotoxin. Preferred method has been described in an embodiment.

Preferred methioninase is thermally-stabilised, can increase like this its storage period and validity when using under the condition of rising temperature in such as animal body. Thermally-stabilised this endonuclease capable that refers to descends to expose 10 minutes and keeps its specific activity to reach 80% preferably to keep 90% specific activity at 60 ℃, more preferably keeps 95% specific activity.

Preferred methioninase has at least 5 hours serum half-life, preferred 6 hours, more preferably at least 7 hours.

Particularly preferred methioninase is to prepare from the expression vector pseudomonas putida preparation or use the dna molecular that contains the methioninase of encoding of separating from pseudomonas putida. The pseudomonas putida methioninase has about 43,000 daltonian apparent molecular weights when PAGE-SDS analyzes under Denaturing. The method for optimizing of purifying methioninase has been described in an embodiment.

So therapeutic combination contains the carrier that can tolerate on a kind of physiology and is dissolved in or is dispersed in wherein the methioninase that separates substantially as active component. In a preferred scheme, when be therapeutic purposes to the clothes for patients time spent, this therapeutic combination is nonimmune originality.

The feature of a scheme of the present invention is the methioninase that chemistry is modified, and it comprises the methioninase that is attached on the polymer. Preferred this methioninase be separate substantially and almost do not contain endotoxin. " chemistry is modified " refers to be changed the formation any type of methioninase different from the methioninase of purifying from nature. Preferably come chemical modification methioninase by this methioninase being connected to method on polymer such as the polyethylene glycol.

As used herein, the term " pharmacy is acceptable ", " physiology can tolerate " and their variations on grammer that are used to refer to component, carrier, diluent and reagent can exchange use, and they all represent can this material administration mammal or the mankind take or to produce undesirable physiology effect uncomfortable etc. such as nauseating, dizzy and stomach taking Shi Buhui for mammal or the mankind.

In the art to comprising that the preparation that is dissolved in or is dispersed in the pharmaceutical composition of active component wherein is very clearly. Generally can make the aseptic liquid solution that to inject such as suspension, moisture or water-free solution to this kind composition, perhaps also can be made into before use the solid form that is applicable to solution and suspension of liquid. Said preparation also can be the emulsion form. Phosphatide and the liposome composition of particularly preferably being as described herein. In addition, on ointment or dispersed cover plate such as bandage, also can contain the methioninase for the treatment of amount so that the part release of this reagent to be provided.

But this active component can be with medicine acceptable and with the mixed with excipients of active component compatibility, its consumption should be suitable for methods for the treatment of as herein described. Suitable excipient is such as water, salt solution, glucose, glycerine etc. and composition thereof are arranged. In addition, if necessary, said composition can contain the auxiliary substance of the effect that can improve this active component of trace such as wetting agent, emulsifying agent, pH buffer etc.

Therapeutic combination of the present invention can comprise the acceptable salt of the medicine of component. The acceptable salt of medicine comprises with the inorganic acid of example hydrochloric acid or phosphoric acid or resembles the acid-addition salts (formed with the free amino of polypeptide) that organic acid such as acetic acid, tartaric acid, mandelic acid forms. Also can be derived by the hydroxide of inorganic alkali such as sodium, potassium, ammonia, calcium or iron and organic alkali such as isopropylamine, front three ammonia, 2-second ethylaminoethanol, histidine, procaine etc. with the formed salt of free carbonyl.

The carrier that can tolerate physiology in this area is known. The example of liquid-carrier has the aseptic aqueous solution that does not contain other materials except active component and water, or contains sodium phosphate, physiological saline or the two salt solution such as phosphate-buffering of buffering liquid such as physiological pH value. Containing in addition water carrier also comprises more than one buffering salt and resembles sodium and the chloride of potassium, glucose, propane diols, polyethylene glycol and other solutes.

Fluid composition as described herein also can comprise with the molten liquid phase of water and with water-insoluble liquid phase. The additional liquid phase example of this kind is glycerine, vegetable oil such as cottonseed oil, organic ester such as oleic acid second ester and oil-in-water emulsion, especially foregoing liposome composition.

This therapeutic combination contains the methioninase of effective amount, and general effective amount is the activated protein of every therapeutic combination gross weight at least 0.1 weight percent ratio, and preferred about at least 25 weight percent ratio. Weight percent is than the weight ratio that is methioninase and total composition. So for example 0.1 weight percent is than the methioninase that is per 100 gram total compositions, 0.1 gram.

For the methioninase composition can be used in body by blood vessel, we consider a kind of scheme of controlling the therapeutic combination that discharges methioninase of preparation, and optionally methioninase albumen is not degraded and can reduce the impact of other phenomenons of serum half-life of the methioninase for the treatment of administration.

So, in a scheme, the present invention considers and comprises the therapeutic combination that transports carrier that this transports carrier and comprises the carriers such as polymer, polymer support, granular substance, emulsion, aggregate, ion exchange resin, lipid body, enteric coating, medium, biological adhesive, microcapsules, hydrogel. Comprise the lipid body drug release carrier example at least by Tarcha at " control medicine discharge polymer " (" Polymers For Controlled Drug Delivery "), CRC publishing house, Boca Raton described in 1990.

The present invention also provides the method detailed of purifying methioninase, and the method that the method and other are known is compared, and it can provide superior productive rate and purity. Purification of Recombinant methioninase, special purifying are the method for optimizing that uses the methioninase of the conversion host generation that efficiently expresses module that contains the coding methioninase, comprise the following steps:

A) in aqueous buffer solution, the extraction thing of the conversion cell that contains methioninase was heated about 1-10 minute under about 40-60 ℃, preferably 50 ℃ of heating 1 minute.

B) in the GS-3 rotor (Sorvall, Du Pont) with about 10k to the extraction thing centrifugation about 15 minute to 1 hour of 20k rpm rotating speed after heating, preferably 4 ℃ of about 13k rpm centrifugation 30 minutes;

C) use 10mM kaliumphosphate buffer (pH8.3), use about 50k to the filter ultrafiltration supernatant liquid in 100k aperture, be preferably Millipore Pre/Scale:TFF PLHK 100K 2.5ft²The filter fuse;

D) at LIS (approximately 10-50mM) KCl and under the condition of the about pH7.0-7.6 of 10-20mM kaliumphosphate buffer, carry out DEAE ion exchange column chromatography, and collection is preferably used the DEAE-SepharoseFF post with the fraction that contains methioninase of the KCl gradient solution wash-out of 40-200mM;

E) at ionic medium intensity (approximately 50-100mM) KCl and under the condition of the about pH8.0-8.6 of 10-20mM kaliumphosphate buffer, carry out DEAE ion-exchange second time chromatography, and collect with the KCl wash-out of 100-200mM and with the fraction that contains methioninase of phosphate buffered liquid (pH8.3) wash-out, preferably use the sugared FF post of DEAE-agar; With

F) fraction of collecting in step (e) is contacted with the post chromatography media that can adsorb endotoxin, and collection wash-out liquid, from this wash-out liquid, remove thus endotoxin and form the methioninase that does not contain endotoxin, this methioninase has active and every milligram of albumen 1-199ng of methioninase of at least 20 units of every milligram of albumen, preferred 1-100ng endotoxin preferably uses Acticlean^The Etox post.

This cell extract preferably makes from the reformed host's cell that can express the RMETASE (approximately 5-75% total cell protein) of high content. On the other hand, also can be the organic matter of natural expression methioninase as starting material. Concerning the bacterium cell extract, it generally is at first to gather in the crops and wash bacterium cell cultivation thing to form cell paste/ball that thing is extracted in preparation, and depend on whether gather in the crops by centrifugal separation method or hollow fibre pipe filter method, these methods generally are called optical imaging.

Then, use conventional instrument cracked cell. Preferred homogenate device such as cavitation type homogenate device (the Microfluidics Corp.Model#HC 8000 cracked cells for example that use.

Resulting suspension is heated to precipitate albumen and other insoluble matters of selection. Heating condition generally be about 45-60 ℃ lower 1-10 minute. Preferred 50 ℃ of heating stepses of 1 minute.

Fragment is removed in extraction thing centrifugation after the heating, and filtering supernatant is used further to the DEAE ion exchange column chromatography media in above-mentioned two steps. Preferred absorption and wash-out condition have been described in an embodiment. In these steps, can use any a kind of of various DEAE ion exchange column chromatography medias, and the selection of medium is not construed as limiting. Commercial source comprises Pharmacia Fine Chemicals, BioRad and Sigma.

Afterwards, remove the albumen that endotoxin production has the endotoxin of the content accepted as previously described. With any a kind of removal step that can both carry out endotoxin in the various instruments of knowing, this removal step generally comprises the albumen in the solution is contacted with a kind of post chromatography media that can adsorb endotoxin, obtains containing the post chromatography media wash-out thing that does not contain endotoxin albumen. The preferred commercial reagents that is used for removing endotoxin is Acticlean^Etox。

D. the methioninase of chemical modifying

For the half-life that prolongs methioninase and immune originality or the antigen that reduces it, can be combined methioninase with a kind of polymer.

In undue responsive individuality, there is allergic possibility. On the other hand, the antibody of anti-methionine enzyme can shorten the half-life of methioninase.

Now attempt various approach and solved the antigen problem of polypeptide and albumen. To albumen, be polymer such as polyethylene glycol conjugation one of approach that reduces protein antigenicity. The present invention relates to use a kind of methionine chemical modification of enzyme of novel effective method production, it comprises lower purifying methioninase of condition and polyethylene glycol (PEG) coupling in the maintenance enzymatic activity. The half-life that PEG-rMETase of the present invention has prolongation does not have apparent immune originality.

The new methioninase of being combined with polyethylene glycol (" PEG-rMETase " or " methioninase of PEGization ") has high methionine and removes half-life and reduced immunogenicity active, that prolong. Therefore the PEG-methioninase provides a kind of maintenance stability, prolongs serum half-life, reduces immune originality and falls the new tool that hypotoxic inhibition tumour is grown.

The present invention stable, methionine removes effectively, the long half-lift of having and be that the PEG-rMETase of nonimmune originality can be as antitumor dose of multiple dose safely and effectively. PEG-rMETase can be kept in the liquid preparation of the 0.12M sodium chloride in the 10mM sodium phosphate (pH 7.2) under-70 ℃, 4 ℃ and room temperature, and loss of activity not.

Important is, PEG-rMETase of the present invention is nonimmune originality, this so that it be particularly suitable for treating responsive to methioninase and need the cancer patient of repeat administration. This area common those of skill in the art understand, with the same with methioninase, PEG-rMETase can provide with multiple formulation.

The preferred formulation of the methioninase that does not have endotoxin of purifying is to be dissolved in the 0.12M sodium chloride solution in the 10mM sodium phosphate buffer (pH7.2) with the concentration between 0.06M and 0.2M. Activity is about 10 unit/mg.

The methioninase of PEGization can be by the known method test of the common those of skill in the art in this area. For example can measure with test in the body pharmacology, security and the function feature of the PEG-rMETase of the inventive method preparation.

These tests can comprise acute toxicity, pharmacokinetics, the removal of methionine in serum of measuring PEG-rMETase, and the immune originality of evaluation PEG-rMETase.

The PEG-rMETase without endotoxin of purifying is injected in the tail vein of mouse, and blood sample collection every two hours. Measure the level of measuring methioninase by activity. Measure the level of methioninase after the methionine derivatization with HPLC.

Can in any suitable experimental animals, carry out studies on acute toxicity, illustrated such as embodiment 5 and 15. In the mouse body, 10-100 unit/1-10mg PEG-rMETase is injected its tail vein. Record live body signal and visual observations. Blood sample collection before injection, and after injection blood sample collection every two hours. Measure methioninase activity and Methionine Levels. Also measure the function of kidney and liver function. With standard technique mensuration tissue there is free of toxic effects such as lung, kidney, liver and brain. Also analyze blood sample and marrow.

In another embodiment, methioninase is combined with a polymer, has produced a kind of composition of basically non-immunogenicity, and also causes the increase of active half-life of methioninase in the body.

In one example, methioninase has carried out chemical modification by being combined with a polymer.

In another example, methioninase is by modifying with the quilt chemistry in conjunction with effect of poly-ring oxygen alkane (polyalkylene oxide), and the example of poly-ring oxygen alkane includes but not limited to gather oxirane, poly-expoxy propane, oxirane copolymer and epoxy propane copolymer.

In preferred embodiment, methioninase is modified by chemistry by being combined with polyethylene glycol.

In another preferred embodiment, be substantially free of endotoxin in conjunction with the methioninase of polyethylene glycol.

The present invention also provides a kind of pharmaceutical composition, and it contains the effectively methioninase of being combined with polymer of amount for the treatment of. This polymer can be poly-ring oxygen alkane, such as but not limited to the copolymer of poly-oxirane, poly-expoxy propane, oxirane copolymer and expoxy propane.

A kind of pharmaceutical composition is provided in a preferred embodiment, and it contains the effectively methioninase of being combined with polyethylene glycol of amount for the treatment of. In another preferred embodiment, pharmaceutical composition contains methioninase endotoxin and that be combined with polyethylene glycol that is substantially free of of the effective amount for the treatment of. Prepare in the material that this kind composition can separate from the organism of natural production methioninase, perhaps preferably from being changed to express host's preparation of methioninase.

A kind of method for preparing without the endotoxin methioninase also is provided, and described method is by without endotoxin methioninase and polymer coupling, and generates the methioninase without endotoxin that non-immunogenicity chemistry is basically modified.

In a preferred embodiment, the method comprises methioninase and polyethylene glycol conjugation.

In another preferred example, by carrying out coupling without endotoxin methioninase and the reaction of amber acid imide carbonic acid first oxygen polyethylene glycol ester.

A kind of method for the treatment of tumor patient also is provided, has comprised the effectively methioninase of amount of administering therapeutic.

In a preferred embodiment, the essentially no endotoxin of methioninase.

In another preferred embodiment, methioninase is combined with polymer.

In another experiment, polymer is a kind of poly-ring oxygen alkane.

In another preferred embodiment, methioninase is combined with polyethylene glycol.

E. RMETASE preparation

The present invention further provides the methioninase of freeze-drying or crystallization shape. In detail, found to use means known in the art, methioninase is freeze-drying or crystallization easily. The methioninase preparation of finding gained crystallization or lyophilized form has high stability, easily hydrated, and the high activity of maintenance after the rehydration.

Can obtain with various approach well known the methioninase of crystallization or lyophilized form. Use in an embodiment Verdis, freeze-drying apparatus 24 is at 100 millibars,-80 ℃, 72 hours, carry out freeze-drying and the crystallization of methioninase, those skilled in the art can adopt other methods known in the art for the preparation of the methioninase of freeze-drying or crystal form easily.

F.DNA fragment and carrier

I. the encode dna molecular of methioninase

DNA isolation molecule and promoter by the coding methioninase that is operably connected when having been found that in importing suitable host's cell, the particularly operation of rna polymerase promoter as T7 RNA polymerization promoter connection, RMETASE can be expressed with 5～75% level of about total cell proteins. Express the high level of high-level RMETASE when therefore the invention provides among the host under importing appropraite condition and express model.

Here employed high level is expressed model, or expression model of the present invention refers to comprise the nucleic acid molecules of the expression regulation element of transcribing and translating of the nucleotides sequence that is operably connected of one or more guidances coding methioninases. The expression model can be the nucleic acid molecules that separates or may reside in (hereinafter explanation) in the carrier.

The present invention expresses model and comprises the controlling element that instructs RMETASE to produce, so that the RMETASE of producing is equivalent to the 5-75% of about total cell proteins, preferably more than 10 % of total cell proteins. Preferred control element rna polymerase promoter, more preferably T7 rna polymerase promoter of expressing. The other embodiment of rna polymerase promoter includes but not limited to Tac and Trc promoter.

Promoter is the expression regulation element that is made of the dna sequence dna that allows the RNA polymerase combination and transcribe. The promoter sequence compatible with the specific host system is well known in the art, and general to provide in the plasmid carrier that comprises one or several suitable restriction restriction enzyme site. Representational such plasmid carrier is to comprise T7 rna polymerase promoter, the plasmid carrier of PT7 and PET, and it can obtain from multiple channel, as being obtained by businessman and the American Type Culture Collection.

The present invention expresses the nucleic acid sequence that model further comprises the methioninase of encoding. As used herein, when the nucleic acid molecules that contains this sequence transcribe and translate the generation of the protein that causes having the methioninase activity time, just think this nucleic acid sequence encoding methioninase.

L-Methionine enzyme (L-Methionine-α-deammoniation base-γ sulfydryl methane-lyase or methioninase) is a kind of by the deammoniation base with remove the degrade enzyme of methionine of sulphur methyl effect. The methioninase activity can record by the amount of measuring α-batanone acid that the methionine cracking generates at least. A unit (U) methioninase is defined under the standard test condition every minute and produces the amount of the enzyme of 1 little mole of α-alpha-ketobutyric acid root from methionine, and these standard conditions are described in Ito etc., J.Bio chem., 79:1263-1272,1976; And Soda, " the biochemical analysis " (Anayt.Bio chem). 25:228-235,1968.

Coding methioninase nucleic acid sequence can comprise the unaltered sequence by the organism acquisition of natural Restruction methioninase, can comprise that also being changed of organism acquisition by natural production methioninase comprises one or more nucleic acid or 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor base, disappearance or the sequence that increases.

The nucleic acid molecules of coding methioninase, no matter its change or change and can both make in any organism by natural generation protein acid enzyme, the source of optimized encoding methioninase nucleic acid molecules is pseudomonas putida (Pseudomonas putida). Embodiment 9 discloses from pseudomonas putida, the separation of coding methioninase nucleic acid molecules and sequence mensuration. Preferably encode the in addition source of methioninase nucleic acid molecules includes but not limited to vagina hair trichomonad (Trichomonas vaginalis), Brazil yen nematode Nippostrongylus brasiliensis, and Fusobacterium belongs to (Fusobacterium SP.).

The methioninase complete encoding sequence can use various methods to be obtained by various sources, those sources of particularly above quoting from. It never is the interior coding methioninase nucleic acid molecules that separates of organism of pseudomonas putida that the methioninase that Fig. 8 provides is convenient to greatly with the nucleic acid sequence.

Specifically, the those skilled in the art's nucleic acid sequence that can use easily Fig. 8 to provide prepares Oligonucleolide primers and expresses the polymerase chain reaction (PCR) of nucleic acid molecules of biology selective amplification coding methioninase from methionine being used for. The sequence that preferably provides take Fig. 8 as the PCR primer on basis to being: 5 '-GCCGGTCTGTGGAATAAGCT-3 ' (justice is arranged)

5 '-CCAGGGTCGACTCCAGCGCC-3 ' (antisense)

Use above-mentioned PCR primer preferred PCR sex change/renaturation/extension is as follows reaction time: 95 ℃ of first time 95 ℃ of sex change 10 minutes, then 94 ℃ of sex change in 30 seconds, 60 ℃ of annealing 30 seconds, extend reaction at 72 ℃ and carried out 5 circulations in 2 hours, 94 ℃ 30 seconds, in 25 cycles of 60 ℃ of sex change in 30 seconds, then extended 1.5 minutes at 72 ℃; Then extend reaction 10 minutes at 72 ℃, carry out 25 circulations. Pcr amplification product is two district's bands, collects 1365bp district band wherein, the ONCase-1DNA that purifying becomes to insert.

Perhaps, Fig. 8 nucleotide sequence fragment can use prior art by the DNA except the methioninase of being encoded by the separation of the organism the pseudomonasputida as probe. Contain about 18-20 nucleotides (about 6-7 the amino acid whose one section sequence of encoding) oligomer with approach well known preparation and use, and be used for detecting enough strictly to reduce the genome dna library that obtains hybridization under the false positive condition. (referring to Sambrook etc., " molecular cloning " (Molecular Cloing), Cold Spring Harbor Press 1989).

Being used as the dna fragmentation (i.e. synthetic oligonucleotides) of the specificity primer of probe or polymer enzyme chain reaction (PCR) and the gene order of coding methioninase can synthesize by chemical technology easily, for example, the method of phosphoric acid three esters of Matteucci etc. (" U.S. chemical institute magazine " J.Am.Chem.Soc.103:3185-3191,1981) or use automatic synthesis method. In addition, the larger dna fragment can be easily by the known method preparation, and for example then the synthetic one group of oligonucleotides that limits dna fragmentation carries out hybridization and connect oligonucleotides consisting of complete fragment.

Except take PCR and dna probe as the method on basis, the dna molecular that the polyclonal antiserum that excites with the fragments of peptides that is expected to be the former Fig. 8 of immunity or monoclonal antibody can be separated the methioninase of encoding. Such antibody can be used for surveying the expression library that is produced by particular organisms, such as λ gtll storehouse, unless obtain the dna molecular of coding methioninase with the organism beyond pseudomonas putida.

In case obtain the nucleic acid molecules of the coding methioninase of naturally-occurring, those skilled in the art can be easily with at random or the locus specificity method of mutagenesis change the methioninase coded sequence, since improve expression, perhaps replace from the methioninase of having encoded, increase or lack one or more amino acid.

In an example, in given host's cell, change the expression of methioninase coded sequence with the raising RMETASE, and do not changed the amino acid sequence of the methioninase that is encoded. The expression that RMETASE improves in the specific host can obtain by one or several codon that change is present in the nucleic acid molecules, and the result is that the codon that obtains is often by host living beings be used for the encoding codon of specific methionine. Change nucleotides sequence makes it comprise preferred codon and can realize with approach well known, such as direct mutagenesis or the synthetic nucleic acid molecules that comprises preferred codon.

Except the change that impact is expressed, also can change the nucleic acid molecules of coding methioninase so that the gained protein purification. For example, terminal by the amino or the carboxyl that change RMETASE as disclosed among the embodiment, to increase by one section polyhistidyl sequence, can use Ni⁺⁺The fusion protein of agar sugar gel-purified gained.

Also can change the methioninase coded sequence and make in the amino acid sequence of methioninase that is encoded and cause variation, as increasing, replace, or lack one or several amino acid residue. The gained RMETASE preferably has the variation that causes RMETASE to have better biology or physiology characteristic, such as the activity that improves, and the Km of reduction, the immune originality of reduction, or the serum half-life that prolongs. Reformed like this type can appropriate design or at random generation.

When variation was specific selection take the physiology characteristic of the amino acid sequence of initial and product albumen matter and expectation as the basis, said change was appropriate design. For example the change of one type appropriate design is to replace hydrophobicity amino acid to carry highly dissoluble with less hydrophobic residue. The method for optimizing that produces the appropriate design change is the direct mutagenesis of using mismatch PCR primer extension method.

When change was not choose reasonable, change was exactly to occur at random. Induced-mutation technique at random, such as chemical mutagenesis, PCR reorganization and the mutagenesis of joint subregion produce in a large number various at random and unspecific variations in given protein coding sequence. Such method can be used for fundamentally changing the nucleic acid molecules of coding methioninase.

Then the form that the RMETASE that produces in such a way changes is used for according to various method screening expectation character known in the art. The selection method of choice for use depends on the method for mutagenesis of host, carrier and use and character to be selected.

The present invention further provides and comprised the carrier that one or several the present invention expresses model. Carrier is the dna molecular that can independently copy in the host. Carrier can comprise by the episomal replication starting point that naturally has plasmid derivative, and the genome duplication starting point perhaps can be derived from viral genome. The selection that the present invention expresses the carrier that model inserts is directly depended on the function characteristic of expectation, for example protein expression, and host's cell that will transform as known in the art.

In one embodiment, carrier comprises a protokaryon replicon. Protokaryon replicon such as ColE1 replicon are well known in the art and are used in easily with the present invention and express in the combination of assembly. In addition, carrier can comprise that coding can select the gene of mark such as the resistance to the action of a drug.

Carrier for expression of eukaryon also can be used in the present invention and express in the combination of assembly. Eukaryotic expression vector is well known in the art and can obtains from some commercial undertakings. Representational such carrier is PSVL and pKSV-10 (Pharmacia), pBPV-1/pML2d (International Biotechnologies, Inc.), pTDT1 (ATCC, #31255), the carrier pCDM8 of this paper explanation, and similar carrier for expression of eukaryon. The high level expression vector can be further produces with the insect cell expression system, as take the expression system of baculoviral as the basis.

Generally speaking, the generation of coding methioninase high expressed assembly typically comprises following content:

At first obtain the DNA of coding methioninase. Be not interrupted if the sequence from bacterial origin of expectation includes son, then it is suitable for expressing in any host. This sequence can change over the form cutting and reclaim of being easy to by insert the sequence comprise one or several restriction endonuclease sites in methioninase coded sequence side district.

Then, be cut or reclaim coded sequence and have being operatively connected of high expressed control element, but preferably place copy expression vector. Then transform suitable host with expressing assembly or carrier, and be converted the host and under the condition that realizes RMETASE production, cultivate. Arbitrarily RMETASE is separated from culture medium or from cell. The recovery of protein and purifying are not necessarily necessary in some instances, wherein can allow some impurity to exist.

Each step in the top step can carry out in various modes. For example can obtain desired coded sequence and be directly used in suitable host from genomic fragment. The structure of the expression vector that can operate among the various hosts is to use two or more suitable replicons and control element to carry out. If usually available, suitable restriction restriction enzyme site can be added to the terminal of coded sequence, and a cut gene that is inserted in these carriers is provided like this.

II. transformed host cell is expressed high-level RMETASE

The present invention further provides host's cell of expressing assembly or carrier conversion with the present invention, thereby produce the 5-75% RMETASE of about total cell proteins, preferably account for the about more than 10% of total cell protein quality. Host's cell can be protokaryon or eucaryon host.

Any prokaryotic hosts can be used for expressing the present invention's high level methioninase encoding pack. Preferred prokaryotic hosts is Escherichia coli (E.coli). In the following embodiments, colibacillary DH5 α and BL21 (DE3) bacterial strain have been used.

Preferred eukaryotic host cell comprises insect cell, yeast cells and mammalian cell, and preferred insect cell such as SP6 and vertebrate cells are such as those cells from mouse, rat, monkey or human fibroblast cell line. Other preferred eukaryotic host cell comprises Chinese hamster ovary (CHO) the cell CCL61 that obtains from ATCC, from the NIH Switzerland mouse embryo cell NIH/3T3 (CRL 1658) that ATCC obtains, baby hamster kidney cell (BHK) and similar eucaryon tissue are cultivated cell system.

The known method of the host that uses and bearer type realizes expressing reconstitution component to the conversion of suitable host with the present invention's high level by usually depending on. For the conversion of prokaryotic host cell, preferably host's cell is carried out electroporation or salt processing method, such as referring to Cohen etc., Proc.Natl.Acad.Sci. USA 69:2110,1972; With Maniatis etc., " molecular cloning, experiment guide " (Molecular Cloning, Alaboratory Mammal), Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982).

About the conversion of eukaryotic, preferred electroporation or use cation lipid, such as referring to Graham etc., Virol.52:456,1973; With Wigler etc., " institute of American National academy of sciences periodical " (Proc.Natl. Acad.Sci.USA) 76:1373-76,1979.

The cell that success transforms, namely comprising the cell that the present invention expresses assembly can differentiate with known technology. The cell of for example expressing the importing of assembly by the present invention and producing can be cloned the single bacterium colony of preparation. Can gather in the crops, dissolve from the cell of these bacterium colonies and with the existence of rDNA among their DNA of known method inspection, described method is by Southern, " molecular biosciences magazine " (J.Mol.Biol), 98:503,1975, or Berent etc., " biotechnology " be 3:208 (Biotech.), and 1985 describe. Yet as hereinafter illustrated, the present invention further provides the rapid screening method of differentiating conversion of expressing high-level RMETASE.

III. identify the host who expresses high-level RMETASE

The present invention further provides evaluation can be with the transformed host cell of the horizontal Restruction methioninase of 5-75% total cell proteins. Specifically, find that the transformed host cell that total cell proteins with about 5-75% is expressed as RMETASE has obvious observable pink. Obvious especially when using Escherichia coli as the host.

For identifying the transformed host cell of expressing high-level RMETASE, allow the conversion cell under the condition that restructuring protein is expressed, grow on culture medium or in the culture medium, and the cell of visual inspection growth. Detect and select and grow cell or bacterium colony based on peach demonstration.

For using the inventive method to select, make the growth of growth transformed host cell, can use many cultivations/growth condition. Thereby the composition of grown cultures base is decided by the nutrition needs of used host/vector and also can separates high-level expression cloning for the identification of expressing relevant peach detection system with the RMETASE high level. Preferred culture medium is that transformed host cell can tile thereon, and with the solid culture base of independent colony growth, each single bacterium colony is among the single host. The method for optimizing of examining and determine high-level expression cloning is range estimation growth bacterium colony.

IV. express assembly output group methioninase with high level

The present invention further provides the method for Restruction methioninase. Specifically, using the host who transforms with one or several the present invention's high level expression assembly can be with the industrial mass production RMETASE. This kind is converted the host with the horizontal expression RMETASE of about 5-75% total cell proteins. Use host of the present invention, those skilled in the art can produce the RMETASE that is used for various diagnosis and methods for the treatment of with means known in the art easily.

The RMETASE that purifying is expressed the conversion host production of model with the high level that comprises the methioninase of encoding, or the method for optimizing of the RMETASE of the host of purifying natural production methioninase production comprises following step:

A) will contain the water-containing buffering liquid of the conversion cell extract of methioninase, in about 40-60 ℃ of heating about 1-10 minute, preferred 50 ℃ of heating 1 minute;

B) centrifugal about 15 minutes to 1 hour of the upper extraction thing that will heat with about 10k to 20k rpm of GS-3 centrifuge rotor (Sorvall, Dvpont), preferably 4 ℃ with about 13k rpm centrifugal about 30 minutes;

C) filter that uses about 50k to 100k aperture is preferably used the Millipore Pre/Scale:TFF PLHK 100K 2.5ft of 10mM kaliumphosphate buffer (pH8.3) with the ultrafiltration of supernatant liquid²Cylinder;

D) carry out DEAE ion exchange column chromatography, with the LIS in about pH7.0-7.6 1-20mM kaliumphosphate buffer (approximately 10-50mM) KCl, collection contains the fraction of the methioninase of 40-200mM KCl gradient wash-out, preferably uses DEAE-agar sugar FF post;

E) carry out the DEAE ion exchange column chromatography second time among ionic medium intensity (50-100mM) KCl in about pH8.0-8.6 10-20mM kaliumphosphate buffer, and collect the fraction of the methioninase that contains useful phosphate buffered liquid (pH 8.3), 100-200mM KCl wash-out. The preferred DEAE-agar sugar FF post that uses;

F) the described fraction of collecting in the step (e) is contacted with the post chromatography substrate that can adsorb endotoxin, and collection wash-out liquid, thereby from e) removed endotoxin the described eluate of step, generated every milligram of protein have the active and every mg protein of at least 20 unit methioninases only contain the 1-100ng endotoxin without the endotoxin methioninase, preferably use Acticlean^The Etox post.

Cell extract is preferably from being changed to express host's cell preparation of high-level RMETASE (approximately 5-75% total cell proteins). For bacillary cell extract, extract thing and generally prepare by at first gathering in the crops and wash bacterium cell cultivation thing generation cell group/ball grain (depend on that results are with centrifugal action or use hollow fibre filtering, two kinds of methods generally are known).

Then use the broken cell of conventional method, preferably use the broken cell of homogenate device, such as cavity type homogenate device, for example Microfluidics Corp.Model#HC 8000.

Heating gained suspension is with protein and other insoluble substance of precipitation selection. Typical heating condition is about 45-60 ℃ of heating 1-10 minute, and preferred steps is 50 ℃ of heating 1 minute.

The extraction thing of centrifugal heating is removed chip, filters out supernatant liquid, and describedly as mentioned is loaded onto on the DEAE ion-exchange chromatography substrate with two steps. Preferred absorption and wash-out condition are seen embodiment. Can use various DEAE ion exchange column chromatography substrates in these steps, the restriction condition is not thought in the selection of matrix. Commercial source comprises Pharmacia Fine Chemicals, BioRad, and Sigma.

After this, remove endotoxin, produce proposed above have can the horizontal endotoxin of acceptance protein. The endotoxin removal step can be carried out with various known methods, generally comprises the protein that makes in the solution and contacts with the post chromatography substrate that can adsorb endotoxin, obtains containing the post chromatography substrate wash-out liquid that has or not endotoxin protein. Selling reagent for the preferred merchant who removes endotoxin is Acticlean^Etox。

G. use methioninase prevention and the too high relevant cardiovascular disease of homocysteine.

Another aspect of the present invention is that methioninase is used to remove the homocysteine treatment.

Homocysteine is too high relevant with the cardiovascular disease of all kinds. The relation of these diseases and homocysteine is that McCully found (" U.S.'s pathology magazine " be 56:111-28 (Am.J.Pathol.) for McCully, KS, 1969) first in 1969. McCully has found the plasma homocysteine concentration of rising and the relation between the arteriosclerosis disease. The research of by Framingham Heart Study 1041 people being carried out recently finds that the plasma homocysteine level that raises causes the danger (Selbub that artery sclerosis increases, J. etc., " Britain's pharmaceutical journal " be Med.32:286-91 (N.Engl.J.), and 1995). Other research even with the medium too high and peripheral vascular of homocysteine blood, the cerebrovascular and crown Cardiac disease connect (" nutrition progress annual " be 12:279-98 (Annu.Rev.Nutr.) for Kang, S. etc., 1992). For example blood vessel disease patient empty stomach homocysteine concentration is higher by 31% than the normal person. Plasma homocysteine concentration surpasses the normal value upper limit 12% and both formed dangerous 3.4 times relevant (" U.S. medical science association proceedings " be 268:877-81 (JAMA) for Stampfer, M. etc., 1992) of increasing with the trouble miocardial infarction. The homocysteine metabolism Research on the effect mechanism is found, in more than 2000 experimenters, 20 example contrasts and cross-region studies show that the patient who suffers from apoplexy or other cardiovascular blood disease has than the blood levels that does not have the higher high light cystine of the cardiovascular disease person of being put to the test. This has the true opposite of normal cholesterol level with most of miocardial infarction patients. Found the result that attracts people's attention at " internal medicine health research " (Physicians Health Study), expection shows, suffering from it having in the blood sample that takes out before the miocardial infarction from 271 male sex that suffered from afterwards miocardial infarction by diagnosis obviously being higher than the average basic line level of the homocysteine of not suffering from the suitable control group of miocardial infarction. (Ueland, P. etc., " cardiovascular disease hemostasis and endothelial function " Cardiovascular Disease Hemostasis and Endothelial Function, New York:Marcel Dekler; 183-236,1992). Although have multiple condition can cause the rising of homocysteine levels, no matter what the metabolism reason is, have the relation between high-level homocysteine and the blood vessel disease. In a directed research, in the baboon body, bring out the blood vessel damage, and with homocysteine to baboon defeated annotate three months (Ueland, P. etc., above). Diagnose homocysteine too high by homocysteine levels in the mensuration patient body behind the oral methionine. After oral methionine excites in arteriosclerotic's body abnormal homocysteine blood plasma concentration be 12 times of normal person (Ueland, etc., above). Can measure quickly and easily plasma levels of homocysteine with HPLC mensuration. Studies show that 40% population may have the homocysteine levels of rising, has the danger (Stampfer, M. and Malinow, M., " New England's medical journal " (New Engl.J.Med.) 332:326-329 1995) of suffering from cardiovascular disease. Homocysteine blood is too high to have acute effect aspect the arteriosclerosis disease bringing out, and makes individuality that the danger of suffering from miocardial infarction and cerebrovascular disease be arranged. Emergency medical is got involved the major part that shows above-mentioned individuality the danger of suffering from cardiovascular disease. Methioninase of the present invention can be used as selectable methods for the treatment of in the emergency medical, can reduce the people's that ill danger is arranged homocysteine levels at once. Two kinds of reactions of methioninase catalysis, not only enzymolysis N-C key and γ C-S key (Hoffman in methionine but also in homocysteine, " biotechnology and biophysics " (Bioch.et Biophys.) Acta, " cancer research review " (Reviews on Cancer), 738:49-87,1984). Fig. 7 illustrates the metabolic cycles of homocysteine and Methionine metabolism. Vitamin B-12, B-6, and folic acid salt affects the left side of the circulation that illustrates among the figure is to being helpful with keeping some normal homocysteine levels after the methioninase treatment. And the level of these vitamins is not depended on the right side of circulation. On the right side of circulation, the existence of methionine causes excessive homocysteine levels by the Methyl transporters reaction that raises, and it can cause cancer and arteriosclerosis disease. For the abnormal patient in circulation right side, it is necessary that maintenance and short-term are used methioninase, can keep the normal level of homocysteine. For cardiovascular disease, methioninase is important to the substrate specificity of methionine and homocysteine. Methioninase can reduce the level of homocysteine precursor methionine, also can directly reduce homocysteine levels. Vitamin B-12 is used in the existing research in this area only suggestion, and B-6 and folic acid salt reduce too high homocysteine blood as the treatment agent. As shown in Figure 7, only show that these vitamins do not correct any undesired symptom in should the circulation right side, also do not reduce the homocysteine levels in the abnormal patient's body in this circulation right side. The present invention includes with the methioninase treatment and suffer from the method for cardiovascular patient.

On the one hand, provide treatment to suffer from the method for cardiovascular patient, comprised the methioninase of effectively measuring to patient's administering therapeutic.

The effective amount for the treatment of that is used for the methioninase of homocysteine removal is premeasuring, calculates the level that institute's phase homocysteine is removed that reaches, thereby, for example, the arteriosclerotic danger of reduction trouble.

Therefore, the dosage scope of methioninase administration of the present invention is the amount that is enough to produce institute's phase effect, and institute's phase effect for example is to reduce to suffer from arteriosclerotic danger or level. Dosage should be greatly to causing side effect, and is too high such as viscous, comprehensive disease, pulmonary edema, congestive heart failure etc. Dosage is according to patient's age generally speaking, and symptom, sex and disease progression degree are and different, and this is that those skilled in the art can determine.

Dosage can be determined by the doctor under any complicated situation.

The effective amount of the treatment of methioninase of the present invention generally is that to be enough to make the concentration of (blood plasma) in the blood vessel or local methioninase when with the compatible composition administration of physiology be about 0.001 to about 100U/ml, preferably be higher than about 0.1U/ml, more preferably be higher than the amount of 1U/ml. The general dosage of administration is decided by body weight, and is at approximately 5-1000U/kg/ days, preferably approximately 10-50U/kg/ days, and more preferably in about 20-40Ukg/ days the scope.

In a preferred method, the essentially no endotoxin of used methioninase is discussed as mentioned in detail. Particularly preferably be the methioninase that uses the present invention to produce, it is from the restructuring source and be substantially free of endotoxin.

Can use the known method administration of the common those of skill in the art in this area, and be illustrated in this manual.

Another aspect of the present invention is to treat the patient who suffers from cardiovascular disease by the methioninase that is substantially free of endotoxin and is combined with polymer that administering therapeutic is effectively measured. One preferred aspect, this polymer is polyethylene glycol. Another preferred aspect of the present invention is that described cardiovascular disease is artery sclerosis. Another aspect of the present invention is narrow to the outer arteria carotis of cranium, peripheral vascular, the cerebrovascular, crown heart disease and obliterative vascular disease patient administration methioninase.

Another aspect of the present invention has provided a kind of method for the treatment of the too high patient of homocysteine blood by the methioninase that patient's drug treatment is effectively measured. Described methioninase is substantially free of endotoxin and is combined with polymer such as polyethylene glycol.

The present invention also provides the method that reduces homocysteine levels in patient's body, comprises the step of the methioninase that patient's drug treatment is effectively measured, and wherein said methioninase is substantially free of endotoxin. The present invention has provided the method that cardiovascular disease occurs a kind of patient of prevention on the other hand, comprises the step of the methioninase that patient's drug treatment is effectively measured. One preferred aspect, give and the essentially no endotoxin of patient's methioninase. Another preferred aspect, described methioninase is combined with a polymer. The method that provides the prevention patient that cardiovascular disease occurs on the one hand again comprises the step to the methioninase of the effective amount of patient's drug treatment, the essentially no endotoxin of described methioninase, and and polyethylene glycol combination. Embodiment 7 provides the example that homocysteine is removed in the body.

H. methioninase is applied to tumor imaging

The present invention provides the method for diagnosis patient in-vivo tumour on the other hand, comprises by to patient's administration methioninase, removes in patient's body¹²The C methionine is then by giving and the patient¹¹The C methionine enriches the methionine in patient's body, measures at last to exist in the patient tumors cell¹¹The C methionine,¹¹The C methyl turns into detecting by show the method that resembles (PET) scanning such as but not limited to positron emission fault. The common those of skill in the art in this area are familiar with other detection cancer cell absorption¹¹The method of C. These methods are described in, for example, Lapela etc., " Journal of Nuclear Medicine " be 35:1618-23 (J.Nucl.Med.), and 1994; Miyazawa etc., " Journal of Nuclear Medicine " be 34:1886-91 (J.Nucl.Med.), and 1993; Leskinen-Kallio etc., " Journal of Nuclear Medicine " be 33:691-95 (J.Nucl.Med.), and 1992; Shields etc., " Journal of Nuclear Medicine " be 33:581-84 (J.Nucl.Med.), and 1992; Huovinen etc.; " Britain's cancer magazine " (Brit J. Cancer) 67:787-91,1993; Dethy etc., " Journal of Nuclear Medicine " be 35:1162-66 (J.Nucl.Med.), and 1994; Lindholm etc., " Journal of Nuclear Medicine " be 34:1711-16 (J.Nucl.Med.), and 1993; Leskinen-Kallio etc., " Journal of Nuclear Medicine " be 32:1211-18 (J.Nucl.Med.), and 1991; With Mineura etc., " Journal of Nuclear Medicine " be 32:726-28 (J.Nucl.Med.), and 1991, incorporated by reference together here.

The preferred aspect of the present invention, the essentially no endotoxin of the methioninase that provides.

Another preferred aspect of the present invention is that described methioninase is and polymer, such as the polyethylene glycol combination.

Embodiment

It is in detail explanations and not as to special restriction of the present invention that the below relates to embodiments of the invention. And, can predict these variations of the present invention present known or that can develop later in the scope those skilled in the art and be considered to hereinafter in the desired scope of the present invention.

Embodiment 1

The expanding production methioninase

The pseudomonasputida strain, the modified and following kalamycin resistance of selecting, and high level is expressed the bacterial strain of methioninase:

Buy ATCC 8209 pseudomonasputidas (Pseudomonas putida) and ATCC 77100 Escherichia coli in October, 1993 from ATCC. ATCC 77100 is growth in the LB that contains 50 μ g/ml kanamycins (Sambrook etc., " molecular cloning, experiment guide " (Molecular Cloning:ALaboratory manual) A.1,1989). Separation quality grain pCN 51 from ATCC 77100, a kind of shuttle plasmid (Nieco etc. that comprise the kalamycin resistance gene that can copy among both pseudomonasputida (P.putida) and Escherichia coli (E.coli), Gene 87:145-149,1990, here incorporated by reference), and with Triton-lysozyme method (Sambrook etc., " molecular cloning; experiment guide " (Molecular Cloning:A laboratory manual) 1.29-1.30,1989) purifying. ATCC 8209 grows in the LB culture medium, and transform with pCN 51 with the standard conversion method, described standard conversion method is as being described in such as Sambrook etc., " molecular cloning; experiment guide " (Molecular Cloning:a laboratory manual.) 1.74-1.84, those methods in 1989. The kalamycin resistance bacterial strain is selected with kanamycins (100 μ g/ml) in the LB culture medium, and further at LB plate (Sambrook etc., " molecular cloning; experiment guide " (Molecular Cloning:Alaboratory manual) A.1-A.4,1989) upper in 100 μ g/ml kanamycins, grow. Single bacterium colony is grow overnight in the LB that contains 100 μ g/ml kanamycins, then place under the high methioninase expression condition: 10%LB, 0.1% kaliumphosphate buffer (pH 7.2), 0.1% urea, 0.025% yeast extract, 0.01% magnesium sulfate and 0.25% methionine that 50 μ g/ml kanamycins are arranged were cultivated 24 hours. Measure the expression of methioninase with the standard methioninase assay method of this specification explanation. Select pseudomonasputida bacterial strain (Pseudomanas putida) and the called after AC-1 of excessive production methioninase.

Then use the sweat that AC-1 pseudomonasputida bacterial strain (Pseudomonas putida) carries out expanding production. The single bacterium colony of AC-1 is grown at the LB plate that contains 50 μ g/ml kanamycins. At 26 ℃ the bacterium colony selected being contained among the LB of 50 μ g/ml kanamycins temperature at 5ml with 250rpm/min jolting speed educated 18 hours. At 26 ℃ the 2ml bacterium was contained among the LB of 50 μ g/ml kanamycins amplification 6 hours at 600ml with the 200rpm/min shake speed of shaking. Then sway at 26 ℃ 50ml bacterium Wen Yu in 2 liters of LB that contain 50 μ g/ml kanamycins spend the night (18 hours) with 100rpm/min. Then allow 2 liters of bacterium (OD₆₀₀1.2-1.6) in 40 liters of tanks, containing 10%LB, 0.1% kaliumphosphate buffer (pH 7.2), 0.1% glycerine, 0.1% urea, 0.025% yeast extract is in the specific culture medium of 0.0l% magnesium sulfate and 0.25% methionine, under high aeration condition, 26 ℃ of growths 24 hours. OD₆₀₀Reach 1.2-1.8 and activity and reach the 20-30 units per liter. The best density of the cell of results is 1.5-1.80D₆₀₀, having the 2-3mg/l methioninase, this is equivalent to 1kg wet cell/400 liter. Preferably, the well-found fermentation tank that uses about productive rate 1kg wet cell/10-20 to rise. Keep 4 ℃ of temperature, collect cell with AGT post (UFP-500-E-55 type cylinder, A/G Technology Corporation), then at 4 ℃, with 9krpm, with centrifugal 10 minutes of automatic refrigerated centrifuge machine (Sorvall Superspeed RC2-B). Then collect cell flaky precipitate thing.

Then cell is suspended in and extracts in the solution (20mM phosphoric acid potassium, pH 9.0), density be 500 gram wet cells/liter, three times with the broken cell of cavity homogenate device (Microfluidics Corp.Model#HC 8000). Immediately the homogenate thing is preserved under-800 ℃ after the cell fragmentation. The specific activity of methioninase is 0.08～0.1 unit/mg albumen in the homogenate thing.

AC-1 homogenate thing is suspended in Extraction buffer (10mM phosphoric acid potassium, pH 7.2,10 μ M phosphoric acid pyridoxals, 0.01% beta-mercaptoethanol, 1mM EDTA and 20% ethanol), and 50 ℃ of heating 2 minutes. Heating steps can carry out the time of any length, is enough to the responsive impurity albumen of precipitation heat and keeps methioninase active. Suspension 4 ℃ with 12krpm centrifugal 30 minutes. Collect supernatant liquid and use Millipore Prep/Scale-TFF PLHK 100k 2.5ft²The cylinder ultrafiltration. Then pH is transferred to 7.2.

10L Extraction buffer (the 10mM kaliumphosphate buffer pH 7.2 of about total protein of 25-35g, 10 μ m phosphoric acid pyridoxals and 0.01%J-sulfydryl ethanol) sample is applied to 10cm * 50cm Toyopear (on the DEAE-650M post (Toso Haas Japan), this post is with the pre-balance of 10mM kaliumphosphate buffer (pH7.2). This post washes in advance with 10mM kaliumphosphate buffer (pH7.2) 20-30L of the 40mM potassium chloride that contains 10 μ m phosphoric acid pyridoxals and 0.01% beta-mercaptoethanol first, until OD₂₈₀Be reduced to below 0.1. Then potassium chloride is increased to 300mM at Extraction buffer from initial concentration 40mM, pillar is carried out linear gradient elution. Collect 400ml and washed out fraction. Also concentrate with the active fraction that contains methioninase of measuring of the methioninase of this specification explanation. With the 10mM kaliumphosphate buffer that contains same concentrations phosphoric acid pyridoxal and beta-mercaptoethanol, pH8.3, and 150mM potassium chloride is with the pre-balance ratio of fraction of concentrating.

Will (buffer sample of the total protein of about 1-2g that the methioninase peak of post of 5cm * 20cm) obtains be applied on DEAE-Sephadex A 50 posts from DEAE-650M, described buffering liquid contains 10mM phosphoric acid potassium pH8.3,150mM potassium chloride, 10 μ M phosphoric acid pyridoxals and 0.01%J-sulfydryl ethanol. With this post of 150-500mM KCl linear gradient elution in the 10mM kaliumphosphate buffer (pH8.3) that contains 10 μ M phosphoric acid pyridoxals and 0.01% beta-mercaptoethanol, collect 150ml and wash out fraction. Concentrate the fraction that contains methioninase of measuring with the active testing of this paper explanation. Then be further purified concentrated methioninase to remove endotoxin. By in the 10mM of 0.12M sodium chloride and pH7.1 sodium phosphate buffer, dialysing the pre-balance of sample. Sample is added on 5cm * 15cm Acticlean Etox resin column (Sterogen Bioseparations, Arcadia, CA). Then with same buffer wash-out enzyme from the post, collect the fraction that washes out with methioninase activity, then measure and wash out endotoxin content in the fraction. Table 1 provides the result of this purification process.

The method of table 1 expanding production methioninase
									Step	Volume (ml)	Active		Protein		Specific activity (unit/mg)	pH	Productive rate (%)
Unit/ml	Total active	mg/ml	Total g
				The homogenate thing	3850	1.05	5200	11.5			44.3	0.1	6.7	100
Heating	3130	1.43	4472						4.4	13.8					0.33	6.9	86
				Ultrafiltration	2950	1.41	4160	4.25			12.5	0.33	7.2	80
The first post	850	4.42	3744						1.64	1.39					2.6	7.2	72
				The second post	1000	3.22	3220	0.22			0.22	14.6	8.3	62
The 3rd post	540	4.8	2620						0.34	0.18					14.3	7.1	52
				Concentrate	16.5	153	2529	10.5			0.173	14.8	7.1	48

The analysis of the methioninase of purifying on the 7.5%SDS-PAGE gel shows a 43kd protein belt, an inferior unit of the 172kd protein that representative is found when analyzing the active fraction that obtains with SDS-PAGE from second post. HPLC the analysis showed that the purity of the methioninase that separates with the method is 98.7%, by only having a protein peak provable.

The extracting method of this paper explanation has produced the methioninase preparation of basically purifying of essentially no endotoxin. The common those of skill in the art in this area understand and can modify the extracting method of explanation that these changes are included in the scope of the present invention.

Embodiment 2

People's tumour is to the dependence of the Methionine Levels of rising

Methionine dependence often occurs in the human cancer situation, is used for the test methionine dependence from 20 kinds of NCI human tumor cell lines of all major organs systems. All 20 cell systems all find it is methionine dependence. Tested in addition fresh people's tumor sample, also found it is methionine dependence. Normal cell system is not methionine dependence.

Fig. 1 has provided the result of this kind test. In Fig. 1, normal cell strain and tumor cell line are grown in Eagle ' s MEM with the serum of 10% dialysis, and the serum of described dialysis is one of following sample: do not contain homocysteine and contain methionine (MET⁺HCY ^-) sample; Do not contain methionine and contain homocysteine (MET^-HCY ^-) sample or do not contain methionine and do not contain homocysteine (MET^-HCY ^-) sample. Containing methionine (MET) culture medium, without the MET culture medium, contain in homocysteine (HCY) culture medium and without the MET culture medium, contain in homocysteine (HCY) culture medium and without MET, without screening kidney in the HCY culture medium, colon, lung and prostate cancer cell line and melanoma and normal fibroblast strain. Cell is the tire cow's serum after being supplemented with 10% dialysis, grows in the Eagle ' s limit dulbecco minimum essential medium Dulbecco (MEM culture medium) of 10 μ m hydroxycobalamins element and 100 μ m folic acid. This culture medium adds or do not add methionine: MET+HCY in following mode: the L-Methionine that does not contain homocysteine with 100 μ m is added this culture medium. METHCY+: do not contain the D of methionine with 200 μ m, the L-homocysteine is added this culture medium. METHCY: this culture medium does not contain methionine and does not contain homocysteine. The tire cow's serum is to phosphate buffered salt solution (PBS) (serum: PBS is 1: 12) dialysis 10 times.

Measure cell propagation by the absorption that the metabolism of measuring dyestuff XTT at 450nm is reduced. By inoculating 5 * 10 in every hole³With 2 * 10⁴Cell within the individual cell scope is grown at 48 hole plates by cell. Live and to be reduced into XTT (two (2-first oxygen base-4-nitro-5-sulphur the phenyl)-5-[(phenyl aminos of 2, the 3-) carbonyl of water-soluble first  product in the cell by metabolism]-2H-tetrazolium hydroxide is used to measure cell propagation. Measure the absorption value of reduction product at the 450nm place. Pre-temperature preparation 1mg/ml XTT in 37 ℃ of PBS, preparation 5mM azophenlyene N-first sulfuric ester (PMS) in PBS. Fresh XTT solution mixes with the ratio of every 1ml XTT 511 PMS with PMS storage solution. Every hole 1ml culture medium of packing into. In every hole, add the XTT that 0.25ml mixes. Inoculate the absorption value of reading the XTT of reduction after 3 hours with Hitachi U-2000 spectrophotometer at the 450nm place. The initial OD that measured an XTT after 24 hours in per three days that cultivates of cell. At MET⁺HCY ^-Or MET^-HCY ⁺In, human foreskin fibroblasts strain FS-3 and HS-68 breed basically equally. But present disclosure has been reported a new discovery, and namely in MET HCY culture medium, two kinds of fibroblast strains are bred after a certain degree and kept at least 16 days.

Table 2 has illustrated the measurement result of the cell propagation of 20 kinds of tumor cell lines in detail. In this is measured, with 5 * 10³-2×10 ⁴The cell suspending liquid of individual cells/well was cultivated 24 hours in the MEM that is containing 10% tire cow's serum on the 48 hole flat boards. Be divided into three groups with Hanks alkaline salt solution (HBSS) with behind twice of the cell washing. First group: cell is at MET⁺HCY ^-Cultivate in the culture medium; Second group: cell is at MET^-HCY ⁺Cultivate in the culture medium; The 3rd group: cell is at MET^-HCY ^-Cultivate in the culture medium. Cell is with 95% air/5%CO₂Cultivate in the cultivation case of ventilation. Changed a subculture in every 2-3 days. In table 2, what cell line growth was vigorous represents with a+++, and to some extent representing with a++ of growth, slightly representing with a+ of some growth, growth does not represent with a-. Only about half of tumour cell ties up to without MET and contains in the culture medium of HCY and can not grow, and other in various degree growth of cell system, and with identical culture medium and in containing the culture medium of MET, normally cell can be grown. Although in without the culture medium of MET without HCY, normal cell strain can grow into and to a certain degree keep afterwards 2 weeks or longer time, but all tested 20 kinds of tumour cells tie up in this culture medium dead, this show might be all cancer cell killed selectively by removing MET. This embodiment provide evidence prove for treatment of cancer especially with methioninase as the treatment agent, methionine dependence may be general and target optionally.

Table 2
					Cell system	The cancer cell type	Propagation
		MET +HCY -	MET -HCY -	MET -HCY +
					Tumour
A498	Kidney	+++	-	-
					CAKI-1	Kidney	+++	++	-
SN12C	Kidney	+++	+	-
					PXF393	Kidney	++	+	-
DU-145	Prostate	+++	-	-
					PC-3	Prostate	+++	-	-
H322M	Lung	+++	-	-
					H23	Lung	+++	+++	-

H460	Lung	+++	-	-
					H522	Lung	+++	++	-
SNB 75	Central nervous system	+++	++	-
					SF 295	Central nervous system	+++	++	-
HCT 15	Colon	+++	-	-
					Colo 205	Colon	+++	+++	-
SW 620	Colon	+++	-	-
					HT 29	Colon	++	+	-
UACC 257	Melanoma	+++	+++	-
					UACC 62	Melanoma	+++	+++	-
SK MEL 5	Melanoma	++	+	-
					LOX	Melanoma	++	-	-
Normal cell
					FS-3	Foreskin	+++	+++	+
HS-68	Foreskin	+++	+++	+

Embodiment 3

Methioninase is to the inhibitory action of people's tumour growth in the mouse heteroplastic transplantation model

For the drug effect that the test methioninase is grown to slowing down tumour, used the mouse heteroplastic transplantation model. People's lung cancer tumour (H460) is transplanted in the hypodermis of naked mouse. One group of per four mouse are divided into four groups with mouse. Transplant after four days, by per 4 hours to intraperitoneal injection give A group 0.4ml buffering liquid (0.12M sodium chloride, the 10mM sodium phosphate, pH7.1); Gave B group methioninase (1 unit/g) by per 4 hours to intraperitoneal injection; Gave C group 5-FU (60mg/kg) by per 4 days to intraperitoneal injection; Give D group vincristine (VCR) (0.9mg/kg) by intraperitoneal injection in per 4 days. Tumour size of measurement in per two days and body weight. The results are shown in table 2 and 3. The result shows, has greatly slowed down the growth of H460 Non-small cell lung carcinoma in the nude mouse with the methioninase treatment. In these experiments, mouse feeds the normal diet of advancing not remove methionine. The drug effect of the anti-H460 of methioninase is fully opposite with the vincristine treatment with 5 FU 5 fluorouracil, and rear two kinds of medicines do not have the activity of anti-this tumour. Give 10 days of the active unit of methioninase 40-120/sky and do not cause and lose weight that this shows that it has hypotoxicity in treating. On the contrary, vincristine causes loses weight, and shows toxic. Therefore, methioninase is a kind of little high efficiency anti-tumor agent of toxicity that new tumor-selective action method is arranged, and proves the clinical effectiveness of anti-human solid tumor potentiality.

Embodiment 4

The preparation PEG-rMETase

Molecular weight is that 5000 first oxygen polyethylene glycol succinimdyl carbonate (M-SC 5000PEG) is dissolved in the 20mM sodium phosphate buffer (pH8.3), and concentration is between 2mM and 20mM. M-SC 5000PEG changes from 6: 1 to 240: 1 with the mole ratio of methioninase. (the 25mM sodium phosphate buffer carried out 30 minutes to 60 minutes at 4 ℃ or 20 ℃ in pH8.3) at reaction buffer in the PEGization reaction. (the 0.14M sodium phosphate buffer pH6.5) stops reaction at 0 ℃ with stopping buffering liquid. Then remove unreacted M-SC 5000PEG according to the gel filtration chromatography of this paper explanation. Use the concentrated device of 30k Amicon Centriprep, in 0.12M sodium chloride and 10mM sodium phosphate (pH7.2), be mixed with final PEG-rMETase. Then by the filtration effect of 0.2 μ m particulate film filter PEG-rMETase is sterilized. This PEG-rMETase can be saved to 6 months and loss of activity not at-70 ℃.

The mensuration methioninase is active. PEG-rMETase reservation at least 60% is the activity of PEGization methioninase not. According to the explanation of Laemmli and Sambrook (Laemmli, " maturation " be 227-680 (Mature), 1970; Sambrook etc., " molecular cloning; experiment guide " (Molecular Cloning:a laboratory manual) 18,47-18.59,1989), analyze the PEG-methioninase by natural and sds polyacrylamide gel electrophoresis, and carried out following improvement: carry out the PEG-rMETase electrophoresis in 7.5% polyacrylamide precast gel in being with or without the 0.2MTris-glycine buffer (pH8.3) of SDS. The gel Coomassie blue stain, and discolor with 40% methyl alcohol, 10% acetic acid. Although a visible very little electrophoresis band when PEG-rMETase is administered on the natural gel, be can not see the electrophoresis band of not modifying methioninase in sds gel.

Then following with HPLC gel filtration post analysis PEG-rMETase: with PEG-rMETase (20 μ l, 1-2mg/ml is added to 0.2M phosphoric acid and receives on Progel-TSK G3000SW (Supelco) post in buffering liquid (pH7.2) with the sample device that adds of 20 μ l, and with 0.2M sodium phosphate buffer (pH7.2) with flow velocity 1.0ml/min wash-out. Only detect a protein peak, namely do not contain the PEG-rMETase peak of unreacted PEG; Can't detect the not methioninase peak of PEGization. The purity of PEG-rMETase approximately is 100%.

A) the time process research of PEGization reaction

The time process of the following measurement polyethylene glycol effect of being combined with methioninase: 0.07mM methioninase and 0.4mM-SC 5000PEG reacted 2 hours at the most at 4 ℃ of reaction different times in 0.2M sodium phosphate buffer (pH8.3). Stop reaction at each time point with 0.2M sodium phosphate (pH6.5). Remove unreacted PEG with the concentrated device of the centrifugal preparation of 30k Amicon. The results are shown in Table 3.

Explanation according to this paper is analyzed PEG-rMETase at natural and SDS-PAGE gel: measured macromolecule amount band and occurred, and in table 3, indicate-,+-,+or ++ symbol,-show do not have PEG-methioninase or methioninase, there are a small amount of PEG-methionine or methioninase+-show, ++ showing has a large amount of PEG-rMETases or methioninase. Table 3 also shows the activity of PEG-rMETase or methioninase.

The time process of table 3 methioninase PEGization
										Mole is than (M*∶P **)	Condition ℃ pH	Time process (dividing)
0	4	30	60	90	120
						Active (%)	1∶6	4   8.3				100	99	77	70	60	58
Natural PAGE	The methioninase PEG-rMETase		++  -	+   +	+-   +				-   ++	-   ++	-   ++
						SDS PAGE	The methioninase PEG-rMETase					++  -	++   +-	++   +	+   +	+   ++	+-   ++

^*The M=methioninase^**p＝M-SC 5000-PEG.

B) with the concentration dependence of M-SC 5000PEG to methioninase PEGization

0.07mM the M-SC 5000PEG of methioninase and various concentration (0.4mM to 4.0mM) reacts in 0.2M sodium phosphate buffer (pH8.3). Mole is than being 1: 6～1: 60. Reaction was carried out 60 minutes at 4 ℃ under the identical condition of embodiment a.

The results are shown in Table 4.

The concentration dependence of table 4 methioninase PEGization
										Condition		Mole is than (P**∶M *)
	℃	Minute		0	6	12	24	48										60
									Active (%)	4	60	100	79	69	48	33	31
Natural PAGE	M *		++	-	-	-	-	-
										P-M ***			-	++	++	++	+++
SDS-PAGE	M *		++	+	+	+-	+-	+-
										P-M ***		-	+	++	++	++	+++

^*M: methioninase^**P:PEG.  ^***The P-M:PEG-methioninase.

C) pharmacokinetics of PEG-rMETase

The M-SC 5000PEG that methioninase PEG turns usefulness into is 1: 6 (P1) and 1: 12 (P2) to the mole of methioninase than respectively. Reaction is carried out under the identical condition in above (b). The P1 of purifying injects respectively the tail vein of three groups of different mouse with the methioninase of P2 and not modification. 0,1, got blood sample in 2,3,4 and 20 hours, methioninase and PEG-rMETase are carried out activity mensuration, and measure the level of removing methionine, the results are shown in Table 5.

The pharmacokinetics of table 5 PEG-rMETase
									The mouse group		Treatment agent condition and method of administration	The activity of the methioninase in the serum half-life (relatively %)
			0 hour	1 hour	2 hours	3 hours	4 hours	20 hours
									I	M *The 8i.v. of unit		100	49	32	8	2	2
II	P1 **The 8i.v. of unit		100	66	56	41	8	3.3
									III	P2 **The 8i.v. of unit		100	94	72	56	18	4.6

M: methioninase.^**P1, the P2:PEG-methioninase

Embodiment 5

Use PEG-rMETase in the cavy body, to carry out the antigen experiment:

Methioninase with M-SC 5000PEG respectively with mole than 1: 60,1: 120 and 1: 240 were 20 ℃ of reactions 30 minutes. Other condition is identical with above (a). By the methioninase active testing, electrophoresis and HPLC analyze PEG-rMETase. Can't detect band or the peak of not modifying methioninase. Therefore, the PEG-methioninase is unique enzyme source.

Cavy intraperitoneal administration 2mg methioninase or PEG-rMETase were administered three times altogether in per 2 days. After two weeks, intravenous administration 4mg methioninase or PEG-rMETase. In this experiment respectively with 0.2 sodium phosphate buffer and BSA as feminine gender and positive control. Criterion evaluation result according to table 6. The results are shown in Table 7. According to testing in the cavy body, the PEG of methioninase turns into the composition that has produced utmost point low antigenicity. It is more responsive that known cavy and people compare antigen.

Table 6

The evaluation criteria of PEG-rMETase antigen research in the cavy body

0. normal 1. unpeaces

2. vertical hair 3. is shaken

4. nose stream mucus 5. is sneezed

6. cough 7. breathings excessively

8. urinate 9. rows just

10. shed tears 11. the expiratory dyspnea

12. snore sound 13. cyanosis are arranged

15. jump 14. lurch

16. pant and twist 17. and twitch

18. side position 19. cheyne-stokes respiration

20. dead

Evaluation criteria

(-) feminine gender: unchanged

(+) is light to be become: 1-4

Degree: 1-10 in (++)

(+++) serious: 1-19

(++ ++) death: 20

The antigen of table 7 PEG-rMETase in cavy
						The sensitization effect			Bring out		Assessment
(injecting once 3 times in per 2 days)			(after two weeks)		WHO standard
							Antigen	Dosage	Antigen	Dosage
A	Buffering liquid	0.2ml，ip	Buffering liquid	0.2ml，ip	-
						B	BSA	1.2ml，ip	BSA	10mg，iv	++++
C	Methioninase	2.0mg，ip	Methioninase	4.0mg，iv	++++
						D	PEG-rMETase	2.0mg，ip	PEG-rMETase	4.0mg，iv	-

The result shows that PEG-rMETase is opposite with bovine serum albumin white (B.S.A), and methioninase is no antigen in the cavy body, and this shows that PEG-rMETase is nonantigenic when to the mammal administration.

Embodiment 6

The administration methioninase is used for people's treatment of cancer

Begun to carry out methioninase I stage dose escalation study and measured methioninase toxicity, pharmacokinetics and maximum are allowed dosage. By giving (iv) defeated 2 hours defeated notes that gave 5000 units (0.5g) and 10000 units (1.0g) methioninase in 2 hours of annotating in 2 advanced breast cancer patient veins. Got blood sample and urine sample with frequent interval in from 0 to 24 hour. Carry out toxicity evaluation according to the WHO hierarchical system. The level of methioninase and methionine from serum and obtain pharmacokinetic data.

Do not find acute clinical toxicity, all toxicity criterions of mensuration have 0 minimum grade. The half-life of methioninase is respectively 2 hours and 3.2 hours in patient 1 and patient's 2 bodies. The defeated notes in rear 30 minutes begins to remove the serum methionine, and keeps 4 hours after defeated notes are finished. Minimum serum Methionine Levels is respectively to process 35% and 19% of front level in patient 1 and patient's 2 bodies. The results are shown in table 8-10 and Fig. 4-6. Following the patient is treated:

The patient 1: the date: on December 14th, 1994. Diagnosis: advanced breast cancer, armpit lymph node and lung shift. The women, 46 years old. Fail in the vein in 2 hours and annotate 200ml administration 5000 units (0.4g) according to the methioninase of extracting method (embodiment 1) purifying. Before the treatment and after the treatment per 2 hours until treat and got blood sample in rear 20 hours. Measure methionine with the methioninase level and calculate relative level, Fig. 4.

The patient 2: the date: February 2 nineteen ninety-five. Diagnosis: advanced breast cancer, the armpit lymph node shifts. The women, 54 years old. Fail in the vein in 2 hours and annotate 400ml administration 10000 units (0.8g) according to the methioninase of extracting method (embodiment 1) purifying. Before the treatment and after the treatment per 2 hours until treat and got blood sample in rear 20 hours. Measure the level of methionine and methioninase and calculate relative level, Fig. 5.

The patient 3: the date: October 15 nineteen ninety-five. Diagnosis: advanced breast cancer, the armpit lymph node shifts. The women, 45 years old. Fail in the vein in 10 hours and annotate 1000ml administration 20000 units (1.6g) according to the methioninase of extracting method (embodiment 1) purifying. Got blood sample in per 2 hours before the treatment and after the treatment, until treated rear 20 hours, measure methionine and methioninase level, and calculate relatively level, Fig. 6.

The 50% high methioninase serum level that keeps maximum level in after defeated notes the 6 hours of patient 3. By 10 hours defeated notes, methionine was removed and is surpassed 200 times, is down to 0.1 μ M from 23.1 μ M. In measuring, all toxicity criterions do not find clinical toxicity.

Carry out toxicity evaluation aspect four according to the WHO toxicity criterion: a. medical history and diagnosis data; B. physical examination; C. laboratory assessment; With d. pharmacokinetics assessment (methioninase and methionine content in the serum). Result shown in table 8-11 and Fig. 4-6 prove methioninase of the present invention in human body be without toxicity and can be used for reducing Methionine Levels.

The clinical phase I test of table 8 methioninase
					Patient I	Patient II	Patient III
Diagnosis	With the breast cancer that lymph node shifts, patient I also has lung to shift		Breast cancer/transfer
				Sex	The women	The women	The women
Age	46	54	45
				The MET enzyme	5,000 units	10,000 units	20,000 units

I.v. fail and annotate	2 hours	2 hours	10 hours
				Get blood sample	Before defeated the notes and during defeated the notes per 2 hours, the defeated notes rear 10 hours
Assessment	WHO standard

The toxicity of the clinical phase I test of table 9 methioninase
				Health and laboratory check	FDA standard toxic grade
Patient I	Patient II	Patient III
			Blood
	0	0		0
			Stomach and intestine		0	0	0
Kidney	0	0		0
			Lung		0	0	0
Fever	0	0		0
			Allergic reaction		0	0	0
Phlebitis	0	0		0
			Skin		0	0	0
Heart	0	0		0
			Neurology		0	0	0

Experimental phase I clinical testing methionine and methioninase level in the table 10 patient III body (10 hours methioninase 20000 units of the defeated notes of iv)
						Time		Homocysteine		Methionine
		μM	％	μM	％
						Before defeated the notes		7.7	100	23.1	100
During defeated the notes	2h	5.4	70	2.9	12.6
							4h	5.6	73	3.4	14.7
	6h	4.8	62	0.5	2.2
							8h	4.2	55	0.2	0.09
	10h	2.8	36	0.1	0.04
						After defeated the notes	2h	2.6	34	0.2	0.01

10h

2.5

32

0.7

0.3

Embodiment 7

The removal of homocysteine in the body

By following this enzyme of mouse administration has been proved that methioninase of the present invention is for rendeing a service in the body of removing homocysteine: to 4 unit methioninases of the method purifying of injection embodiment 1 in the mouse peritoneal. After injecting about 1 hour, carry out anti-phase FPLC by the mouse serum to 50 deriving of μ l PITC and analyze to measure methionine, the blood sample concentration of homocysteine and cysteine. With the raw sample methionine that chromatogram and PITC derive, homocysteine, and the chromatogram of cysteine standard sample is compared. The sensitivity of test is about 0.5 μ M methionine.

As shown in table 11, compare with cysteine with the high hemiamic acid of untreated mouse contrast, methioninase have in the significant body homocysteine remove active, and without any the removal effect of cysteine in the obvious body.

Table 11 methioninase is to minimizing effect in the body of methionine and to other amino acid whose effect
				Sample	Methionine (μ M)	Homocysteine (μ M)	Cysteine ​​(μM)
Comparison	131.8	2.7	74
				Methioninase	6.6	0.5	71

Example 8

Methioninase for tumor imaging

As described herein, by the administration of the purified enzyme methionine, removed from the patient [¹²C] Methionine. Preferably, the endotoxin-free methioninase. Enter through the intravenous administration of 4 to 8 hours eggs Neuraminidase (10000-20000 units). Then give about 5-50mCi [¹¹C] methionine enzymes. Should then be Positron emission tomography (PET) imaging to determine the patient cells [¹¹C] tracer intake. By One of ordinary skill in the known method, by calculating the standardized uptake value (S, U, V) and dynamic Provided constant (Ki) values ​​of quantitative determination of tracer intake. Elevated levels of intracellular [¹¹C] methionine showed These cells may be tumor cells. Priority tumor cell uptake [¹¹C] methionine provides a positive Normal cells in selective tumor cell detection approach.

The specific description of the above, including specific examples and embodiments are to illustrate the present invention and are not As limited. Does not exceed the true spirit and scope of the present invention, can be a variety of other changes and modifications Ornaments.

Example 9

Isolated nucleic acid molecule encoding methioninase

Methioninase gene insert in the PCR reactions:

A bad smell derived ATCC8209 Pseudomonas AC-1 genomic DNA as a template; the Primers used were as follows:

t1：5′-GCCGGTCTGTGGAAT AAGCT3 '(sense),

                     Hind III

t2：5′-CCAG GGTCGACTCCAGCGCC-3 '(antisense)

         Sal I

PCR reaction conditions were as follows: denaturation at 95 ℃ the first 10 minutes and then at 94 ℃ for 30 Seconds, annealing at 60 ℃ for 30 seconds, at 72 ℃ for 2 minutes, then 5 cycles at 94 ℃ changed Of 30 seconds, 60 ℃ annealing for 30 seconds and at 72 ℃ for 1.5 min for 25 cycles; then Final extension at 75 ℃ after 10 minutes. There are two PCR products electrophoresis to collect them 1365bp The band was purified insert ONCase-1DNA.

Cloning and transformation

ONCase-1DNA with pT7Blue T-vector (Novagen) at the EcoR VT-cloning site of connection. Using standard methods pONCase-1DNA transformed into DH5-α bacterial cells.

DNA Sequencing

With T7DNA polymerase and dideoxynucleotide termination DNA sequencing reactions. Use Primer walk method. With [³⁵S] dATP labeled. Containing 8M urea in a 6% polyacrylamide wedge Or wedge-shaped gel analysis of the sequencing reaction. DNA samples are loaded in order to ACGT. By Mac Vector DNA sequence analysis. Figure 8 provides the DNA sequence and corresponding amino acid sequence.

Example 10

High expression recombinant methioninase clone

Methioninase expression cloning the insert of the PCR reactions:

PONCase-1 clone as a template and the primers used were as follows:

t14.5′-GGAATTC CATATGCACGGCTCCAACAAGC-3 '(sense)

               NdeI

t15.5′-AGTCAT CCTAGGTCACATCATCATCATCATCATGGCACTCGCCTTGAGT

GC-3 '(antisense) BamHI

t18.5′-AGTCAT CCTAGGTCAGGCACTCGCCTTGAGTGC-3 '(antisense)

              BamHI

PCR reaction conditions were as follows: denaturation at 95 ℃ the first 10 minutes and then at 94 ℃ for 1 Minutes, 1.5 minutes at 56 ℃ annealing and extension at 72 ℃ for 2 minutes, 5 cycles; and At 94 ℃ for 30 seconds, annealing at 56 ℃ for 30 seconds, then at 72 ℃ for 1.5 minutes for 20 Cycles; then a final extension at 72 ℃ for 10 minutes. Collected and purified two PCR products, ONCase-2 (1238bp), ONCase-3 (1220bp) band.

Cloning and transformation

With Nde I and Bam HI digestion of ONCase-2 and ONCase-3DNA, and with the pT7.7 vector The Nde I and Bam HI cloning site connection. Then using standard methods PONCase-2 and PONCase-3DNA sequence was transformed into BL21 (DE3) bacterial cells.

Select pAC-1 and pAC-2 clone

Plates containing ampicillin to select positive clones. At 4 ℃ for 24 hours, the expression High levels of recombinant methioninase has obvious positive clones selected for the identification and pink. Through Over activity of positive clones was determined expression levels of methioninase. Select two high tables Nasdaq Long is included ONCase-3 of pAC-1 clone and contain ONCase-2 of pAC-2 clones.

Construct pAC-3 clones and pAC-4 clone

From pBR322 in AvaI and Cla I sites to obtain tetracycline resistance gene. Ava I ends are complementary To the flat end, and with the pAC-1 connection, the pAC-1 was BamHI and ClaI restriction endonuclease elimination Technology, BamHI ends are complementary for the flat side. From the selection plates containing tetracycline for 24 hours at 4 ℃ after The positive clones becomes pink. Activity was measured through analysis of high expression of recombinant enzyme methionine cloning, and ordered Named pAC-3 clones.

PBR 322 at position from Ava I and Hind III also received tetracycline resistance gene. Ava-1 Charged into a flat end end and with a Hind III and Cla I restriction endonuclease digested pAC-1 connections, Cla I end filled with a flat end. From the selection on plates containing tetracycline at 4 ℃ for 24 hours after the change powder Colored positive clones. Activity was measured with a high expression of recombinant enzyme methionine cloned and named pAC-4 Cloning. Table 12 and Figure 9 provides a variety of high expression clones.

Table 12 Enzyme expression cloning
						Clone	Vector	Antibiotic resistance	Promoter	Fuse	Expression (g / l)
pAC-1	pT7.7	Amp	T7	---	1.0
						pAC-2	pT7.7	Amp	T7	His.Tag	0.5
pAC-3	pT7.7	Tc	T7	---	0.5

pAC-4	pT7.7	Tc	T7	---	1.0
						*Expression levels in shake flask (TB medium, 37 ℃, 400rpm, 36 hours).

Example 11

Recombinant expression of cloned enzyme methionine fermentation

Containing ampicillin (100μg/ml) or tetracycline (10μg/ml) in Terrific Broth medium , In the 28 ℃ or 37 ℃, 400rpm shaking in 6L flasks or fermenter recombinant methionyl Acid-enzyme expression cloning.

Example 12

Purification of recombinant methioninase

Figures 10 and 11 provides a thumbnail purification methods.

(1) pre-column treatment of the sample

At 4 ℃ to 800 × g centrifugation for 10 minutes to collect the bacteria, the bacterial pellet was then suspended in Extraction solution (20mM potassium phosphate (pH9.0), 10μm pyridoxal phosphate and 0.01% β-mercaptoethanol), With cavity-type homogenizer (Microfluidics Corp.model # HC 8000) broken. Then at 50 ℃ The homogenate was subjected to heat treatment for 1 minute. Automatic refrigerated centrifuge (SORVALL Superspeed RC2-B) at 4 ℃ to 13rpm and the suspension was centrifuged for 30 minutes. Then the supernatant was collected. Followed by Millipore prep / Scale-TFF PLHK 100k 2.5ft²Column with buffer (10mM potassium phosphate, pH8.3) ultrafiltration. PH was adjusted to 7.2 by ultrafiltration.

(2) Column chromatography conditions

First column: DEAE Sepharose FF

Column: XK 100/60, Height: 32cm, Volume: 2.5L

Solution: [A] containing 10μm pyridoxal phosphate and 0.01% β-mercaptoethanol 40mM KCl, 10mM potassium phosphate (pH7.2).

[B] containing 10μm pyridoxal phosphate and 0.01% β-mercaptoethanol 200mM KCl, 10mM potassium phosphate (pH7.2).

Flow rate: 5ml/min

Sample: about 100-200g of total protein (10-20mg/ml) is applied to the first column.

Gradient: [1] with about 10 volumes of solution A until the OD preflush₂₈₀Drops below 0.1.

[2] Gradient: 20% to 100% of solution B

Fractions: 200ml eluted fractions collected. By activity analysis to identify fractions containing rMETase and Concentrated.

Second column: DEAE Sepharose FF

Column: XK 50/30, Height: 25cm, Volume: 500mL

Solution: [A] with 10μm pyridoxal phosphate and 0.01% β-mercaptoethanol 100mM potassium chloride, 10mM potassium phosphate (pH8.3).

[B] with 10μm pyridoxal phosphate and 0.01% β-mercaptoethanol 200mM KCl, 10mM Potassium phosphate (pH8.3).

Flow rate: 5ml/min

Sample: 10μm containing pyridoxal phosphate 100mM potassium chloride, 10mM potassium phosphate (pH8.3) After 24 hours dialysis about 10-20g of total protein (2-4mg/ml) applied to the second column.

Gradient: [1] with about 5 volumes of solution A pre-washed until the OD₂₈₀Drops below 0.05.

[2] Gradient: 0% to 60% solution B.

Fractions: 200ml eluted fractions collected. By activity analysis to identify fractions containing rMETase and Concentrated.

The third column: Sephacryl S-200HR

Column: Hi Prep 26/60, Volume: 320ml.

Solution: 0.15M sodium chloride in 10mM sodium phosphate (pH7.2) was added.

Flow rate: 1.2ml/min

Sample: about 10ml concentrated sample. (In 0.15M NaCl, 10mM sodium phosphate (pH7.2) Dialyzed 12 hours), applied to the third column.

Fractions: by yellow color and activity analysis to identify fractions containing rMETase eluted and collected.

The fourth column: Acticlean^Etox

100-200ml volume of purified rMETase (10-20mg protein / ml) were added to 500ml Acticlean^Etox column and eluted with elution buffer (0.15M NaCl in 10mM sodium phosphate, pH7.2) elution to remove endotoxin. Acticlean^Etox be regenerated, and can hydroxide 1M Sodium washed, and can be autoclaved.

Final eluate was concentrated

Prepared using 30K Amicon centrifugal concentrator final eluate was concentrated. Purified braking rMETase Agent is 0.15M NaCl, 10mM sodium phosphate, pH7.2.

Purification rMETase. Histidine: the Ni⁺⁺Chromatography on a column of Sepharose

After pretreatment of the column, the cell homogenate was suspended in binding buffer (5mM imidazole, 0.5M NaCl, 20mM Tris-HCl, pH7.9). Then washed with 10 column volumes of binding buffer wash, followed by 6 volumes with wash buffer (60mM imidazole, 0.5M NaCl, 20mM Tris, HCl, pH7.9) punch Wash. 6 volumes of elution buffer (1M imidazole, 0.5M NaCl, 20mM Tris · HCl pH7.9) was purified by column Child after elution. Identification by the yellow fractions containing rMETase, and collected.

Example 13

The purity determined by HPLC rMETase

Column: SUPELCO ,8-08541, Progel TM-TSK, G 3000-SWXL, 30cm × 7.8mm.

Elution buffer: 0.15M NaCl with 10mM sodium phosphate buffer (pH7.2).

Flow rate: 1ml/min

Sample: 20μl (0.1-1mg/ml)

Production of rMETase see Examples 10 and 11. Purification of Figure 12.

Example 14

Crystallization and lyophilized form containing recombinant methioninase (rMETase) preparation

Solution preparation:

Concentration to 10-20mg/ml, preparation rMETase solution, the solution is 0.15M sodium chloride, 10mM sodium phosphate buffer (pH7.2). Figure 13 Stability of rMETase.

Crystalline forms:

To 0.15M sodium chloride and 10mM sodium phosphate buffer (pH7.2) in the rMETase (10-20mg/ml) with Sephadex G-25 (DNA grade, superfine, Sigma) column desalting. The solution was dried Frozen ice and acetone bath and then Verdis Freeze Mobile 24, at 100 mbar vacuum at -80 ℃ crystallize for 72 hours.

Lyophilized form:

In 0.15M sodium chloride and 10mM sodium phosphate buffer (pH7.2) in the rMETase (10-20mg/ml) in a dry ice acetone bath and chilled, with Verdis Freeze Mobil 24 100 mbar vacuum at -80 ℃ lyophilized for 72 hours.

Activity test:

Is tested in 1ml volume containing 10μM pyridoxal phosphate and phosphate 10mM 50mM methionine Salt buffer pH8.0 at 37 ℃, with different amounts of enzyme for 10 minutes. Add 0.5ml 4.5% TCA terminate the reaction. Suspension was centrifuged at 15K rpm for 2 minutes. The supernatant was mixed with 0.5ml 0.5ml 0.05 % 3 - methyl - 2 - benzothiazolinone hydrazone and 1ml 1M sodium acetate (pH5.2) was incubated together at 50 ℃ 30 minutes. Then using a spectrophotometer at OD₃₃₅Determination of α-butanone radical. With Lowry Reagent Kit (Sigma) the amount of protein determined by the method, in units / mg protein specific activity calculations.

Compare rMETase activity between different preparations results showed no big difference.

Example 15

Recombinant methioninase (PEG-rMETase) chemical modification

10mM sodium chloride in 0.15M sodium phosphate buffer (pH7.2) in between 0.2M to 0.1M and The concentration of the purified preparation rMETaes. Activity is about 20 units / mg.

A molecular weight of 5000 M-SC 5000PEG (Methoxy-SC-PEG, MW 5000, purchased from Shear water Polymers) to a concentration of between 2mM and 20mM sodium phosphate buffer dissolved in 20mM Red liquid (pH8.3) in. M-SC 5000PEG and rMETase molar ratio from 10:1 to 120:1 changed.

PEG reaction in reaction buffer (25mM sodium phosphate buffer, pH8.3) in progress at 20 ℃ For 60 minutes. A stop buffer (0.14M sodium phosphate buffer, pH6.5) at 0 ℃ terminate the reaction. Then 30K Amicon Centriprep concentrator unreacted M-SC 5000PEG. With 30K Centrifugal concentrator Amicon Centriprep NaCl and 10mM sodium phosphate 0.15 (pH7.2) in distribution Made the final PEG-methionine enzymes.

PEG-rMETase in vitro tests:

The active analysis, electrophoresis, and HPLC analysis PEG-rMETase, Figure 14-16.

Activity analysis:

The activity of PEG-rMETase activity of the unmodified rMETase 80% to 20%.

Electrophoresis:

Invariance and SDS-PAGE in both pairs of PEG-rMETase electrophoresis.

HPLC analysis:

The PEG-rMETase applied to the gel filtration column, no original rMETase measured peaks Found only PEG-METASE peaks. Retention time (RT) with the molecular ratio of PEG and rMETase growth Large and shorter.

Pharmacokinetics of PEG-rMETase:

The purified endotoxin-free PEG-rMETase in mice injected into the tail vein. Collected every 2 hours Blood samples. RMETase by measuring the level of activity assay (Figure 16).

Example 16

Efficacy of recombinant methioninase and toxicity

rMETase in vitro cell growth inhibition of

In supplemented with 10% FBS in RPMI 1640 culture medium KB3-1 cells (human squamous Skin cell carcinoma). Added to the medium at various concentrations rMETase. And at 37 ℃, 5% CO₂Condition Incubation. In OD₅₇₀Is measured relative cell number. The results prove that inhibit cell growth rMETase Length (Figure 17).

H460 and HT29 rMETase on in vitro growth inhibition

H460 human lung cancer cells and human HT29 colon cancer cells at different concentrations rMETase (0-4 units / ml) in the grown for four days, and then counting surviving cells. The real test is repeated three times. The results prove rMETase Effectively inhibited both H460 and HT29 cells (Figure 25).

Vitro compared to normal cells and the sensitivity of human cancer cells to rMETase

Normal human foreskin fibroblasts HS-68 and human keratinocytes as a control, and human colon Carcinoma SW-620 and human lung cancer cells H322m compared. Cells with different concentrations (0-4 units / ml) rMETase counted after three days with the growing number of viable cells. The experiment was repeated three times. The results prove SW-620 cells and H322m rMETase concentration of 1 unit / ml of deaths, while the normal HS-68 Cells were still alive, but the growth rate slowed down. Normal human foreskin fibroblast cell lung cancer compared with Of rMETase have smaller sensitivity (Figure 26).

Nude mice rMETase on cell growth inhibition

To Balb / c nu / nu, female, a group of eight mice injected 2 × 10⁵Cells. Control: Health Saline. Group I: 30 units rMETase, Group II: 100 units rMETase; from the 5th Days to 14 days, twice a day intraperitoneally. Tumor size and body weight measurements. Day 18 blood Samples. The results prove that rMETase effectively inhibited tumor growth without the weight, and the blood cell growth A no effect (Figure 18-22).

H460 rMETase in nude mice and the growth inhibition of HT29 cells

Were subcutaneously (S.C.) transplant, 10⁶A H460 cells and HT29 cells from the first two days to 16 Day twice a day by intraperitoneal injection of 40 units or 100 units administered rMETase. Daily control group Twice intraperitoneal injection of saline 0.2ml. Mice were sacrificed on day 16. The results prove that there rMETase Potent inhibition of tumor growth and not lose weight, and does not affect blood cell production.

Purified recombinant METASE of the first phase of the pilot clinical trial

Patient 1, female, 50 years old, IV breast cancer and lymph node metastasis, intravenous infusion of 10 hours Administration of 10,000 units (0.5g) rMETase.

Patients 2,48 years old, female, IV breast cancer and lymph node metastasis, intravenous infusion for 24 hours Medicine 5000 units (0.25g) rMETase.

Patients 3,56 years old, female, III renal cell, enter 24 hours of intravenous administration of 10,000 units (0.5g) rMETase. Table 13. Record physical examination before treatment, during treatment, blood samples were taken every two hours, Until the first 48 hours after the infusion (such as indicated). According to WHO criteria for laboratory determination.

The results showed that all patients rMETase level after the start of the infusion increased immediately and the infusion Maintain a high level during the period. A patient-methionine at 48 hours after the enzyme levels drop back to the base line. Results Table That rMETase level immediately after the start of the infusion increased from 10 hours to the highest point. Stop infusion Only after eight hours, methionine enzyme levels are 50% of peak, and 16 hours after the infusion peak remains 20%. According to the WHO standard evaluation laboratory findings indicate that patients with 1, 2 or 3 is not urgent Of toxicity. Table 14 and 15 and Figures 23 and 24. The results showed that does not cause any toxic rMETase.

Table 13 Recombinant enzyme methionine Phase I clinical trial program
					Patients I	Patients II	Patients III
Diagnosis	Breast cancer with metastasis		Kidney Cancer
				Gender	Female	Female	Female
Age	46	48	56
				rMET enzyme	10,00 Unit	5,000 units	10,000 units
i.v. infusion	8 hours	24 hours	24 hours
				Blood samples were taken	Before infusion, infusion every two hours during the infusion after 48 hours
Assess	WHO criteria

Table 14 recombinant enzyme methionine Phase I clinical trial of toxicity
				Physical and laboratory tests Search	Grade
Patients I	Patients II	Patients III
			Blood
	0	0		0
			Gastrointestinal		0	0	0
Kidney	0	0		0
			Lung		0	0	0
Fever	0	0		0
			Allergic reactions		0	0	0
Phlebitis	0	0		0

Skin	0	0	0
				Heart	0	0	0
Neurology	0	0	0

Table 15 Implementation of Phase I clinical trials, statistical records vital signs of patients I (iv input 8 hours 10,000 units rMET enzyme)
						Time
		Body temperature	Pulse	Respiration rate	Blood pressure
						Before infusion		36.70	61	20	114/76
During infusion	1h	36.60	58	18	116/78
						2h	36.60	59	20	118/80
		3h	36.60	62	20						112/74
4h						36.70	64	20	112/74
			5h	36.50	62					20	116/76
6h	36.60					64	20	116/78
				7h	36.60				64	20	114/78
8h	36.60	62				20	114/76
				After infusion	10h			36.60	62	20	114/76
	24h	36.60	60			18	114/76

Sequence Table

<110> anticancer Company (ANTICANCER, INC.)

Tan Yuying (TAN, Yuying)

Valery. Li Shike (LISHKO, Valeriy)

<120> in the anti-methionine and methioninase anti-homocysteine ​​chemotherapy application

<130>31276-20002.75

<140>200410078709.x

<141>2004-09-17

<150>PCT/US96/09935

<151>1996-06-07

<150>US 08/486,519

<151>1995-06-07

<150>US 08/624,541

<151>1996-05-03

<160>7

<170>FastSEQ for Windows Version 4.0

<210>1

<211>20

<212>DNA

<213> Artificial Sequence

<220>

<223> primer (sense)

<400>1

gccggtctgt ggaataagct                          20

<210>2

<211>20

<212>DNA

<213> Artificial Sequence

<220>

<223> primer (antisense)

<400>2

ccagggtcga ctccagcgcc                          20

<210>3

<211>29

<212>DNA

<213> Artificial Sequence

<220>

<223> primer (sense)

<400>3

ggaattccat atgcacggct ccaacaagc                 29

<210>4

<211>51

<212>DNA

<213> Artificial Sequence

<220>

<223> primer (antisense)

<400>4

agtcatccta ggtcacatca tcatcatcat catggcactc gccttgagtg c    51

<210>5

<211>33

<212>DNA

<213> Artificial Sequence

<220>

<223> primer (antisense)

<400>5

agtcatccta ggtcaggcac tcgccttgag tgc                     33

<210>6

<211>1260

<212>DNA

<213> Pseudomonas putida (P.putida)

<220>

<221>CDS

<222>(48)...(1241)

<400>6

gccggtctgt ggaataagct tataacaaac cacaagaggc ggttgcc atg cac ggc    56

                                                    Met His Gly

                                                     1

tcc aac aag ctc cca gga ttt gcc acc cgc gcc att cac cat ggc tac    104

Ser Asn Lys Leu Pro Gly Phe Ala Thr Arg Ala Ile His His Gly Tyr

     5                   10                  15

gac ccc cag gac cac ggc ggc gca ctg gtg cca ccg gtc tac cag acc    152

Asp Pro Gln Asp His Gly Gly Ala Leu Val Pro Pro Val Tyr Gln Thr

 20                  25                  30                  35

gcg acg ttc acc ttc ccc acc gtg gaa tac ggc gct gcg tgc ttt gcc    200

Ala Thr Phe Thr Phe Pro Thr Val Glu Tyr Gly Ala Ala Cys Phe Ala

                 40                  45                  50

ggc gag cag gcc ggc cat ttc tac agc cgc atc tcc aac ccc acc ctc    248

Gly Glu Gln Ala Gly His Phe Tyr Ser Arg Ile Ser Asn Pro Thr Leu

             55                  60                  65

aac ctg ctg gaa gca cgc atg gcc tcg ctg gaa ggc ggc gag gcc ggg    296

Asn Leu Leu Glu Ala Arg Met Ala Ser Leu Glu Gly Gly Glu Ala Gly

         70                  75                  80

ctg gcg ctg gcc tcg ggc atg ggg gcg atc acg tcc acg cta tgg aca    344

Leu Ala Leu Ala Ser Gly Met Gly Ala Ile Thr Ser Thr Leu Trp Thr

     85                  90                  95

ctg ctg cgc ccc ggt gac gag gtg ctg ctg ggc aac acc ctg tac ggc    392

Leu Leu Arg Pro Gly Asp Glu Val Leu Leu Gly Asn Thr Leu Tyr Gly

100                 105                 110                 115

tgc acc ttt gcc ttc ctg cac cac ggc atc ggc gag ttc ggg gtc aag    440

Cys Thr Phe Ala Phe Leu His His Gly Ile Gly Glu Phe Gly Val Lys

                120                 125                 130

ctg cgc cat gtg gac atg gcc gac ctg cag gca ctg gag gcg gcc atg    488

Leu Arg His Val Asp Met Ala Asp Leu Gln Ala Leu Glu Ala Ala Met

            135                 140                 145

acg ccg gcc acc cgg gtg atc tat ttc gag tcg ccg gcc aac ccc aac    536

Thr Pro Ala Thr Arg Val Ile Tyr Phe Glu Ser Pro Ala Asn Pro Asn

        150                 155                 160

atg cac atg gcc gat atc gcc ggc gtg gcg aag att gca cgc aag cac    584

Met His Met Ala Asp Ile Ala Gly Val Ala Lys Ile Ala Arg Lys His

    165                 170                 175

ggc gcg acc gtg gtg gtc gac aac acc tac tgc acg ccg tac ctg caa    632

Gly Ala Thr Val Val Val Asp Asn Thr Tyr Cys Thr Pro Tyr Leu Gln

180                 185                 190                 195

cgg cca ctg gag ctg ggc gcc gac ctg gtg gtg cat tcg gcc acc aag    680

Arg Pro Leu Glu Leu Gly Ala Asp Leu Val Val His Ser Ala Thr Lys

                200                 205                 210

tac ctg agc ggc cat ggc gac atc act gct ggc att gtg gtg ggc agc    728

Tyr Leu Ser Gly His Gly Asp Ile Thr Ala Gly Ile Val Val Gly Ser

            215                 220                 225

cag gca ctg gtg gac cgt ata cgt ctg cag ggc ctc aag gac atg acc    776

Gln Ala Leu Val Asp Arg Ile Arg Leu Gln Gly Leu Lys Asp Met Thr

        230                 235                 240

ggt gcg gtg ctc tcg ccc cat gac gcc gca ctg ttg atg cgc ggc atc    824

Gly Ala Val Leu Ser Pro His Asp Ala Ala Leu Leu Met Arg Gly Ile

    245                 250                 255

aag acc ctc aac ctg cgc atg gac cgc cac  tgc gcc aac gct cag gtg    872

Lys Thr Leu Asn Leu Arg Met Asp Arg His Cys Ala Asn Ala Gln Val

260                 265                 270                 275

ctg gcc gag ttc ctc gcc cgg cag ccg cag gtg gag ctg atc cat tac    920

Leu Ala Glu Phe Leu Ala Arg Gln Pro Gln Val Glu Leu Ile His Tyr

                280                 285                 290

ccg ggc ctg gcg agc ttc ccg cag tac acc ctg gcc cgc cag cag atg    968

Pro Gly Leu Ala Ser Phe Pro Gln Tyr Thr Leu Ala Arg Gln Gln Met

            295                 300                 305

agc cag ccg ggc ggc atg atc gcc ttc gaa ctc aag ggc ggc atc ggt    1016

Ser Gln Pro Gly Gly Met Ile Ala Phe Glu Leu Lys Gly Gly Ile Gly

        310                 315                 320

gcc ggg cgg cgg ttc atg aac gcc ctg caa ctg ttc agc cgc gcg gtg    1064

Ala Gly Arg Arg Phe Met Asn Ala Leu Gln Leu Phe Ser Arg Ala Val

    325                 330                 335

agc ctg ggc gat gcc gag tcg ctg gcg cag cac ccg gca agc atg act    1112

Ser Leu Gly Asp Ala Glu Ser Leu Ala Gln His Pro Ala Ser Met Thr

340                 345                 350                 355

cat tcc agc tat acc cca gag gag cgt gcg cat tac ggc atc tcc gag    1160

His Ser Ser Tyr Thr Pro Glu Glu Arg Ala His Tyr Gly Ile Ser Glu

                360                 365                 370

ggg ctg gtg cgg ttg tcg gtg ggg ctg gaa gac atc gac gac ctg ctg    1208

Gly Leu Val Arg Leu Ser Val Gly Leu Glu Asp Ile Asp Asp Leu Leu

            375                 380                 385

gcc gat gtg caa cag gca ctc aag gcg agt gcc tgaacccgtc acggatgag  1260

Ala Asp Val Gln Gln Ala Leu Lys Ala Ser Ala

        390                 395

<210>7

<211>398

<212>PRT

<213> Pseudomonas putida (P.putida)

<400>7

Met His Gly Ser Asn Lys Leu Pro Gly Phe Ala Thr Arg Ala Ile His

 1               5                  10                  15

His Gly Tyr Asp Pro Gln Asp His Gly Gly Ala Leu Val Pro Pro Val

            20                  25                  30

Tyr Gln Thr Ala Thr Phe Thr Phe Pro Thr Val Glu Tyr Gly Ala Ala

        35                  40                  45

Cys Phe Ala Gly Glu Gln Ala Gly His Phe Tyr Ser Arg Ile Ser Asn

    50                  55                  60

Pro Thr Leu Asn Leu Leu Glu Ala Arg Met Ala Ser Leu Glu Gly Gly

65                  70                  75                  80

Glu Ala Gly Leu Ala Leu Ala Ser Gly Met Gly Ala Ile Thr Ser Thr

                85                  90                  95

Leu Trp Thr Leu Leu Arg Pro Gly Asp Glu Val Leu Leu Gly Asn Thr

            100                 105                 110

Leu Tyr Gly Cys Thr Phe Ala Phe Leu His His Gly Ile Gly Glu Phe

        115                 120                 125

Gly Val Lys Leu Arg His Val Asp Met Ala Asp Leu Gln Ala Leu Glu

    130                 135                 140

Ala Ala Met Thr Pro Ala Thr Arg Val Ile Tyr Phe Glu Ser Pro Ala

145                 150                 155                 160

Asn Pro Asn Met His Met Ala Asp Ile Ala Gly Val Ala Lys Ile Ala

                165                 170                 175

Arg Lys His Gly Ala Thr Val Val Val Asp Asn Thr Tyr Cys Thr Pro

            180                 185                 190

Tyr Leu Gln Arg Pro Leu Glu Leu Gly Ala Asp Leu Val Val His Ser

        195                 200                 205

Ala Thr Lys Tyr Leu Ser Gly His Gly Asp Ile Thr Ala Gly Ile Val

    210                 215                 220

Val Gly Ser Gln Ala Leu Val Asp Arg Ile Arg Leu Gln Gly Leu Lys

225                 230                 235                 240

Asp Met Thr Gly Ala Val Leu Ser Pro His Asp Ala Ala Leu Leu Met

                245                 250                 255

Arg Gly Ile Lys Thr Leu Asn Leu Arg Met Asp Arg His Cys Ala Asn

            260                 265                 270

Ala Gln Val Leu Ala Glu Phe Leu Ala Arg Gln Pro Gln Val Glu Leu

        275                 280                 285

Ile His Tyr Pro Gly Leu Ala Ser Phe Pro Gln Tyr Thr Leu Ala Arg

    290                 295                 300

Gln Gln Met Ser Gln Pro Gly Gly Met Ile Ala Phe Glu Leu Lys Gly

305                 310                 315                 320

Gly Ile Gly Ala Gly Arg Arg Phe Met Asn Ala Leu Gln Leu Phe Ser

                325                 330                 335

Arg Ala Val Ser Leu Gly Asp Ala Glu Ser Leu Ala Gln His Pro Ala

            340                 345                 350

Ser Met Thr His Ser Ser Tyr Thr Pro Glu Glu Arg Ala His Tyr Gly

        355                 360                 365

Ile Ser Glu Gly Leu Val Arg Leu Ser Val Gly Leu Glu Asp Ile Asp

    370                 375                 380

Asp Leu Leu Ala Asp Val Gln Gln Ala Leu Lys Ala Ser Ala

385                 390                 395

Claims (36)

1, a chemical modification of methioninase, binding to the polymer containing methioninase.

2, according to claim 1, chemically modified methioninase wherein the polymer is a polyalkylene oxide, Thereof.

3, the chemical modification claimed in claim 2 methioninase, wherein the polyalkylene oxide is polyethylene Diol.

4, according to claim 1, chemically modified methioninase wherein the methioninase is substantially free of internal Toxins.

5, the separated crystalline methioninase.

6, the separated type methioninase lyophilized.

7, isolated methioninase having at least about 20 units / mg and a specific activity of HPLC analysis of the measured purity of at least about 95%.

8, a therapeutic composition comprising a therapeutically effective amount of a claimed in any one of claims 1-7 Methioninase.

9, a method for treating cancer patients, which comprises a therapeutically effective amount of the protein of claim 8 Neuraminidase compositions to patients taking steps.

10, a diagnostic method for cancer patients, comprising the steps of:

a) by giving patients taking enzyme methionine to remove a patient's body 12C methionine;

b) by giving patients taking 11C methionine to give patients an adequate supply of methionine; and

c) determining the patient's body 11C tumor cells present in elevated levels of methionine.

11, The method of claim 10, wherein the methioninase is the composition of claim 8.

12 A method for treating or preventing cardiovascular disease in patients with a method which comprises administration to the patient A therapeutically effective amount of methioninase step wherein methioninase is substantially free of endotoxin.

13, The method of claim 12, wherein the methioninase is the composition of claim 8.

14, The method of claim 12, wherein the cardiovascular disease is atherosclerosis.

15 A method for reducing homocysteine ​​content in the patient, which comprises administering to the patient a therapeutically An effective amount of methioninase step wherein the methioninase is substantially free of endotoxin.

16, The method of claim 15, wherein the methioninase is the composition of claim 8.

17, a coding efficiency methioninase expression model that contains operational connection startup The methioninase-encoding sequence of the nucleotide sequence, wherein the promoter sequence is able to guide the host cell Methioninase expression in cells, such that the expression of methioninase is produced by the host cell total protein Of 5-75 percent.

18, expression module of claim 17, wherein the promoter is an RNA polymerase start Mover.

19, the expression module of claim 18, wherein the promoter is a T7 RNA polymerase start Child.

20, the expression module of claim 17, wherein the nucleotide sequence encoding methioninase from Selected from the stench of Pseudomonas (Pseudomonas putida), Trichomonas vaginalis (Trichomonas vaginalis), Brazil yen nematode (Nippostrongylus brasiliensis) and Fusobacterium genus (Fusobacteriumsp.) of organisms isolated.

21, the expression module of claim 20, wherein the nucleotide sequence is provided in Figure 8 and its Degenerate form.

22, expression module of claim 21, wherein the form of Figure 8 degenerate nucleotide sequences include Figure 8 has been changed in the sequence provided, including the sequence in E. coli (E.coli.) More commonly used in One or more codons.

23 A method as claimed in claim 17, a host cell transformed with the expression model.

24, the host of claim 23, wherein the host is Escherichia coli.

25, the host of claim 24, wherein the host is Escherichia coli (E.coli.) BL21 (DE3).

26 A vector comprising expression module of claim 17.

27 An isolated nucleic acid molecule comprising in Figure 8 provides the nucleotide sequence and a One or more of the enzyme methionine C-or N-terminal encoding two or more histidine residues in a nucleic acid sequence Columns.

28, an identity efficient expression of methioninase transformed host cell, the method comprising The following steps:

Methioninase expressing cultured under conditions transfected host cell; and

Select Pink transformed host cells.

29, The method of claim 28 wherein the host cell is Escherichia coli (E.coli).

30, The method of claim 29, wherein the host is cultured on solid medium.

31, The method of claim 28, wherein said selective host cells produce approximately the total protein 5-75% of the white methioninase.

32, a modified gene therapy, wherein the improvement comprises use of the expression module of claim 17 Style.

33, The method of claim 32, wherein the tumor specific promoter to control the expression of the model Expression.

34, a purified methioninase, the method comprising the steps of:

a) in the expression of the enzyme methionine cultured under conditions methioninase expression host;

b) heating at about 40-60 ℃ methioninase transformed cells containing an extract of aqueous buffer Was about 1-10 minutes;

c) In the GS-3 rotor (Sorval, Du Pont) in the order of about 10k to 20k rpm after the heat Extract was centrifuged for about 15 minutes to 1 hour;

d) uses about 50k to 100k pore size filter ultrafiltration supernatant;

e) at low ionic strength (about 10-50mM) KCl approximately pH7.0-7.6 under the conditions DEAE ion exchange chromatography, and collecting the with about 40-200mM KCl gradient elution solution The fractions containing methioninase;

f) at moderate ionic strength (approximately 100-200mM) KCl approximately pH8.0-8.6 under conditions The second line of DEAE ion exchange chromatography, and collecting a 0.1-0.2M KCl in phosphate buffer Eluted fractions containing methioninase;

g) in step (e), and the fractions collected to endotoxin adsorption column chromatography medium contact; and

h) collecting the eluant containing methioninase.

35, The method of claim 34, wherein the collected protein per mg methioninase having at least And 10 units of activity per mg protein of about 1-100ng of endotoxin.

36, The method of claim 34, wherein in step (g) using Acticlean^Etox column.

Images