CN1840691A - Function regulation of selenium protein Se1k to interactive protein HCLP1 and anti-oncogene LZIP - Google Patents
Function regulation of selenium protein Se1k to interactive protein HCLP1 and anti-oncogene LZIP Download PDFInfo
- Publication number
- CN1840691A CN1840691A CN 200510059335 CN200510059335A CN1840691A CN 1840691 A CN1840691 A CN 1840691A CN 200510059335 CN200510059335 CN 200510059335 CN 200510059335 A CN200510059335 A CN 200510059335A CN 1840691 A CN1840691 A CN 1840691A
- Authority
- CN
- China
- Prior art keywords
- hclp1
- selk
- lzip
- protein
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The related function regulation of SelK to HCLP1 comprises: with HCLP1 as bait protein and barm dual-hybridization technique, screening cDNA library of HeLa cell to obtain interacted SelK. The cell immunofluorescence locationg analysis shows the SelK can improve SelK moving from nucleus to cytoplasm, co-inhibits the transcription and activation of LZIP. The results show Se element plays an important role for health care.
Description
Technical field:
The present invention for utilize scientific discoveries such as yeast two-hybrid and co-immunoprecipitation, cellular immunofluorescence and confirmed SelK albumen can with the HCLP1 protein-interacting, and this interaction has promoted the caryoplasm transposition of HCLP1, SelK albumen and the collaborative transcriptional activation that has suppressed cancer suppressor gene LZIP of the proteic interaction of HCLP1 have been disclosed by two luciferase transcriptional activity experiments, for the selenium element is given a clue to vital role and cancer therapy that human life's health is risen.
The present invention relates to novel method in the biomedical hi-tech, new gene, new proteic exploitation and Application Areas.
Background of invention:
Selenium (Se) is the element of the character of discovery in 1817 like sulphur, and people recognize that gradually selenium is the essential a kind of micronutrient element of Mammals after the 1950's, and its meaning on biomedicine has caused increasing attention.Yet, the mineral compound of the chemical property of selenium element itself or biological a few selenium of contact usually can not pragmatize by the caused biological effect of selenium.First seleno-protein of finding in 1973---albumin A in clostridial hydrogenlyase and the glycine reductase enzyme system and Mammals Selenoperoxidase provide clue for we understand the syndromes that selenium deficiency causes.Subsequently, various seleno-proteins find in different biologies that in succession their biological function and the effect in molecular pathology are also constantly illustrated.Along with known seleno-protein number constantly increases, we will have more deep understanding to selenium role in the disease of virus infection, cardiovascular disorder, cancer prevention and other types.
The selenium element can be present in the native protein with two kinds of basic forms, and first kind is that selenium can be present in the albumen by posttranslational modification by dissociated cofactor as a kind of, and the form that this albumen of selenium is relevant is rarer, only contains in the molybdenum enzyme on several bacteriums and finds; In addition, selenium can be with rare amino acid---and the form of seleno-cysteine is gone in the albumen by cotranslational integration, and the albumen that contains seleno-cysteine on this primary structure is seleno-protein (selenoprotein).Seleno-protein extensively is present in organic sphere, as all having identified multiple seleno-protein in bacterium, archeobacteria and the Mammals.Seleno-protein is more common in Mammals, and since finding the first routine Mammals seleno-protein, the number of Mammals seleno-protein increases rapidly, and up to the present, people's seleno-protein sum has been increased to 25.
Understanding maximum Mammals seleno-protein families is Selenoperoxidase family, thioredoxin reductase family and take off the iodine enzyme family.There are four member: cGPx, GPx-GI, pGPx, PHGPX in Mammals Selenoperoxidase family.Its basic function is that the protection cell is avoided the oxidation attack.Mammals thioredoxin reductase molecular weight is about 55-65kD, and the many diverse reactions of catalysis, the disulfide linkage of its not only reduction-oxidation type Trx, and reduce some other proteic disulfide linkage and various oxidized low-molecular weight compound.Thioredoxin reductase plays a significant role in intracellular signal cascade as one of important reduction mechanism of ROS, and sulphur oxygen also system regulating reduction responsive type transcription factor such as p53, the transcriptional activity of NF κ B.Identify that in vertebrates three kinds of iodothyrines take off the iodine enzyme, I type (D1), II type (D2) and III type (D3) they all are seleno-proteins.Their catalysis thyroxine (T4, T4) and iodine thyronine take off iodine, the synthetic and degraded of decision Triiodothyronine.Other most selenium albumen comprise seleno-protein SelK Unknown Function, are still waiting further investigation.The vital role that present seleno-protein is played the part of in biology has become one of focus of biomedical research.
We are to begin in the process of research another one gene function for the concern of SelK.This gene is called HCLP1, and its one of coding has 406 amino acid whose albumen, is a kind of nucleus albumen of wide expression.This albumen is by six 45～71 amino acid whose repetition motifs, and promptly KELCH repeats to form, and belongs to the KELCH superfamily protein.
The KELCH motif is a kind of ancient element, at first finds in fruit bat kelch albumen, extensively is present in the protein of evolutionary process.The general formation kelch repeating structure territory of repeating 4 to 7 times of KELCH motif, the research of galactose oxidase crystalline structure discloses the KELCH structural domain and spatially forms a β propeller arrangement.71 kinds of albumen that contain KELCH repeating structure territory in the people's gene group, have been identified now.Existence according to other structural domains in the position of KELCH β water screw and the albumen is divided into five classes with the KELCH repetitive proteins, it is proteic 72% that wherein BTB/KELCH albumen constitutes KELCH repeating structure territory, and the whole protein molecular of HCLP1 just forms a six-bladed propeller structure.That KELCH superfamily albumen distributes is very extensive, existingly is positioned at intracellularly, also have to be positioned at cytolemma, is positioned at intercellular substance in addition.The function that KELCH superfamily albumen is brought into play in organism is also very various.
HCLP1 is a brand-new β water screw albumen, and is also fewer about its function report in vivo.We are " bait " albumen with HCLP1, adopt yeast-two hybrid technique screening human Hela cell cDNA library, have obtained a clone, and the albumen of its cDNA sequence encoding is SelK.Our experiment promptly is with the two interactional clue that is found to be, and explores both molecule mechanisms in transcriptional regulatory, and both functions aspect cell.Our experiment may be given a clue to the vital role that human life's health is risen for the selenium element.
Summary of the invention:
We find the interaction of HCLP1 and SelK, have strengthened the caryoplasm transposition of HCLP1 by this interaction, thereby further suppress the transcriptional activation of cancer suppressor gene LZIP.
The selenium element is played the part of vital role at organic sphere, yet the molecular mechanism of selenium biological function is still waiting further to illustrate.Our result has tentatively disclosed SelK at intracellular biological function, for the selenium element is given a clue to the vital role that human life's health is risen.
1. we are bait protein with HCLP1, utilize yeast-two hybrid technique screening HeLa cell cdna library, and examination is to HCLP1 interactional Protein S elK taking place.Subsequently, we utilize protein co-immunoprecipitation technology to verify that further the interaction of HCLP1 and SelK is special.
2. the cellular immunofluorescence experiment shows that the interaction between HCLP1 albumen and the SelK has changed the Subcellular Localization of HCLP1---promoted HCLP1 to be indexed into tenuigenin, and the Subcellular Localization of SelK albumen self does not change from nucleus.
3. the luciferase reporter gene detected result shows, the collaborative transcriptional activation that suppresses cancer suppressor gene LZIP mediation of the interaction between HCLP1 albumen and the SelK.
Therefore, SelK by with the interaction of HCLP1, strengthen the caryoplasm transposition of HCLP1, and the collaborative transcriptional activation that has suppressed cancer suppressor gene LZIP mediation of the interaction between HCLP1 albumen and the SelK.
The above experiment content and result who reaches also is a technical indicator of the present invention.
Description of drawings:
Combination experiment (Co-immunoprecipitation) in Fig. 1 HCLP1 and the SelK body
1.SelK independent transfection HEK293ET cell; 2.SelK and HCLP1 cotransfection HEK293ET cell;
3.SelK independent transfection HeLa cell; 4.SelK and HCLP1 cotransfection HeLa cell
Fig. 2 HCLP1 and the SelK location in the HeLa cell
The independent transfection HeLa cell of a.pEGFP-SelK; The independent transfection HeLa cell of b.pEGFP-HCLP1
Interaction between Fig. 3 HCLP1 albumen and the SelK promotes tenuigenin location pEGFP-SelK and pcDNA3.1/V5-HCLP1 difference cotransfection COS7 and the HeLa cell of HCLP1, and a and d are the location of SelK in COS7 and HeLa cell; B and e are the location of HCLP1 in the COS7 cell; C and f are that SelK and the tenuigenin of HCLP1 in COS7 and HeLa cell are located altogether.
The collaborative transcriptional activation that suppresses the LZIP mediation of the interaction of Fig. 4 HCLP1 albumen and SelK
1. use plasmid pM-LZIP and pGal4Luc, pRL-TK cotransfection COS7 cell;
2. use plasmid pM-LZIP, pcDNA3.1/V5-HCLP1 and pGal4Luc, pRL-TK corotation COS7 cell;
3-6. pEGFP-SelK cotransfection COS7 cell with plasmid pM-LZIP, pcDNA3.1/V5-HCLP1 and pGal4Luc, pRL-TK and various dose.
Embodiment:
1. test required primer:
| The primer title | Sequence | Restriction enzyme site | Purposes |
| AS-HCLP1 F： | 5’- CGGGATCCGTATGGCTGATGGCA ACGAGG-3’ | 5’BamHI | Yeast two-hybrid bait protein carrier pAS2-1-HCLP1 |
| AS-HCLP1 R： | 5’-AACTGCAG CCAGATCCAGAAGTGTTGTTAC -3’ | 3’PstI | |
| V5-HCLP1 F： | 5′- CGGGATCCCATGGCTGATGGCAA CGAGG-3′ | 5’BamHI | Mammalian cell expression vector pcDNA3.1 V5/HisB-HCLP1 |
| V5-HCLP1 R： | 5′-CCGCTCGAGCCAGATCCAGAA GTGTTGTTAC-3′ | 3’XhoI | |
| GFP-HCLP1 F： | 5′- AACTGCAGATGAAGTGCAGCCTC AAGATGGC-3′ | 5’PstI | The expression pEGFP-N1-HCL P1 of green fluorescent fusion protein |
| GFP-HCLP1 R： | 5′- CGGGATCCCCAGATCCAGAAGTG TTGTTAC-3′ | 3’BamHI | |
| GFP-SelK F： | 5′- CGGGATCCACCATGGAACAAA CTCATCTCAGAAGAGGATCTGAT GGTTTACATCTCGAACGGAC-3′ | 5’BamHI | The expression pEGFP-C1-SelK of green fluorescent fusion protein |
| GFP-SelK R： | 5’-GCTCTAGAAAAGATGAGTCCA TTCTGC-3′ | 3’XbaI | |
| M-LZIP F | 5’- CGGAATTCATGGAGCTGGAATTG GATGC-3′ | 5’EcoRI | Mammalian cell expression vector pM-LZIP |
| M-LZIP R： | 5′- CCGCTCGAGGCCTGAGTATCTGT CCTGC-3′ | 3’XhoI |
1. the interaction protein of yeast two-hybrid screening HCLP1
This carries out pcr amplification to the cDNA recombinant plasmid of people HCLP1 with the pfu enzyme to primer with AS-HCLP1F and AS-HCLP1R for we, the PCR product is carried out BamHI and Pst I double digestion, simultaneously the pAS2-1 plasmid is carried out double digestion, reorganization is connected subsequent transformation DH5 α with segment with carrier.Select single bacterium colony from the bacterium colony that transforms, the extraction recombinant plasmid carries out the PCR evaluation, enzyme is cut and identified and sequence verification.The reading frame that the result shows people HCLP1 gene is inserted among the carrier by correct.This recombinant vectors is called pAS2-1-HCLP1 in this research.We are laid on SD/Trp respectively after changing pAS2-1-HCLP1 over to yeast
-With the SD/Trp that contains different concns 3-AT
-His
-On the substratum, observe its growing state.The result shows that the yeast Y190 transformant that contains pAS2-HCLP1 can not be at SD/Trp
-His
-The growth of+20mM 3-AT substratum, LacZ detects and is negative.Illustrating after pAS2-1-HCLP1 changes Y190 over to does not have the self activation phenomenon, can carry out next step library screening.
Our employing order infection protocol changes the human Hela cell cDNA library of clontech company in the Y190 yeast that contains the pAS2-1-HCLP1 plasmid over to, and transformant all is laid on SD/Trp
-Leu
-His
-Carry out His on the+5mM 3-AT substratum
+Clone's screening.After a week was cultivated in 30 ℃ of inversions, the positive colony dibbling of selecting diameter＞2mm on the culture dish was in the fresh SD/Trp that draws lattice
-Leu
-His
-Continue on+5mM 3-AT the plate to cultivate, after cultivating in 72 hours, carry out betagalactosidase activity and detect.His as a result
+Present blue bacterium colony among the clone, i.e. His
+LacZ
+Clone positive clone.
With the plasmid in the yeast clone that screens respectively with pAS2-1-HCLP1 and pAS2-1 empty carrier cotransfection yeast SFY526 bacterial strain, whether can produce the self activation phenomenon and whether can under more rigorous condition, interact with the albumen of determining to screen with HCLP1 albumen.
By two commentaries on classics confirmatory experiments with to His
+LacZ
+Yeast clone checks order, and sequencing result is carried out the information inquiry of ncbi database, finds that a positive colony encoded protein is SelK.
2.Co-immunoprecipitation test
Coding region for the people SelK gene that increases; we carry out pcr amplification with GFP-SelK F and this a pair of primer of GFP-SelK R to the coding region of SelK; used 20 bases in SelK gene reading frame and its downstream at this a pair of primer middle and upper reaches primer, 5 ' end has been introduced Myc label, BamH I restriction enzyme site and protection base.Downstream primer has used the terminator codon of this gene self, and introduces XbaI enzyme cutting site and protection base.
Above-mentioned primer institute amplification PCR products is carried out after end cut with BamH I and the two enzymes of XbaI, be connected with the pEGFP-C1 carrier of handling with same enzyme, transform DH5 α afterwards, and the clone carried out PCR identifies and enzyme is cut evaluation, the positive colony that is obtained has further been done sequence verification.Simultaneously, we design primer V5-HCLP1 F and V5-HCLP1 R, be connected with the pCDNA3.1V5/HisB carrier of Xho I double digestion with BamH I after reclaiming product, connect product and transform DH5 α to obtain recombinant vectors, cut evaluation and dna sequencing checking through enzyme, the reading frame that shows the HCLP1 gene correctly inserts in the carrier, and the plasmid of naming this reorganization is pcDNA3.1/V5-HCLP1.
We have collected about 1 * 10 after changeing cell and pEGFP-SelK and the two commentaries on classics of pcDNA3.1/V5-HCLP1 cell with pEGFP-SelK is single
7The lysate of individual cell has carried out the Co-immunoprecipitation experiment according to the standard step of the molecular cloning master third edition, result such as Fig. 1, and the interaction that HCLP1 and SelK are described is special.
Attached: the Co-immunoprecipitation experimental procedure
Reagent
Cell pyrolysis liquid:
20mmol/L HEPES(pH7.5) 150mmol/L NaCl
1％NP40 1mmol/L EDTA
100mmo/L NaF 10mmol/L trisodium phosphate
20mmol/L sodium 1mmol/L vanadic acid sodium *
1mmol/L DTT* 2mmol/L PMSF*
10μg/ml Aprotinin*
*: fresh adding during use
Experimental procedure
1). the transfection transfection of cell is a few days ago with 75cm
2The cell that is in logarithmic phase in the culturing bottle to import 75cm at 1: 3
2Continue in the culturing bottle to cultivate.Treat that cell grows at 70～80% o'clock, with calcium phosphate method transfection plasmid.The plasmid consumption is 880 μ l (40ng/ μ l).48hrs collecting cell after the transfection.
2). add the pre-lysate of 1.5ml ice in every bottle of the cracking of cell, place cracking 1hr on ice.
Append PMSF therebetween one time, and 10min scrapes stirring once with cell at interval.Cell lysate is collected supernatant behind 4 ℃ of centrifugal 20min of 14000rpm frozen in-70 ℃.
3). add 40 μ l 50%protein A agarose in the co-immunoprecipitation 1ml cell pyrolysis liquid, 4 ℃ of jolting 3hrs are to remove the protein of non-special absorption.The centrifugal 20sec of 12000rpm collects supernatant.The mouse monoclonal antibody of 2 μ l anti-V5 is added in the supernatant, append 50 μ l 50%proteinA agarose behind 4 ℃ of jolting 1hr again, continue jolting 1hr.With the lysate 1ml washing that contains the 1mmol/L vanadic acid sodium 3 times, the last lysate that does not contain vanadic acid sodium of using again washs once subsequently.Sample is handled through sample-loading buffer, and is anti-as one with the monoclonal antibody of mouse-anti Myc, and the goat anti-mouse igg of HRP mark detects the colour developing of ECL method as the two anti-Western Blot that carry out.
3. cellular immunofluorescence is located
We are building up to the coding region sequence of people SelK among the pEGFP-C1 at first as mentioned above.GFP is a green fluorescent protein, and after the coding region of people SelK gene was building up in the carrier, mode that promptly can people SelK-GFP fusion rotein obtained to express.Simultaneously, we design primer GFP-HCLP1F and GFP-HCLP1R, be connected with the pEGFP-N1 carrier of BamH I double digestion with Pst I after reclaiming product, connect product and transform DH5 α to obtain recombinant vectors, cut evaluation and dna sequencing checking through enzyme, the reading frame that shows the HCLP1 gene correctly inserts in the carrier, and the plasmid of naming this reorganization is pEGFP-HCLP1
With the method for Lipofectamine2000 mediation, we are with pEGFP-SelK and pEGFP-HCLP1 difference transfection HeLa cell.Because GFP and SelK or HCLP1 amalgamation and expression, so, under the laser excitation of certain wavelength, can show SelK and the HCLP1 location in cell.The result shows, people SelK albumen is positioned at tenuigenin, and (Fig. 2 a), HCLP1 albumen is positioned at nucleus (Fig. 2 b).
We are with pEGFP-SelK and pcDNA3.1/V5-HCLP1 corotation HeLa cell.Cell is after fixing, and is anti-as one with anti-V5 (Invitrogen), anti-as two with the anti-mouse antibodies of the rabbit of rhodamine red marker, like this, just can in the cell of cotransfection, excite, see the location situation of two albumen in same cell by different wavelength of laser.At the fluorescence co-focusing microscopically, people GFP-SelK is green, all is positioned tenuigenin (Fig. 3 a and 3d), and HCLP1 redfree in nucleus distributes, and all is positioned at (Fig. 3 b and 3e) in the tenuigenin, and both location overlaids (Fig. 3 c and 3f).This explanation, HCLP1 has promoted the caryoplasm transposition of HCLP1 by the interaction with SelK, has strengthened the tenuigenin location of HCLP1.
Attached: cellular immunofluorescence
Reagent
Concentrated acid: concentrated nitric acid: concentrated hydrochloric acid=2: 1 (V/V)
4% Paraformaldehyde 96 stationary liquid: add the 4g Paraformaldehyde 96 in the 60ml water, the NaOH that drips 1mol/L in 60～80 ℃ of water-baths is transparent to dissolving.With HCl pH is transferred to 7.0 when treating that solution is cooled to 15 ℃.Be supplemented to 100ml with PBS at last.
Saturatingization liquid: 0.5%Triton/PBS
Confining liquid: 3%BSA/PBS
Mountant: the 2%DABCO/PBS (Triethy lenediamine) with preparation in advance prepares 90% glycerine
Experimental procedure
1). the processing of cover glass: the cover glass gradation inserted in the concentrated acid soaked 2 hours, clean the back drying at room temperature with deionized water.To drop in the Poly-L-Lysine Solution of ten times of dilutions through the cover glass of acid treatment, room temperature is taken out in 60 ℃ of dry 1hr or ambient temperature overnight after placing 5min.With preceding cover glass is soaked in 75% ethanol 30min at least.
2). plasmid transfection: by carrying out with the method for Lipofectamine2000 mediation.
3). cellular immunofluorescence dyeing:
(1) cell fixation: 48hrs cleans cell twice with PBS after the transfection, takes out cover glass, with filter paper residual liquid is blotted, and fixes 10～15min with 4% Paraformaldehyde 96 stationary liquid room temperature.
(2) PBS rinsing, 3 * 5min.
(3) cell permeabilization: under the room temperature, 0.5%Triton/PBS changes processing 10min thoroughly.
(4) PBS rinsing, 3 * 5min.
(5) cell sealing: with the 3%BSA/PBS sealing, 37 ℃, 30min or 4 ℃ spend the night.
(6) one anti-hatching: on the Parafilm film, add 50 μ l and resist (resisting) by one of certain dilution if carry out two immunofluorescence analysis then add two kind one simultaneously with PBS, with cover glass have one of cell face down Fu Yuyi anti-on, be sealed in the wet box, 37 ℃, 30min.
(7) PBS rinsing, 3 * 5min.
(8) two anti-hatching: on the Parafilm film, add 50 μ l if carry out two immunofluorescence analysis then add two kind two simultaneously with fluorescein-labeled two anti-(the resisting) of PBS by dilution in 1: 50,37 ℃, 30min.
(9) PBS rinsing, 3 * 5min.
(10) rinsed with deionized water desalts, 2 * 5min.
(11) mounting: get 10 μ l mountant and drop on the slide glass, cover glass is had one of the cell mounting that faces down, seal with nail varnish all around.Observe and photograph with fluorescent microscope or laser confocal microscope at once.
4. the influence of the transcriptional activation of the interaction partners LZIP of people HCLP1 and SelK mediation
This carries out pcr amplification to the cDNA recombinant plasmid of people LZIP with the pfu enzyme to primer with M-LZIP F and M-LZIP R for we, the PCR product is carried out EcoRI and XhoI double digestion, simultaneously the pM plasmid is carried out EcoRI and SalI double digestion, reorganization is connected subsequent transformation DH5 α with segment with carrier.Select single bacterium colony from the bacterium colony that transforms, the extraction recombinant plasmid carries out the PCR evaluation, enzyme is cut and identified and sequence verification.The reading frame that the result shows people LZIP gene is inserted among the carrier by correct.This recombinant vectors is called pM-LZIP in this research.
Document shows, people LZIP gene is a kind of cancer suppressor gene, HCLP1 can suppress the transcriptional activation of LZIP, and the interaction of HCLP1 and SelK can cause the caryoplasm transposition of HCLP1, and whether the transposition of HCLP1 can be influential unknown to the transcriptional activation of LZIP.Therefore, this research and utilization luciferase reporter gene system, the influence of the transcriptional activation of the interaction partners cancer suppressor gene LZIP mediation of discussion people HCLP1 and SelK.
We judge the influence of the transcriptional activation that the interaction partners LZIP of HCLP1 and SelK mediates with the pEGFP-SelK cotransfection COS7 cell of pM-LZIP and pGAL4Luc, pcDNA3.1/V5-HCLP1 and various dose by the activity that detects luciferase reporter gene.In addition, the pRL-TK carrier of the transfection simultaneously another kind of luciferase of can encoding, the activity of this enzyme is as the internal reference of test.
The result as shown in Figure 4, HCLP1 albumen can significantly suppress the transcriptional activation of LZIP, and along with the increase of SelK dosage, the collaborative transcriptional activation that has suppressed LZIP of HCLP1 and SelK.
Attached: experimental procedure and method that luciferase reporter gene is analyzed:
Specimen preparation
1) with cell with 1 * 10
5Be inoculated in 12 orifice plates, 90% carries out transfection with LIPOFECTAMINE2000 when converging.
2) 24-48 collecting cell.PBS gives a baby a bath on the third day after its birth time, the exhaustion residual liquid, and every hole adds 150 lysates, and room temperature was placed 15-20 minute, rocked once every several minutes, made lysate cover cell fully.
3) collecting cell lysate, 4 ℃ 12, the centrifugal 2min of 000rpm collects supernatant, and-70 preservations are standby.
Reporter gene activity is measured
Use the Dual-Luciferase Reporter Assay System. of Promega company ultimate principle: test used reporter gene carrier and be pGL3, coding firefly luciferase.In order to weigh the transfection efficiency in each hole, during experiment corotation pRL-TK as internal reference, this plasmid-encoded Renilla luciferase.The substrate of these two kinds of enzymes is different with reaction buffer, can measure in same test tube with same sample.Firefly luciferase reaction system is LAR II, and Renilla luciferase reaction system is Stop ﹠amp; Glo Reagent provides by test kit.
1) preheating photofluorometer, setup parameter postpones to begin after 2 seconds to measure at every turn, and minute is ten seconds.
2) 100 μ l LAR II are added fluorescent tube, then add 20 μ l cell pyrolysis liquids, use rifle head mixing 2-3 time, put into photofluorometer and begin reading.
3) record firefly luciferase reading repeats once.
4) in same pipe, add 100 μ l Stop ﹠amp; Glo Reagent, mixing is reentered into photofluorometer and begins to measure, and repeats once.
Claims (4)
1. the present invention relates to the interactional discovery between seleno-protein SelK and the HCLP1 and the influence of the interaction partners cancer suppressor gene LZIP transcriptional activation between the two.
2. according to described 2 albumen: SelK of claim 1 and the interaction between the HCLP1, it is characterized in that SelK promotes that by the interaction with HCLP1 HCLP1 is indexed into cytoplasm from nucleus, strengthened the cytoplasm location of HCLP1.
3. according to claim 1,2 SelK that address and the interaction between the HCLP1, it is characterized in that, analyze by the Luciferase reporting system, SelK and HCLP1 can suppress the transcriptional activation of cancer suppressor gene LZIP, the collaborative transcriptional activation that suppresses LZIP of the interaction energy of SelK and HCLP1.
4. according to claim 1,2,3 described 2 albumen: SelK and HCLP1, it is characterized in that SelK by with the interaction of HCLP1, strengthened the caryoplasm transposition of HCLP1, the collaborative transcriptional activation that suppresses cancer suppressor gene LZIP is for oncotherapy provides target.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510059335 CN1840691A (en) | 2005-03-29 | 2005-03-29 | Function regulation of selenium protein Se1k to interactive protein HCLP1 and anti-oncogene LZIP |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510059335 CN1840691A (en) | 2005-03-29 | 2005-03-29 | Function regulation of selenium protein Se1k to interactive protein HCLP1 and anti-oncogene LZIP |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1840691A true CN1840691A (en) | 2006-10-04 |
Family
ID=37029884
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200510059335 Pending CN1840691A (en) | 2005-03-29 | 2005-03-29 | Function regulation of selenium protein Se1k to interactive protein HCLP1 and anti-oncogene LZIP |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1840691A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101105493B (en) * | 2007-06-27 | 2011-06-22 | 中国人民解放军军事医学科学院放射与辐射医学研究所 | Method for detecting protein interaction by immunological coprecipitation based on protein chip and reagent kit for detecting protein interaction |
| CN102628038A (en) * | 2012-04-09 | 2012-08-08 | 武汉生命之美科技有限公司 | Method for identifying target RNA (Ribonucleic Acid) of RNA binding protein through improved CLIP method |
| CN104561288A (en) * | 2014-12-26 | 2015-04-29 | 深圳市疾病预防控制中心 | Fluorescent quantitative PCR assay kit and method of SelK gene expression level |
| CN112641947A (en) * | 2019-10-11 | 2021-04-13 | 沈阳福洋医药科技有限公司 | Screening target spot, application and screening method of anti-tumor drug |
-
2005
- 2005-03-29 CN CN 200510059335 patent/CN1840691A/en active Pending
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101105493B (en) * | 2007-06-27 | 2011-06-22 | 中国人民解放军军事医学科学院放射与辐射医学研究所 | Method for detecting protein interaction by immunological coprecipitation based on protein chip and reagent kit for detecting protein interaction |
| CN102628038A (en) * | 2012-04-09 | 2012-08-08 | 武汉生命之美科技有限公司 | Method for identifying target RNA (Ribonucleic Acid) of RNA binding protein through improved CLIP method |
| CN104561288A (en) * | 2014-12-26 | 2015-04-29 | 深圳市疾病预防控制中心 | Fluorescent quantitative PCR assay kit and method of SelK gene expression level |
| CN104561288B (en) * | 2014-12-26 | 2017-01-04 | 深圳市疾病预防控制中心 | The fluorescent quantificationally PCR detecting kit of SelK gene expression dose and method |
| CN112641947A (en) * | 2019-10-11 | 2021-04-13 | 沈阳福洋医药科技有限公司 | Screening target spot, application and screening method of anti-tumor drug |
| WO2021068910A1 (en) * | 2019-10-11 | 2021-04-15 | 沈阳福洋医药科技有限公司 | Target for screening anti-tumor drug, use thereof and screening method therefor |
| CN112641947B (en) * | 2019-10-11 | 2023-02-03 | 沈阳福洋医药科技有限公司 | Screening target spot, application and screening method of anti-tumor drug |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Salman et al. | Nuclear localization signal peptides induce molecular delivery along microtubules | |
| Pelagalli et al. | Aquaporins in health and disease: an overview focusing on the gut of different species | |
| Charbonneau et al. | Microfibril structure masks fibrillin-2 in postnatal tissues | |
| Wang et al. | UBA6 and its bispecific pathways for ubiquitin and FAT10 | |
| He et al. | Purification and characterization of a novel calcium-binding heptapeptide from the hydrolysate of tilapia bone with its osteogenic activity | |
| Weinberg et al. | EGFR expression in HER2-driven breast cancer cells | |
| Nie et al. | Development of teleost intermuscular bones undergoing intramembranous ossification based on histological-transcriptomic-proteomic data | |
| Cioni et al. | Nitric oxide and the neuroendocrine control of the osmotic stress response in teleosts | |
| Arcidiacono et al. | Hyperinsulinemia promotes esophageal cancer development in a surgically-induced duodeno-esophageal reflux murine model | |
| CN1840691A (en) | Function regulation of selenium protein Se1k to interactive protein HCLP1 and anti-oncogene LZIP | |
| Huang et al. | Effects of lower temperature on expression and biochemical characteristics of hcv ns3 antigen recombinant protein | |
| Elbialy et al. | A zebrafish acromegaly model elevates DNA damage and impairs DNA repair pathways | |
| Miller et al. | Evaluation of the phosphoproteome of mouse alpha 4/beta 2-containing nicotinic acetylcholine receptors in vitro and in vivo | |
| Ozaki et al. | Novel implications of DNA damage response in drug resistance of malignant cancers obtained from the functional interaction between p53 family and RUNX2 | |
| Cilibrasi et al. | Definition of an inflammatory biomarker signature in plasma-derived extracellular vesicles of glioblastoma patients | |
| Di Giuseppe et al. | Proteomic characterization of two extracellular vesicle subtypes isolated from human glioblastoma stem cell secretome by sequential centrifugal ultrafiltration | |
| Gorasia et al. | Type B CTD proteins secreted by the type IX secretion system associate with PorP-like proteins for cell surface anchorage | |
| Marconi et al. | Trastuzumab modulates the protein cargo of extracellular vesicles released by erbb2+ breast cancer cells | |
| Yu et al. | Marine-derived bioactive peptides self-assembled multifunctional materials: antioxidant and wound healing | |
| De Paepe | The cytokine growth differentiation factor-15 and skeletal muscle health: portrait of an emerging widely applicable disease biomarker | |
| Martin et al. | In vitro characterization and stability profiles of antibody–fluorophore conjugates derived from interchain cysteine cross-linking or lysine bioconjugation | |
| Su et al. | Comparative proteomics analysis reveals the difference during antler regeneration stage between red deer and sika deer | |
| Li et al. | Extraction, characterization and osteogenic activity of a type I collagen from starfish (Asterias amurensis) | |
| Isola et al. | The oral transglutaminase 2 inhibitor ZED1227 accumulates in the villous enterocytes in celiac disease patients during gluten challenge and drug treatment | |
| Pandey et al. | Identification of NPB, NPW and Their Receptor in the Rat Heart |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |