CN1814747A - Bacterial speices and method for producing succinic acid by microbial fermentation - Google Patents

Abstract

This invention relates to a method for producing succinic acid type culture by animalcule fermentation, especially relating to an animalcule actinobacillus succinogenes SW0580 generating succinic acid by a fermentated sugariness raw material, its preservation number: CGMCC No. 1593 and a method for utilizing said animalcule fermentation to produce succinic acid, in which, said animalcule is the actinobacillus succinogenes separated from the rumen tested and 10-50g/L succinic acid can be produced by anaerobic fermentating 20-100g/L sugariness raw materials.

Description

A kind of bacterial classification of producing succinic acid by microbial fermentation and method

Technical field

A kind of bacterial classification of producing succinic acid by microbial fermentation and method belong to technical field of bioengineering.Be specifically related to bacterial classification and method with a kind of anaerobion fermentation of biomass raw material production Succinic Acid.

Background technology

Succinic Acid claims succsinic acid (succsinic acid) again, and molecular formula is C ₄H ₆O ₄, molecular weight is 118.09, is a kind of common natural organic acids, extensively is present in human body, animal, plant and the microorganism.

Succinic Acid is industrial a kind of important C4 compound, and it is widely used in food, medicine, agricultural chemicals, dyestuff, spices, paint, plastics and material industry as organic synthesis starting material, intermediate product or professional chemical preparations.The market of its maximum is fields such as tensio-active agent, sanitising agent, green solvent, ion chelating agent, biodegradable plastic.In food service industry as souring agent, pH modifying agent, flavour substances and antiseptic-germicide, and as raw material or intermediate be used for medicine, microbiotic, amino acid and VITAMIN production (ApplMicrobiol Biotechnol, 1999,51:545-552).In addition, succinate can also be used as fodder additives of ruminating animal and monogastric animal such as pig and the growth substance of plant.At present, the production of Succinic Acid and its most of derivatives also is in the further research and development stage.

At present develop multinomial technology Succinic Acid has been converted into important industrial chemical, comprised N-Methyl pyrrolidone, 1,4-butyleneglycol, tetrahydrofuran (THF), gamma-butyrolactone, polybutylene terephthalate (PBT resin), hexanodioic acid etc.Wherein many Chemicals all are to be the raw material synthetic with benzene, and benzene is oil or Coal Chemical Industry product, and resource scarcity is non-renewable.At present nearly 250 kinds is that the Chemicals of raw material can be that raw material is produced by Succinic Acid with benzene.Therefore, the whole world constantly increases the demand of Succinic Acid.

The production method of industrial Succinic Acid is mainly chemical process, mainly contains paraffin oxidation style, light oil oxidation style, butane oxidation method, succinonitrile hydrolysis method, shortening method and is the electrolytic oxidation of raw material with ethene and carbon monoxide.At present, main use both at home and abroad is the shortening method.

Chemically obtain Succinic Acid, will consume a large amount of non-renewable petrochemical materials inevitably, also environment is caused severe contamination, exist transformation efficiency low, drawbacks such as easy contaminate environment.

The production of Succinic Acid can be undertaken by chemical synthesis process or fermentation process, because the minimizing day by day of petrochemical material, the method for producing Succinic Acid with the microbial fermentation carbohydrate is subject to people's attention day by day.Because the fermentative Production Succinic Acid is as main raw material with renewable sugared source (as glucose) and carbonic acid gas, so Production by Microorganism Fermentation Succinic Acid, it is low and break away from the advantage that petrochemical material is relied on to have cost, and opened up the new way that the greenhouse gases carbonic acid gas utilizes, shown the environmental friendliness feature more.

Succinic Acid is the fermentation organic acid product of tool market potential behind citric acid, but mostly still produces with chemical process at present.The demand of global Succinic Acid in 1999 is 270,000 tons, and calendar year 2001 is 480,000 tons, and market demand in 2002 is 590,000 tons.Increase progressively with about 100,000 tons/year amplitude.According to the estimation of MBI institute of U.S. Michigan university, in the coming years, the year demand of Succinic Acid will reach 1,000,000 tons level.

Succinic Acid is many strictly anaerobic bacteriums and the metabolic important intermediate of facultative anaerobe.The microorganism of succinic acid-producing has: propionic acid produces bacterium, for example Propionibacterium sp.; Typical enterobacteria, for example E.coli, Pectinatus sp.; Cud bacterium, for example Actinobacillus succinogenes, Bacteroides amylophilus, Brebibacterium divaricatum, Succinimonas amylolytica, Succinivibriodextrinisolvens, Wolinella succinogenes, Ruminococcus flavefaciens etc.In addition, the bacterial strain of some milk-acid bacterias also can produce a spot of Succinic Acid.

Wherein produce the Succinic Acid that bacterium acidi propionici can accumulate lower concentration, cud bacterium of from cud, separating such as succsinic acid thread fungus Fibrobacter Succinogenes (Weimer, 1993), Succinivibrio Succinivibriodextrinisolvens (O ' Herrin and Kenealy, 1993), Bacteroides ruminicola (Howlett, 1976), Bacteroides amylophilus (Caldwell, 1969) but etc. also succinic acid-producing, and rate ratio bacterium acidi propionici height.But the fermentation of cud bacterium has many low-producing by products, and fermentation is unstable, and most bacterial strains can not satisfy industrial production requirement economically on producing.Though have report succsinic acid actinobacillus Actinobacillus succinogenesATCC55618 (US 5,504,004,1996; US 5,723,322,1998) succinic acid-producing content 70g/L, productive rate more than 80%, (US 5 for anaerobism spirillum Anaerobiospirillumsucciniciproducens ATCC 29305,143,833, US 5,143, and 834 and US 5,168,055,1992) succinic acid-producing 43g/L, productive rate 91%.Genetic engineering bacterium E.coli AFP111/pTrc99A-pyc succinic acid-producing 99.2g/L, productive rate 110% (Vemuri, J.Industrial Microbiology ﹠amp; Biotechnology, 2002).These bacterial strains are not easy to obtain, and cultivation and fermentation conditional request height, should not be used for domestic industrial production but at home.Therefore, autonomous innovation ground screening can tolerate the microorganism strains of high density Succinic Acid at home, and to work out a kind of fermentation process that can production high density Succinic Acid be necessary.

Summary of the invention

The bacterial classification and the method that the purpose of this invention is to provide a kind of producing succinic acid by microbial fermentation, this bacterial strain are the new bacterial strains that Succinic Acid can be effectively produced in a strain, produce the method for Succinic Acid with the saccharine material of this strain fermentation cheapness.

It below is the detailed description of technical solution of the present invention.

The screening of microorganism strains and evaluation:

In the present invention, set up a model that screens high succinic acid-producing bacterial strain fast and effectively.According to producing higher fumaric acid desaturase (Van der Werf in its cellular process of succinic acid-producing bacterial strain, ArchMicrobiol, 1997) this point characteristic, designing with the sodium fumarate is the selectivity flat board of sole carbon source, filters out the bacterial strain that can utilize fumaric acid.Because the fumaric acid desaturase can transform Succinic Acid with fumaric acid, and fumaric acid is muddy shape under acidic conditions, therefore can select the bigger bacterium colony of transparent circle to filter out the higher bacterial strain of fumaric acid desaturase.

The present invention samples from the cud of the careless ruminant animal of foods such as ox, sheep, gets ruminal digestion thing anaerobism enrichment culture 2-4 time in the enrichment medium that contains fumaric acid, and coating with the sodium fumarate is on the selective separation flat board of sole carbon source again, is being full of CO ₂Environment in cultivate.Select the bigger bacterium colony of transparent circle, with the test tube of fermention medium is housed, the anaerobically fermenting primary dcreening operation was got clear liquid after 2-3 days again, and point sample is to the silica gel column chromatography thin plate, in benzene: ethyl acetate: the acetate volume ratio is an exhibition layer in 2: 1: 0.03 systems, develops the color with bromjophenol blue.The bacterial strain that remains with Succinic Acid colour developing spot transferred again carry out anaerobically fermenting sieve again in the triangular flask that fermention medium is housed, 36-72h is with HPLC method (Lichrospher C18 250 * 4.6mm, 5 μ m; Moving phase 50mmol/L KH ₂PO ₄, pH 2.8, ultraviolet detection wavelength 210nm) and measure the content of Succinic Acid.Through a large amount of bacterial strain screening work to a plurality of cud samples, near hundreds of strain rumen bacterias of separating, just filter out the bacterial strain of nearly tens strain succinic acid-producings altogether, it is less that multiple at last sieve obtains heteroacid, the succinic acid-producing bacterial strain SW0580 bacterial strain that genetic stability is good.

The microorganism SW0580 that can effectively accumulate Succinic Acid that the present invention's screening obtains, identify through 16S rRNA genetic testing with by " uncle Jie Shi Bacteria Identification handbook (the 8th edition) " Physiology and biochemistry, think the succsinic acid actinobacillus (Actinobacillussuccinogenes) that belongs to Pasteurellaceae (pasteurellaceae) Actinobacillus (Actinobacillus).The cell of this bacterium becomes bar-shaped, does not move, no gemma, and visible typical actinobacillus feature in nutrient broth medium, the class ball particle that promptly scatters is formed the bacillus (Morse code and chain are Morse code shape) that seems to be " password ".Gram-negative, amphimicrobian.100%CO ₂Under the environment, thalline is grown separately, is grown in groups and becomes chain growth.Bacterium colony on the TSB nutrient agar circularizes, complete, grey, translucent, and CO is being arranged ₂When existing, behind the cultivation 24h, diameter can reach 1～1.5mm under 37 ℃ of conditions.Thalline sticks together on flat board when cultivating in air.Bacterial strain has tangible decline phenomenon after preserving a week on flat board, the inclined-plane.

The seed culture of microorganism strains and fermentation:

Consisting of of seed culture medium: glucose 5-15g/L, yeast extract paste 5-10g/L, corn steep liquor 5-15g/L, Na ₂HPO ₄12H ₂O 0.5-2.0g/L, NaH ₂PO ₄2H ₂O 0.2-2.0g/L, mixed vitamin 1-10ml/L, pH 6.0-7.0.

Fermention medium: saccharine material 20-100g/L, nitrogenous source 1-50g/L, yeast extract paste 5-25g/L, Na ₂HPO ₄12H ₂O 1.0-5.0g/L, NaH ₂PO ₄2H ₂O 1.0-5.0g/L, NaCl 1.0-5.0g/L, MgCl ₂0.1-5.0g/L, CaCl ₂0.1-5.0g/L, sodium acetate 0.1-5.0g/L, vitamin H 1-5ml/L, mixed vitamin 1-10ml/L, medium pH 3～8.

Described mixed vitamin consists of: B ₁₂5mg, B ₆100mg, folic acid 20mg, Riboflavin Tetrabutyrate 0mg, VitB1 20mg, nicotinic acid 20mg, pantothenic acid 50mg, para-amino benzoic acid 50mg, distilled water is settled to 1000ml.

The sterilising temp of seed culture medium and fermention medium is 115-121 ℃, 15min.Temperature-sensitive materials such as VITAMIN preparation back 0.2 μ membrane filtration degerming adds before the inoculation.

Experimental strain is inoculated in the seed culture medium, and the bottled liquid 20～80ml of 100ml triangle is being full of CO in 30-40 ℃ ₂Environment in static or under the condition of aerobic, shake, cultivate 24-48h.

Inoculum size by 1%-10% inserts fermention medium with cultured seed, 30～40 ℃ of culture temperature, and fermentation is at logical CO ₂Or N ₂Anaerobic condition under, anaerobism is cultivated 1-4d.

The saccharine material carbon source that is used to ferment can be a glucose sugar, fructose, maltose, wood sugar, sucrose, lactose, semi-lactosi, whey, and the hydrolyzate or the syrup of cassava, corn, beet or lignocellulose.Inorganic ammonium salts such as soybean cake powder, corn steep liquor, urea or ammonium sulfate can be used as the nitrogenous source of substratum, also contain inorganic salt and vitamin H and mixed vitamins such as phosphoric acid salt, sodium acetate in the fermention medium.Fermentation is at logical CO ₂Or N ₂Carry out under the anaerobic environment of gas, 30-40 ℃ of static or stir culture, and keep pH in the fermented liquid at 5.5-7.0 with carbonate or ammoniacal liquor or liquid caustic soda.

Beneficial effect of the present invention: characteristics of the present invention are to have separated the succsinic acid actinobacillus CGMCC 1593 of effective generation Succinic Acid from fresh cud, it is under suitable conditions such as anaerobism, can accumulate Succinic Acid significantly, succinic acid-producing reaches 10-50g/L, be up to more than the 40g/L, can satisfy and realize industrial production requirement economically.

The advantage that the present invention gives prominence to is to utilize reproducible agricultural byproducts such as cheap corn, cassava to produce Succinic Acid for fermenting raw materials, is a kind of continuable production method, can alleviate the nervous problem of petrochemical industry resource of Succinic Acid chemosynthesis, and is environmentally friendly.

Below be the embodiment of succsinic acid actinobacillus CGMCC 1593 screenings, evaluation and fermentation production of succinic acid.But the present invention is not limited to listed several examples.

The biological material specimens preservation: succsinic acid actinobacillus (Actinobacillus succinogenes) SW0580 bacterial strain was kept at Zhong Guan-cun, BeiJing, China China Committee for Culture Collection of Microorganisms common micro-organisms center, preserving number CGMCC No1593 on January 23rd, 2006.

Embodiment

Embodiment 1

Sample from the fresh cud of ox has just been slaughtered in Wuxi City beef cattle slaughterhouse, get digest in the cud, be inoculated in and be equipped with in the triangular flask of enrichment medium that 80mL contains sodium fumarate, 37 ℃ of anaerobism are cultivated about 36-48h, and the inoculum size by 10% is carried out twice enrichment again.Getting that the enrichment culture thing dilutes with PBS (0.145mol/L sodium-chlor, 0.01mol/L sodium phosphate aqueous solution) and coat with the sodium fumarate is on the selectivity flat board of plate screening substratum of sole carbon source, cultivates 48h.Select the bigger bacterium colony of transparent circle, be seeded in the test tube that the 5mL fermention medium is housed, anaerobism is cultivated 36h.Measure supernatant liquor with the TCL method, select the bacterium colony of the similar Succinic Acid spot of 72 strains in 160 bacterium colonies altogether.

Wherein: enrichment medium (g/L): corn steep liquor 20, glucose 15, sodium fumarate 5.88, CaCl ₂0.2, MgCO ₃10, K ₂HPO ₄3.0 NaCl 1.0, (NH ₄) ₂SO ₄1.0, MgCl ₂0.2.

Plate screening substratum (g/L): sodium fumarate 25, peptone 10, yeast extract paste 5, NaCl 5, NaHCO ₃2, cysteine hydrochloride 1, agar 20.Seed culture medium (g/L): glucose 5, yeast extract paste 5, corn steep liquor 5, Na ₂HPO ₄12H ₂O 0.5, NaH ₂PO ₄2H ₂O 0.5, mixed vitamin 1ml/L, and pH 6.5.

Primary dcreening operation fermention medium (g/L): glucose 20, yeast extract paste 5, NaCl ₂1, MgCl ₂2, Na ₂HPO ₄0.5, NaH ₂PO ₄0.5, MgCO ₃10, mixed vitamin 1ml/L.The pH value all is adjusted to 6.5.

Embodiment 2

The bacterial strain that keeps is transferred in the test tube that the above-mentioned fermention medium of 5mL is housed, and 37 ℃ of anaerobism are cultivated 36h.Get the 5mL nutrient solution and be transferred in the triangular flask that the same fermention medium of 80ml is housed, and add the lime carbonate of the bacterium of going out, control pH6.5 after 37 ℃ of anaerobism are cultivated 48h, filters, and measures the content of Succinic Acid in the supernatant liquor with the HPLC method.Most bacterial strain lactic acid contents are higher, only have II-80 number (laboratory is numbered SW0580) succinic acid-producing remarkable.

The product acid situation of table 1 part test bacterial strain

Strain number	Lactic acid content g/L	Succinic Acid content g/L	Strain number	Lactic acid content g/L	Succinic Acid content g/L
						I-3	7.04	1.70	II-44	3.98	1.77
I-4	4.26	2.07	II-45	10.75	2.33
						I-6	2.95	1.15	II-46	12.97	1.50
I-14	7.65	2.01	II-51	10.28	2.48
						I-15	8.36	1.99	II-54	11.54	2.54
I-16	6.68	1.86	II-6	9.21	1.23
						I-27	7.25	2.05	II-8	12.15	2.62
I-28	7.60	1.71	II-10	10.36	2.35
						I-30	7.85	2.00	II-12	10.35	2.54
I-62	12.16	2.29	II-33	11.35	2.55
						I-83	7.91	1.97	II-56	10.56	2.28
I-85	7.04	1.81	II-59	12.46	2.10
						I-92	2.10	1.46	II-60	12.30	2.35
I-95	8.91	1.17	II-63	12.74	2.49
						I-97	9.91	2.04	II-80	0.68	10.55
II-35	11.81	2.82	01-15	7.11	1.69
						II-41	6.12	3.91	01-16	8.45	1.93

Embodiment 3

SW0580 bacterial strain to screening carries out physio-biochemical characteristics evaluations (seeing Table 2) by " uncle's Jie Shi Bacteria Identification handbook (the 8th edition) ", and the method for pressing fine works molecular biology experiment guide is extracted chromosomal DNA, with Y1 and Y2 is forward and reverse primer (Y1:ATTGAACGCTGGCGGCAGGC, Y2:CGGGCGGTGTGTACAAGGCC), with pcr amplification 16S rRNA gene, entrust the Shen, Shanghai can win bio tech ltd and carry out 16S rDNA order-checking, after obtaining this bacterial strain part 16S rRNA gene segment, on the NCBI website, retrieve the 16S rRNA gene order of relevant bacterial strain among the GenBank, and carry out homology comparison (table 3) with BLAST.Identify based on 16S rDNA sequential analysis and physio-biochemical characteristics, study in conjunction with growth and fermentation character this bacterium, with the most relatively near the strains A ctinobacillus succinogenes ATCC 55618 of (or homology is the highest), utilize Citrate trianion, H in its physio-biochemical characteristics ₂S reaction, tryptophane (indoles) have difference, therefore think the mutation of succsinic acid actinobacillus, intend called after succsinic acid actinobacillus (Actinobacillus succinogenes) SW0580, this bacterial strain has been kept at China Committee for Culture Collection of Microorganisms common micro-organisms center, and preserving number is CGMCC No.1593.

Table 2 physio-biochemical characteristics qualification result synopsis

Index		CGMCC 1593	ATCC 55618T[1]
				Gramstaining		-	-
Catalase		+	+
				Oxydase		+	+
Utilize Citrate trianion		+	-
				H 2S		+	-
Urase		-	-
				Tryptophane (indoles)		+	-
V-P		-	-
				The gel hydrolysis		-	-
The glucose aerogenesis		-	-
				Consume nitrate		+	+
Utilize acid in postpartum	Glucose	+	+
				Seminose	+	+
	N.F,USP MANNITOL	+	+
				The D-sorbyl alcohol	+	+
	Fructose	+	+
				Maltose	+	+
	The D-wood sugar	+	+
				The D-pectinose	+	+
	Sucrose	+	+
				Lactose	+	+
	Semi-lactosi	+	+
				Glycerine	-	-
	Starch	-	-

Dextrin

-

ND

The 16S rDNA sequence (1289bp) of CGMCC 1593 bacterial strains

CGGTAACGGG TGGAAAGCTT GCTTTCCATG CTGACGAGTG GCGGACGGGT GAGTAATGCT 60

TGGGGATCTG GCTTATGGAG GGGGATAACG ACGGGAAACT GTCGCTAATA CCGCGTAATG 120

TCTAAGGACT AAAGGGTGGG ATTTTCGGAC CGCCCGCCAT AAGATGAGCC CAAGTGGGAT 180

TAGGTAGTTG GTGGGGTAAA GGCCTACCAA GCCGACGATC TCTAGCTGGT CTGAGAGGAT 240

GACCAGCCAC ACTGGAACTG AGACACGGTC CAGACTCCTA CGGGAGGCAG CAGTGGGGAA 300

TATTGCGCAA TGGGGGCAAC CCTGACGCAG CCATGCCGCG TGAATGAAGA AGGCCTTCGG 360

GTTGTAAAGT TCTTTCGGTG GTGAGGAAGG CGGATAAGTT AACAGCTTAT TCGATTGACG 420

TTAGCCACAG AAGAAGCACC GGCTAACTCC GTGCCAGCAG CCGCGGTAAT ACGGAGGGTG 480

CGAGCGTTAA TCGGAATAAC TGGGCGTAAA GGGCACGCAG GCGGCTATTT AAGTGAGATG 540

TGAAATCCCC GGGCTTAACC TGGGAACTGC ATTTCAGACT GGGTAGCTAG AGTACTTTAG 600

GGAGGGGTAG AATTCCACGT GTAGCGGTGA AATGCGTAGA GATGTGGAGG AATACCGAAG 660

GCGAAGGCAG CCCCTTGGGA ACGTACTGAC GCTCATGTGC GAAAGCGTGG GGAGCAAACA 720

GGATTAGATA CCCTGGTAGF CCACGCTGTA AACGCTGTCG ATTTGGGGAT TGGGCGATAA 780

GCCTGGTGCC CGAAGCTAAC GTGATAAATC GACCGCCTGG GGAGTACGGC CGCAAGGTTA 840

AAACTCAAAT GAATTGACGG GGGCCCGCAC AAGCGGTGGA GCATGTGGTT TAATTCGATG 900

CAACGCGAAG AACCTTACCT ACTCTTGACA TCCTCAGAAT CCGGTAGAGA TATCGGAGTG 960

CCTTCGGGAA CTGAGAGACA GGTGCTGCAT GGCTGTCGTC AGCTCGTGTT GTGAAATGTT 1020

GGGTTAAGTC CCGCAACGAG CGCAACCCTT ATCCTTTGTT GCCAGCATGT AGAGATGGGA 1080

ACTCAAAGGA GACTGCCGGT GATAAACCGG AGGAAGGTGG GGATGACGTC AAGTCATCAT 1140

GGCCCTTACG AGTAGGGCTA CACACGTGCT ACAATGGCGT ATACAGAGGG AAACGAGCCC 1200

GCGAGGGGGA GTGAATCTCA GAAAGTGCGT CGTAGTCCGG ATTGGAGTCT GCAACTCGAC 1260

TCCATGAAGT CGGAATCGCT AGTAATCGC 1289

Wherein, consist of A25.7%; C21.3%; G32.6%; T20.4%; )

Table 3 16SrDNA sequence homology (or similarity) relatively

Strain name	The GenBank numbering	Sequence homology (%)
			CGMCC 1593		100
Actinobacillus capsulatus	M75062	92
			Actinobacillus genomo sp.52418-03	AY749139	94
Actinobacillus indolicus STRAIN H1271	AF268963	94
			Actinobacillus lignieresii F 127	AF247722	94
Actinobacillus minor H1275	AF268944	94
			Actinobacillus muris	AF024526	93
Actinobacillus pleuropneumoniae MCCM_00189	AF224283	93
			Actinobacillus porcitonsillarum	AF486274	94
Actinobacillus succiniciproducens ATCC55618	AF024525	99
			Actinobacillus succinogenes CCUG 43843	AY362898	99
Acidithiobacillu thiooxidans	AF359941	94
			Haemophilus haemoglobinophilus CCUG 3714	AY362907	95
Haemophilus parahaemolyticus	HPA295746	94
			Histophilus somni 2336	AF549388	93
Histophilus somni	AB176900	93
			Mannheimiasp.R19.2	AF53894	94
Mannheimia sp.BA597/9	AY465370	94
			Mannheimia sp.BJ3956.1	AY425295	94
Mannheimia succiniciproducens MBE55E	AE016827	94
			Mannheimia varigena V1835	AY425282	94
Pasteurella haemolytica PH704	PHU57072	94
			Pasteurella aerogens MCCM01550	AF224288	93
Pasteurellaceaegen sp.CCUG28030	AF024527	93
			Escherichia coli	J01695	88

Embodiment 4

CGMCC No.1593 is inoculated in the above-mentioned fermention medium that contains different glucose concn, and fermention medium consists of: saccharine material 20-100g/L, nitrogenous source 1-50g/L, yeast extract paste 5-25g/L, Na ₂HPO ₄12H ₂O1.0-5.0g/L, NaH ₂PO ₄2H ₂O 1.0-5.0g/L, NaCl 1.0-5.0g/L, MgCl ₂0.1-5.0g/L, CaCl ₂0.1-5.0g/L, sodium acetate 0.1-5.0g/L, vitamin H 1-5ml/L, mixed vitamin 1-10ml/L, medium pH 3～8; Described mixed vitamin consists of: B ₁₂5mg, B ₆100mg, folic acid 20mg, Riboflavin Tetrabutyrate 0mg, VitB1 20mg, nicotinic acid 20mg, pantothenic acid 50mg, para-amino benzoic acid 50mg, distilled water is settled to 1000ml.Control pH6.5 is being full of CO ₂Or N ₂Environment in 37 ℃ of static cultivations 2-4 days, measure the content of Succinic Acid in the fermented liquid with HPLC.

When glucose sugar concentration was 60g/L, fermenting 4 days the time, the concentration of Succinic Acid reached 25.81g/L in the fermented liquid.When glucose sugar concentration was 80g/L, fermenting 4 days the time, the concentration of Succinic Acid reached 32g/L in the fermented liquid.

Embodiment 5

60g/L lactose or sucrose or maltose are replaced glucose in the above-mentioned fermention medium, and insert cultured CGMCC No.1593 seed, use 2mol/L Na ₂CO ₃Regulate fermented liquid pH and maintain 6.5, ferment, the Succinic Acid and the heteroacid that ferment and measured in the fermented liquid in 4 days by above-mentioned condition.Result such as table 4:

Table 4CGMCC No.1593 bacterial strain is to the fermentation and acid of different sugar

	Succinic Acid content (g/L)	Acetic acid content (g/L)	Lactic acid content (g/L)	Formic acid content (g/L)
					Maltose	35.29	10.03	0.68	0.92
Sucrose	21.16	1.10	14.07	0
					Lactose	27.54	6.79	0	0
Glucose sugar	25.81	11.36	1.13	0

Embodiment 6

With cassava or corn abrasive dust, cross 40 mesh sieves, get Tapioca Starch or Semen Maydis powder 200g, add 1L water and be in harmonious proportion, add 1ml Ye Huamei (company of outstanding person's energy section, Wuxi) and stir evenly 100 ℃ of insulation 1h.Replace glucose sugar (containing reducing sugar 60g/L) in the above-mentioned fermention medium with cassava and Semen Maydis powder hydrolysis sugar, insert cultured CGMCCNo.1593, ferment, the Succinic Acid and the heteroacid that ferment and measured in the fermented liquid in 4 days by above-mentioned condition.Result such as table 5:

Table 5CGMCC 1 No 1593 bacterial strains are to the fermentation and acid of cassava and Semen Maydis powder hydrolysis sugar

	Succinic Acid content (g/L)	Acetic acid content (g/L)	Lactic acid content (g/L)	Formic acid content (g/L)
					The cassava hydrolysis sugar	29.30	8.19	0.93	3.82
The Semen Maydis powder hydrolysis sugar	25.35	6.90	1.03	3.46
					Glucose sugar	25.81	11.36	1.13	0

Embodiment 7

Press embodiment 6, with the Tapioca Starch hydrolysis sugar as the sugared source in the fermention medium, by the fermention medium that contains reducing sugar 20～150g/L preparation different concns, insert cultured CGMCC 1 No.593, ferment by above-mentioned condition, Succinic Acid in the mensuration fermented liquid and heteroacid content (because of the lactic acid content of measuring all is lower than 1g/L, so show in the table) after 4 days ferment.Result such as table 6:

Table 6CGMCC No.1593 bacterial strain is to the fermentation and acid of different concns Tapioca Starch hydrolysis sugar

Cassava liquefaction sugar (g/L)	Fermentation ends pH	The dense OD660 of bacterium	Residual sugar (g/L)	Succinic Acid content (g/L)	Acetic acid content (g/L)	Formic acid content (g/L)
							20	6.23	1.97	5.01	11.51	4.90	2.96
40	6.84	3.33	9.30	25.93	6.13	4.00
							60	6.64	3.69	9.13	29.30	8.19	3.82
80	6.60	4.36	27.03	35.08	14.26	9.90
							100	6.63	4.61	42.06	36.45	15.25	11.30
120	6.74	4.58	57.73	32.82	14.27	12.05
							140	6.21	4.54	36.29	27.65	12.35	10.29
150	6.18	4.47	40.55	28.08	12.62	10.93

Claims (4)

1. the microorganism strains of a fermentation production of succinic acid, succsinic acid actinobacillus (Actinobacillussuccinogenes) SW0580 of its minute generic Pasteurellaceae (pasteurellaceae) Actinobacillus (Actinobacillus), preserving number is CGMCC No.1593.

2. the method for a producing succinic acid by microbial fermentation is characterized in that:

Fermentation strain is CGMCC No.1593;

Fermention medium consists of: saccharine material 20-100g/L, nitrogenous source 1-50g/L, yeast extract paste 5-25g/L, Na ₂HPO ₄12H ₂O 1.0-5.0g/L, NaH ₂PO ₄2H ₂O 1.0-5.0g/L, NaCl 1.0-5.0g/L, MgCl ₂0.1-5.0g/L, CaCl ₂0.1-5.0g/L, sodium acetate 0.1-5.0g/L, vitamin H 1-5ml/L, mixed vitamin 1-10ml/L, medium pH 3～8;

Described mixed vitamin consists of: B ₁₂5mg, B ₆100mg, folic acid 20mg, Riboflavin Tetrabutyrate 0mg, VitB1 20mg, nicotinic acid 20mg, pantothenic acid 50mg, para-amino benzoic acid 50mg, distilled water is settled to 1000ml;

Fermentation culture: the inoculum size by 1%-10% inserts fermention medium with cultured seed, 30～40 ℃ of culture temperature, and fermentation is at logical CO ₂Or N ₂Anaerobic condition under, anaerobism is cultivated 1-4d;

In the fermenting process, keep the pH5.5-7.0 of fermented liquid with carbonate, ammoniacal liquor or liquid caustic soda.

3. method according to claim 2 is characterized in that saccharine material comprises glucose sugar, fructose, maltose, wood sugar, sucrose, lactose, semi-lactosi, whey, and the hydrolyzate or the syrup of cassava, corn, beet or lignocellulose.

4. method according to claim 2 is characterized in that nitrogenous source comprises soybean cake powder, corn steep liquor, urea or inorganic ammonium salt.