CN1837233A - Halophilic bacteria and its immune protein and genes encoding same and use thereof - Google Patents

Abstract

The invention discloses a halophil element and immune protein and their encode gene and application, which is characterized by the following: the original protein consists of SEQ IDNo.: 2 amino acid residual basic sequence protein in sequence table; the mature protein has one of under amino acid residual basic sequence protein: 1), 208-283 place of SEQ ID No.:2 in sequence table; 2) making 208-283 place amino acid residual basic sequence of SEQ ID No.:2 in sequence table to replace delete or add in protein of microbe action protein with inhibiting ultimate halophilism Archimycetes Halobacterium sp.AS7092 by one to ten amino acid residues. The encode gene halI of C8 immune protein can be used for resistant selected marker to construct new genetic operating platform of ultimate halophilism Archimycetes.

Description

A kind of halophilic bacteria and immune protein thereof and their encoding gene and application

Technical field

The present invention relates to protein microbiotic-halophilic bacteria and immune protein and their encoding gene and application that extremely halophilic archaea produces, particularly relate to a kind of halophilic bacteria and immune protein thereof and their application of encoding gene in the extremely halophilic archaea genetic operating system.

Background technology

Tellurian biology can be divided into prokaryotic organism (Prokaryotes) and eukaryote (Eukaryotes) two big classes, prokaryotic organism are made of two different systematic groups, be eubacterium (Eubacteria) and Archimycetes (Archaebacteria), Archimycetes is called ancient bacterium (Archaea) now.

Ancient bacterium has been counted as the single evolutionary system group who originates from the common ancestor now, different with demand to nutrition according to survival environment, ancient bacterium generally can be divided into and produces the ancient bacterium (Methanogens) of methane, extremely halophilic archaea (Extremehalophiles) and extreme hyperthermophilic archaeon strain (Extreme thermophiles) three major types group.Extremely halophilic archaea (Extremely halophilic archaea) abbreviates halophilic archaea (haloarchaea) or halophilic bacterium (halobacteria) usually as, is the important monoid of ancient bacterium.

Halophilic bacteria (Halocin) is to be secreted into the protein microbiotic that the outer microorganism to its close genus or kind of born of the same parents has inhibition or lethal effect by extremely halophilic archaea (especially bacillus), and it is the ideal material of research extremely halophilic archaea gene expression regulation, protein excretion and 26S Proteasome Structure and Function thereof.

Halophilic bacteria the earliest is by Rodriguez-Valera and work together and find (Rodriguez-Valera, et al., 1982, Can J Microbiol 28:151-154.) in nineteen eighty-two.At present, found that strain extremely halophilic archaeas up to a hundred can produce different types of halophilic bacteria, but wherein the more deep halophilic bacteria of research only is: H1 (Platas et al., 2002, Int Microbiol 5:15-19), H4 (Cheung et al., 1997, J Bacteriol 179:548-551), H6 (Torreblanca et al., 1989, J Gen Microbiol135:2655-2661) and S8 (Price et al.2000.J Bacteriol 182:4951-4958).And only have two kinds of halophilic bacterias of H4 and S8 to finish gene clone in the world, and the research of the immune protein of halophilic bacteria (or resistant gene) does not still have report up to now in the world.

Halophilic bacteria be extremely halophilic archaea mostly from logarithmic growth latter stage to stationary phase transit time produce, the generation that shows halophilic bacteria has important ecological significance for extremely halophilic archaea: when entering stationary phase, because the consumption of nutrition etc., environmental degradation, growth slows down, at this moment the halophilic bacteria that produces on the one hand can the cracking sensitive cells, discharges content, the nutrition in the enriched environment; On the other hand, bacteriolyze or bacteriostatic action can reduce competition.When the nutrition in the environment becomes when enriching again, the bacterial strain that produces halophilic bacteria will preferentially utilize these nutrition in to the environment that reduces at a competing phase, and therefore, the retention time of halophilic bacteria in environment is long more, and character is stable more, and it is favourable more that it is produced bacterial strain.And stable in properties, the wide halophilic bacteria of antimicrobial spectrum have the better application prospect.

The generation bacterium of halophilic bacteria has resistance to the halophilic bacteria of its generation, and this mainly is by the resistant gene decision of its immune protein of coding.The resistant gene of halophilic bacteria (gene of its immune protein of promptly encoding) can be used as resistance selective marker good in the extremely halophilic archaea genetic transformation system.Extremely halophilic archaea is because its unique Physiology and biochemistry and hereditary property and intracellular high salt concentration thereof make its microbiotic to routine insensitive.The microbiotic that is used for the selection of extremely halophilic archaea genetic transformation system resistance at present mainly is Vulkamycin. PA-93 (Novobiocin, Nb) and nervinolin (Mevinolin, Mv), not only resistance marker is single, and resistant maker gene is easy and the karyomit(e) reorganization causes carrier less stable etc., makes the application of these microbiotic in halophilic archaea be subjected to certain restriction.In addition, because at present used nervinolin resistant gene too big (3.5kb), increased self size of carrier greatly as selective marker, caused the reduction of insertion capacity with it.The resistant gene of halophilic bacteria if can be cloned out, and in the genetic transformation system of extremely halophilic archaea as the selected marker of resistance, will solve a great problem of extremely halophilic archaea genetic transformation system in making up.Because have the incomparable superiority of other microbiotic as the resistance selective marker with the halophilic bacteria resistant gene: the one, halophilic bacteria stable in properties, preparation technology are simple, cost is extremely low, and now the most frequently used microbiotic nervinolin is extremely expensive; The 2nd, the halophilic bacteria resistant gene may be by plasmid-encoded, and sensitive strain does not contain this gene, therefore is difficult for and the chromogene reorganization, and character is more stable.

Summary of the invention

The purpose of this invention is to provide a kind of halophilic bacteria and immune protein thereof and their encoding gene.

Halophilic bacteria provided by the present invention (name is called halophilic bacteria C8) and immune protein (Hal I) thereof derive from extremely halophilic archaea salt bacillus AS7092 bacterial strain (Halobacterium sp.AS7092).

This halophilic bacteria C8 is by the maturation protein (HalC8) of the former albumen of halophilic bacteria C8 (ProC8) through the halophilic bacteria C8 that forms of translation post-treatment.

The former albumen of halophilic bacteria C8 is to have SEQ ID № in the sequence table: the protein of 2 amino acid residue sequence.

SEQ ID № in the sequence table: 2 are made up of 283 amino-acid residues, from aminoterminal (N end) 1-207 amino acids residue is the immune protein HalI of halophilic bacteria C8, is the maturation protein HalC8 of halophilic bacteria C8 from carboxyl terminal (C end) 208-283 amino acids residue.

The maturation protein HalC8 of halophilic bacteria C8 is the protein with one of following amino acid residue sequences:

1) SEQ ID № in the sequence table: 2 208-283 position;

2) with SEQ ID № in the sequence table: 2 208-283 amino acids residue sequence is through replacement, disappearance or the interpolation of one to ten amino-acid residue and have the protein of the microbial process that suppresses extremely halophilic archaea close genus of Halobacterium sp.AS7092 or kind.

The immune protein Hal I of halophilic bacteria C8 is the protein with one of following amino acid residue sequences:

1) SEQ ID № in the sequence table: 2 1-207 position;

2) with SEQ ID № in the sequence table: any several protein that replace, lack or add and described halophilic bacteria is had resistance in 2 the 1-52 amino acids residue sequence;

3) with SEQ ID № in the sequence table: any several in 2 the 1-52 amino acids residue sequence replace, lack or add; With of replacement, disappearance or the interpolation of 53-207 amino acids residue sequence through one to ten amino-acid residue, and the protein that described halophilic bacteria is had resistance;

4) has sequence table SEQ ID №: the albumen of 2 53-207 amino acids residue sequence, or with of replacement, disappearance or the interpolation of 53-207 amino acids residue sequence, and the protein that described halophilic bacteria is had resistance through one to ten amino-acid residue.

SEQ ID № in the sequence table: 2 53-207 amino acids residue sequence is Hal I active zone.

The encoding gene of halophilic bacteria C8 and immune protein thereof is one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 1 dna sequence dna;

2) SEQ ID № in the code sequence tabulation: the polynucleotide of 2 protein sequences;

3) under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 1 dna sequence dna hybridization that limits.

SEQ ID № in the sequence table: 1 by 852 based compositions, and its open reading frame is that coding has SEQ ID № in the sequence table: the protein of 2 amino acid residue sequence from 5 ' end 1-852 bit base.

SEQ ID № in the sequence table: 1 from 5 ' end 1-852 position DNA (the former proteic encoding gene of halophilic bacteria C8 (proC8)) coding halophilic bacteria former albumen ProC8.SEQ ID № in the sequence table: 1 622-849 position DNA (halC8) coding halophilic bacteria maturation protein HalC8.SEQ ID № in the sequence table: 1 1-621 position DNA (halI) coding halophilic bacteria immune protein HalI.

SEQ ID № in the sequence table: 1 157-621 position dna sequence dna is the encoding gene of Hal I active zone.

The rigorous condition of described height can be that (or 0.1 * SSC), the solution of 0.1%SDS is hybridized and washed film with 0.1 * SSPE under 65 ℃.

Contain expression carrier of the present invention, transgenic cell line and host bacterium and all belong to protection scope of the present invention.

Increase arbitrary segmental primer in the gene of the present invention to also within protection scope of the present invention.

The invention provides a kind of extremely halophilic archaea protein microbiotic-halophilic bacteria C8 and immune protein HalI thereof.Halophilic bacteria C8 is a kind of protein microbiotic with unique amino acid sequence, its stable in properties, through desalination, boil or freeze-drying is handled and can not made its inactivation, C8 has antimicrobial spectrum widely in extremely halophilic archaea simultaneously, and is inhibited to most extremely halophilic archaeas (comprise and partly have a liking for saline and alkaline ancient bacterium).The encoding gene halI (resistant gene) of C8 immune protein can be used as the novel genetic manipulation platform that the resistance selective marker is used to make up extremely halophilic archaea, the cost that extremely halophilic archaea carries out genetic modification will be reduced, this system uses halophilic bacteria C8 to replace traditional microbiotic when carrying out resistance screening simultaneously, can avoid of the pollution of traditional microbiotic to environment, making in extreme environment original position use its engineering bacteria transformation or administering respective environment becomes possibility, provides a kind of novel and effective tool system for carry out protein expression in the ancient bacterium of extreme halotolerant alkali.In addition, the length of halI only is bp more than 600, and by plasmid-encoded, halophilic bacteria C8 sensitive strain does not contain this gene, therefore is difficult for and the chromogene reorganization, and character is more stable.The preparation technology of halophilic bacteria C8 is simple, production cost is extremely low, with respect to expensive nervinolin, as the screening microbiotic, has more advantage with halI as the genetic operating system of selective marker with halophilic bacteria C8.

Description of drawings

Fig. 1 is for accurately measuring the result of halophilic bacteria C8 molecular weight with mass spectrograph

Fig. 2 is GST-ProC8, GST-HalI, and GST-Δ I1, GST-Δ I2, GST-Δ I3, GST-HalR and GST are to the immunity test result of C8

Fig. 3 is the physical map of HalI expression plasmid pHalI

Fig. 4 is the bacteriostatic test result of halophilic bacteria C8 to Haloarcula hispanica ATCC33960/pPbop and Haloarcula.hispanica ATCC33960/pHalI

Embodiment

Method therefor is ordinary method if no special instructions among the following embodiment.

The clone of embodiment 1, halophilic bacteria C8 and immune protein encoding gene thereof and their amino acid sequence analysis

Purifying secreted halophilic bacteria C8 (Li et al, 2003, Extremophiles 7:401-407) outside born of the same parents measures its N terminal amino acid sequence with ordinary method from the nutrient solution of extremely halophilic archaea Halobacterium sp.AS7092.Then, according to the N of halophilic bacteria C8 end 15 amino acid residue sequences " DIDITGCSACKYAAG " (SEQ ID № in the sequence table: 2 hold 208-222 position from N), and utilize the high characteristics of G/C content in the degeneracy of amino acid code and the extremely halophilic archaea, the pair of degenerate primers of design amplification halophilic bacteria C8N terminal amino acid sequence encoding gene, primer sequence is: C8-2:5 ' GAYATYGAYATYACSGG 3 ' (Y=C or T, S=C or G); C8-4:5 ' CCSGCSGCRTAYTTRCASGC 3 ' (Y=C or T, R=A or G, S=C or G).Utilize C8-2 and C8-4, genomic dna with extremely halophilic archaea Halobacterium sp.AS7092 is that template is carried out pcr amplification, the dna fragmentation that it is 44bp that the result amplifies a length, this dna fragmentation is connected with carrier pUCm-T (worker bio-engineering corporation is given birth in Shanghai), obtain containing the recombinant vectors that this length is the 44bp dna fragmentation through screening, called after pUCm-T-44, it is checked order, and sequencing result shows that this length is that the coded amino acid residue sequence " DIDITGCSACKYAAG " of the dna fragmentation of 44bp is in full accord with 15 amino acid residue sequences of N end of halophilic bacteria C8.With plasmid vector pUCm-T-44 is template, utilize T7 RNA polymerase (Progema company) to transcribe out a RNA fragment corresponding to this 44bp dna fragmentation, and to be probe with this RNA fragment carry out Southern hybridization with genomic dna through the extremely halophilic archaea Halobacterium of different digestion with restriction enzyme AS7092, the result shows, can obtain the hybridization signal band that a size is about 6.3kb in the complete degestion product of BamHI.Therefore the genome DNA of cutting extremely halophilic archaea Halobacterium AS7092 with the BamHI enzyme, and recovery length is the dna fragmentation of 6.3kb, should reclaim dna fragmentation and be cloned among the carrier pUC18, will contain and reclaim segmental recombinant vectors transformed into escherichia coli DH5 α structure portion gene group library.Adopt the PCR method to screen (primer is above-mentioned C8-2 and C8-4) to this gene library, with the positive colony plasmid called after pB03 that obtains, it is to have inserted the dna fragmentation that above-mentioned length is 6.3kb on the BamHI of carrier pUC18 restriction enzyme site, be that primer carries out two-way sequencing reaction with M13 (+)/M13 (-) then, and then design primer again according to the known array of gained and continue toward the downstream order-checking, until the full sequence mensuration work of finishing obtaining positive colony.

This sequencing result is analyzed, analytical results shows, this length is that the dna fragmentation of 6.3kb is one section gene cluster that comprises a plurality of genes, wherein halophilic bacteria C8 and immune protein thereof are by the different dna fragmentation codings of same gene, and, be proC8 with this unnamed gene through the post-translational cleavage acquisition.ProC8 has SEQ ID № in the sequence table: 1 polynucleotide sequence, by 852 based compositions, its open reading frame is from 5 ' end 1-852 bit base, coding has SEQ ID № in the sequence table: the protein of 2 amino acid residue sequence (29.38kDa), this albumen are called as the former albumen of halophilic bacteria C8 (ProC8).SEQ ID № in the sequence table: 2 are made up of 283 amino-acid residues.Infer that according to N 15 amino acid residue sequences of end " DIDITGCSACKYAAG " of halophilic bacteria C8 ProC8 cuts off 207 amino acid (SEQ ID № in the sequence table: 2 1-207 position) just can become sophisticated halophilic bacteria C8 of its N end, maturation protein called after HalC8 with halophilic bacteria C8, if this inference is correct, then the maturation protein of halophilic bacteria C8 should be made of that (SEQ ID № in the sequence table: 2 208-283 position), molecular weight is 7.4kDa 76 amino acid of the C of ProC8 end.To carry out molecular weight determination with the MALDI-TOF-MS mass spectrograph from the halophilic bacteria C8 of extremely halophilic archaea Halobacterium AS7092 purifying, its molecular weight is 7.4kDa (Fig. 1) just as a result, and is consistent with expected results.By said gene sequence, albumen n end order-checking and molecular weight determination, the aminoacid sequence of having determined halophilic bacteria C8 maturation protein really is SEQ ID № in the sequence table: 2 208-283 position, form by 76 amino-acid residues, belong to extremely halophilic archaea protein microbiotic, its encoding gene called after halC8 has SEQ ID № in the sequence table: 1 622-849 position nucleotide sequence.SEQ ID № in the sequence table: the polypeptide of 2 1-207 position is the immune protein of halophilic bacteria C8, called after HalI, and its encoding gene called after halI has SEQ ID № in the sequence table: 1 1-621 position nucleotide sequence.

The immune protein HalI of embodiment 2, halophilic bacteria C8 is to the immunization checking of C8

In the middle of bacterium, at present bacteriocin gene of finding and bacteriocin immunogene be all by genes encoding independently, but the gene of the bacteriocin immune protein of often can finding to encode often just is close to the bacteriocin encoding gene, thereby self is played a protective role.

Genomic dna with extremely halophilic archaea Halobacterium AS7092 is a template, pcr amplification proC8 (SEQID №: 1 from 5 ' end 1-852 position nucleotide sequence), halI (SEQ ID №: 1 from 5 ' end 1-621 position nucleotide sequence), the shortening fragment that halI is different [comprises halI-1 (SEQ ID №: 1 from 5 ' end 76-621 position nucleotide sequence), halI-2 (SEQ ID №: 1 from 5 ' end 157-621 position nucleotide sequence), halI-3 (SEQ ID №: 1 from 5 ' end 310-621 position nucleotide sequence)], used primer sequence following (on, introduce BamH I and EcoR I recognition site (line part base) in the downstream primer respectively):

The primer of amplification proC8:

The C8-14:(upstream primer) 5 ' TT GGATCCATGAAGGAAGATAAT 3 ';

The C8-16:(downstream primer) 5 ' CG GAATTCGCCGTCTAACAGAGC 3 '.

The primer of amplification halI:

The C8-14:(upstream primer) 5 ' TT GGATCCATGAAGGAAGATAAT 3 ';

The C8-25:(downstream primer) 5 ' GC GAATTCTGTCGATATCCGCCG.

The primer of amplification halI-1:

The C8-14-1:(upstream primer) 5 ' AT GGATCCGCTGGGCTATTCGCT3 ';

The C8-25:(downstream primer) 5 ' GC GAATTCTGTCGATATCCGCCG.

The primer of amplification halI-2:

The C8-14-2:(upstream primer) 5 ' TA GGATCCACCGGCACCGAGAAA 3 ';

The C8-25:(downstream primer) 5 ' GC GAATTCTGTCGATATCCGCCG.

The primer of amplification halI-3:

The C8-14-3:(upstream primer) 5 ' CG GGATCCGAGGTCGTCCAATAC 3 ';

The C8-25:(downstream primer) 5 ' GC GAATTCTGTCGATATCCGCCG.

Be cloned into respectively in the expression vector pGEX-4T-1 (Pharmacia company) that the same enzyme enzyme is cut after the dna fragmentation of above-mentioned pcr amplification cut with restriction enzyme BamH I and EcoR I enzyme, transformed into escherichia coli DH5 α then, the method of cutting with PCR and enzyme filters out the positive colony of insertion sequence and correct position, the positive colony that will contain different dna fragmentations then is after being cultured to mid-log phase under 37 ℃, adding final concentration is the IPTG inductor of 1mM, continue down to cultivate 3-4 hour at 37 ℃, make protein expression.After cultivating end, centrifugal collection thalline carries out ultrasonication to collected thalline and handles, and with the GST affinity column expressed albumen carried out purifying, obtain purified GST-ProC8, GST-HalI, GST-Δ I-1, GST-Δ I-2, GST-Δ I-3, and GST.

At AS-168 (the Li et al that is coated with halophilic bacteria C8 sensitive strain Halorubrum saccharovorum ATCC29252,2003, Extremophiles 7:401-407) on the solid plate, beat two row holes of spacing distance identical (0.8cm) respectively, wherein the every hole of delegation adds the halophilic bacteria C8 of 1nmol, another row adds the GST-ProC8 of same molar (1nmol) respectively, GST-HalI, GST-Δ I-1, GST-Δ I-2, GST-Δ I-3, and GST, observing of the influence of the albumen of above-mentioned abduction delivering to halophilic bacteria C8 sensitive strain Hrr.SaccharovorumATCC29252 growth, the result is as shown in Figure 2, halophilic bacteria C8 maturation protein HalC8 inhibition zone be diffused in GST-ProC8, GST-HalI, GST-Δ I-1, the relative position of GST-Δ I-2 presents the state that significantly is suppressed, relative position at GST-Δ I-3 and GST does not then have repressed phenomenon to produce, and has got rid of and has suppressed the possibility that phenomenon is caused by the GST size.GST-ProC8 and GST-HalI all have immunization to halophilic bacteria C8 in that halophilic archaea is external, and GST-Δ I-3 forfeiture immunization, show that this kind immunocompetence is provided by the corresponding sequence in the HalI fragment, therefore HalI is called as the immune protein of halophilic bacteria C8, and its encoding gene halI is called as the resistant gene of halophilic bacteria C8.Because GST-Δ I-2 is the present immunocompetent minimum peptide section of the known C8 of having, so its corresponding sequence (SEQ ID №: 2 hold 53-207 amino acids sequence from N) is called the active zone of HalI.

The resistant gene halI of embodiment 3, halophilic bacteria C8 is to provide protection of sensitive strain and the application in genetic operating system thereof

One, the resistant gene halI of halophilic bacteria C8 is to the protection experiment of sensitive strain

With plasmid pSCM201 (referring to patent application " a kind of extremely halophilic archaea plasmid and the plasmid vector of deriving thereof ", number of patent application is 200410049751.9) be template, under the guiding of primer SCMF:5 '-TCCCCATCACTGTGCTGC-3 ' and primer SCMR:5 '-CCCCAGTGAATGTTATGC-3 ', the dna fragmentation of pcr amplification carrier pSCM201, pSCM201 with pcr amplification is connected with carrier pUCm-T then, with this recombinant vectors called after pUCm-T/pSCM201, cloning vector pUBP2 (Woods et al. again will shuttle back and forth, 1997, Mol Microbiol23 (4): after the MevR 791-797) downcuts with restriction enzyme EcoR I and Kpn I, be connected on the recombinant vectors pUCm-T/pSCM201 of same enzyme double digestion, with the recombinant vectors called after pUCm-T/pSCM201/MevR that obtains.Between the BglII of carrier pUCm-T/pSCM201/MevR and BamH I restriction enzyme site, insert bop promotor (Patenge et al., 2000, Mol Microbiol 36:105-113), obtain recombinant vectors pPbop, between the BamH of pPbop I and Xba I restriction enzyme site, insert halI again, obtain the shuttle expression plasmid pHalI of HalI, its physical map as shown in Figure 3.

Carrier pHalI and the carrier pPbop (negative control) that do not insert halI are transformed halophilic archaea bacterial strain Haloarcula.hispanica (ATCC33960) to halophilic bacteria C8 sensitivity respectively with the protoplast transformation method, cutting and turn round colibacillary method with enzyme verifies and obtains positive colony, the positive colony called after Haloarcula.hispanica ATCC33960/pHalI that conversion is had pHalI, the positive colony called after Haloarcula.hispanica ATCC33960/pPbop that conversion is had pPbop, above-mentioned two kinds of positive colony bacterial strains are measured its susceptibility to halophilic bacteria C8 as indicator strain, method is: the AS-168 solid indication dull and stereotyped (containing nervinolin 3 μ g/ml) of equivalent Haloarcula.hispanica (ATCC33960)/pPbop and Haloarcula.hispanica ATCC33960/pHalI is arranged at separate application, at 37 ℃, under the condition of illumination and minimizing air flow, after inducing 48h, on each flat board, beat 4 holes of spacing distance identical (0.8cm), click and enter 8 μ g respectively in 4 holes of each flat board, 5 μ g, the halophilic bacteria C8 of 3 μ g and 1.5 μ g, observe the influence of halophilic bacteria C8 to above-mentioned two kinds of recombinant bacterial strains growth, the result shows that inhibition zone on the indication flat board that contains Haloarcula.hispanica ATCC33960/pPbop is obviously greater than the indication flat board that contains Haloarcula.hispanica ATCC33960/pHalI as shown in Figure 4; In the indication flat board of Haloarcula.hispanica ATCC33960/pPbop, halophilic bacteria C8 forms tangible inhibition zone more than 5 μ g; In the indication flat board of Haloarcula.hispanica ATCC33960/pHalI, halophilic bacteria C8 does not form inhibition zone at 5 μ g; Proof HalI makes Haloarcula.hispanica ATCC33960 produce immunization to halophilic bacteria C8, and when lower concentration (5 μ g/ hole), contains the germicidal action that the engineering bacteria of halI can resist halophilic bacteria C8.This experiment reduces its susceptibility to halophilic bacteria C8 at halophilic archaea bacterial strain Haloarcula.hispanica (ATCC33960) expression in vivo halI greatly, proves that HalI also can play the effect of immune halophilic bacteria C8 in the halophilic archaea body of nonhost bacterium.

Two, the application of resistant gene halI in genetic operating system of halophilic bacteria C8

MevR among the HalI shuttle expression plasmid pHalI cut with restriction enzyme EcoR I and Kpn I enzyme remove, plasmid after enzyme cut is mended the connection of flat back through the Klenow enzyme, obtain the extremely halophilic archaea gene cloning and expression carrier as the resistance selective marker, called after pHI-1 with halI.This carrier can be used for transforming Haloarcula hispanica extremely halophilic archaeas such as (ATCC33960), screening positive clone in the substratum that contains 10-30 μ g/ml halophilic bacteria C8.Treat that in insertions such as the Nde of pHI-1 I and Xba I expressed exogenous gene can realize the expression of foreign gene in this carrier.(10-30 μ g/ml μ g/ml halophilic bacteria C8) cultivates transformant Haloarcula hispanica/pHI-1 totally 100 generations under above-mentioned selective pressure, and plasmid pHI-1 does not lose, and proves that halI is the resistance selective marker of a success.

Sequence table

<160>2

<210>1

<211>852

<212>DNA

＜213〉extremely halophilic archaea salt bacillus AS7092 (Halobacterium sp.AS7092)

<400>1

atgaaggaag?ataataacac?atcagaagaa?agtggtcgaa?ttaatcgccg?aaacgtcctc 60

aaaaccgtcg?gtgctgctgg?gctattcgct?gccggatcga?cgggaatggc?cgccgcagcg 120

gacagcctct?cgcaggcgga?ggaaccgaaa?ctgctcaccg?gcaccgagaa?acgaacgctc 180

gcccgcgaac?tcgcgaagac?gcccgcgttc?cgtgaactcg?cacagcgcgc?ccgagccgac 240

ggcgcgcaga?tccgatccga?tgccgacagc?atcgttgccg?gctacgcccg?gggagaggac 300

ttcgctcgag?aggtcgtcca?atacgatctc?gagaacctga?cggacgctgc?cgaggccagc 360

atcgtcatcg?gtcgcaatcc?cgaaaccggt?gagatcgaag?tcgccaacct?cgattactac 420

tacgaaaccg?acgacggtgt?cctcgacgag?gttcaccggt?tcgagcccac?gaacgcgtcg 480

gaaaccgacg?gggtgcagtc?cgcagccacg?tccgacggag?cgacggtcat?tgccgtcgat 540

acggacgcga?tccgagaagc?gcaaaacagc?gagatcgacg?tcgacgagag?cagtccctcg 600

aacgccgcac?ccacgccggc?ggatatcgac?atcacgggct?gtagcgcttg?taaatacgcc 660

gcaggtcagg?tctgtactat?cggctgtagt?gccgccggtg?gattcatctg?tgggctcctc 720

ggtatcacca?ttccggtcgc?ggggctcagc?tgtctgggct?tcgtcgaaat?cgtctgtacc 780

gtcgccgacg?agtacagcgg?ttgcggtgac?gcggtcgcca?aagaggcctg?taatcgagcg 840

gggctctgtt?ag 852

<210>2

<211>283

<212>PRT

＜213〉extremely halophilic archaea salt bacillus AS7092 (Halobacterium sp.AS7092)

<400>2

Met?Lys?Glu?Asp?Asn?Asn?Thr?Ser?Glu?Glu?Ser?Gly?Arg?Ile?Asn?Arg

1 5 10 15

Arg?Asn?Val?Leu?Lys?Thr?Val?Gly?Ala?Ala?Gly?Leu?Phe?Ala?Ala?Gly

20 25 30

Ser?Thr?Gly?Met?Ala?Ala?Ala?Ala?Asp?Ser?Leu?Ser?Gln?Ala?Glu?Glu

35 40 45

Pro?Lys?Leu?Leu?Thr?Gly?Thr?Glu?Lys?Arg?Thr?Leu?Ala?Arg?Glu?Leu

50 55 60

Ala?Lys?Thr?Pro?Ala?Phe?Arg?Glu?Leu?Ala?Gln?Arg?Ala?Arg?Ala?Asp

65 70 75 80

Gly?Ala?Gln?Ile?Arg?Ser?Asp?Ala?Asp?Ser?Ile?Val?Ala?Gly?Tyr?Ala

85 90 95

Arg?Gly?Glu?Asp?Phe?Ala?Arg?Glu?Val?Val?Gln?Tyr?Asp?Leu?Glu?Asn

100 105 110

Leu?Thr?Asp?Ala?Ala?Glu?Ala?Ser?Ile?Val?Ile?Gly?Arg?Asn?Pro?Glu

115 120 125

Thr?Gly?Glu?Ile?Glu?Val?Ala?Asn?Leu?Asp?Tyr?Tyr?Tyr?Glu?Thr?Asp

130 135 140

Asp?Gly?Val?Leu?Asp?Glu?Val?His?Arg?Phe?Glu?Pro?Thr?Asn?Ala?Ser

145 150 155 160

Glu?Thr?Asp?Gly?Val?Gln?Ser?Ala?Ala?Thr?Ser?Asp?Gly?Ala?Thr?Val

165 170 175

Ile?Ala?Val?Asp?Thr?Asp?Ala?Ile?Arg?Glu?Ala?Gln?Asn?Ser?Glu?Ile

180 185 190

Asp?Val?Asp?Glu?Ser?Ser?Pro?Ser?Asn?Ala?Ala?Pro?Thr?Pro?Ala?Asp

195 200 205

Ile?Asp?Ile?Thr?Gly?Cys?Ser?Ala?Cys?Lys?Tyr?Ala?Ala?Gly?Gln?Val

210 215 220

Cys?Thr?Ile?Gly?Cys?Ser?Ala?Ala?Gly?Gly?Phe?Ile?Cys?Gly?Leu?Leu

225 230 235 240

Gly?Ile?Thr?Ile?Pro?Val?Ala?Gly?Leu?Ser?Cys?Leu?Gly?Phe?Val?Glu

245 250 255

Ile?Val?Cys?Thr?Val?Ala?Asp?Glu?Tyr?Ser?Gly?Cys?Gly?Asp?Ala?Val

260 265 270

Ala?Lys?Glu?Ala?Cys?Asn?Arg?Ala?Gly?Leu?Cys

275 280

Claims (10)

1, a kind of halophilic bacteria, its former albumen are the SEQ ID № that has in the sequence table: the protein of 2 amino acid residue sequences.

2, the maturation protein of the described halophilic bacteria of claim 1 is the protein with one of following amino acid residue sequences:

1) SEQ ID № in the sequence table: 2 208-283 position;

2) with SEQ ID № in the sequence table: 2 208-283 amino acids residue sequence is through replacement, disappearance or the interpolation of one to ten amino-acid residue and have the protein of the microbial process that suppresses extremely halophilic archaea close genus of Halobacterium sp.AS7092 or kind.

3, the immune protein of the described halophilic bacteria of claim 1 is the protein with one of following amino acid residue sequences:

1) SEQ ID № in the sequence table: 2 1-207 position;

2) with SEQ ID № in the sequence table: any several protein that replace, lack or add and described halophilic bacteria is had resistance in 2 the 1-52 amino acids residue sequence;

3) with SEQ ID № in the sequence table: any several in 2 the 1-52 amino acids residue sequence replace, lack or add; With of replacement, disappearance or the interpolation of 53-207 amino acids residue sequence through one to ten amino-acid residue, and the protein that described halophilic bacteria is had resistance;

4) has sequence table SEQ ID №: the albumen of 2 53-207 amino acids residue sequence, or with of replacement, disappearance or the interpolation of 53-207 amino acids residue sequence, and the protein that described halophilic bacteria is had resistance through one to ten amino-acid residue.

4, the encoding gene of claim 2 and 3 described halophilic bacterias and immune protein thereof is one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 1 dna sequence dna;

2) SEQ ID № in the code sequence tabulation: the polynucleotide of 2 protein sequences;

3) under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 1 dna sequence dna hybridization that limits.

5, encoding gene according to claim 4 is characterized in that: described SEQ ID №: 1 the former albumen of 1-852 position dna encoding halophilic bacteria; Described SEQ ID №: 1 622-849 position dna encoding halophilic bacteria maturation protein; Described SEQ ID №: 1 1-621 position dna encoding halophilic bacteria immune protein.

6, the expression vector that contains claim 4 or 5 described encoding genes, transgenic cell line, arbitrary segmental primer is right in host bacterium and the described encoding gene of amplification.

7, the described halophilic bacteria maturation protein of claim 2 is suppressing or is killing application in the extremely halophilic archaea.

8, the encoding gene of the described halophilic bacteria immune protein of claim 7 is as the application in the resistance selective marker.

9, application according to claim 8 is characterized in that: the application of the encoding gene of described halophilic bacteria immune protein in the clonal expression carrier and the plasmid construction of deriving.

10, the described halophilic bacteria maturation protein of claim 2 as selective pressure in constructed clonal expression carrier of claim 11 and the application in the plasmid transformant examination of deriving thereof.

Images