CN1814804A - Watermelon anthrax bacteria detecting kit and its detecting method - Google Patents
Watermelon anthrax bacteria detecting kit and its detecting method Download PDFInfo
- Publication number
- CN1814804A CN1814804A CN 200510110776 CN200510110776A CN1814804A CN 1814804 A CN1814804 A CN 1814804A CN 200510110776 CN200510110776 CN 200510110776 CN 200510110776 A CN200510110776 A CN 200510110776A CN 1814804 A CN1814804 A CN 1814804A
- Authority
- CN
- China
- Prior art keywords
- melon
- primer
- anthrax
- pcr
- bacilus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
This invention provides a primer combination of melon anthracins used in a specific test sample and a PCR test reagent box containing said primer combination and a method for testing melon anthracins.
Description
Technical field
The application relates to biological technical field, especially field of biological detection.Particularly, the application relates to the detection kit and the detection method thereof of melon anthrax bacteria.
Background technology
Cucurbitaceous plant is the big important phyto-group of class of one in the agriculture production, commonly on the agricultural comprises various melon crops, has higher economic value.But be again that disease species is numerous simultaneously, a serious big class crop is injured.The anthrax that infects cucurbitaceous plant then is that cucurbitaceous plant production all over the world endangers one of severe diseases the most, also is the main disease of main melon grown place, China various places.Wherein watermelon is injured the heavyliest, and muskmelon, cucumber, wax gourd, flesh melon and balsam pear take second place, and pumpkin, summer squash and sponge gourd are lighter.Melon anthrax is caused by melon anthrax-bacilus (Colletotrichum orbiculare).The different name of the same race that Colletotrichum lagenarium that occurs in some document at present and Glomerella lagenarium are actually this kind.
In actual production, no matter be land, booth, or the greenhouse, watermelon, muskmelon are subjected to its harm quite serious, and should disease still can continue to cause harm at duration of storage, cause watermelon, muskmelon to rot in a large number.In vegetative period, the morbidity of anthrax is very fast, under appropriate condition, just can cause big area death in several days.Therefore, if can not in time prevent and treat, just may cause heavy losses.Simultaneously, anthrax bacteria is invaded in watermelon or the muskmelon before results, hides in the melon body, and after waiting to gather in the crops, the various physiological activities of melon body weaken, and pathogenic bacteria begins a large amount of breedings, manifests symptom, causes serious rotting, thereby can not store and transport, and shelf-lives is short.
In the traditional melon anthrax evaluation and diagnostic procedure, because the difference of envrionment conditions makes the symptom of generation different, give to rely on the symptom evaluation to bring bigger error, the result is often inaccurate.In to separation and Identification of Pathogens, except needs 6～8 days time, because employed culture condition, the discordance as substratum, temperature, pH value, incubation time etc. often causes the difference that often has in the evaluation because of individual subjective mind to derive a lot of puzzlements.And these are identified all and carry out after disease produces symptom.Agriculture production directive significance to reality is limited.Cause muskmelon, watermelon can not standing storage and the major cause of remote transportation rot after adopting exactly, and the major cause that rots after adopting is because anthrax bacteria infects before gathering, and causes morbidity in gather back storage and the transportation.Therefore, before gathering the back accumulating, western muskmelon must the latent infection situation of anthrax be detected.Traditional anthrax detection method generally needs 6～8 days, and need after producing symptom, carry out, so before storage and transportation, situation that can not clear and definite anthrax bacteria latent infection, cause the western muskmelon that has been infected by anthrax bacteria in storage and transport process, to rot in a large number, produce massive losses.
In recent years, increasing molecular engineering is used for evaluation, detection and the disease screening of pathogenic bacteria, rrna transcribed spacer (ITS), it is the zone between 18S rDNA, 5.8S rDNA and 28S rDNA, this zone evolutionary rate is fast than the coding region, high conservative between different strains in planting, and between the kind of fungi, exist abundant variation.SCAR (Sequence-characterized amplified regions) mark is in the technical method that grows up of RAPD, it designs primer according to the special RAPD fragments sequence that screens, carry out pcr amplification again, like this can be identifying out to have the stability higher than RAPD with the corresponding single site SCAR of original fragment.Can provide prolific hereditary information for phylogeny, classification evaluation and the Molecular Detection of research fungi.
Other anthrax plant detects in the diagnosis, domestic report also few, open the glad special oligonucleotide primer of glue born of the same parents anthrax-bacilus that utilizes, 21 complete genome DNAs that come from the glue born of the same parents anthrax-bacilus bacterial strain of rubber tree, mango are increased, about 500bp fragment that all increases then can not be amplified some other bacterium.Abroad, P.V.Martinez Culebras etc. has designed the primer that colletotrichum belongs to, and according to the ITS sequence, also designed the C.acutatum Auele Specific Primer, by RAPD technology random amplification 80 strain anthrax bacterias, find out the specific band of C.fragariae, behind the commentaries on classics SCAR mark it is detected.Bibliographical information was crossed before P.Parikka and A.Lemmetty utilized primer CaInt2 and ITS4 carry out specific amplification to Colletotrichum acutatum, can obtain the 490bp segment.D.W.Cullen waits the segment to being different from other colletotrichum in the C.coccodes ITS zone to design a fluorescent probe, does real-time fluorescence quantitative PCR and detects C.coccodes.
Yet this area yet there are no the report to melon anthrax bacteria Colletotrichum orbiculare Molecular Detection at present.
Summary of the invention
The objective of the invention is to solve in the prior art melons such as watermelon, muskmelon (class) anthrax bacteria is detected and identifies mainly based on morphological characteristic, method length consuming time, program is loaded down with trivial details, sensitivity is low and empirical strong, is difficult to accomplish disease is taken place the propagation, popular and adopt the septic problem of morbidity in the storage and transport process of back of monitoring in time and control pathogenic bacteria.Provide a kind of melon anthrax bacterias such as watermelon, muskmelon are carried out test kit and the detection method that fast PCR detects, detection time is short, highly sensitive, accuracy is strong.
For achieving the above object, first aspect present invention provides a kind of combination that is used for specific detection sample melon anthrax-bacilus, and described combination comprises two pairs of Auele Specific Primers, and described Auele Specific Primer is selected from following sequence:
First pair: upstream primer 5 ' CTTTGTGAACATACCTAACC 3 ' (SEQ ID NO:1)
Downstream primer 5 ' GGTTTTACGGCAGGAGTG 3 ' (SEQ ID NO:2)
Second pair: upstream primer 5 ' GCTGTCACTTTGTGGTGTG 3 ' (SEQ ID NO:3)
Downstream primer 5 ' TGTCGTAGCCCATCTTGTC 3 ' (SEQ ID NO:4).
Second aspect present invention provides a kind of PCR detection kit, and described test kit comprises the PCR reaction system, and described reaction system comprises two pairs of Auele Specific Primers, and described Auele Specific Primer is selected from following sequence:
First pair: upstream primer 5 ' CTTTGTGAACATACCTAACC 3 '
Downstream primer 5 ' GGTTTTACGGCAGGAGTG 3 '
Second pair: upstream primer 5 ' GCTGTCACTTTGTGGTGTG 3 '
Downstream primer 5 ' TGTCGTAGCCCATCTTGTC 3 '.
Third aspect present invention provides the method for melon anthrax-bacilus in a kind of test sample, and this method may further comprise the steps,
A) with the above-mentioned PCR detection kit of the present invention described sample is carried out pcr amplification, obtain pcr amplification product;
B) size of the pcr amplification product that a) obtains of determination step, if there is the dna fragmentation of 442bp and 216bp in the product, then showing has the melon anthrax-bacilus in the described sample.
A further aspect of the invention relates to PCR detection kit of the present invention application in the melon anthrax-bacilus in test sample.
Compared with prior art, the advantage of technical solution of the present invention and positively effect show:
(1) practical
The rapid detection of watermelon anthrax bacteria has important application value.The major cause that rots after watermelon is adopted is after watermelon anthrax bacteria infects before gathering, to cause morbidity after adopting.Traditional watermelon anthrax detection method generally is after symptom appears in watermelon, by its disease symptom, a series of loaded down with trivial details processes such as the separation of pathogen, purifying, evaluation, generally need 6～8 days, and also there is certain difficulty in pathogen when separating, and gives to detect pathogen fast and accurately and increased difficulty.Before making gather back storage and transportation, situation that can not clear and definite anthrax bacteria latent infection causes and is infected to such an extent that watermelon rots in storage and transport process in a large number, produces massive losses.Owing to can not in time carry out colony's dynamic monitoring in field, miss an opportunity because of a delay also for the control of agriculture production simultaneously.Therefore, existing technology can't satisfy the requirement of agriculture production.Adopt the present invention, under the situation that does not have illness to occur, just can detect, and just can finish testing exactly at 4～6 hours, improved working efficiency greatly, for the long-term accumulating of watermelon provide may, also created chance for effective control of disease.
(2) accuracy height
The present invention utilizes the ITS series of comparisons of 24 kinds that Colletetrichum belongs among the GeneBank, design a pair of primer CY1/CY2, bacterium and other bacterium of these two kinds of Colletetrichum orbiculare, Colletetrichumlindemuthianum separated.Further utilize RAPD reaction random amplification Colletetrichum orbiculare and Colletetrichum lindemuthianu, find out the specific band in Colletetrichumorbiculare, after clone, order-checking, design primer CD3/CD4, Colletetrichum orbiculare and Colletetrichum lindemuthianu are separated.Then utilize above-mentioned two pairs of primer sets to synthesize the composite PCR detection architecture, can be directly separately with similar with other or the relevant kind of Colletetrichum orbiculare.189 bacterial strains such as common fungi in the present inventor pair fungi close and relevant with anthrax-bacilus, plant materials, the soil increase, and found that the accuracy rate of detection method of the present invention is up to 100%.
(3) highly sensitive
Traditional watermelon anthrax detection method generally is after symptom appears in plant, by its disease symptom, carry out separation, purifying, evaluation of pathogen etc., need pathogenic bacteria to produce abundant mycelia or spore, generally need to contain 500～800 conidiums or suitable mycelium in every gram plant tissue or the soil, just can separate.Watermelon anthrax bacteria detection kit provided by the invention and detection method thereof can detect the DNA of 10pg/ μ l, that is to say, can detect and contain 5～10 conidiums or suitable mycelium in every gram plant tissue or the soil before disease manifest symptom, sensitivity is quite high.
Other purpose advantage of the present invention can be known after in conjunction with the accompanying drawings from the following detailed description.
Description of drawings
Fig. 1 has shown that in one embodiment of the invention to the detected result of anthrax-bacilus in the watermelon plant leaf, swimming lane 1 among the figure: negative control; Swimming lane 2: positive control; Swimming lane 3～13: morbidity water melon leaf; Swimming lane 14～16: Kidney bean incidence of leaf.
Fig. 2 has shown the result who in another embodiment of the present invention anthrax-bacilus in the muskmelon melon skin is detected, and swimming lane 1 among the figure: negative control; Swimming lane 2: positive control; Swimming lane 3～6: morbidity muskmelon melon skin; Swimming lane 7: healthy water melon leaf; Swimming lane 8: capsicum anthrax-bacilus; Swimming lane 9: Chinese cabbage anthrax-bacilus.
Fig. 3 has shown the result who in another embodiment of the present invention the melon anthrax-bacilus in the watermelon field soil is detected, and swimming lane 1 among the figure: positive control; Swimming lane 2～4: morbidity watermelon field soil; Swimming lane 5～6: non-watermelon field soil; Swimming lane 7: healthy water melon leaf.
Embodiment
Melon anthrax bacteria of the present invention (Colletetrichum orbiculare) detection kit belongs to that farm crop are prevented and cured diseases and the Plant Quarantine category.According to the ITS gene order of watermelon anthrax bacteria, the present inventor designs a pair of special primer: upstream primer 5 ' CTTTGTGAACATACCTAACC 3 ', downstream primer 5 ' GGTTTTACGGCAGGAGTG 3 '; Utilize RAPD reaction again, change the SCAR mark, design another to special primer: upstream primer 5 ' GCTGTCACTTTGTGGTGTG 3 ', downstream primer 5 ' TGTCGTAGCCCATCTTGTC 3 '.Utilize above-mentioned two pairs of primer sets to synthesize composite PCR detection reaction system.Reaction system comprises, detects solution promptly with 1mL, contains 120 μ l, 10 * PCR reaction buffer, 80 μ l 2.0mM MgCl
2, the dNTPs of 200 μ l 2.5mmolL-1, each 25 μ l of two pairs of upstream and downstream primers of 20 μ ML-1,600 Taq of unit polysaccharases add ultrapure water and detect solution to 1mL.This watermelon anthrax bacteria composite PCR detection kit has stronger specificity, susceptibility and stability.The present invention for melon vegetative period such as watermelon, muskmelon and adopt back anthrax fast, accurately and sensitive technology and the method for providing is provided.
Particularly, first aspect present invention provides a kind of combination that is used for specific detection sample melon anthrax-bacilus, and described combination comprises two pairs of Auele Specific Primers, and described Auele Specific Primer is selected from following sequence:
First pair: upstream primer 5 ' CTTTGTGAACATACCTAACC 3 '
Downstream primer 5 ' GGTTTTACGGCAGGAGTG 3 '
Second pair: upstream primer 5 ' GCTGTCACTTTGTGGTGTG 3 '
Downstream primer 5 ' TGTCGTAGCCCATCTTGTC 3 '.
Primer of the present invention can produce with any known method, people's [Proc.Natl.Acad.Sci.USA (1983) 80:7461] such as people's [J.Am.Chem.Soc. (1981) 103:3185] such as Matteucci three ester synthetic methods or Urdea method for example, or synthetic with commercially available automatic oligonucleotide synthesizer.In addition, can also select the chemical feature of primer according to preference.Use for some, DNA or RNA are suitable.For other application, can also add modification, for example backbone modification as thiophosphatephosphorothioate or methyl phosphorodithioate, changes RNA avidity, and increase ribozyme resistances etc. are [for example referring to Agrawal and Iyer (1995) Curr Opin Biotechnol 6:12-19; Agrawal (1996) TIBTECH 14:376-387]; Also can adopt analogue such as peptide nucleic acid(PNA) [for example referring to Corey (1997) TIBTECH 15:224-229; People such as Buchardt (1993) TIBTECH 11:384-386].
Second aspect present invention provides a kind of PCR detection kit, and described test kit comprises the PCR reaction system, and described reaction system comprises two pairs of Auele Specific Primers, and described Auele Specific Primer is selected from following sequence:
First pair: upstream primer 5 ' CTTTGTGAACATACCTAACC 3 '
Downstream primer 5 ' GGTTTTACGGCAGGAGTG 3 '
Second pair: upstream primer 5 ' GCTGTCACTTTGTGGTGTG 3 '
Downstream primer 5 ' TGTCGTAGCCCATCTTGTC 3 '.
Used term " PCR " or " polymerase chain reaction " refer to a kind of process or technology (as U.S. Patent No. 4,683, described in 195 (mandates on July 28th, 1987) like that) among the present invention.Usually, need to obtain the sequence information of area-of-interest two ends or its extension, thus can the design oligonucleotides primer; These primers should be same or similar with the sequence of template opposite strand to be amplified.5 ' terminal nucleotide of two primers can overlap just with the two ends of amplification material.Round pcr can be used to increase among the full gene group DNA, transcribe specific RNA sequence, specific dna sequence the cDNA of acquisition from whole-cell rna, phage or plasmid sequence etc.See Mullis etc., ColdSpring Harbor Symp.Quant.Biol.51:263 (1987); Erlich edits, PCR Technology (Stockton Press, NY, 1989).
Polymerase chain reaction technique is a kind of means that detect a small amount of target nucleic acid well known to those skilled in the art.Similar test is at people such as Mullis [Meth.Enzymol. (1987) 155:335-350]; United States Patent (USP) 4,683 is described in 195 and 4,683,202 to some extent.With two " primer " Nucleotide and target nucleic acid hybridization, and be used for guiding reaction.Primer can comprise not the sequence with amplified target sequence (or its complementary sequence) hybridization, helping the stability of duplex, or for example can insert an easy restriction site.In order to detect the existence of target nucleic acid, the selection of Auele Specific Primer is vital.
Those skilled in the art can be according to the PCR reaction system in the suitable selection of the technology of the knowing test kit of the present invention.In a preferable embodiment of the present invention, described reaction system also can comprise PCR reaction buffer, Mg
2+, dNTP and Taq enzyme etc.The composition of PCR damping fluid can be determined according to known technology by those skilled in the art, for example can be 100mM Tris HCl (pH 8.3); 500mM KCl; 1.0%TritonX-100.In a better embodiment, described reaction system is composed of the following components: in 1 ml soln, and 10 * PCR reaction buffer, 120 μ l, 2.0mM MgCl
280 μ l, the dNTPs200 μ l of 2.5mmolL-1, each 25 μ l of two pairs of upstream and downstream primers of 20 μ ML-1,600 Taq of unit polysaccharases, surplus is a ultrapure water.
In addition, also can attach process specifications in the PCR detection kit of the present invention.
The existence that PCR detection kit of the present invention can be used for melon anthrax-bacilus in the test sample specifically whether.Therefore, the present invention relates to the application in the melon anthrax-bacilus in test sample of described PCR detection kit on the other hand.
The present invention also provides the method for melon anthrax-bacilus in a kind of test sample on the other hand, and this method may further comprise the steps,
A) with the above-mentioned PCR detection kit of the present invention described sample is carried out pcr amplification, obtain pcr amplification product;
B) size of the pcr amplification product that a) obtains of determination step, if there is the dna fragmentation of 442bp and 216bp in the product, then showing has the melon anthrax-bacilus in the described sample.
In described method, sample for example can be, but is not limited to, the cotyledon of melon plant, young stem, true leaf, stem, pod and seed, preferably the DNA extraction thing of above-mentioned plant tissue.Described DNA extraction thing can obtain with commercially available DNA extraction test kit or other conventional DNA extraction methods.Though the embodiment of the invention describes as an example with watermelon and muskmelon, be to be understood that the melon that the inventive method is suitable for is not limited to watermelon and muskmelon, it also can comprise cucumber, wax gourd, flesh melon, balsam pear, pumpkin, summer squash and sponge gourd.In another preferable embodiment, described sample also can contain any sample of melon anthrax-bacilus from soil or other suspection.
In aforesaid method, at first the conditioned disjunction at the appended specification sheets of PCR detection kit is under the condition of being determined according to normal experiment by those skilled in the art, with two pairs of Auele Specific Primers of the present invention sample is carried out pcr amplification, obtains pcr amplification product.Then, use ordinary method, the size of the pcr amplification product that a) obtains as gel electrophoresis (as agarose gel electrophoresis) determination step.If of course, can also adopt more accurate measuring method, as product being checked order etc.If the result shows above-mentioned two pairs of primers and has successfully amplified the have expectation length band of (442bp and 216bp) that then showing has the melon anthrax-bacilus in the described sample.Should be understood that various variations (as disappearance, increase or replacement) may take place the dna sequence dna of melon anthrax-bacilus, therefore the length of the actual amplified production that records may have certain difference with above-mentioned length.So, the implication of specification sheets of the present invention used length " 442bp and 216bp " is in the whole text not merely represented these length itself, but comprised near the length that described length, (for example differs 20 bp or more, be preferably and differ 10 bp, be more preferred from and differ 5 bp's).
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.Unless description is arranged in addition, enforcement of the present invention will be adopted molecular biology, microbiology, recombinant DNA and immunologic routine techniques, and these all are known to those skilled in the art.These technology have complete description in following document: for example, and Sambrook " molecular cloning experiment guide " the 2nd edition (1989); " dna clone " I and II volume (D.N.Glover edits 1985); " oligonucleotide is synthetic " (M.J.Gait edits, 1984).Perhaps, can carry out according to the specification sheets that the reagent manufacturer is provided.
Anthrax-bacilus in embodiment 1, the detection watermelon plant leaf
A) material
Design the specific primer sequence of melon anthrax-bacilus as follows:
First pair: upstream primer 5 ' CTTTGTGAACATACCTAACC 3 '
Downstream primer 5 ' GGTTTTACGGCAGGAGTG 3 '
Second pair: upstream primer 5 ' GCTGTCACTTTGTGGTGTG 3 '
Downstream primer 5 ' TGTCGTAGCCCATCTTGTC 3 '
With the synthetic above-mentioned sequence of dna synthesizer.
Following reagent preparation box reaction system: 1mL detects solution and comprises: contain 10 * PCR reaction buffer, 120 μ l, 2.0mM MgCl
280 μ l, 2.5mmolL
-1DNTPs 200 μ l, 20 μ ML
-1Each 25 μ l of two pairs of upstream and downstream primers, 600 Taq of unit polysaccharases add ultrapure water and detect solution to 1mL.
B) method:
1) the thick DNA extraction liquid of acquisition anthrax-bacilus from plant leafs such as watermelon or muskmelon:
Get the plant leaf of watermelon or muskmelon, behind the aseptic water washing, every gram tissue adds 0.5N NaOH solution 15 μ l, be transferred in the centrifuge tube after fully grinding, the centrifugal 5min of 12000rpm, get 5 μ l supernatant liquors and add 495 μ l 0.1mM Tris (pH 8.0) damping fluids, get 1 μ l behind the mixing and be directly used in the PCR reaction.
2) get the above-mentioned DNA of 1 μ l and slightly carry solution, add 24 μ l test kit solution, cumulative volume is 25 μ l.The pcr amplification program is: 94 ℃ of pre-sex change 5min, enter circulation, and 94 ℃ of sex change 45S, 62 ℃ of annealing 30S, 72 ℃ are extended 1min, amount to 33 circulations.Last 72 ℃ are extended 7min.
The electrophoresis detection of amplified reaction: get the solution after the 10 μ l amplification, the sepharose 1.5% in 1 * TAE (10mM Tris, the 5mM sodium-acetate, 0.5mM EDTA, PH7.8) in electrophoresis, voltage 5V/cm, electrophoresis was observed detected result after 30 minutes under ultraviolet lamp.The result shows that morbidity water melon leaf (swimming lane 3-13) amplifies 442bp and two DNA bands of a spectrum of 216bp, and morbidity Kidney bean blade (swimming lane 14-16) then has only DNA bands of a spectrum (as shown in Figure 1).Contain melon anthrax-bacilus (Colletetrichumorbiculare) in the blade that this explanation detects, and the bacterial classification (as the Kidney bean anthrax-bacilus) that described detection method can be similar or relevant with melon anthrax-bacilus and other makes a distinction.
Anthrax-bacilus in embodiment 2, the detection muskmelon melon skin
Adopt and embodiment 1a) identical reaction system.
Get the muskmelon melon skin tissue of sorrel point shape scab, every gram tissue adds 25 μ l 0.5M NaOH, be transferred in the Eppendorf pipe of 1.5ml after in mortar, fully grinding, the centrifugal 5min of 12000g, get 8 μ l supernatant liquors and add 492 μ l 0.1mM Tris (pH 8.0), get 1 μ l behind the mixing and be directly used in the PCR reaction.
Method according to embodiment 1 is carried out pcr amplification, and the result shows that morbidity muskmelon melon skin (swimming lane 3-6) equally with positive control (swimming lane 2) sees two specific DNA bands of a spectrum clearly at 216bp and 442bp place.Healthy water melon leaf (swimming lane 7), capsicum anthrax-bacilus (swimming lane 8), Chinese cabbage anthrax-bacilus (swimming lane 9) are not then seen band (as shown in Figure 2).
Watermelon anthrax-bacilus in embodiment 3, the detection watermelon field soil
Get the heavier field piece soil of 1g watermelon anthrax morbidity, add 10ml extracting solution (0.5mM glucitol in the sample, 15% polyoxyethylene glycol 6 000,2% baycovin, 100mM EDTA and 50mM Tutofusin tris, pH 8.0), mix 5min, add 600mg PVPP again, 120 μ l 50mgml-1 N,O-Diacetylmuramidases and 120 μ l 200mgml
-1Beta-glucanase is placed 2h on ice after the mixing.Add cytolysis extracting solution (4.0ml 4% SDS, 100mM EDTA, 60 μ lml then
-1Proteinase K and 50mM Tris pH8.0), place 18h on ice after the mixing.Centrifugal 10min, supernatant liquor add the 3M Potassium ethanoate and put 2h on ice, the centrifugal supernatant liquor that stays, and 100% ethanol sedimentation DNA of adding two volumes is dissolved in the TE damping fluid.Get 1 μ l and be directly used in the PCR reaction.Adopt and embodiment 1a) identical reaction system.
Method according to embodiment 1 is carried out pcr amplification, the result is at the specific band (swimming lane 2-4) of visible two the watermelon anthrax-bacilus of 216bp and 442bp place, but not watermelon field soil (swimming lane 5-6) and healthy water melon leaf (swimming lane 7) are not then seen band (as shown in Figure 3).This shows that method of the present invention can detect the melon anthrax-bacilus that contains in the soil specifically.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition read of the present invention above-mentioned tell about content after, those skilled in the art can make various changes or modifications the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉East China University of Science
＜120〉detection kit of watermelon anthrax bacteria and detection method thereof
<130>058656
<160>4
<170>PatentIn?version?3.3
<210>1
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>1
ctttgtgaac?atacctaacc 20
<210>2
<211>18
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>2
ggttttacgg?caggagtg 18
<210>3
<211>19
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>3
gctgtcactt?tgtggtgtg 19
<210>4
<211>19
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>4
tgtcgtagcc?catcttgtc 19
Claims (9)
1. combination that is used for specific detection sample melon anthrax-bacilus, described combination comprises two pairs of Auele Specific Primers, described Auele Specific Primer is selected from following sequence:
First pair: upstream primer 5 ' CTTTGTGAACATACCTAACC 3 '
Downstream primer 5 ' GGTTTTACGGCAGGAGTG 3 '
Second pair: upstream primer 5 ' GCTGTCACTTTGTGGTGTG 3 '
Downstream primer 5 ' TGTCGTAGCCCATCTTGTC 3 '.
2. PCR detection kit, described test kit comprises the PCR reaction system, and described reaction system comprises two pairs of Auele Specific Primers, and described Auele Specific Primer is selected from following sequence:
First pair: upstream primer 5 ' CTTTGTGAACATACCTAACC 3 '
Downstream primer 5 ' GGTTTTACGGCAGGAGTG 3 '
Second pair: upstream primer 5 ' GCTGTCACTTTGTGGTGTG 3 '
Downstream primer 5 ' TGTCGTAGCCCATCTTGTC 3 '.
3. PCR detection kit as claimed in claim 2 is characterized in that described reaction system also comprises PCR reaction buffer, Mg2
+, dNTP and Taq enzyme.
4. PCR detection kit as claimed in claim 2 is characterized in that, described reaction system is composed of the following components: in 1 ml soln, and 10 * PCR reaction buffer, 120 μ l, 2.0mM MgCl
280 μ l, the dNTPs 200 μ l of 2.5mmolL-1, each 25 μ l of two pairs of upstream and downstream primers of 20 μ ML-1,600 Taq of unit polysaccharases, surplus is a ultrapure water.
5. the method for melon anthrax-bacilus in the test sample, this method may further comprise the steps,
A) with the described PCR detection kit of claim 2 described sample is carried out pcr amplification, obtain pcr amplification product;
B) size of the pcr amplification product that a) obtains of determination step, if there is the dna fragmentation of 442bp and 216bp in the product, then showing has the melon anthrax-bacilus in the described sample.
6. method as claimed in claim 5 is characterized in that, described sample is the cotyledon of melon, young stem, true leaf, stem, pod, seed and DNA extraction thing thereof.
7. method as claimed in claim 6 is characterized in that, described melon is selected from watermelon, muskmelon, cucumber, wax gourd, flesh melon, balsam pear, pumpkin, summer squash and sponge gourd.
8. method as claimed in claim 5 is characterized in that described sample is a soil.
9. the described PCR detection kit of claim 2 application in the melon anthrax-bacilus in test sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB200510110776XA CN100413979C (en) | 2005-11-25 | 2005-11-25 | Watermelon anthrax bacteria detecting kit and its detecting method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB200510110776XA CN100413979C (en) | 2005-11-25 | 2005-11-25 | Watermelon anthrax bacteria detecting kit and its detecting method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1814804A true CN1814804A (en) | 2006-08-09 |
| CN100413979C CN100413979C (en) | 2008-08-27 |
Family
ID=36907160
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB200510110776XA Expired - Fee Related CN100413979C (en) | 2005-11-25 | 2005-11-25 | Watermelon anthrax bacteria detecting kit and its detecting method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100413979C (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103290099A (en) * | 2012-02-24 | 2013-09-11 | 中国科学院微生物研究所 | Quick molecular detection kit for colletotrichum kahawae and application thereof |
| CN104593502A (en) * | 2015-01-21 | 2015-05-06 | 南京农业大学 | Loop-mediated isothermal amplification primer composition capable of detecting colletotrichum truncatum and application thereof |
| CN107130050A (en) * | 2017-06-23 | 2017-09-05 | 苏州蔻美新材料有限公司 | A kind of molecular labeling and its application for being used to detect Strawberry anthracnose bacterium |
| CN109022538A (en) * | 2018-08-22 | 2018-12-18 | 湖南省蔬菜研究所 | A kind of method identified in watermelon anthrax resistance room |
| CN110760602A (en) * | 2018-07-25 | 2020-02-07 | 武汉市农业科学院 | SSR primer and method for identifying watermelon anthracnose resistance |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1514019A (en) * | 2003-06-10 | 2004-07-21 | 南京农业大学 | Detecting gene of bacillus anthracis anticarbendazol and its reagent box |
-
2005
- 2005-11-25 CN CNB200510110776XA patent/CN100413979C/en not_active Expired - Fee Related
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103290099A (en) * | 2012-02-24 | 2013-09-11 | 中国科学院微生物研究所 | Quick molecular detection kit for colletotrichum kahawae and application thereof |
| CN103290099B (en) * | 2012-02-24 | 2015-01-14 | 中国科学院微生物研究所 | Quick molecular detection kit for colletotrichum kahawae and application thereof |
| CN104593502A (en) * | 2015-01-21 | 2015-05-06 | 南京农业大学 | Loop-mediated isothermal amplification primer composition capable of detecting colletotrichum truncatum and application thereof |
| CN107130050A (en) * | 2017-06-23 | 2017-09-05 | 苏州蔻美新材料有限公司 | A kind of molecular labeling and its application for being used to detect Strawberry anthracnose bacterium |
| CN110760602A (en) * | 2018-07-25 | 2020-02-07 | 武汉市农业科学院 | SSR primer and method for identifying watermelon anthracnose resistance |
| CN109022538A (en) * | 2018-08-22 | 2018-12-18 | 湖南省蔬菜研究所 | A kind of method identified in watermelon anthrax resistance room |
| CN109022538B (en) * | 2018-08-22 | 2022-06-17 | 湖南省蔬菜研究所 | Indoor identification method for watermelon anthracnose resistance |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100413979C (en) | 2008-08-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kamle et al. | Identification and phylogenetic correlation among Colletotrichum gloeosporioides pathogen of anthracnose for mango | |
| CN1814804A (en) | Watermelon anthrax bacteria detecting kit and its detecting method | |
| Li et al. | First report of root rot caused by Plectosphaerella cucumerina on cabbage in China | |
| Li et al. | Fusarium solani causing root rot disease on Gastrodia elata in Shaxi, China | |
| Vasić et al. | Morphological description and molecular detection of Pestalotiopsis sp. on hazelnut in Serbia | |
| Siddiquee et al. | Morphological and molecular detection of Fusarium chlamydosporum from root endophytes of Dendrobium crumenatum | |
| CN102586470A (en) | Polymerase chain reaction (PCR) detection kit for maize curvularia leaf spot and detection method for PCR detection kit | |
| Huarhua et al. | Morphological and molecular identification of Phytophthora cinnamomi Rands as a causal agent of Crown and root rot in Blueberry (Vaccinium corymbosum) in Peru | |
| CN1814803A (en) | Bean anthrax bacteria detecting kit and its detecting method | |
| Singh et al. | Phylogenetic relationship of Trichoderma asperellum Tasp/8940 using internal transcribed spacer (ITS) sequences | |
| Elansky et al. | Molecular identification of the species composition of Russian isolates of pathogens, causing early blight of potato and tomato | |
| CN106434879B (en) | Rapidly and efficiently detect the method for Cordyceps militaris different strain mating type | |
| Tang et al. | First Worldwide Report of Exserohilum rostratum Causing Leaf Spot on Strawberry (Fragaria× ananassa) | |
| Kihara et al. | PCR-mediated detection of endophytic and phytopathogenic fungi from needles of the Japanese black pine, Pinus thunbergii | |
| Abdrassulova et al. | Identification of fungi storage types by sequencing method | |
| CN1171998C (en) | Antibacterial peptide gene of Chinese prawn and its colon technique | |
| Urtgam et al. | Genetic evolution of Asian predatory wasp, Vespa velutina, in northern of Thailand based on cytochrome oxidase subunit I DNA barcoding. NU | |
| CN1880476A (en) | Molecular detection method for Fusarium circinatum | |
| CN105567827A (en) | PCR method for simultaneously detecting various parasitic myxosporeans of carassius auratus gibelio | |
| Yang et al. | First Report of Potato Stem Canker Caused by Rhizoctonia solani AG-2-2IIIB in Heilongjiang Province, China | |
| CN1281755C (en) | Powdery mildew resistance gene fragment or gene marker of Maihuang grape as wild species of China vitis and application | |
| Bulat et al. | Molecular identification of ascochyta blight of Cicer montbretii Jaub. & Spach | |
| Ramli et al. | AN ITS GENE-MEDIATED MOLECULAR DETECTION OF FUNGI ASSOCIATED WITH NATURAL AND ARTIFICIAL AGARWOOD FROM Aquilaria malaccensis | |
| Anokhina et al. | Isolation and identification of Saprolegnia spp. from infected sturgeon caviar | |
| CN1216153C (en) | Specificity molecule marker of penicillum IPC strain and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080827 Termination date: 20121125 |