CN1809589A - GITR ligand and GITR ligand-related molecules and antibodies and uses thereof - Google Patents

Abstract

The present invention provides novel isolated and purified polynucleotides and polypeptides related to a novel ligand for glucocorticoidinduced TNF receptor (GITR). The invention also provides antibodies to the GITR ligand (GITRL). The present invention also is directed to novel methods for diagnosing, prognosing, monitoring the progress of, and treating disorders arising from disregulation of the immune system (e.g., autoimmune disorders, inflammatory diseases, and transplant rejection, and cancers and infectious diseases) using GITRL and/or modulators of GITRL. The present invention is further directed to novel therapeutics and therapeutic targets and to methods of screening and assessing test compounds for the intervention (treatment) and prevention of said disorders arising from disregulation of the immune system, as related to GITRL and GITR.

Description

GITR part and GITR ligand-related molecules and antibody and application thereof

The application requires the rights and interests of U.S. Provisional Application series number of submitting on May 23rd, 2,003 60/472,844 and the U.S. Provisional Application series number of submitting on February 26th, 2,004 60/547,975, and these two applications are incorporated herein by reference in full with it.

The present invention is supported to carry out by government under NIH in-house research project #Z01-AI-000224.Government enjoys certain right in the present invention.

Background of invention

Invention field

The present invention is directed to and (for example be used for diagnosis, prediction, monitoring by immune system disorder, autoimmune disease, inflammation and transplant rejection and cancer and infectious diseases) disease that causes progress and treat the novel method of described disease, described immune system disorder relates to the TNF acceptor (GITR) of glucocorticoid inducible, and the present invention is also at the relevant part (GITRL) of GITR with relate to its regulon.The invention further relates to new therapeutical agent and treatment target and relate to screening and estimation is used for interfering the method for (treatment) and prophylactic test-compound, described disease is caused by the immune system disorder that relates to GITR and GITRL.

The background context field

Usually, the T lymphocyte is responsible for cell-mediated immunity and by strengthening or suppressing other white corpuscle and play regulating effect.The notion that the T lymphocyte suppresses immunne response is well-known (referring to, for example, people such as Gershon (1970) Immunology 18:723-35).Yet the mechanism of the target antigen of these SCs and its function of control is still the theme of research.

The regulatory T cells that a group produces in thymus gland is obviously different in the expression of unique membrane antigen with effector T cell.These regulatory T cells constitute the antigenic CD4 of coexpression CD25 ⁺T cell (that is, expressing the T cell of T4 antigen) subgroup.CD25 is also referred to as interleukin 2 receptor (IL-2R) α chain.CD25 ⁺The corotation of T cell moves or is reconstituted in and relates to preventing inflammation damage and autoimmunization (referring to, Shevach (2000) Ann.Rev.Immunol.18:423-49, with and the reference quoted) in the various animal models.CD4 ⁺CD25 ⁺The T cell also relates to the inhibition of external T cytoactive and the CD4 that cultivates altogether ⁺CD25 ^-The adopting property inhibition of T cell (Shevach, the same).

The T cell that proved some id reactions before two more than ten years has been escaped maincenter immunological tolerance mechanism and has been present in periphery, is under the control of the regulatory T cells that derives from thymus gland.Nineteen ninety-five, Sakaguchi and colleague's proof are expressed IL-2R (that is microcommunity CD4 of α chain CD25), natively ⁺The T cell relates to the control (people (1995) J.Immunol.155:1151-64 such as Sakaguchi) of organ specificity autoreactive T cell.Especially, its proof is with CD4 ⁺CD25 ^-T cell transfer to immune deficiency host cell causes a series of autoimmune diseases, and described disease can be passed through CD4 ⁺CD25 ⁺The capable prevention of the corotation shift-in of T cell (people such as Sakaguchi, the same).Research has subsequently hinted CD4 ⁺CD25 ⁺Regulatory T cells suppresses at the immunne response of virus, bacterium and protozoal infections (people (2002) J.Immunol.169:3232-41 such as Aseffa; People such as Belkaid (2002) Nature 420:502-07; People such as Hisaeda (2004) Nat.Med.10:29-30; People such as Kursar (2002) J.Exp.Med.196:1585-92; People such as Lundgren (2003) Infect.Immun.71:1755-62; People such as Maloy (2003) J.Exp.Med.197:111-19).Generally speaking, these researchs provide and have removed CD4 ⁺CD25 ⁺The T cell has strengthened the evidence of immunne response.For determining these CD4 ⁺CD25 ⁺The activation of T cell and carried out many effort by the restraining effect of its generation.These cells have been represented in vivo and external all unique pedigrees of the cell that derives from thymus gland of retarding effect T cell function significantly.

Several in vitro studies show CD4 ⁺CD25 ⁺Cell is transcribed and is suppressed mitogen and antigen are made the CD4 that replys by closing IL-2 ⁺The propagation of cell (for example, Thornton and Shevach (1998) J.Exp.Med.188:287-96; People such as Takahashi (1998) Int.Immunol.10:1969-80).In vivo with CD4 ⁺T cell corotation together moves CD4 ⁺CD25 ⁺The T cell is enough to suppress that organ specificity is autoimmune induces and effector phase (people (1999) Eur.J.Immunol.29:669-77 such as Suri-Payer; People such as Suri-Payer (1998) J.Immunol.160:1212-18).CD4 ⁺CD25 ⁺Other characteristic of T cell be included under the situation that lacks external source IL-2 low responsiveness that TXi Baoshouti (TCR) is stimulated, the immunosuppression by cell-cell interaction and to induce its inhibition phenotype (yet, after it was activated, its inhibition function was not rely on antigenicity to stimulate) the demand of TCR signal conduction.Proved and only expressed CD25 (as passing through to stimulate CD4 ⁺CD25 ^-The T cell obtains) can not induce the inhibition phenotype.Known these CD4 ⁺CD25 ⁺The T cell is present in the person and goes up (Shevach (2001) J.Exp.Med.193:F1-F6).

One studies have shown that in order to produce modulability CD4 ⁺CD25 ⁺The T cell need change thymus gland and select people (2001) Nat.Immunol.2:301-06 such as () Jordan.In addition, studies have shown that in order to produce these cells of knock out mice need relate to the molecule that IL-2 is synthetic and reply; IL2 or IL2R β or B7.1 (CD80) and B7.2 (CD86) or CD28 hereditary defect mouse all have the CD4 of serious minimizing ⁺CD25 ⁺Cell causes some peripheral tissues in these mouse to produce lymphadenopathy and hyper-proliferative (people (1998) Int.Immunol.10:371-78 such as Papiernik; People such as Salomon (2000) Immunity 12:431-40; People such as Kumanogoh (2001) J.Immunol.166:353-60).

Up to date, this area does not determine to relate to CD4 yet ⁺CD25 ⁺The mechanism that the immunity system of mediation suppresses, for example antigen-specific, relate to the cell surface molecule or the shortterm effect cytokine that suppress the molecule that obtains and relate to the effector phase of inhibition; CD25 in regulating autoimmunization ⁺The target molecule of T cell is still clear far away.By using gene chip to CD4 ⁺CD25 ⁺And CD4 ⁺CD25 ^-The differential expression of the gene of T cell is checked, has now proved to have several CD25 ⁺Differential gene (people (2002) Immunity 16:311-23 such as McHugh; Also referring to patent application 10/194,754, this sentence its be incorporated by reference in this text examine).These are determined preferably at CD4 ⁺CD25 ⁺The gene of expressing in the T cell can serve as therapeutic target of interfering and the screening method that is used for autoimmune disease, inflammation and transplant rejection and cancer and infectious diseases.

It should be noted that and be defined as at CD25 ⁺One of them gene of differential expression is the TNF acceptor (GITR) (people such as McHugh, the same) of glucocorticoid inducible in the cell.GITR (cell surface transmembrane protein acceptor) is the member of Tumor Necrosis Factor Receptors (TNFR) superfamily.GITR has been proved to be composing type ground and has been present in unactivated T cell (people (2002) Nat.Immunol.3:33-41 such as Gavin; People such as McHugh, the same; People such as Shimizu (2002) Nat.Immunol.3:135-42).GITR is called the transmembrane protein of GITR part (GITRL) in conjunction with another.The agonistic antibody that has shown GITR is eliminated CD4 ⁺CD25 ⁺T cell inhibiting activity proves that GITR is in the function of regulating on these cell activity people such as (, the same) McHugh.Another research has been proved conclusively with monoclonal antibody specific stimulates GITR to eliminate CD4 ⁺CD25 ⁺Therefore the restraining effect that T is cell-mediated has been induced autoimmunization people such as (, the same) Shimizu.It is CD4 that these researchs have caused proposing GITR ⁺CD25 ⁺The mark (people (2003) J.Immunol.171:708-16 such as Uraushihara) that the T cell is more loyal; Yet independent GITR expresses can not exclusively distinguish this hypotype, because the rise of GITR also occurs in CD4 ⁺CD25 ^-Behind the T cell activation (people such as McHugh, the same; People such as Shimizu, the same).

Because GITR has been presented at CD4 ⁺CD25 ⁺The T cell is to CD4 ⁺CD25 ^-Very important in the adjusting of T cell inhibiting activity, so want very much the interactional recruit of evaluation and sign and GITR.Disclosed herein this and the interactional recruit of GITR.The regulon of these molecules also is provided in addition.

The invention summary

The invention provides the Nucleotide and the aminoacid sequence of the mouse homologue of new people GITRL.The present invention also provides the antibody at mouse GITRL.The present invention also provides and has been used for by inducing excitability GITR-GITRL combination to reverse immunosuppression and (for example to pass through antagonism GITR-GITRL combination, by using the neutralizing antibody that suppresses GITRL activity (for example, the interaction between prevention GITR and the GITRL)) recover or the inhibiting method of enhancing immunity.This reverse or recovery/enhancing immunity restraining effect various aspect the treatment of diseases that causes of immunne response of imbalance, be useful, described disease is for example autoimmune disease, inflammation and transplant rejection and cancer and infectious diseases.Method of the present invention relates to the operation of GITRL and GITR, includes but not limited to mouse GITRL and GITR and its homologue; In these homologues particularly including be people GITRL and GITR.

The invention provides the polynucleotide and the polypeptide of the new part that relates to GITR (GITRL) of isolating and purifying.The method that the present invention also provides the antibody of anti-GITRL and has been used for the treatment of, diagnoses, predicts and monitor the progress of autoimmune disease, inflammation and transplant rejection and cancer and infectious diseases.In one embodiment of the invention, during treatment disease and illness, described disclosed method and molecule can be used for controlling the result of immunne response, and described disease comprises autoimmune disease, inflammation and transplant rejection and cancer and infectious diseases.In another embodiment, disclosed polynucleotide of the present invention and polypeptide can be used for recovering or the restraining effect of enhancing immunity system, described polynucleotide and polypeptide by for example reducing GITRL expression active or by in conjunction with GITRL (but not inducing the conduction of GITR signal) thus stop or inhibition GITR and GITRL between interaction.In another embodiment, can stop or suppress interaction between GITR and the GITRL by small molecules.The adjusting (that is these embodiments) that those skilled in the art recognize these types is being the most useful in treatment autoimmune disease and some inflammation and similar or relevant disease and treating aspect the transplant rejection.In another embodiment, polynucleotide disclosed by the invention and polypeptide can be used for reversing, block or eliminate immune inhibition, expression by for example raising GITRL of described polynucleotide and polypeptide or active or induce the GITR signal to conduct by promoting to combine with GITR.In another embodiment, the interaction between GITR and the GITRL can be strengthened by small molecules or simulate.Those skilled in the art recognize that it is the most useful that being adjusted in of these types treated cancer and similar disease and infectious diseases aspect.Those skilled in the art also recognize with these new therapeuticss with set up with other therapeutics bonded may benefit.

In one embodiment, the invention provides the isolated nucleic acid molecule of the nucleotide sequence that comprises SEQ ID NO:1 or SFQ IDNO:3.In another embodiment, described nucleic acid molecule connects at least one expression control sequenc effectively.In another embodiment, provide with described nucleic acid molecule and transformed or the host cell of transfection.

In another embodiment, the invention provides the allelotrope of isolating SEQ ID NO:1 or SEQID NO:3.In another embodiment, the invention provides the isolating gene of the nucleotide sequence that comprises SEQ IDNO:3.

In another embodiment, the invention provides isolated nucleic acid molecule, described nucleic acid molecule under high stringent condition specifically with nucleotide sequence or its complementary sequence hybridization shown in SEQ ID NO:1 or the SEQ ID NO:3.

In another embodiment, the invention provides isolated nucleic acid molecule, described nucleic acid molecule encoding comprises the proteic nucleic acid molecule of aminoacid sequence of SEQ ID NO:2 or the fragment of its encoding said proteins active fragments.In another embodiment, described nucleic acid molecule or its fragment connect at least one expression control sequenc effectively.In another embodiment, provide with the described isolating nucleic acid molecule of at least one expression control sequenc or the host cell of conversion of its fragment or transfection of connecting effectively.In another embodiment, the invention provides the non-human transgenic animal, somatocyte and sexual cell comprise described isolated nucleic acid molecule or its fragment in described transgenic animal.In another embodiment, the invention provides the non-human transgenic animal, somatocyte and sexual cell comprise the DNA of the nucleotide sequence that contains SEQ ID NO:1 or SEQ ID NO:3 in described transgenic animal.

In another embodiment, the invention provides the protein isolate that comprises by the aminoacid sequence of isolating nucleic acid encoding, described isolating nucleic acid under high stringent condition specifically with nucleotide sequence or its complementary sequence hybridization shown in SEQ ID NO:1 or the SEQ ID NO:3.In another embodiment, the invention provides protein isolate or its active fragments of the aminoacid sequence that comprises SEQ ID NO:2.

In another embodiment, the invention provides the isolated nucleic acid molecule that comprises nucleotide sequence, the nucleotide sequence of described nucleotide sequence and SEQ ID NO:1 or SEQ ID NO:3 or its fragment complementation wherein cause the GITRL output that reduces in the expression of nucleic acid molecule described in the cell.In another embodiment, described nucleic acid molecule or its fragment connect at least one expression control sequenc effectively.In another embodiment, provide with the described isolating nucleic acid molecule of at least one expression control sequenc or the host cell of conversion of its fragment or transfection of connecting effectively.In another embodiment, the invention provides the non-human transgenic animal, somatocyte and sexual cell comprise described isolated nucleic acid molecule or its fragment in described transgenic animal.

In another embodiment, the invention provides with corresponding to the mRNA complementary antisense oligonucleotide that comprises SEQ ID NO:1 or SEQ ID NO:3 or its segmental nucleotide sequence, wherein said oligonucleotide suppresses the expression of GITRL.In another embodiment, the invention provides siRNA molecule, the expression of wherein said siRNA molecules in inhibiting GITRL corresponding to the nucleic acid molecule that comprises SEQ ID NO:1 or SEQ ID NO:3 or its segmental nucleotide sequence.

In another embodiment, the invention provides can be specifically in conjunction with the separation antibody that comprises the protein isolate of aminoacid sequence, and described aminoacid sequence is by encoding with the isolating nucleic acid of nucleotide sequence shown in SEQ ID NO:1 or the SEQ ID NO:3 or its complementary sequence hybridization specifically under high stringent condition.In another embodiment, in the antibody and the GITRL activity.In another embodiment, described antibody is the 10F12 that has the 5F1 of ATCC PTA-5336 or have ATCC PTA-5337.In another embodiment, described antibody comprises the Fab of 5F1 or 10F12.In another embodiment, the invention provides can specificity in conjunction with the separation antibody of the protein isolate of the aminoacid sequence that comprises SEQ ID NO:2 or its active fragments.In another embodiment, in the described antibody and the activity of GITRL.In another embodiment, described antibody is the 10F12 that has the 5F1 of ATCC PTA-5336 or have ATCC PTA-5337.In another embodiment, described antibody comprises the Fab of 5F1 or 10F12.

In another embodiment, the invention provides the method that screening can suppress or stop GITRL and the interactional test-compound of GITR, described method comprises that the sample that will comprise GITRL and GITR contacts with being subjected to the examinationization thing, and determine with respect to not with sample that described compound contacts in GITRL and the interaction of GITR, whether the interaction of GITRL and GITR reduces in the sample, thus with sample that described compound contacts in GITRL and the interactional described compound of proof that weakens of GITR be to suppress or stop GITRL and the interactional compound of GITR.In another embodiment, described being used for the treatment of through compounds identified has after diagnosing or is in experimenter's the method for autoimmune disease, inflammation or transplant rejection risk, described method comprises from described experimenter separates the T cell on one's body, handles described isolating T cell and the T cell transfer of described processing is returned described experimenter's step through compounds identified with described.In another embodiment, described being used for the treatment of through compounds identified has after diagnosing or is in experimenter's the method for autoimmune disease, inflammation or transplant rejection risk, and described method comprises to described experimenter uses described step through compounds identified.In another embodiment, the invention provides and be used for estimating through the method for compounds identified in experimenter's effect, described method is included in to described experimenter and uses the detection before of described compound from first number of experimenter's effector T cell, after using described compound for described experimenter, detect second number of effector T cell, with comparison first and second numbers, comparing with first number thus, the remarkable minimizing of effector T cell number shows that described compound treats autoimmunization in described experimenter in second number, be effective on inflammation or the transplant rejection.In another embodiment, described effector T cell is CD4 ⁺T cell or CD8 ⁺The T cell.

In another embodiment, the invention provides the method that screening can strengthen or simulate GITRL and the interactional test-compound of GITR, described method comprises that the sample that will comprise GITRL and GITR contacts with test-compound, and determine with respect to not with sample that described compound contacts in GITRL and the interaction of GITR, whether the interaction of GITRL and GITR increases in the sample, thus with sample that described compound contacts in GITRL and the interactional increase of GITR proved that described compound is to increase or simulation GITRL and the interactional compound of GITR.In another embodiment, described being used for the treatment of through compounds identified has after diagnosing or is in experimenter's the method for risk of cancer or infectious diseases, described method comprises from described experimenter separates the T cell, handles described isolating T cell and described treated T cell is gone back to described experimenter's step through compounds identified with described.In another embodiment, described being used for the treatment of through compounds identified has after diagnosing or is in experimenter's the method for cancer or infectious diseases risk, and described method comprises uses for described experimenter with described through compounds identified.In another embodiment, the invention provides the described method of estimating through the effect of compounds identified in the experimenter, described method comprises step: detected first number from described experimenter's effector T cell before using described compound to the experimenter, after using described compound to described experimenter, detection is from second number of described experimenter's effector T cell, more described first and second numbers, compare with first number thus, remarkable the increasing of the number of T cell shows that it is effective that described compound is treated on cancer or the infectious diseases in described experimenter in second number.In another embodiment, described effector T cell is CD4 ⁺T cell or CD8 ⁺The T cell.

In another embodiment, the invention provides the method that is used to diagnose experimenter's autoimmune disease, inflammation or transplant rejection, described method comprises that detection measures from the examination that is subjected to of the GITRL gene product in described experimenter's the sample, and with described be subjected to the examination amount with from the normal amount of the GITRL gene product of control sample relatively, be subjected to the examination amount to be significantly higher than described normal amount thus positive sign be provided in the diagnosis of autoimmune disease, inflammation or transplant rejection.In another embodiment, the invention provides the method that is used at experimenter's diagnosing cancer or infectious diseases, described method comprises that detection measures from the examination that is subjected to of GITRL gene product in described experimenter's the sample, and the described normal amount of examination amount and control sample GITRL gene product that is subjected to compared, be subjected to the examination amount significantly to be lower than described normal amount thus positive sign is provided in the diagnosis of cancer or infectious diseases.

In another embodiment, the invention provides the method that treatment has or be in the experimenter of autoimmune disease, inflammation or transplant rejection risk after diagnosing, described method comprises to described experimenter uses the GITR antagonist.In another embodiment, described method comprises and uses the GITR antagonist to keep among the described experimenter effector T cell to CD4 ⁺CD25 ⁺The inhibiting susceptibility (for example, to keep the significant quantity of this susceptibility) that regulatory T cells produces.In another embodiment, described GITR antagonist is selected from the anti-GITRL antibody of neutralization, and anti-GITR antibody neutralizes, the fusion rotein that comprises GITR, the fusion rotein that comprises the active fragments of GITR, antagonism small molecules, antisense GITRL nucleic acid molecule and siRNA GITRL nucleic acid molecule.In another embodiment, autoimmune disease or inflammation are selected from rheumatoid arthritis, encephalomyelitis, osteoarthritis, multiple sclerosis, autoimmunity gastritis, systemic lupus erythematous, psoriasis and other inflammatory dermatosis, type i diabetes, asthma, allergy and inflammatory bowel disease and comprise Crohn's disease and ulcerative colitis.

In another embodiment, the invention provides the method that treatment has or be in the experimenter of cancer or infectious diseases risk after diagnosing, described method comprises to the experimenter uses the GITR agonist.In another embodiment, described method comprises use described GITR agonist so that the GITR agonist provides at the costimulatory signal of effector T cell and makes it not be subject to CD4 in described experimenter in described experimenter ⁺CD25 ⁺The restraining effect that regulatory T cells produces (for example, so that the significant quantity of such signal to be provided).In another embodiment, described GITR agonist is selected from the active fragments of GITRL, GITRL, the fusion rotein that comprises GITRL, the fusion rotein that comprises the GITRL active fragments and excitability GITR antibody.

In another embodiment, the invention provides the method for inducing the cell colony propagation that contains effector T cell, described method comprises to described cell colony uses the GITR agonist.In another embodiment, described GITR agonist is selected from the active fragments of GITRL, GITRL, the fusion rotein that contains GITRL, the fusion rotein that contains the GITRL active fragments and excitability GITR antibody.In another embodiment, described effector T cell is CD4 ⁺T cell or CD8 ⁺The T cell.

In another embodiment, the invention provides the method for the propagation of the cell colony that suppresses to contain effector T cell, described method comprises to described cell colony uses the GITR antagonist.In another embodiment, described GITR antagonist is selected from the anti-GITRL antibody of neutralization, the anti-GITR antibody of neutralization, the fusion rotein that contains GITR, the fusion rotein that contains the GITR active fragments, antagonism small molecules, antisense GITRL nucleic acid molecule and siRNA GITRL nucleic acid molecule.In another embodiment, described effector T cell is CD4 ⁺T cell or CD8 ⁺The T cell.In another embodiment, described GITR antagonist is 5F1 or 10F12.

In another embodiment, the invention provides at CD4 ⁺CD25 ⁺Suppress or stop method to the inhibition of the cell colony that contains effector T cell under the situation that regulatory T cells exists, described method comprises to described cell colony uses the GITR agonist.In another embodiment, described method comprises and uses described GITR agonist so that described GITR agonist provides costimulatory signal and make it not be subject to CD4 for described effector T cell ⁺CD25 ⁺The inhibition of regulatory T cells (for example, so that the amount of sort signal effectively to be provided).In another embodiment, described GITR agonist is selected from the active fragments of GITRL, GITRL, the fusion rotein that contains GITRL, the fusion rotein that contains the GITRL active fragments and excitability GITR antibody.In another embodiment, described effector T cell is CD4 ⁺T cell or CD8 ⁺The T cell.

In another embodiment, the invention provides at CD4 ⁺CD25 ⁺Inhibition contains the method for the cell colony of effector T cell under the situation that regulatory T cells exists, and described method comprises to described cell colony uses the GITR antagonist.In another embodiment, described method comprises and uses the GITR antagonist to keep described effector T cell to by described CD4 ⁺CD25 ⁺The inhibiting susceptibility (for example, to keep the amount of this susceptibility effectively) that regulatory T cells produces.In another embodiment, described GITR antagonist is selected from the anti-GITRL antibody of neutralization, the anti-GITR antibody of neutralization, the fusion rotein that contains GITR, the fusion rotein that contains the GITR active fragments, antagonism small molecules, antisense GITRL nucleic acid molecule and siRNA GITRL nucleic acid molecule.In another embodiment, described effector T cell is CD4 ⁺T cell or CD8 ⁺The T cell.In another embodiment, described GITR antagonist is 5F1 or 10F12.

In another embodiment, the invention provides and in cell colony, suppress the method that GITRL expresses, described method comprises with isolated nucleic acid molecule handles described cell colony, described nucleic acid molecule comprises nucleotide sequence complementary nucleotide sequence or its fragment with SEQ ID NO:1 or SEQ ID NO:3, and wherein the expression at nucleic acid molecule described in the described cell causes GITRL output to reduce.In another embodiment, the invention provides and in cell colony, suppress the method that GITRL expresses, described method comprises with antisense oligonucleotide handles described cell colony, described antisense oligonucleotide with corresponding to the mRNA complementation that comprises SEQ ID NO:1 or SEQ ID NO:3 or its segmental nucleotide sequence, wherein said oligonucleotide suppresses the expression of GITRL.

In another embodiment, the invention provides and in cell colony, suppress the method that GITRL expresses, described method comprises that the siRNA with target mRNA handles described cell colony, and described mRNA is corresponding to the isolated nucleic acid molecule of the nucleotide sequence that comprises SEQ ID NO:1 or SEQ ID NO:3.In another embodiment, the invention provides and in cell colony, suppress the method that GITRL expresses, described method comprises that the siRNA with target mRNA handles described cell colony, and described mRNA is corresponding to the isolated nucleic acid molecule that comprises with the nucleotide sequence complementary nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:3.

In another embodiment, the invention provides in cell colony and to suppress the method that GITRL expresses, described method comprises that the antisense oligonucleotide of using at the nucleic acid molecule of coding GITRL handles described cell colony.In another embodiment, the invention provides and suppress the method that GITRL expresses in cell, described method comprises that the siRNA with the mRNA of target coding GITRL handles described cell colony.

In another embodiment, the invention provides the method for in cell colony, inducing GITRL to express, described method comprises by handling described cell colony with isolated nucleic acid molecule conversion or the described cell colony of transfection, described isolated nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO:I or SEQID NO:3 or the albumen that coding comprises the aminoacid sequence of SEQ ID NO:2, or transform or the described cell colony of transfection with the fragment of the active fragments of its encoding said proteins, wherein said nucleic acid molecule connects at least one expression control sequenc effectively.

In another embodiment, the invention provides in effector T cell colony that external or stripped state contacts with the GITR agonist.In another embodiment, described GITR agonist is selected from GITRL or GITRL active fragments, contains the anti-GITR antibody of the fusion rotein of GITRL, the fusion rotein that contains the GITRL active fragments, excitability small molecules and excitability.In another embodiment, described effector T cell is CD4 ⁺T cell or CD8 ⁺The T cell.

In another embodiment, the invention provides in the experimenter method of treatment cancer or infectious diseases, described method comprises to be obtained effector T cell colony, handles described colony and use described treated colony to the experimenter who suffers from cancer or infectious diseases with the GITR agonist.In another embodiment, described GITR agonist is selected from GITRL, GITRL active fragments, contains the anti-GITR antibody of the fusion rotein of GITRL, the fusion rotein that contains the GITRL active fragments, excitability small molecules and excitability.In another embodiment, described experimenter suffers from cancer and described treated colony is used as tumor vaccine.

In another embodiment, the invention provides the pharmaceutical composition that comprises GITR agonist and drug acceptable carrier.In another embodiment, described GITR agonist is selected from GITRL, GITRL active fragments, contains the anti-GITR antibody of the fusion rotein of GITRL, the fusion rotein that contains the GITRL active fragments, excitability small molecules and excitability.

In another embodiment, the invention provides the pharmaceutical composition that comprises GITR antagonist and drug acceptable carrier.In another embodiment, described GITR antagonist is selected from the anti-GITRL antibody of neutralization, the anti-GITR antibody of neutralization, the fusion rotein that contains GITR, the fusion rotein that contains the GITR active fragments, antagonism small molecules, antisense GITRL nucleic acid molecule and siRNAGITRL nucleic acid molecule.In another embodiment, described antibody comprises the Fab of 5F1 or 10F12.

In another embodiment, the invention provides and comprise GITR agonist and antigenic vaccine adjuvant, described antigen is selected from virus antigen, bacterial antigens, fungal antigen, parasite antigen, cancer antigen, tumor associated antigen and its fragment.In another embodiment, described GITR agonist is selected from the active fragments of GITRL or GITRL, the fusion rotein that contains GITRL, the fusion rotein that contains the GITRL active fragments, excitability small molecules and the anti-GITR antibody of excitability.

In another embodiment, the invention provides and comprise GITR antagonist and antigenic vaccine adjuvant, described antigen is selected from autoantigen, amylaceous peptide protein, isoantigen, transplantation antigen, anaphylactogen and its fragment.In another embodiment, described GITR antagonist is selected from the anti-GITRL antibody of neutralization, the anti-GITR antibody of neutralization, the fusion rotein that contains GITR, the fusion rotein that contains the GITR active fragments, antagonism small molecules, antisense GITRL nucleic acid molecule and siRNAGITRL nucleic acid molecule.In another embodiment, described antibody comprises the Fab of 5F1 or 10F12.

In another embodiment, the invention provides screening can in and the method for the active test-compound of GITRL, described method comprises that the sample that will contain GITRL and neutralizing antibody contacts with described compound, and determine with respect to not with sample that described compound contacts in GITRL and the interaction of described neutralizing antibody, whether the GITRL in the described sample and the interaction of described neutralizing antibody weaken, thus with sample that described compound contacts in GITRL and interactional the weakening of neutralizing antibody determined that described compound is to suppress or stop GITRL and the interactional compound of described neutralizing antibody.In another embodiment, described antibody is 5F1 or 10F12.

In another embodiment, the invention provides the method that costimulatory signal is provided to the cell colony that comprises effector T cell, described method comprises uses the GITR agonist.In another embodiment, described GITR agonist is selected from GITRL or GITRL active fragments, contains the anti-GITR antibody of the fusion rotein of GITRL, the fusion rotein that contains the GITR active fragments and excitability.In another embodiment, described effector T cell is CD4 ⁺T cell or CD8 ⁺The T cell.

The accompanying drawing summary

Fig. 1 represents that the comparison of aminoacid sequence of mouse (m) and people (h) GITRL is (based on BLOSUM62 amino acid replacement matrix; Referring to Henikoff and Henikoff (1992) Proc.Natl.Acad.Sci.USA 89:10915-19).

Fig. 2 represents about the GITRL:GITR combination CD4 ⁺CD25 ⁺The experimental result of the influence of T cell proliferation.Measure thymidine integration (cpm) as the method for estimating cell proliferation.Fig. 2 A represents that the anti-GITR antibody of excitability stimulates CD4 ⁺CD25 ⁺The propagation of T cell, but do not stimulate CD4 ⁺CD25 ^-T cell proliferation.Fig. 2 B represents to express the YB2/0 cytositimulation CD4 of GITRL ⁺CD25 ⁺The propagation of cell.

Fig. 3 A represents that the GITRL and the anti-GITR antibody of excitability (2 μ g/ml) of being expressed by YB2/0 cell (～50,000) reverse by new isolating CD4 ⁺CD25 ⁺The restraining effect that suppressor T cell (# inhibitor) produces (that is negative per-cent restraining effect).Fig. 3 B shows and to be less than 50,000 by number the GITRL-YB2/0 cell of (that is ,～3,000-25,000) can partly reverse restraining effect with the dose-dependently form.

Fig. 4 represents when using activated CD4 ⁺CD25 ⁺The T cell replaces new isolating CD4 ⁺CD25 ⁺GITRL-YB2/0 cell during the T cell (～50,000) can not reverse restraining effect; Can obtain similar result with the anti-GITR antibody of excitability.

Fig. 5 A and 5B are illustrated under the situation that anti-GITRL antibody (" anti-GITRL "=5F1 antibody) exists the GITRL inductive to new isolating CD4 ⁺CD25 ⁺The inhibiting reverse that the T cell produces can take a turn for the worse voluntarily.Fig. 5 B comprises that other demonstration control antibodies (" contrast Ig ") can not recover inhibiting experiment.

Fig. 6 represents that anti-GITRL antibody can only be at CD4 ⁺CD25 ⁺Strengthen restraining effect under the situation that the T cell exists.The propagation that Fig. 6 A is illustrated in the situation inferior gluteal lymph node cell of anti-GITRL antibody (5F1) existence is suppressed.Fig. 6 B represents when remove CD4 in lymph-node cell colony ⁺CD25 ⁺Anti-GITRL antibody deficiency suppresses active during the T cell.

Fig. 7 represents the distribution of GITRL express cell in Lymphoid tissue.Fig. 7 A: by with anti-CD4, anti-CD8 and anti-GITRL antibody staining to CD11c with magnetic bead enrichment from the spleen of BALB/c mouse ⁺Cell carries out flow cytometry.By relatively using the painted CD4 of anti-GITRL antibody (filling histogram) ⁺, CD8 ⁺And CD4 ^-CD8 ^-The fluorescence intensity of Asia-type (respectively corresponding upper, middle and lower histogram) and determine the GITRL expression with the fluorescence intensity of painted these cells of isotype control antibodies (not filling histogram).Fig. 7 B: by with anti-GITRL mAb (filling histogram) or isotype control antibodies (not filling histogram) to new isolating BALB/c CD11c ⁺Spleen DCs (top histogram) and CD11c ^LowB220 ⁺Plasmocyte DCs (bottom histogram) dyes and carries out the GITRL expression that flow cytometry determines that spleen dendritic cell (DCs) and B-1B cell carry out.Fig. 7 C (top histogram): the CD11b that will resist the GITRL antibody staining ⁺B220 ⁺B220 in-type peritonaeum (perC) B-1B cell (solid line is not filled histogram) and all splenocytes ⁺The fluorescence intensity of B cell (filling histogram) compares with the fluorescence intensity that contrasts (dotted line is not filled histogram) painted cell with isotype.Fig. 7 C (bottom histogram): (the filling histogram) and isotype antibody painted (the not filling histogram) perC scavenger cell (CD11b that represent anti-GITRL antibody staining ⁺B220 ^-Cell) fluorescence intensity relatively.Fig. 7 D: thymocyte is dyeed with GITRL or isotype contrast because of expressing CD4, CD8.To resist the painted CD4 of GITRL antibody (filling histogram) ⁺CD8 ^-(left upper quadrant), CD4 ⁺CD8 ⁺(right upper quadrant) and CD4 ^-CD8 ⁺The fluorescence intensity of fluorescence intensity of (right lower quadrant) cell and painted these cells of isotype control antibodies (not filling histogram) compares.Fig. 7 E: determine CD44 by the fluorescence intensity of painted these cells of more anti-GITRL antibody (filling histogram) and the fluorescence intensity of painted these cells of isotype control antibodies (not filling histogram) ⁺CD25 ^-(R1), CD44 ⁺CD25 ⁺(R2), CD44 ^-CD25 ⁺(R3) or CD44 ^-CD25 ^-(R4) GITRL of type thymus gland precursor expresses.Fig. 7 F: the lymphocytic nodal cell without stimulation is dyeed with anti-CD4, anti-CD8, anti-CD25 and/or anti-GITRL antibody.To CD4 ⁺CD8 ^-Cell (left upper quadrant) rather than CD4 ^-CD8 ⁺Cell (right lower quadrant) further is described with regard to the expression of the CD25 of these cells.CD4 ⁺CD8 ^-CD25 ^-(upper right histogram), CD4 ⁺CD8 ^-CD25 ⁺(lower right histogram) or CD4 ^-CD8 ⁺The GITRL of (bottom (centre) histogram)-type lymph-node cell expresses can be by relatively coming these fluorescence intensity and these fluorescence intensities with the painted cell of isotype control antibodies (not filling histogram) with the painted cell of anti-GITRL antibody (filling histogram) to determine.The result is from 5 independently experiments.

Fig. 8 represents the downward modulation of the GITRL that produced by APCs after stimulating.Fig. 8 A: using polyI:C (10 μ g/ml), LPS (0.5 μ g/ml), CpGs (ODN 1826,1 μ M), anti-CD40 and IL-4 (10 μ g/ml and 20ng/ml respectively) and anti-IgM (the anti-IgM F (ab ') of the anti-IgM μ of goat chain ₂Fragment, 1 μ g/ml) the back spleen B220 that determines purifying of processing ⁺B cell or total peritonaeum (PerC) B220 ⁺CD11b ⁺B-1 B cell is expressed at the GITRL of different time points.Showed that anti-GITRL is painted painted without (substratum) cell (solid line is not filled histogram) that stimulates and the fluorescence intensity of the painted cell of isotype control antibodies (dotted line is not filled histogram) through stimulated cells (filling histogram), anti-GITRL.Fig. 8 B: after 48 hours incubation periods, will be present in the B220 in whole splenocytes of handling with anti-CD3 mAb (0.5 μ g/ml) ⁺The GITRL expression of B cell (filling histogram) and B220 without stimulation ⁺B cell (solid line is not filled histogram) and with the painted B220 of isotype control antibodies (dotted line is not filled histogram) ⁺The GITRL of B expresses and compares.Fig. 8 C: with or cultivate without LPS (0.5 μ g/ml) back shown in time point on the CD11c of purifying ⁺The GITRL of DCs (top filling histogram) and B7.2 (that is, the CD86) expression of (below filling histogram).Fig. 8 D: the anti-cD3 mAb of solubility (0.5 μ g/ml) exist or non-existent situation under behind 48 hours incubation periods, type is CD4 ⁺Or CD8 ⁺The GITRL of total spleen cell of express cell expresses.Chart is from 2 to 4 independently experiments; Carry out all experiments with the tissue that separates from BALB/c mouse.

Fig. 9 has verified the influence that stops the interaction partners splenocyte inhibition of proliferation effect of GITR/GITRL.For Fig. 9 A and 9B, scale is represented the s.d. value.Fig. 9 A: determining at CD25 afterwards in 72 hours with the anti-CD3 of the solubility of different concns (x axle) cultivation ⁺There is or does not exist the situation inferior gluteal lymph node (LN of (be respectively total or Δ 25) in cell; 1 * 10 ⁵) and splenocyte (Sp; 0.5 * 10 ⁵) propagation (y axle).At the anti-GITRL mAb of purifying (10 μ g/ml; Filled circles) or rat IgG2 _aIsotype contrast (10 μ g/ml; Open circles) incubation cell under the situation of Cun Zaiing.The result is from three independently experiments.Fig. 9 B: 5 * 10 ⁴The APCs that removes the T cell and 5 * 10 through radiation (3000R) ⁴Under the situation of radiating (8000R) YB2/0-GITRL (open circles) or the existence of contrast YB2/0 (filled circles) cell, cultivate CD4 ⁺CD25 ^-Or CD8 ⁺The T cell.Activate culture with the anti-CD3 mAb of the solubility of different concns (x axle), and measured propagation (y axle) behind the incubation period at 72 hours.Fig. 9 C: at the CD4 that determines the anti-GITR antibody staining of purifying under the situation that the APCs that removes the T cell through radiation (3000R) exists with solubility after anti-CD3 (the 0.5 μ g/ml) activation at different time points ⁺CD25 ^-The average fluorescent strength of T cell (x axle).The result is from least two independently experiments.

Figure 10 has verified that the reverse restraining effect needs CD25 ^-The GITR of T cell expresses.Figure 10 A: by measuring ³Absorption (the cpm of H thymidine; The y axle) come to determine with through the APCs (5 * 10 of radiating from wild-type mice ⁴) and with the CD4 from the range gene knock-out mice of the anti-CD3 of solubility (0.5 μ g/ml) and anti-GITR antibody of 2 μ g/ml (filled circles) or isotype control antibodies (open circles) incubation ⁺CD25 ^-T cell (5 * 10 ⁴) culture propagation and from range gene knock-out mice [(Aa) CD4 ⁺CD25 ^-: GITR ^{+ /+}, CD4 ⁺CD25 ⁺: GITR ^{+ /+}(Ab) CD4 ⁺CD25 ^-: GITR ^{+ /+}, CD 4 ⁺CD25 ⁺: GITR ^-/-(Ac) CD4 ⁺CD25 ^-: GITR ^-/-, CD4 ⁺CD25 ⁺: GITR ^{+ /+}(Ad) CD4 ⁺CD25 ^-: GITR ^-/-, CD4 ⁺CD25 ⁺: GITR ^-/-] CD4 ⁺CD25 ⁺The different numbers of T cell (x axle).Figure 10 B: as mentioned above, under situation about existing through the rat APCs of radiation (3000R) with the mouse CD4 of different numbers ⁺CD25 ⁺T cell (x axle) and (Ba) mouse CD4 ⁺CD5 ^-T cell or (Bb) rat CD4 ⁺CD25 ^-The T cell carries out the propagation of coculture.Mixture with the antibody of Chinese People's Anti-Japanese Military and Political College mouse and mouse anti CD3 (each 0.25 μ g/ml) stimulates culture and contrasts (rat IgG with 2 μ g/ml isotypes; Open circles) or anti-GITR (DTA-1; Filled circles) antibody treatment culture.Scale represents to calculate the s.d. value that repeats the propagation of culture from three parts.Figure 10 C: described with isotype contrast (rat IgG; Left figure) or anti-GITR antibody (DTA-1; Right figure) to suppress the painted mouse CD4 of CFSE-that sub-pairing effect device ratio is cultivated altogether at 1: 8 ⁺CD25 ⁺(last figure) and rat CD4 ⁺CD25 ^-The fluorescence intensity of T cell (figure below) (x axle).By distinguishing mouse and rat T cell subsets with the dyeing of specificity anti-CD 4 antibodies.The result is from 2 to 4 independently experiments.

Figure 11 has verified that the restraining effect that overcomes by endogenous regulatory T cells mediation needs the GITR signal.Figure 11 A: with the anti-CD3 mAb of solubility (x axle) of different concns cultivate the CFSE mark from B6 (wild-type), GITR ^+/-, CD28 ^-/-And GITR ^-/-The lymphoglandula of mouse (LN) cell (5 * 10 ⁴).There is not (Aa) or exist at external source IL-2 (50U/ml) and cultivate total LN cell under the situation of (Ac).There is not (Ab) or exist to cultivate under the situation of (Ad) at external source IL-2 (50U/ml) and remove CD25 ⁺The LN cell of cell (LN Δ 25).Omit the scale of expression s.d. value for clarity.Figure 11 B: cultivated the back at 72 hours and separate from CD28 to using ^-/-, GITR ^-/-, GITR ^{+ /+}Or GITR ^+/-The CD4 of animal ⁺And CD8 ⁺The CFSE of type lymphoglandula T cell dilution carries out fluidic cell and estimates.Described result is corresponding to the anti-CD3 of solubility (in Figure 11 A) of 0.63 μ g/ml concentration.Figure 11 C: to H-2D without stimulation (dotted line is not filled histogram) ^bPositive CD4 ⁺CD25 ^-Cell carries out the flow cytometry that CD25 expresses, described H-2D ^bPositive CD4 ⁺CD25 ^-Cell is available from GITR ^-/-Mouse (solid line is not filled histogram) or available from GITR ^{+ /+}Mouse (filling histogram).Under the situation that anti-CD3 (0.5 μ g/ml) exists and at CD4 from BALB/c mouse ⁺CD25 ⁺Cell have (left histogram) or do not exist under the situation of (right histogram) use LN APCs from wild-type mice to cultivate 24 hours with the sub-pairing effect device of 1: 2 inhibition ratio after, determine available from GITR ^-/-Or GITR ^{+ /+}The CD4 of mouse ⁺CD25 ^-The CD25 of cell expresses.There is not (top histogram) yet or have the expression of determining CD25 under the situation of (below histogram) at 50U/ml rhIL-2.The above results is from three independently experiments.

Figure 12 proves that the CD28 dependency stimulates altogether to be strengthened GITR and expresses and reply.Figure 12 A: after closing hamster isotype (" aCD3 ") or the anti-CD28 of plate bonded (" aCD3+aCD28 ") and cultivate 72 hours with hardening of anti-CD3 of plate bonded and 2 μ g/ml, to the CD4 of purifying ⁺CD25 ^-Or CD8 ⁺T cell (2.5 * 10 ⁴) GITR express and to carry out flow cytometry.Figure 12 B (left histogram): with maybe need not anti-CD80/86 the mixture of (each 10 μ g/ml) antibody under situation about existing, cultivating 72 hours CD4 through radiating, the splenocyte of removing the T cell and the anti-CD3 of solubility (0.5 μ g/ml) ⁺CD25 ^-The T cell carries out anti-GITR dyeing.Figure 12 B (right histogram): with maybe need not anti-IL-2 and the CD4 of mixture under situation about existing, cultivating of IL-2R Alpha antibodies through radiating, the splenocyte of removing the T cell and the anti-CD3 of solubility (0.5 μ g/ml) ⁺CD25 ^-The T cell carries out anti-GITR dyeing.Figure 12 C: adding anti-GITR mAb (2 μ g/ml; " DTA-1 ") or isotype control antibodies (2 μ g/ml; " Rat IgG ") and anti-CD80/86 mAbs (each 10 μ g/ml; " aB7 ") exist or non-existent situation under propagation is estimated.Scale is represented the s.d. value.The result is from 2 to 3 independently experiments.

Figure 13 proves that GITRL combines on-effect T cell costimulatory signal is provided with GITR.Figure 13 A: by measuring ³The H thymidine absorbs (cpm; The y axle) under that determine to exist or the non-existent situation on the anti-CD3 pearl of every HT-2 cell one or two, separately (white scale) cultivate or with 1 * 10 ⁴Individual contrast YB2/0 cell (oblique line scale) or GITRL-express the effect GITR that YB2/0 cell (solid scale) is cultivated altogether ⁺/ TCR ⁺HT-2T cell (4 * 10 ⁴) propagation.Figure 13 B: by measuring ³The H thymidine absorbs (cpm; The y axle) determines and two anti-CD3 globules of every cell, 1 * 10 ⁴YB2/0 cell and the anti-GITRL antibody (SF1.1 of individual expression GITRL; Filled circles) or isotype control antibodies (rIgGl; Concentration (the ng/ml of increase open circles); The x axle) is total to 4 * 10 of cultivation ⁴The propagation of HT-2 cell.Figure 13 C: by measuring ³The H thymidine absorbs (cpm; The y axle) determines and two anti-CD3 globules of each cell, 1 * 10 ⁴The different anti-GITRL antibody of YB2/0 cell of individual expression GITRL: the concentration (ng/ml of the increase of 5F1.1 (filled circles), MGLT-10 (solid squares), MGTL-15 (square hollow) or polyclonal antibody (open circles) with 4; The x axle) is total to 4 * 10 of cultivation ⁴The propagation of HT-2 cell.

Figure 14 proves with anti-GITRL antibody and stops the GITR-GITRL combination, stoped the adoptive transfer of the experimental autoimmunization encephalomyelitis of PLP inductive (EAE).Estimate the EAE sickness rate of mouse.With 5 * 10 ⁶Individual spleens cell injection mouse, described splenocyte separate that personal 150 μ g PLP peptides immunity crosses from female SLJ mouse, and under three kinds of different conditions, exsomatize and stimulated again 3 days: independent 10 μ g/ml PLP (open circles), 10 μ g/ml PLP and the isotype control antibodies (CK01 of 10 μ g/ml; Filled circles) or 10 μ g/ml PLP and anti-GITRL antibody (5F1.1; Solid squares).Monitoring EAE sickness rate 52 days (x-axle) and according to 0 to 5 grade marking (y-axle).

Detailed Description Of The Invention

Because as if anti-GITR antibody produces excitability signal (described anti-GITR antibody produces the reverse of inhibitory activity), and is measurable by the engage inhibitory activity that should also suppress regulatory T cells of GITRL with GITR. Previous owing to lack suitable reagent and hindered more meeting under the physiological condition GITR/GITRL interacted and carry out detailed functional analysis. Now, identify the mouse straight homologues of GITRL, and produced specifically antagonistic antibodies in conjunction with the mouse straight homologues of GITRL (that is, not with people GITRL cross reaction).

By using this reagent, Tissue distribution and the adjusting of GITRL have been checked. In addition, by using GITR^-/-Mouse is investigated the ability of GITR/GITRL interaction adjusting T cyto-inhibition. Because CD25^-And CD25⁺The T cell is all expressed GITR, although degree varies, so checking had produced uncertain result to the research that inhibit feature suppresses in the cellular targets about the GITR combination with the anti-GITR antibody treatment of excitability coculture in the past. Now, by in co-culture experiments, using from wild type and GITR^-/-The CD4 of mouse⁺CD25 ⁺And CD4⁺CD25 ^-The combination of T cell finds that GITR is at CD4⁺CD25 ^-On the effector T cell rather than CD4⁺CD25 ⁺Combination on the suppressor T lymphocyte is that the elimination inhibitory action is necessary. At CD4⁺CD25 ⁺In the non-existent situation of T cell, GITR^-/-The propagation that the T cell produces is replied and is similar to replying of wild type animal, although at the CD4 with physiology number⁺CD25 ⁺It is suppressed fully in the situation that the T cell exists. These results hint for the first time: GITR/GITRL is in conjunction with the undetermined effector T cell opposing CD4 that makes before providing⁺CD25 ⁺The inhibiting signal of T cell. Therefore, the downward modulation that GITRL expresses behind response secondary inflammation signal can promote CD4⁺CD25 ⁺The inhibition of mediation and harmful consequence of preventing vigorous effector cell to reply to cause.

This research clearly illustrated in the interactional behind of GITR and its part GITRL mechanism, particularly about to CD4⁺CD25 ^-The impact of T cell (described cell is understood to the target of inhibitory activity traditionally). In brief, by using GITR^-/-Mouse has proved that it is to CD4 by it that anti-GITR mAb (the anti-GITR mouse antibodies of excitability) eliminates inhibiting ability⁺CD25 ^-Rather than CD4⁺CD25 ⁺The effect mediation of T cell (proposing such as former some research institutes). GITRL is expressed on APCs (antigen presenting cell) composing type ground, described GITRL downward modulation after the conduction of Toll sample receptor signal. Although GITR^-/-The CD4 of mouse⁺CD25 ^-The T cell can produce propagation and reply, but it can not be at physiology number CD4⁺CD25 ⁺Breed in the situation that the T cell exists. Therefore, GITRL provides and has been used for CD4⁺CD25 ^-T cell and other effector T cell (for example, CD8⁺The T cell) signal of interest, described signal make it resist at the very start CD4 in immune response⁺CD25 ⁺The adjusting of mediation. The downward modulation of the GITRL that inflammatory stimulus causes can increase effector T cell (for example, CD4 in for example cancer or infectious process of attacking⁺CD25 ^-The T cell) to the sensitiveness of inhibitor activity.

For this reason, the invention provides nucleotides and the amino acid sequence of the new mouse homologue of people GITRL. Identified (people (1999) the J.Biol.Chem. 274:6056-61 such as Kwon of people GITRL; The people such as Gurney (1999) Curr.Biol.9:215-18); In addition, nearest several research groups have also reported clone (people such as Kim, 2003 of murine GITR part; The people such as Tone, 2003; The people such as Yu, 2003).

In one aspect, the invention provides the nucleotide sequence of new mouse homologue of people GITRL and amino acid sequence with and active fragment and/or fusion. GITRL polynucleotides of the present invention comprise regulates the polynucleotides that GITRL expresses, and for example, can raise the expression vector that comprises the GITRL polynucleotides of GITRL expression and/or antisense and/or the RNAi GITRL polynucleotides that downward modulation GITRL expresses. Also provide these polynucleotides in cell and/or animal, to regulate the purposes that GITRL expresses. Except the GITRL polypeptide, the present invention also provides other excitability polypeptide, for example, can simulate active fragment and/or the GITRL fusion of the GITRL of GITRL (namely inducing the GITR activity in effector T cell). Contain the transformed host cell of GITRL polynucleotides and transgenic animals also within the scope of the invention.

In yet another aspect, provide specifically antibody in conjunction with described new murine GITRL polypeptide of the present invention (namely not in conjunction with people GITRL). Especially, provide the neutralizing antibody (for example, stoping GITRL in conjunction with the antibody of GITR) that suppresses the GITRL activity; These antibody allegedly can in and the activity of GITRL (that is, GITRL being lost efficacy). Neutralizing antibody of the present invention comprises mosaic type of the present invention and/or the humanized non-human antibody's version for inhuman and people's antibody of the inhibition GITRL activity of GITRL and inhibition GITRL activity. The antagonistic antibodies that can have one or more sudden changes is also included within the scope of the invention, and it can increase half life, stability or the affinity of described antibody, maybe can modify the effector functions of described antibody.

Another aspect of the present invention provides the Screening test method, at GITRL polynucleotides and polypeptide described in the described determination method (including but not limited to its people's homologue) for the identification of can in cell, organism or experimenter, regulating the compound of GITR activity. The present invention also provides the method for the effect of estimating the compound through identifying, wherein before using described compound through identifying and determine afterwards patient's T cell number. In addition, the invention provides described compounds for treating patient through evaluation or experimenter's the method used.

Except for example method of GITR activator or GITR antagonist of test-compound that screening can regulate the GITR activity is provided, the present invention also provides and has been used for for example method of the progress of autoimmune disease, inflammation and graft rejection and cancer and infectious diseases of disease that diagnosis, prediction and monitoring relate to immune system disorder.

The method of using GITRL of the present invention and correlation molecule to be used for the treatment of the disease that relates to immune system disorder is also disclosed herein, described molecule comprises excitability GITR molecule (namely, GITRL polynucleotides, GITRL polypeptide, its active fragment and/or its fusion, the little molecule of excitability and excitability GITR antibody) and Antagonism GITR molecule (that is, the GITRL inhibitory polynucleotide, in and GITR antibody, in and GITRL antibody, the little molecule of Antagonism and GITR fusion). For example, provide to be used for the treatment of the method that has after diagnosing or be in the experimenter of autoimmune disease, graft rejection and/or other inflammation risk, described method comprises for described experimenter uses the GITR antagonist, and anti-GITRL antibody for example neutralizes; Also provide treatment to have after diagnosing or be in the experimenter's of cancer or infectious diseases risk method, described method comprises uses the GITR activator, for example GITRL or its excitability fusion. Selectively, provide by use respectively the GITR activator for example for example neutralize anti-GITRL antibody or Antagonism GITR fusion of GITRL (comprising its excitability fusion) or GITR antagonist induce or suppress the method for T cell proliferation. Similarly, also provide at CD4⁺CD25 ⁺Stop or strengthen the inhibiting method of T cell in the situation that the T cell exists, described method comprises uses respectively for example GITRL (comprising its excitability fusion) or the GITR antagonist anti-GITRL antibody that for example neutralizes of GITR activator. The T cell colony of processing with GITRL polypeptide and correlation molecule (comprising its excitability fusion) belongs within the scope of the present invention, and can use to the experimenter in the method for the treatment of cancer or infectious diseases. Other methods for the treatment of is provided, comprise with the Antagonism compounds for treating that reduces the GITR activity have after diagnosing or be in autoimmune disease, inflammation or graft rejection risk the experimenter method and have after diagnosing or be in the experimenter's of cancer or infectious diseases risk method with the excitability compounds for treating of increase GITR activity. Pharmaceutical composition of the present invention is vaccine adjuvant for example, comprises GITRL polynucleotides, polypeptide and correlation molecule (comprising the anti-GITRL antibody of excitability GITRL fusion and Antagonism), also within the scope of the invention. Method of the present invention relates to GITRL and GITR, includes but not limited to mouse GITRL and GITR and its homologue; Be included in especially in these homologues is people GITRL and GITR.

GITRL polynucleotides and polypeptide

The invention provides the new separation of the new part (GITRL) that relates to GITR and polynucleotides and the polypeptide of purifying. Gene of the present invention, polynucleotides, proteins and peptides include, but are not limited to mouse GITRL and its homologue.

For example, the invention provides the polynucleotides of the purification and separation of coding murine GITRL. Preferred dna sequence dna of the present invention comprises the dna sequence dna of genome, cDNA and chemical synthesis.

The cDNA nucleotide sequence that is called this new part of coding of mouse GITRL cDNA is the listed sequence of SEQ ID NO:1. Polynucleotides of the present invention are also included within the stringent condition polynucleotides that keep the polypeptide (that is, active fragment) of the basic BA of total length mouse GITRL with the polynucleotides of SEQ ID NO:1 or its complementary sequence hybridization and/or coding. Polynucleotides of the present invention also comprise the continuous part of the listed sequence of SEQ ID NO:1 that comprises at least 21 continuous nucleotides.

The nucleotide sequence of genomic DNA that is called this new part of coding of Mouse Glucocorticoid-induced Tumor Necrosis Factor Receptor Ligand Gene group DNA is the listed nucleotide sequence of SEQ ID NO:3. Polynucleotides of the present invention are also included within the stringent condition polynucleotides that keep the polypeptide of the basic BA of total length mouse GITRL with SEQ ID NO:3 or its complementary sequence hybridization and/or coding. Polynucleotides of the present invention also comprise the continuous part of the listed sequence of SEQ ID NO:3 that comprises at least 21 continuous nucleotides.

Mouse GITRL amino acid sequence is the listed sequence of SEQ ID NO:2. Polypeptide of the present invention also comprises the continuous part of the listed amino acid sequence of SEQ ID NO:2 that comprises at least 7 continuous amino acids. Preferred polypeptide of the present invention comprises the continuous part of the listed sequence of SEQ ID NO:2 of the basic BA of any maintenance total length mouse GITRL. Except these polynucleotides in above-mentioned mouse source, polynucleotides of the present invention also comprise the polynucleotides of the coding SEQ listed amino acid sequence of ID NO:2 or its continuous part, and for no other reason than that the reason of well-known genetic code degeneration causes the polynucleotides different from above-mentioned polynucleotide sequence.

Separation polynucleotides of the present invention can be used as hybridization probe and primer, and described hybridization probe and primer are for the identification of having and the described disclosed polynucleotide sequence homogeneity of coding or similar nucleic acid with separating. Comprise PCR (PCR), Southern hybridization, in situ hybridization and Northern hybridization for the identification of the hybridizing method with isolating nucleic acid, and be well known to those skilled in the art.

Hybridization reaction can carry out under different stringent conditions. The stringency of hybridization reaction comprises the difficulty of any two nucleic acid molecules phases mutual cross. Preferably, under low stringent condition, more preferably under stringent condition and most preferably under high stringent condition, each hybridizes the polynucleotides multi-nucleotide hybrid corresponding with it. The example of stringent condition is shown in the lower tabulation 1: high stringent condition is the same with for example condition A-F at least tight condition; Stringent condition is the same with for example condition G-L at least tight condition; The same with for example condition M-R at least tight condition with low stringent condition.

Table 1

Stringent condition	The multi-nucleotide hybrid body	Hybridization length (bp)1	Hybridization temperature and buffer solution2	Wash temperature and buffer solution2
					A	DNA:DNA	＞50	65 ℃; 1 * SSC or 42 ℃; 1 * SSC, 50% formamide	65℃；0.3×SSC
B	DNA:DNA	＜50	T B *；1×SSC	T B *；1×SSC
					C	DNA:RNA	＞50	67 ℃; 1 * SSC or 45 ℃; 1 * SSC, 50% formamide	67℃；0.3×SSC
D	DNA:RNA	＜50	T D *；1×SSC	T D *；1×SSC
					E	RNA:RNA	＞50	70 ℃; 1 * SSC or 50 ℃; 1 * SSC, 50% formamide	70℃；0.3×SSC
F	RNA:RNA	＜50	T F *；1×SSC	T F *；1×SSC
					G	DNA:DNA	＞50	65 ℃; 4 * SSC or 42 ℃; 4 * SSC, 50% formamide	65℃；1×SSC
H	DNA:DNA	＜50	T H *；4×SSC	T H *；4×SSC
					I	DNA:RNA	＞50	67 ℃; 4 * SSC or 45 ℃; 4 * SSC, 50% formamide	67℃；1×SSC
J	DNA:RNA	＜50	T J *；4×SSC	T J *；4×SSC
					K	RNA:RNA	＞50	70 ℃; 4 * SSC or 50 ℃; 4 * SSC, 50% formamide	67℃；1×SSC
L	RNA:RNA	＜50	T L *；2×SSC	T L *；2×SSC
					M	DNA:DNA	＞50	50 ℃; 4 * SSC or 40 ℃; 6 * SSC, 50% formamide	50℃；2×SSC
N	DNA:DNA	＜50	T N *；6×SSC	T N *；6×SSC
					O	DNA:RNA	＞50	55 ℃; 4 * SSC or 42 ℃; 6 * SSC, 50% formamide	55℃；2×SSC
P	DNA:RNA	＜50	T P *；6×SSC	T P *；6×SSC
					Q	RNA:RNA	＞50	60 ℃; 4 * SSC or 45 ℃; 6 * SSC, 50% formamide	60℃；2×SSC
R	RNA:RNA	＜50	T R *；4×SSC	T R *；4×SSC

¹Hybridization length is the expection length in the hybridization zone of hybridization polynucleotides. When the target polynucleotide of polynucleotides and unknown nucleotide sequence was hybridized, hybridization length was assumed to the length of hybridization polynucleotides. When the polynucleotides of known array were hybridized, hybridization length can be determined by sequence and the definite optimized complementary series zone of comparing described polynucleotide.

²(1 * SSPE is 0.15M NaCl, 10mM NaH to SSPE₂PO ₄With 1.25mM EDTA, pH 7.4) alternative SSC (1 * SSC is 0.15M NaCl and 15mM natrium citricum) in hybridization and cleaning buffer solution; After finishing, hybridization carries out cleaning in 15 minutes.

T _B ^*-T _R ^*: the hybridization temperature that the length that is used for expection is less than the crossbred of 50 base-pairs should be lower than 5-10 ℃ of the melting temperature (Tm) of described crossbred, and wherein Tm determines according to following equation. Be lower than the crossbred of 18 base-pairs for length, Tm (℃)=2 (number of A+T base)+4 (number of G+C base). For the crossbred of length between 18 to 49 base-pairs, Tm (℃)=81.5+16.6 (log₁₀Na ⁺)+0.41 (%G+C)-(600/N), wherein N is the base number of crossbred, and Na⁺Be sodium ion in the hybridization buffer concentration (for 1 * SSC, Na⁺＝0.165M)。

At the people's such as Sambrook Molecular Cloning:A Laboratory Manual, Chs.9﹠11, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989), the Current Protocols in Molecular Biology that writes with people such as Ausubel, Sects.2.10﹠6.3-6.4, John Wiley﹠Sons, Inc., the example that is used for the other stringent condition of multi-nucleotide hybrid is provided in (1995), has quoted as a reference herein.

Separation polynucleotides of the present invention can be used as hybridization probe and primer, described hybridization probe and primer for the identification of with the DNA of the sequence of separating the allele variant with the described disclosed polynucleotides of coding. Allele variant is the alternative form of the described disclosed polynucleotides of natural generation, its coding and polypeptide same by the polypeptide of described disclosed polynucleotide encoding or that have remarkable similitude. Preferably, allele variant has sequence homogeneity (more preferably, at least 95% the homogeneity with described disclosed polynucleotides at least 90%; Most preferably, at least 99% homogeneity).

The polynucleotides of separation of the present invention also can be used as hybridization probe and primer, described hybridization probe and primer for the identification of with separate the DNAs with coding and sequence of the polypeptide of described disclosed homologous peptide. These homologues are to separate from the species different from the species of described disclosed polypeptide and polynucleotides, or separate from same species but have polynucleotides and polypeptide with described disclosed nucleotide sequence and the remarkable sequence similarity of polypeptide. Preferably, the polynucleotides homologue has sequence homogeneity (more preferably, at least 75% the homogeneity with described disclosed polynucleotides at least 50%; At least 90% homogeneity most preferably), wherein the homologous peptide thing has sequence homogeneity (more preferably, at least 45% homogeneity with described disclosed polypeptide at least 30%; Most preferably, at least 60% homogeneity). Preferably, the homologue of described disclosed polynucleotides and polypeptide is the homologue that separates from mammalian species.

The polynucleotides that the present invention separates also can be used as hybridization probe and primer, described hybridization probe and primer for the identification of the cell of expressing polypeptide of the present invention and tissue with and condition when expressing.

In addition, the polynucleotides of the present invention's separation can be used for changing (that is, strengthen, reduce or modify) corresponding to the expression of gene in cell or organism of polynucleotides of the present invention. These corresponding genes are the genomic dna sequences of the present invention (such as SEQ ID NO:3) that produce mRNAs through transcribing, and described mRNAs is the source of cDNA polynucleotides of the present invention (for example, SEQ ID NO:1).

For example antisense polynucleotides is (for example by using various inhibitory polynucleotides, antisense GITRL nucleic acid molecules) and in conjunction with and/or cutting transcribe ribozyme from the mRNA of gene of the present invention (referring to, for example, people (1999) the J.Cell Physiol. 181:251-57 such as Galderisi; Sioud (2001) Curr.Mol.Med.1:575-88) can in cell or organism, realize changing the expression of gene of the present invention (including but not limited to mouse GITRL and its homologue). This inhibitory polynucleotide can be used for prevention and treatment autoimmune disease, inflammation, graft rejection and similar or relevant disease.

Antisense polynucleotides of the present invention or ribozyme can be complementary or only complementary with its part with complete gene code chain of the present invention. Selectively, antisense polynucleotides or ribozyme can be complementary with the non-coding region of the coding strand of gene of the present invention. Use chemical synthesis and enzymatic coupled reaction can make up antisense polynucleotides or ribozyme by using method well known in the art. Can modify the nucleotide bond of the polynucleotides of chemical synthesis resists nuclease-mediated degraded and increases its sequence-specific to strengthen it. This generic key modify include, but not limited to thiophosphate, methyl phosphorodithioate, phosphatidyl imines, borine phosphoric acid, morpholino and peptide nucleic acid (PNA) key (people such as Galderisi, the same; Heasman (2002) Dev.Biol.243:209-14; Micklefield (2001) Curr.Med.Chem.8:1157-79). Selectively, but produce these molecules by use expression vector biology ground, polynucleotides of the present invention enter in the described expression vector with antisense (that is, opposite) direction subclone.

Inhibitory polynucleotide of the present invention also comprises with high degree of specificity and affinity (Knauert and Glazer (2001) Hum.Mol.Genet.10:2243-51) and is combined in the formation triple helical oligonucleotides (TFOs) in the duplex DNA major groove. Stop the triple-helix structure of described genetic transcription to suppress gene expression of the present invention by the control band (that is, promoter and/or enhancer sequence) with complementary TFOs target gene to form.

In one embodiment of the invention, inhibitory polynucleotide of the present invention is short intervening rna (siRNA) molecule (for example, siRNA GITRL nucleic acid molecules). These siRNA molecules are (19-25 the nucleotides preferably that causes the weak point of said target mrna sequence-specific degraded; 19 or 21 nucleotides most preferably), double stranded rna molecule. This degraded is called RNA and interferes (RNAi) (for example, Bass (2001) Nature 411:428-29). Identified in unicellular lower eukaryote at first, now RNAi has been effectively applied to mammalian cell, recently is presented at siRNA molecule with target Fas mRNA people (2003) Nature Med. 9:347-51 such as () Song but prophylaxis of acute hepatitis in the mouse of processing. In addition, reported recently that (people (2004) the Nucleic Acids Res.32 (5) such as Dorn: the siRNA blocking-up pain of e49) sending in model (pain model of agonist induction and the europathology pain model) mesotheca is replied two kinds of rats.

Can be by with two the single stranded RNA molecule annealed combination portion paired of said target mrna (one of them and) (people such as Fire together, U.S. Patent number 6,506,559) but or by using the single hairpin RNA molecule that self is folded to form needed double-stranded part people (2002) Proc.Natl.Acad.Sci.USA 99:6047-52 such as () Yu to produce siRNA molecule of the present invention. Described siRNA molecule can be by chemical synthesis (people (2001) the Nature 411:494-98 such as Elbashir) or by transcribe generation (people such as Yu, the same) in external use single stranded DNA template. Selectively, the expression vector that described siRNA molecule can comprise sense and antisense siRNA sequence by use instantaneously (people such as Yu, the same; The people such as Sui (2002) Proc. Natl.Acad.Sci.USA 99:5515-20) or stably the biology ground such as (Paddison people (2002) Proc.Natl.Acad.Sci.USA 99:1443-48) produces. The adenovirus vector of in recent years, use expressing the hairpin RNA s that will be further processed into siRNAs people (2003) Genome Res. 13:2325-32 such as () Arts proved said target mrna level in former generation people cell reduction (with effectively and the sequence-specific mode).

Can design the siRNA molecule of target polynucleotide of the present invention based on standard well known in the art (for example, people (2001) EMBO such as Elbashir J.20:6877-88).For example, the target fragment of said target mrna should begin with AA (most preferred), TA, GA or CA; The GC ratio of siRNA molecule preferably should be 45-55%; The siRNA molecule preferably should not comprise three consecutive identical Nucleotide; The siRNA molecule preferably should not comprise 7 continuous G/Cs of blended; With the target fragment preferably should be in the ORF zone of described said target mrna and preferably should be after opening beginning ATG after at least 75bp and before terminator codon 75bp at least.Based on these standards or based on other known standard (for example, people such as Reynolds (2004) NatureBiotechnol.22:326-30), those skilled in the art can design the siRNA of the present invention of target mRNA polynucleotide of the present invention.

Also can be implemented in change expression of gene of the present invention in the organism by setting up the non-human transgenic animal, polynucleotide wherein of the present invention have imported in described non-human transgenic animal's the genome.Such transgenic animal comprise the have multi-copy gene of the present invention animal of (that is transgenosis).Tissue specificity is regulated sequence can connect described transgenosis effectively to instruct polynucleotide of the present invention in specific cell or specific etap expression.Be used for by embryo operation and microinjection produce transgenic animal particularly for example the method for the animal of mouse and so on become conventional and in this area well-known (for example, people such as Bockamp, Physiol.Genomics, 11:115-32 (2002)).

Foundation by animal also can be implemented in and change expression of gene of the present invention in the organism, wherein the insertion destroyed by the exogenous polynucleotide sequence corresponding to the native gene (that is gene knockout animal) of the described animal of polynucleotide of the present invention.Can destroy the coding region of native gene, thereby produce no function albumen.Selectively, can destroy or substitute the upstream regulatory region territory of described native gene, cause changing the proteic expression that still has function with different controlling elements.The method that is used to produce the animal of gene knockout and so on comprises homologous recombination, and in this area well-known (for example, people such as Wolfer, Trends Neurosci., 25:336-40 (2002)).

Separation polynucleotide of the present invention can connect expression control sequenc effectively and/or connect into the expression vector that is used for polypeptide recombinant production of the present invention.The general method of express recombinant protein is well known in the art.Such recombinant protein can be expressed with the soluble form that is used for the treatment of the disease that is caused by immune system disorder; This class disease comprises, for example, and cancer and infectious diseases and autoimmune disease and inflammation and transplant rejection.Autoimmune disease and inflammation include, but are not limited to rheumatoid arthritis, encephalomyelitis, osteoarthritis, multiple sclerosis, autoimmunity gastritis, systemic lupus erythematous, psoriasis and other inflammatory dermatosis, type i diabetes, asthma, allergy and inflammatory bowel disease and comprise Crohn's disease and ulcerative colitis.

Expression vector as used herein, is meant the nucleic acid molecule that can transport another coupled nucleic acid.Wherein a kind of bearer type is a plasmid, and described plasmid is meant the circular double-stranded DNA ring that can connect other dna fragmentation.The carrier of another kind of type is a virus vector, and wherein other dna fragmentation can connect in the described viral genome.Some carrier can be in host cell self-replicating, described host cell has been imported into described carrier (for example, having bacteria carrier and the free Mammals carrier that bacterium is duplicated super beginning site).By importing host cell, other carrier (for example, non-free Mammals carrier) can be integrated in the genome of described host cell, thereby along with host genome is replicated together.In addition, some carrier can instruct its expression of gene that effectively connects.This class carrier is called recombinant expression vector (or being called for short expression vector) herein.Usually, the expression vector that uses in recombinant DNA technology is the plasmid form normally.In this manual, plasmid and carrier are used interchangeably, because plasmid is the most frequently used carrier format.Yet, the present invention includes the expression vector of the performance identical function of other form, for example virus vector (for example, replication defect type retrovirus, adenovirus and adeno associated virus).

In one embodiment, polynucleotide of the present invention are used to produce the GITR agonist, for example, the GITRL polypeptide, its active fragments and/or fusion polypeptide, they are also included within the scope of the invention.For example, GITRL polypeptide or its active fragments can be fused to second section for example on immunoglobulin (Ig) or its fragment (for example, its Fc binding fragment).In some embodiments, described first polypeptide comprises total length GITRL polypeptide.Selectively, described first polypeptide can comprise the GITRL polypeptide that is shorter than total length.In addition, the soluble form of GITRL can merge Fc part to immunoglobulin (Ig) by " linker " sequence.Can use other fusion rotein, for example the fusion rotein that merges with glutathione-S-transferase (GST), Lex-A, Trx (TRX) or maltose binding protein (MBP).

Fusion rotein can comprise the linker sequence that GITRL or GITRL fragment are connected with second section extraly.The use of this linker sequence is known in this area.For example, fusion rotein can comprise the peptide linker, and for example length more preferably is less than 10 amino acid whose peptide linkers greatly about 2 to 20.In one embodiment, the peptide linker can be 2 amino acid on length.

In another embodiment, fusion rotein comprises allos signal sequence (that is, not being present in by the peptide sequence in the polypeptide of GITRL nucleic acid encoding) at N-terminal.For example, can merge with GITRL polypeptide (comprising its active fragments and/or fusion rotein) from another proteic signal sequence.In some host cell (for example, mammalian host cell), can increase expression and/or the secretion of GITRL by using the allos signal sequence.

The signal peptide that can be contained in the fusion rotein is MKFLVNVALVFMVVYISYIYA (SEQID NO:11).If want, can between first polypeptide portion that comprises the GITRL part and second polypeptide portion, additionally insert one or more amino acid.Second polypeptide is solubility preferably.In some embodiments, the second polypeptide increase is connected the half life (for example, serum half life) of polypeptide.In some embodiments, second polypeptide comprises promotion fusion polypeptide and the 2nd GITRL polypeptide bonded sequence.In some embodiments, second polypeptide comprises the zone of immunoglobulin polypeptides at least.The immunoglobulin (Ig) fusion polypeptide is known in this area and is described in for example U.S. Patent number 5,516,964,5,225,538,5,428,130,5,514,582,5,714,147 and 5,455,165 that all these patents are quoted as a reference herein.

Mosaic type of the present invention or fusion rotein can be by the recombinant DNA technology productions of standard.For example, can couple together by reading frame according to will the encode dna fragmentation of different peptide sequences of routine techniques, for example use flush end or breach end to connect, the Restriction Enzyme degraded is to provide appropriate end, fill sticky end rightly, carry out alkaline phosphatase treatment to avoid undesired connection, carry out enzymatic and connect.In another embodiment, comprise that with routine techniques automatic dna synthesizer can synthesize fusion gene.Selectively, use anchor primer can carry out the pcr amplification of gene fragment, described primer produces complementary overhang between two consecutive gene fragments, with after annealing lay equal stress on new amplification produce chimeric gene sequence (referring to, for example, people such as Ausubel (Eds.) CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley﹠amp; Sons, 1992).In addition, the expression vector of many codings fusion parts (for example, the Fc zone of heavy chain immunoglobulin) can commerce be buied.The GITRL coding nucleic acid can be cloned in such expression vector so that described fusion part is connected on the immunoglobulin (Ig) by reading frame.In some embodiments, for example dimer or trimeric form exist the GITRL fusion polypeptide with oligomer.

Many clones can be used as the suitable recombinant expressed host cell of polypeptide of the present invention that is used for.Mammalian host cell line comprises, for example, COS cell, Chinese hamster ovary celI, 293T cell, A431 cell, 3T3 cell, CV-1 cell, HeLa cell, L cell, BHK21 cell, HL-60 cell, U937 cell, HaK cell, Jurkat cell and derive from vitro culture former generation tissue and former generation explant clone.

Selectively, may be at lower eukaryotes yeast or in prokaryotic organism, be recombinantly produced described polypeptide of the present invention for example.Potential suitable yeast strains is to comprise Saccharomyces cerevisiae (Saccharomyces cerevisiae), grain wine fragmentation sugar yeast (Schizosaccharomyces pombe), Crewe Vickers yeast belong (Kluyveromyces) strain system and mycocandida (Candida) strain system.Suitable potentially bacterial strain system comprises intestinal bacteria (Escherichia coli), subtilis (Bacillus subtilis) and Salmonella typhimurium (Salmonella typhimurium).If described polypeptide of the present invention is prepared in yeast or bacterium, may need by for example in place it being carried out phosphorylation or glycosylation modified functional to obtain.Chemistry that use is known or enzymatic means can be finished this covalently bound.

In bacterium, express the formation of the inclusion body can cause comprising recombinant protein.Therefore, may require the folding again of recombinant protein to produce activated or to have more active material.Several methods that are used to obtain correct folding heterologous protein from the bacterium inclusion body are known in this area.These methods are usually directed to dissolve the albumen from inclusion body, use chaotropic agent to make the complete sex change of described albumen then.When halfcystine is present in the protein one-level aminoacid sequence, need in the environment (redox system) that allows correct formation disulfide linkage, finish again folding usually.Again the Zhe Die usual way Meth.Enzymol.185:187-95.EP 0433225 and the patent application U.S. serial 08/163,877 that are described in Kohno (1990) described other suitable method.

Described polypeptide of the present invention also can be by being connected to separation polynucleotide of the present invention one or more insect expression vectors for example on the suitable control sequence in the baculovirus vector and use the insect cell expression system generation of recombinating effectively.With test kit (for example, the MaxBac ^_Kit, Invitrogen, Carlsbad, CA) form can commerce be buied material and the method that is used for baculovirus/sf9 expression system.

GITR agonist for example GITRL albumen, its active fragments and/or fusion rotein can be prepared by cultivating the transformed host cells culture under the required culture condition of the albumen of wanting in expression.Behind the proper host cell express recombinant protein, available then known purification process example gel filters and ion exchange chromatography purifying polypeptide of the present invention from substratum or cell extract.Can be from conditioned medium the purifying GITR agonist soluble form of GITRL albumen, its active fragments and/or fusion rotein for example.Can by the total membrane portions of preparation from express cell and with the nonionic washing agent for example Triton X-100 extract described film and come for example GITRL albumen of purifying film combining form of the present invention albumen.Purification process also can comprise the affinity chromatography of using known reagent in conjunction with polypeptide of the present invention.These purification process also can be used for purifying comprises natural origin from other source polypeptide of the present invention.As previously described, the GITR agonist for example GITRL albumen, its active fragments and/or fusion rotein also can be used as transgenic animal product for example the milk composition of transgenosis milk cow, goat, pig or sheep express, described transgenic animal are characterised in that somatocyte or sexual cell contain the polynucleotide sequence of the described GITR agonist of encoding.

Can be used for purifying GITR agonist for example the method for GITRL albumen, its active fragments and/or fusion rotein be known for a person skilled in the art.For example, by use albumen thickening filtration device that commerce buys for example the ultrafiltration unit of Amicon or Millipore Pellicon can concentrate GITRL albumen of the present invention.After the enrichment step, described enriched product can be added on the purifying matrix example gel filtration medium.Selectively, can use anionite-exchange resin, for example have matrix or substrate that side is hung diethylamino ethyl (DEAE) or polymine (PEI) group.Described matrix can be acrylamide, agarose, dextran, Mierocrystalline cellulose or other general type that just is applied to protein purification.Selectively, can use cation-exchange step.Suitable cationite comprises the various insoluble matrix that comprise sulfopropyl or carboxymethyl group.The sulfopropyl group is preferred (for example, S-Sepharose ^_Post).For example GITRL albumen, its active fragments and/or fusion rotein also can comprise one or more affine resin for example concanavalin A-agarose, heparin-toyopearl of passing through to purifying GITR agonist from culture supernatant ^_Or Cibacrom blue 3GA Sepharose ^_Column chromatography or by using the resin for example hydrophobic interaction chromatography of phenyl ether, butyl ether or propyl ether or the step by immunoaffinity chromatography.At last, can use a step or multistep using hydrophobic RP-HPLC medium for example to have the described GITRL albumen of RPHPLC (reversed-phase high-performance liquid chromatography) (RP-HPLC) purifying that side is hung methyl or other aliphatic group.According to known method, also can use the affinity column that comprises the anti-proteic antibody of described GITRL to carry out purifying.Some or all of aforementioned purification steps (combining with various combinations or with other currently known methods) also can be used for providing the isolating recombinant protein of basic purifying.Preferably, described isolating GITRL protein purification does not conform to other mammalian proteins substantially to it.

Selectively, for example GITRL albumen, its active fragments and/or fusion rotein also can help the form reorganization ground of purifying to express to the GITR agonist.For example, described polypeptide can with the albumen expressing fusion protein that forms of maltose binding protein (MBP), glutathione-S-transferase (GST) or Trx (TRX) for example.Be used to express with the test kit of these fusion roteins of purifying can be respectively from New England BioLabs (Beverly, MA), Pharmacia (Piscataway, NJ) and Invitrogen commerce buy.The GITR agonist for example also available little epi-position of GITRL albumen, its active fragments and/or fusion rotein carries out mark, uses then at the specific antibody of described epi-position and identifies or purifying.Preferred epi-position is can be from Eastman Kodak (New Haven, CT) the commerce FLAG epi-position of buying.

Also can produce GITR agonist for example GITRL albumen, its active fragments and/or fusion rotein by known conventional chemical synthetic method.The method that is used for this class polypeptide of chemosynthesis is known for a person skilled in the art.The polypeptide of this chemosynthesis can have and the same biologic activity of polypeptide natural, purifying, thereby can be used as biologic activity or the immunology surrogate that substitutes described natural polypeptides.

GITR agonist for example GITRL albumen, its active fragments and/or fusion rotein also comprises and (for example is different from described disclosed polypeptide on the structure, have a little the polypeptide of sequence that changes) but have molecule with the essentially identical biological characteristics of described disclosed polypeptide (for example, only changing on the nonessential amino-acid residue on the function).This quasi-molecule comprises allele variant and the specially engineered variant that contains the natural generation that changes, replaces, replaces, inserts or delete.The technology that is used for this change, replacement, replacement, insertion or deletion is known for a person skilled in the art.In some embodiments, described GITRL polypeptide portion provides with the variant GITRL polypeptide form that has sudden change on the GITRL of natural generation sequence (wild-type), and described sudden change causes the GITRL sequence to resist proteolysis (with respect to mutant nucleotide sequence not) more.

Disclosed herein be used to produce the GITR agonist for example the method for GITRL, its active fragments and/or fusion rotein can be used for producing GITR antagonist particularly soluble g ITR albumen, its active fragments and/or its fusion rotein.Those skilled in the art recognize that needed is nucleotide sequence or the aminoacid sequence of GITR in order to produce GITR antagonist for example soluble g ITR, its active fragments and/or fusion rotein, the two all is known.By using these sequences, as mentioned above, can produce GITR antagonist for example soluble g ITR, its active fragments and/or fusion rotein by using recombinant DNA technology and/or chemosynthesis.

Anti-GITRL antibody

In another embodiment, the invention provides the GITR antagonist as antibody or its Fab, described antibody or its Fab are specifically in conjunction with GITRL, preferably in conjunction with Mammals (for example, mouse) GITRL, and in and the GITR activity.

Those skilled in the art recognize that, as used herein, term " antibody " is meant and comprises at least one and two weights (H) chain variable region (being abbreviated as VH herein) and at least one albumen of two light (L) chain variable regions (being abbreviated as VL herein) preferably preferably.Described VH and VL district can be subdivided into again and be called " complementary determining region " (" CDR ") hypervariable region, and the zone of more conservative being called " framework region " (" FR ") of scattering.The category of described FRs and CDRs by explication (referring to, Kabat, E.A., Deng people (1991) Sequencesof Proteins of Immunological Interest, Fifth Edition, U.S.Department of Health and Human Services, NIH Publication No.91-3242, and Chothia, people such as C. (1987) J.Mol.Biol.196:901-917 quotes as a reference herein).Each VH and VL are made of three CDRs and four FRs, arrange from aminoterminal to carboxyl terminal in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

Described antibody can further comprise heavy chain and constant region of light chain, thereby forms heavy chain and light chain immunoglobulin chain respectively.In one embodiment, described antibody is the tetramer of two heavy chain immunoglobulins and two light chain immunoglobulins, and wherein said heavy chain immunoglobulin is connected by for example disulfide linkage with light chain immunoglobulin.Described CH comprises three structural domain: CH1, CH2 and CH3.Described constant region of light chain comprises a domain C L.The variable region of heavy chain and light chain comprises the binding domains with AI.The common mediate antibody of the constant region of antibody and the host tissue or the factor comprise the combination of first component (Clq) of various immune cells (for example, effector cell) and classical complement system.

Immunoglobulin (Ig) is meant the albumen that is made of the immunoglobulin gene encoded polypeptides basically one or more.The human immunoglobulin gene who generally acknowledges comprises κ, λ, α (IgA1 and IgA2), γ (IgG1, IgG2, IgG3, IgG4), δ, ε and μ constant region gene and countless immune globulin variable region gene.Total length immunoglobulin (Ig) " light chain " (approximately 25Dd, or 214 amino acid) is held by κ or λ constant region genes encoding by the variable region gene coding with at COOH at NH2 end (about 110 amino acid).Total length immunoglobulin (Ig) " heavy chain " (approximately 50Kd, or 466 amino acid) similarly by variable region gene (about 116 amino acid) and aforementioned constant region gene for example γ (about 330 amino acid of encoding) encode.Immunoglobulin heavy chain constant region genes encoding antibody type is isotype (for example, IgM or IgG1).As used herein, antigen-binding fragments of antibodies (or abbreviation " antibody moiety " or " fragment ") is meant one or more reservation specificity conjugated antigen (for example, fragments of the full length antibody of ability CD3).The example that is included in the binding fragment of the antibody in the term " Fab " comprises (i) Fab fragment, the unit price fragment that is made of VL, VH, CL and CH1 structural domain; (ii) F (ab ') ₂Fragment comprises two segmental divalence fragments of Fab that connected by disulfide linkage at hinge area; The (iii) Fd fragment that constitutes by VH and CH1 structural domain; The (iv) Fv fragment that constitutes by the VL and the VH structural domain of antibody single armed; (v) dAb fragment (people such as Ward, (1989) Nature 341:544-46) is made of the VH structural domain; (vi) isolating complementary determining region (CDR).In addition, although segmental two structural domains of Fv are that VL and VH are by two genes encodings that separate, but can make its synthetic linker that is prepared into single chain protein by using, can connect by using recombination method, wherein VL and VH district pairing formation monovalent molecule (is called strand Fv (scFv); Referring to, people (1988) Science 242:423-26 such as Bird for example; With people (1988) Proc.Natl.Acad.Sci.USA 85:5879-83 such as Huston).This single-chain antibody also belongs to term antibody " Fab ".By using ordinary method well known by persons skilled in the art to obtain these antibody fragments, and to screen described segmental purposes with the same way as that complete antibody is adopted.

Those skilled in the art recognize that disclosed herein being used to produce at polypeptide of the present invention for example the method for the antibody molecule of murine GITRL also can be used for producing at other albumen antibody of GITR or people GITRL for example.Therefore, the described method that is used to produce antibody molecule not only is used for disclosed polypeptide of the present invention and also is used for for example GITR or people GITRL.

Neutralizing antibody at for example anti-murine GITRL of the antibody of polypeptide of the present invention (including but not limited to mouse GITRL and its homologue) can be used for preventing or treating autoimmune disease, inflammation, transplant rejection and similar or relevant disease.Other antibody molecule is excitability GITR antibody for example, can be used for the method that is used for the treatment of cancer, infectious diseases and class Sihe relative disease of the present invention.Can produce these antibody molecules by method well known to those skilled in the art.For example, can come the production monoclonal antibody by producing hybridoma according to known method.The method of using standard then for example enzyme linked immunological absorption measurement method (ELISA) is screened the hybridoma that forms by this way identifying one or more hybridomas, and described hybridoma produces specifically and polypeptide bonded antibody of the present invention.For example, GITRL albumen of the present invention also can be used for immune animal to obtain polyclone and monoclonal antibody, and described antibody can be that GITR combine with suppressing part with acceptor with the GITRL albumen test specifically.Similarly, GITR albumen also can be used for obtaining polyclone and the monoclonal antibody with the GITR specific reaction.Peptide based immunogens can comprise cysteine residues and be connected in for example keyhole limpet hemocyanin (KLH) of haptens at C-terminal extraly.Can produce other peptide based immunogens by replacing tyrosine residues with Sulfated tyrosine residues.The method that is used for synthetic this class polypeptide is known in this area, for example, and as at Merrifield (1963) J.Amer.Chem.Soc.85:2149-54; Described in people such as Krstenansky (1987) the FEBS Lett.211:10.

Full-length polypeptide of the present invention can be used as immunogen, or alternatively, can use the antigenic peptide fragment of described polypeptide.The antigenic peptide of polypeptide of the present invention comprises at least 7 continuous amino acid residues, and comprises epi-position so that the antibody of the anti-described peptide that produces and described polypeptide form the specific immunity mixture.Preferably, described antigenic peptide comprises at least 10 amino-acid residues, more preferably comprises at least 15 amino-acid residues, more preferably at least 20 amino-acid residues and at least 30 amino-acid residues most preferably.

Can produce monoclonal antibody by the method known to the skilled in other recombinant DNA technology field.Alternative method as preparation monoclonal antibody secretor type hybridoma, by (for example with polypeptide of the present invention, GITRL) or with GITR screening reorganization (for example make up the immunoglobulin (Ig) library, the antibody phage display libraries) thus isolate respectively immunoglobulin library member in conjunction with polypeptide of the present invention or GITR, thereby identify and the monoclonal antibody of separating polypeptide of the present invention.Be used to produce and screen the technology of phage display library and commercially can buy test kit and know for a person skilled in the art.In addition, can find in the literature and be particularly suitable for producing and screening the method for antibody phage display libraries and the example of reagent.For example." combinatorial antibody displaying " method has developed and has been used for identifying with separating to have the specific fragment of specific antigen and can be used for (the description of showing about combinatorial antibody of manufacture order clonal antibody, referring to, people (1989) Proc.Natl.Acad.Sci.USA 86:5728 such as Sastry for example; People such as Huse (1989) Science 246:1275; People such as Orlandi 1989 Proc.Natl.Acad.Sci.USA86:3833)).After with above-mentioned immunogen immune animal, clone the antibody library of resulting Blymphocyte repertoire.It is normally known that mixture by using the oligomer primer and PCR obtain the method for dna sequence dna of variable region of various immunoglobulin molecules colony.For example, can be used for from the heavy chain of many murine antibody people (1991) Biotechniques 11:152-56 such as () Larrick and the pcr amplification of variable region of light chain corresponding to the mixing Oligonucleolide primers of 5 ' leading (signal peptide) sequence and/or framework 1 (FR1) sequence and at the primer of conservative 3 ' constant region.Similarly strategy also can be used for heavy chain and the variable region of light chain of amplification from people's antibody people (1991) Methods:Companion to Methods in Enzymology 2:106-10 such as () Larrick.

By producing polyclonal serum and antibody with the suitable experimenter of polypeptide immune of the present invention.For example use the ELISA of fixed labelled protein in for some time, can monitor antibody titers among the described immune experimenter by standard technique.If want, can from experimenter or substratum, separate anti-polypeptide of the present invention antibody molecule and by the technology known for example the albumin A chromatography advance the described antibody of a purifying to obtain the IgG part.

Can produce the antibody fragment of anti-polypeptide of the present invention by method cutting antibody well known in the art.For example, by with enzyme for example pepsin antibody can produce Fab with immunologic competence and F (ab ') ₂Fragment.

In addition, recombinant DNA technology that can be by using standard and/or reorganization combination immunoglobulin (Ig) library produce chimeric, the humanization and the single-chain antibody of the anti-polypeptide of the present invention that comprise people and inhuman part.Also can produce humanized antibody by using transgenic mice, described transgenic mice can not be expressed endogenous heavy chain immunoglobulin and light chain gene but can expressing human heavy chain and light chain gene.For example, the human monoclonal antibodies of anti-GITRL (mAbs) can carry described human immunoglobulin gene but not the transgenic mice generation of murine immunoglobulin gene by use.Then can be used for producing the hybridoma of secretion people mAbs from these splenocytes with the transgenic mice of purpose antigen immune, described people mAbs to from people's albumen (referring to, for example, people such as Wood, WO 91/00906; People such as Kucherlapati, WO91/10741; People WO 92/03918 such as Lonberg; People such as Kay, WO 92/03917; People such as Lonberg (1994) Nature 368:856-59; People such as Green (1994) Nat.Genet.7:13-21; People such as Morrison (1994) Proc.Natl.Acad.Sci.USA 81:6851-55; Bruggeman (1993) YearImmunol 7:33-40; People such as Tuaillon (1993) Proc.Natl.Acad.Sci.USA 90:3720-24; People such as Bruggeman (1991) Eur.J.Immunol.21:1323-26) epi-position has specificity avidity.

Can produce the chimeric antibody that comprises the gomphosis immunoglobulin chain by recombinant DNA technology known in the art.For example, with the gene of the Fc constant region of Restriction Enzyme degraded coding murine (or other species) monoclonal antibody molecule to remove the zone of coding Muridae Fc, and with the gene of coding people Fc constant region be equal to part substitute (referring to, people such as Robinson, International Patent Publication No. PCT/US86/02269; People such as Akira, european patent application 184,187; Taniguchi, european patent application 171,496; People such as Morrison, european patent application 173,494; People such as Neuberger, WO 86/01533; People such as Cabilly, U.S. Patent number 4,816,567; People such as Cabilly, european patent application 125,023; People such as Better (1988) Science 240:1041-43; People such as Liu (1987) Proc.Natl.Acad.Sci.USA 84:3439-43; People such as Liu (1987) J.Immunol.139:3521-26; People such as Sun (1987) Proc.Natl.Acad.Sci.USA 84:214-18; People such as Nishimura (1987) Cancer Res.47:999-1005; People such as Wood (1985) Nature 314:446-49; With people (1988) J.Natl.CancerInst.80:1553-59 such as Shaw).

But by methods known in the art humanized antibody or immunoglobulin chain.Do not participate in the sequence of antigen bonded Fv Variable Area directly and can produce humanized antibody by using, comprise the Humanized immunoglobulin chain from the sequence replacing that is equal to of people Fv variable region.By Morrison (1985) Science 229:1202-07; People such as Oi (1986) BioTechniques 4:214; People such as Queen, U.S. Patent number 5,585,089; 5,693,761; 5,693,762 are provided for producing the general method of humanized antibody, and the content of quoting all these documents herein as a reference.These methods comprise separation, operation and express nucleotide sequence, and described nucleotide coding is all or part of from the IgF v variable region of at least one heavy chain or light chain.The source of these nucleotide sequences is known for a person skilled in the art, for example, can obtain from the hybridoma that produces the antibody that resists predetermined target.The described humanized antibody of coding or its segmental recombinant DNA can be cloned in the suitable expression vector then.

Transplant or CDR replaces and can produce antibody molecule or immunoglobulin (Ig) humanized or that CDR transplants by CDR, wherein one of immunoglobulin chain, two or all CDRs can be substituted.Referring to, for example, U.S. Patent number 5,225,539; People such as Jones (1986) Nature 321:552-25; People such as Verhoeyan (1988) Science 239:1534; People such as Beidler (1988) J:Immunol.141:4053-60; Winter, U.S. Patent number 5,225,539, the content of quoting all these documents herein is as a reference.Winter has described CDR implantation method (the UK Patent Application GB2188638A that can be used for preparing humanized antibody of the present invention; Winter, U.S.Pat.No.5,225,539), quote it herein in full as a reference.The CDRs of people's antibody that all are specific can replace with the part of inhuman at least CDRs, or has only some described CDRs to replace with inhuman CDRs.Only need to replace humanized antibody and combine required CDRs with predetermined antigens.

For example mono-clonal, mosaic type and the humanized antibody modified of constant region be also within the scope of the invention for other parts by for example deleting, add or replace described antibody.For example, can modify by following antagonist: (i) by the deletion constant region; The (ii) constant region of half life, stability or the avidity by for example increasing antibody with other constant region or replace constant region from the constant region of other species or antibody type; Or (iii) by modify on one or more constant regions amino acid with the number of Change Example such as glycosylation position, effector cell's function, Fc acceptor (FcR) in conjunction with, complementary fixing (complement fixation) etc.

The method that is used to change antibody constant region is known in this area.Have that the function of change for example changes at the antibody of the avidity of effector part (for example FcR on the cell or the C1 component in the complement) can by at least one amino-acid residue generation in the constant region part that replaces antibody with different residues (referring to, for example, EP 388,151 A1, U.S. Patent number 5,624,821 and U.S. Patent number 5,648,260, quote it herein in full as a reference).Change to the similar type of mouse (or other species) immunoglobulin (Ig) can be used for reducing or eliminating these functions.It is known that this class changes in this area.

For example, by being used in that residue that its side chain has proper function replaces specific residue or by introducing charged functional groups for example L-glutamic acid or aspartic acid, or the aromatic series non-polar residue for example phenylalanine, tyrosine, tryptophane or L-Ala (referring to, for example, the U.S. 5,624,821) (for example may change antibody, IgG, for example human IgG) the Fc zone at FcR (for example, Fc γ R1) or C1q bonded avidity.

Anti-GITRL antibody of the present invention is used in supernatant liquor, cell lysate or cell surface separation, purifying and/or detects the GITRL polypeptide.Disclosed antibody can be used for that monitoring GITRL protein level (as the part of clinical trial process) or be used for comprises the sub-target of therapeutic regulation the antigenic cell of described GITRL antibody clinically and organizes in diagnosis among the present invention.For example, can with therapeutical agent for example small molecules or other therapeutical agent of the present invention connect described GITRL antibody with the therapeutical agent target to cell of expressing GITRL and tissue.Also can be used for treating the illness autoimmune disease for example that relates to immune system disorder in conjunction with the proteic neutralization of GITRL or nonneutralizing antibody (preferred monoclonal antibody).These neutralizing monoclonal antibodies can stop GITRL in conjunction with GITR.The present invention further provides the composition that comprises specifically with the antibody of GITRL reaction.Similarly, anti-GITR antibody can be used for separating, purifying and/or detect GITR, in diagnosis monitoring GITR level or clinically with the sub-target of therapeutic regulation to the cell or tissue that comprises GITR.Also can be used for treating illness for example cancer or the infectious diseases that relates to immune system disorder at the agonistic antibody (preferably monoclonal antibody) of GITR.The activity that these agonistic antibodies may can be induced GITR.Therefore the present invention further provides the composition that comprises anti-GITR antibody.

The GITRL screening assay

Polynucleotide of the present invention and polypeptide can be used for the screening assay method, thereby described method is used for identifying pharmaceutical agent or can regulates the lead compound that the GITRL activity is regulated the active reagent of GITR at cell or organism, thereby described reagent becomes the potential regulatory factor of immunne response.For example, with a plurality of test-compounds (biological reagent or organic molecule) one of the sample that comprises GITRL (natural or reorganization) can be contacted, in the sample that each is treated in the activity of GITRL and the untreated sample or with sample that different test-compounds contact in the GITRL specific activity.These will determine relatively whether any one test-compound causes: the expression level or the activity that 1) reduce GITRL significantly, thereby the inhibitor of expression GITRL (for example, can recover or the inhibiting compound of booster immunization), or 2) significantly increase expression level or the activity of GITRL, thereby the activator of expression GITRL (for example, reversing the compound of immunosuppressive action).In one embodiment, by using for example BIACORE of high flux screening assay method ^_(Biacore International AB, Uppsala, Sweden), BRET (transfer of noclilucence resonance energy) and FRET (FRET (fluorescence resonance energy transfer)) assay method and ELISA and carry out the evaluation of test-compound based on the assay method of cell, described test-compound can be regulated the GITRL activity.

Small molecules

In the organism (or experimenter) that suffers (or being in risk) autoimmune disease, inflammation or transplant rejection or in the cell from the organism that relates to this disease, also can obtain the GITR activity that reduces by the active small molecules (normally organic molecule) that uses antagonism promptly to suppress GITR.Can identify that by above-mentioned screening method new antagonism small molecules and described small molecules can be used in the following methods of treatment of the present invention.On the contrary, in suffering the organism (or experimenter) of (or being in risk) cancer or infectious diseases or in the cell from the biology body (or experimenter) that relates to this class disease, also can promote promptly to strengthen the activity that the active small molecules of GITR (being generally organic molecule) realizes increasing GITR by using.Can identify that new excitability small molecules and described small molecules can be used in the method for following treatment cancer of the present invention and/or infectious diseases by above-mentioned screening method.

The amynologic mechanism that the method for progress that is used for diagnosing, predict and monitor autoimmune disease and cancer is particularly studied on the murine model at animal model as everyone knows in this area can with often be transferred to human immune system.Similarly, although embodiment disclosed herein has illustrated that GITR is at CD4 in animal model ⁺CD25 ⁺Effect in the immunosuppressive action that regulatory cell produces, but described disclosed be used for diagnosing, predict and monitor relate to immune system disorder disease for example the method for autoimmune disease, inflammation and transplant rejection and cancer and infectious diseases can be used in particular in people's diagnosis, predict and monitor this class disease.In putting into practice described disclosed method, those skilled in the art recognize that the people's homologue of GITR and GITRL and people GITR agonist and antagonist are used in the philtrum diagnosis, predict and monitor in the method for the present invention of this class disease.

The invention provides method, described method is used for by detecting the active rise of GITR for example is subjected to autoimmune disease among formula person's (for example, directly or indirectly relating to increase GITRL level) by rise (including but not limited to use such method people experimenter) diagnosis, prediction and the monitoring that detects GITRL progress.Those skilled in the art recognize that also and these methods can be applied to inflammation and transplant rejection.Can carry out these methods by using wrapped diagnostic kit, described test kit comprises at least one and comes self-contained GITRL polynucleotide or its fragment, GITRL polypeptide or its part (comprising its fusion rotein) or at the composition of the group of the regulon of the antibody of GITRL or derivatives thereof or GITRL polypeptide and/or polypeptide disclosed herein, described composition can for example be used for clinically routinely.In addition, those skilled in the art recognize that the rise that also can for example calculate the number detection GITRL of immunocyte by round-about way.

" diagnosis " or " diagnosis " is meant the existence of identifying pathological condition or do not exist.Diagnostic method comprises by (for example determine the GITRL gene product in from the biological sample of experimenter's (people or non-human mammal), mRNA, cDNA or polypeptide, comprise its fragment) the examination amount that is subjected to detect the rise of GITRL, compare be subjected to examination amount and normal amount or scope (that is, from known amount or the scope of not suffering from the individuality of autoimmune disease) described GITRL gene product.Although specific diagnostic method may not provide definite diagnosis of autoimmune disease, if described method provides the positive sign of assisted diagnosis, it is just enough.

The present invention also provides by detecting the active rise of GITR for example by transferring to diagnose the method for this class autoimmune disease on the mensuration GITRL." prediction " or " prediction " is meant possible development and/or the severity of prediction pathological condition.Forecasting Methodology is included in from the examination that is subjected to of determining the GITRL gene product in experimenter's the biological sample and measures, compare be subjected to examination amount and premeasuring or the scope amount or the scope of individuality (that is, from) with different autoimmune disease severities with described GITRL gene product.Some prediction of the various amounts of GITRL gene product and autoimmune disease coincide in given the test agent.The detection of GITRL gene product amount provides the prediction to the experimenter on specific prediction level.

By detecting the active rise of GITR for example by detecting the rise of GITRL, the present invention also provides and has been used to monitor the progress of this class autoimmune disease or the method for process.Monitoring method is included in the examination that is subjected to of determining the GITRL gene product in the biological sample and measures, and described biological sample is taken from the experimenter on first and second times, and more described amount.The variation of autoimmune disease process is represented in variation on GITRL gene product amount between first and second times, and the minimizing of amount represents that autoimmune disease alleviates, and the increase of amount represents that autoimmune disease increases the weight of.This monitoring measuring method also is used for estimating the validity of intervening in patient's particular treatment of accepting treating autoimmune diseases.

In various biological samples, comprise body fluid (for example, whole blood, blood plasma and urine), cell (for example, whole cell, cell part and cell extract) and tissue, can detect the increase that GITRL expresses in the aforesaid method.Biological sample also comprises tissue slice, for example is used for histology purpose biopsy and frozen section.Preferred biological sample comprises blood, blood plasma, lymph, biopsy, urine, CSF (celiolymph), synovia (synovial) and BAL (bronchoalveolar lavage fluid).The analysis that will be appreciated that biological sample not necessarily needs to take out cell or tissue on one's body from the experimenter.For example, the reagent in conjunction with the GITRL gene product (for example, antibody, nucleic acid) of appropriate flags can be used and used imaging technique (for example, CAT, the NMR (MRI) and PET) observation (when the time) of standard in conjunction with target to the experimenter.

In diagnosis of the present invention and prediction are measured, the GITRL gene product is detected and quantitatively measured by examination with generation.Contrasted by examination amount and normal amount or scope.In the diagnosis of autoimmune disease, the amount that is significantly higher than normal amount or scope is positive disease million.The method of specific detection and quantitative GITRL product is described below.

Can determine the normal amount or the baseline values of the GITRL gene product of any specific sample type and colony.Usually, determine baseline (normally) level of GITRL albumen or mRNA by the amount of measuring GITRL albumen or mRNA in from normal (that is health) experimenter's biological sample.Selectively, can take from experimenter's healthy cell or the amount in the tissue is determined the normal value of GITRL gene product, the subject cell of wherein catch an illness (maybe may catch an illness) or organize and also take from identical described experimenter by measurement.Can on each cell, each total protein or each volume unit, determine or represent the amount (normal amount or measured by examination) of GITRL gene product.For determining the cell concentration of sample, can measure level or other level of the gene product of constitutive expression in the cell of described type with the gene product of known level expression, described cell type is the cell type that biological sample therefrom obtains.

Will be appreciated that measuring method of the present invention not necessarily needs to measure the absolute value of GITRL gene product, because relative value is enough to satisfy the application of many these methods.Also to recognize except the quantity or abundance of GITRL gene product, by identifying unusual GITRL gene product or variant or its expression pattern (for example, the polypeptide of the transcript of sudden change, brachymemma) with normal gene product and expression pattern contrast.

Diagnosis of the present invention, prediction and monitoring assay method relate to detection and quantitative GITRL gene product in biological sample.The GITRL gene product comprises GITRL mRNA and GITRL polypeptide, and by using method well known to those skilled in the art can measure the two.

For example, by using for example Northern hybridization of assay method, in situ hybridization, Points And lines blot hybridization and oligonucleotide arrays can directly detect and quantitative GITRL mRNA product based on hybridization.Assay method based on hybridization is meant the assay method that dna probe nucleic acid and target nucleic acid are hybridized.In some form, described target, probe or both are fixed.The described nucleic acid that is fixed can be DNA, RNA or other oligonucleotide or polynucleotide, and can comprise Nucleotide, nucleotide analog or main chain natural or that non-natural takes place.The method that selection is used for nucleic acid probe sequence of the present invention is based on the nucleotide sequence of GITRL and well-known at this neighborhood.

Selectively, detect and quantitatively before the GITRL mRNA that can increase.This based on amplification to be determined at this area well-known, it comprises polymerase chain reaction (PCR), reverse transcription PCR (RT-PCR), PCR enzyme-linked immunosorbent assay (PCR-ELISA) and ligase chain reaction (LCR) (LCR).Based on the nucleotide sequence of GITRL, those skilled in the art can easily design and produce the primer of the GITRL gene product (for example, mRNA or cDNA) that is used to produce and detect amplification and probe and need not too much experiment.By the example gel electrophoresis, with probe nucleic acid hybridization, order-checking, fluoroscopic examination, but phosphorescence is luminous or the GITRL gene product of radiated signal or the amplification of any known method direct analysis.In addition, the method that is used to increase the signal that the amplification by target nucleic acid sequence produces is known to those skilled in the art.Those skilled in the art recognize that no matter use which amplification method,, can use a large amount of methods known in the art (for example, quantitative PCR) if want quantitative GITRL gene product.

Use above-mentioned anti-GITRL antibody can detect GITRL polypeptide (or its fragment) by using the various immunologic assays of knowing.Immunologic assay is meant and uses the assay method of specificity in conjunction with the antibody of GITRL polypeptide (or its fragment) (for example, polyclonal, monoclonal, chimeric, humanized, scFv and its fragment).The known immunoassay of this present invention's of being suitable for practice comprises ELISA, radioimmunoassay (RIA), immunoprecipitation, immunofluorescence technique, fluorescence-activated cell sorting method (FACS) and Western blotting.But the GITRL polypeptide also GITR of applying marking detects.

Those skilled in the art understand aforesaid method and can be used for autoimmune disease and other illness (for example inflammation), include but not limited to rheumatoid arthritis, osteoarthritis, multiple sclerosis, autoimmunization gastritis, systemic lupus erythematous, psoriasis and other inflammatory dermatosis, type i diabetes, asthma, allergy, and inflammatory bowel disease, comprise Crohn disease and ulcerative colitis.

Those skilled in the art also recognize, by detecting the activity downward modulation of GITR, for example downward modulation (including but not limited in people experimenter, use these methods) by detecting GITRL, aforesaid method or its change the progress that also is used in diagnosis among experimenter's (for example, relating to reduction GITRL level directly or indirectly), predicts and monitor various cancers and infectious diseases.

GITRL and the associated molecule purposes in treatment

The applicant believes that it is that first is recognized and by GITRL or other GITR agonist GITR is combined in that on-effect T cell provides costimulatory signal on the effector T cell, and wherein sort signal is not subject to by CD4 described effector T cell ⁺CD25 ⁺The inhibiting influence that regulatory T cells produces and increased multiplication capacity when effector T cell is replied anti-CD3 or other activation signal.Although use the murine model to disclose described mechanism, the amynologic mechanism that this area is studied in the murine model as everyone knows can with often be transferred in the human immune system.Equally, the illness that disclosed use GITRL and associated molecule (that is, GITR agonist or GITR antagonist) treatment the relates to immune system disorder for example method of autoimmune disease, inflammation and transplant rejection and cancer and infectious diseases can be used in particular for this class illness of treatment in the people.In putting into practice described disclosed method, those skilled in the art recognize that the people's homologue of GITR and GITRL and people GITR agonist and antagonist can be used for method of the present invention, described method uses GITRL and GITRL associated protein (that is, GITR agonist and antagonist) to treat autoimmune disease, inflammation and transplant rejection and cancer and infectious diseases in the people.

GITRL associated molecule disclosed herein, be GITR agonist and antagonist (comprising the GITRL polynucleotide of use aforesaid method evaluation and/or the regulon of polypeptide active), can be in external or stripped use, or be incorporated in the pharmaceutical composition and use with treatment to individuality in vivo, for example, by (for example using the GITR antagonist, the GITRL inhibitory polynucleotide, the antagonism small molecules, the anti-GITR antibody and/or the anti-GITRL antibody that neutralizes neutralize) the treatment autoimmune disease, or for example by using GITR agonist (for example, GITRL polynucleotide, GITRL polypeptide or its fusion rotein, the anti-GITR antibody of excitability small molecules and/or excitability) treatment cancer.This GITRL and/or associated molecule (comprising regulon) include, but are not limited to mouse GITRL and its homologue (with the antibody at this quasi-molecule), and these homologues include, but are not limited to people GITRL.Several considerations are used to determine whether that the medicine genome method of using GITRL and/or GITRL associated molecule knows this field technique personnel, and it comprises dependency, candidate gene approach and the allelic expression of genome range.Prepare the compatible pharmaceutical composition of wanting with pharmaceutical composition of the present invention of the present invention (for example, oral compositions generally includes inert diluent or edible carrier) of route of administration.The indefiniteness example of other route of administration comprises parenteral (for example, intravenously), intracutaneous, subcutaneous, per os (for example, sucking), through skin (part), through mucous membrane and rectal administration.The pharmaceutical composition compatible with respectively wanting approach is well known in the art.

When making up with drug acceptable carrier, GITR agonist or antagonist useful as drug composition.Except GITR agonist or antagonist and carrier, this composition also can comprise various thinners, weighting agent, salt, damping fluid, stablizer, solubilizing agent and other material well known in the art.Term " medicine can be accepted " is meant the nontoxicity material that does not influence the biologic activity of activeconstituents efficient.The feature of carrier depends on route of administration.

Pharmaceutical composition of the present invention also can comprise cytokine, lymphokine or other Hemopoietic factor for example M-CSF, GM-CSF, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-14, IL-15, G-CSF, STEM CELL FACTOR and erythropoietin.As below in greater detail, described pharmaceutical composition also can comprise anti-cytokine antibodies.Described pharmaceutical composition can comprise thrombus dissolving or the anti-hemolysis bolt factor for example plasminogen activators and Factor IX.As described in more detail below, described pharmaceutical composition can further comprise other anti-inflammatory reagent.The factor that these are extra and/or reagent can be used in the pharmaceutical composition producing synergism (synergy) with GITR agonist or antagonist, or the side effect that GITR agonist or antagonist cause is dropped to minimum.On the contrary, GITR agonist or antagonist can be used for dropping to minimum with the side effect with cytokine, lymphokine, other Hemopoietic factor, thrombus dissolving or the anti-hemolysis bolt factor or anti-inflammatory reagent in the preparation of the specific cells factor, lymphokine, other Hemopoietic factor, thrombus dissolving or the anti-hemolysis bolt factor or anti-inflammatory reagent.

Pharmaceutical composition of the present invention can liposome form exist, in described liposome, except other medicines can be accepted the carrier, GITR agonist or antagonist combine with the lipid that amphiphilic reagent for example exists with aggregated forms such as micelle, insoluble unimolecular layer, liquid crystal or multilayer form in the aqueous solution.The suitable lipid that is used for Liposomal formulation includes, but not limited to direactive glyceride, two glyceryl ester, sulfatide, lysolecithin, phosphatide, Saponin/TSM, bile acide etc.The preparation of these Liposomal formulations within those skilled in the art's level, for example, as in U.S. Patent number 4,235,871; U.S. Patent number 4,501,728; U.S. Patent number 4,837,028 and U.S. Patent number 4,737,323 disclosed, all documents are incorporated herein by reference.

As used herein, term " treatment significant quantity " is meant the total amount of each activeconstituents of the pharmaceutical composition that is enough to show significant patient's benefit or method, and described significant patient's benefit is symptom, healing that for example alleviates these illnesss or the healing speed that increases these illnesss.When using the single-activity composition individually, term is meant the dosage of independent activeconstituents.When being used to make up, the unitized dose of the activeconstituents of validity represented to cause to treat in term, no matter is with combination, uses in turn or use simultaneously.

In the method for putting into practice treatment of the present invention or purposes, for example Mammals is (for example to give the experimenter, the people) the GITR agonist of administering therapeutic significant quantity (for example, the GITRL polypeptide of GITRL polynucleotide or its expression) or GITR antagonist (for example, neutralize the anti-GITRL antibody or the anti-GITR antibody that neutralizes).But the method according to this invention combines individually or with other therapeutics and uses GITR agonist or antagonist, and described other therapeutics is for example to use the methods of treatment of cytokine, lymphokine, other Hemopoietic factor or anti-inflammatory reagent.When using altogether, GITR agonist or antagonist and second kind of reagent can be used simultaneously or used successively with one or more reagent.If use successively, the doctor in charge will determine suitable order of administration so, for example GITRL polypeptide (or its fusion rotein) or neutralize anti-GITRL antibody and other reagent coupling.

When the treatment GITR agonist of significant quantity or antagonist were dosage forms for oral administration, wedding agent existed with the form of tablet, capsule, pulvis, solution or elixir so.When using with tablet form, pharmaceutical composition of the present invention can comprise solid carrier for example gelatin or adjuvant extraly.Described tablet, capsule and pulvis comprise from about wedding agent of 5 to 95%, and preferably comprise from about wedding agent of 25 to 90%.When using, can add liquid vehicle for example oil for example peanut oil, mineral oil, soybean oil or sesame oil or the synthetic oil in water, oil, animal or plant source with liquid form.The liquid form of pharmaceutical composition can further contain physiological salt solution, glucose or other saccharide solution or dibasic alcohol for example ethylene glycol, propylene glycol or polyoxyethylene glycol.When using with liquid form, described pharmaceutical composition contains to be calculated by weight from about wedding agent of 0.5 to 90% and preferably calculates by weight from about wedding agent of 1 to 50%.

When GITR agonist that passes through intravenously, intracutaneous or subcutaneous injection administering therapeutic significant quantity or antagonist, described GITR agonist or antagonist exist with pyrogen-free, the acceptable aqueous solution form of parenteral.This class has considered that the parenteral of pH, isotonicity, stability etc. can accept the preparation of protein solution, within those skilled in the art's grasp.Except GITR agonist or antagonist, preferably be used for intravenously, intracutaneous or hypodermic pharmaceutical composition and also should comprise etc. and to ooze carrier for example sodium chloride injection, Ringer ' s injection liquid, glucose injection, dextrose ﹠ sodium chloride injection, newborn acidifying Ringer ' s injection liquid or other carrier known in the art.Pharmaceutical composition of the present invention also can comprise stablizer, sanitas, damping fluid, antioxidant or other additive well known by persons skilled in the art.

GITR agonist or the antagonist content in pharmaceutical composition of the present invention depends on the character and the severity of the illness of being treated, and the character that depends on the treatment that the patient experienced in the past.Finally, the doctor in charge will determine to cure the required GITR agonist of each single patient or the amount of antagonist.At first, the doctor in charge uses the GITR agonist or the antagonist of low dosage and observes reaction.Can use more heavy dose of GITR agonist or antagonist then and obtain best result of treatment, at this moment no longer further increase dosage usually until the patient.The various pharmaceutical compositions that are used to put into practice the inventive method should comprise the about 0.1 μ g of every Kg body weight to the approximately for example GITRL polypeptide or the anti-GITRL antibody that neutralizes of 100mg.

Use time length of intravenously (i.v.) treatment that pharmaceutical composition of the present invention carries out to look the situation of the severity of the disease of receiving treatment and each single patient and idiosyncrasy and change.Each intravenously is continuously used time length of GITR agonist or antagonist can be in 12 to 24 hours scopes.Also relate to subcutaneous (s.c.) therapeutics of using pharmaceutical composition of the present invention to carry out.But these treatments every day, weekly or more preferably per two weeks or used once in every month.Also relate to when described GITR agonist or antagonist are small molecules, treatment can be once a day, twice of every day, every days three inferior carrying out.Final doctor in charge will determine by intravenously or subcutaneous treatment or with the suitable time length of small molecules treatment and the time of application arrangement of use medicine composite for curing of the present invention.

Purposes or biologic activity (comprising relevant) that polynucleotide of the present invention and albumen expection performance is determined below one or more with assay method cited herein.By using or use these albumen or by using or using these proteic polynucleotide of coding (for example, gene therapy or be suitable for the carrier that DNA imports) that described proteic purposes of the present invention and activity can be provided.

Use GITRL and other GITR agonist to increase immunne response

In one aspect, the invention provides and be used to increase immunocyte for example the T cell is (for example, effector T cell) Zeng Zhi method, described method with immunocyte or immune cell population and GITR agonist GITRL polynucleotide for example of the present invention or polypeptide (for example, its fusion rotein) and/or the contact of the anti-GITR antibody of excitability, their strengthen or have strengthened the activity of GITR.These methods based on, to small part based on following discovery: the anti-GITR antibody of excitability reverses CD4 ⁺CD25 ⁺The inhibition CD4 that T is cell-mediated ⁺CD25 ^-The effect of T cell proliferation (embodiment 5).Described method also part based on following discovery: the GITR zygotic induction by for example GITRL or the anti-GITR antibody of excitability effector T cell (for example, CD4 ⁺CD25 ^-And CD8 ⁺The T cell) propagation of (embodiment 9 and embodiment 13).The applicant shows that also the GITR by GITRL is combined into effector T cell (CD4 for example ⁺And CD8 ⁺The T cell) provides costimulatory signal, therefore increased the T cell and overcome by CD4 ⁺CD25 ⁺The ability of inhibiting ability propagation of regulatory T cells mediation with replying anti-CD3 (embodiment 11 and 13); That is, being incorporated into the GITR that expresses on the effector T cell by GITR agonist (for example, the anti-GITR antibody of GITRL polypeptide, its active fragments and/or excitability) makes effector T cell not be subject to by CD4 ⁺CD25 ⁺The inhibiting influence that regulatory T cells produces.Therefore, the active GITR agonist of the GITR in the stimulatory effect T cell himself or with antigen for example adjuvant (for example, vaccine adjuvant) combination can be used for raising immunne response in the body, for example be used for the treatment of cancer and infectious diseases.

In one embodiment, the GITR agonist (for example, the anti-GITR antibody of GITRL polynucleotide, polypeptide, its active fragments and/or fusion rotein, excitability small molecules and/or excitability) can be used for treating various immune deficiencies and illness (comprising serious combination immune deficiency (SCID)), for example, aspect the growth and propagation of raising the T cell.These immune deficiencies can be heredity or by virus (for example, HIV) and bacterium or fungi infestation cause, or can cause by autoimmune disease.More particularly, the infectious diseases that is caused by virus, bacterium, fungi or other infection can use protein for treatment of the present invention, and described infection comprises for example moniliosis of the infection that caused by HIV, hepatitis virus, simplexvirus, mycobacterium (mycobacteria), leishmania species (Leishmaniaspp.), malaria spp. and various fungi infestation.Certainly, aspect this, albumen of the present invention also can be used for wanting usually under the situation of enhancing immunity system, promptly in treatment for cancer.

As the mode that raises immunne response, antigen is shown off the antigenic rise of delivery cell (APC) (for example, the rise of B7.1, B7.2 and B7.3) and also be can be used for treatment.The rise of immunne response can be to strengthen already present immunne response or to cause originally the form of immunne response and carry out.For example, having antigen by stimulation shows off the dendritic cell enhancing immunity of passing function and replys under the situation that can be used for virus infection.In addition, but the stimulation form of presenting molecule by administration of antigens systematically for example influenza, common cold and encephalitis of dendritic cell antigen mitigation system venereal disease poison disease for example.

Selectively, by remove T cell, (for example on one's body from the patient with the full-time APCs of virus antigen pulse, B cell, scavenger cell and/or dendritic cell) and the GITR agonist is (for example, the anti-GITR antibody of GITRL polynucleotide, polypeptide, its active fragments and/or fusion rotein, excitability small molecules and/or excitability) exsomatize and to stimulate the T cell altogether, in infected patient, can strengthen antiviral immunity and reply.GITR agonist (for example anti-GITR antibody of GITRL polynucleotide, polypeptide, its active fragments and/or fusion rotein and/or excitability) can soluble proteins or the form expressed by described APCs provide.The method that another enhancing antiviral immunity is replied is to separate infected cells on one's body from the patient, with the proteic nucleic acid transfection of coding as described herein GITRL of the present invention its, so that described cell is at the described albumen of its surface expression all or part, then will be in cell transformed imports described patient's body again.Describedly like this in can be the effector T cell body, cells transfected sends costimulatory signal, promptly, express GITRL albumen or other active fragments by described through cells transfected, these GITRL albumen can make described T cell not be subject to CD4 with combining of GITR on the effector T cell ⁺CD25 ⁺The inhibiting influence that regulatory T cells produces.

In Another application, rise or enhancing APC antigen function can be used for inducing of tumour immunity.The tumour cell (for example sarcoma, melanoma, lymphoma, leukemia, neuroblastoma and cancer) of nucleic acid transfection with at least one peptide of the present invention of coding can be administered to the patient to overcome the tumour-specific tolerance in described patient's body.If want, but the described tumour cell of transfection makes up with expression of peptides.For example, availablely (for example instruct the GITR agonist, GITRL polypeptide, its active fragments and/or fusion rotein, and/or the anti-GITR antibody of excitability) the stripped transfection of the expression vector of Biao Daing is available from patient's tumour, described GITR agonist can be only with have that the active peptide of B7.2 sample is expressed or with have the active peptide of B7.1 sample and put together, or the like.Will be to cause described in the tumour cell of transfection is put back to patient's body through the described peptide of cells transfected surface expression.Alternatively, gene therapy technology can be used for the tumour cell that target in vivo is used for transfection.

The GITR agonist (for example, the anti-GITR antibody of GITRL polypeptide, its active fragments and/or fusion rotein, excitability small molecules and/or excitability) and tumor cell surface (for example have APC antigen, B7.1, B7.2 etc.) the T cell that exists for of active peptide essential costimulatory signal is provided, with the anti-described immunne response of inducing T cell mediation through transfection tumor cell.In addition, thereby available nucleic acid transfection tumor cell is at described cell surface expression I class MHC or II class MHC albumen (or corresponding HLA molecule), described tumour cell is to lack I class MHC or II class MHC molecule or can not express the I class MHC of q.s again or the tumour cell of II class MHC molecule, described nucleic acid is coding all or part (for example, the part of tenuigenin structural domain brachymemma) I class MHC α catenin and β ₂Microglobulin or II class MHC α catenin and II class MHC β catenin (or corresponding people HLA nucleic acid).Suitable I class or II class MHC and GITR agonist (for example anti-GITR antibody of GITRL polypeptide, its active fragments and/or fusion rotein and/or excitability) and/or have the active peptide of APC antigen (for example, B7.1, B7.2 etc.) induced expression the immunne response of the cell-mediated anti-tumour cell through transfection of T.Randomly, the encoding antisense construct for example gene of constant chain also can be used for coding GITR agonist (for example anti-GITR antibody of GITRL polypeptide, its active fragments, its fusion rotein and/or excitability) and/or peptide cotransfection with APC antigenic activity to improve presenting and the inducing tumor-specific immunity of tumor associated antigen, and described antisense constructs can stop the expression of II class MHC associated protein.Therefore, in people experimenter, the human immune of inducing T cell mediation can be enough to overcome the tumour-specific tolerance in described experimenter.

In another embodiment, GITR agonist of the present invention (for example GITRL polypeptide, its active fragments and/or fusion rotein, its fusion rotein, excitability is little divided and/or the anti-GITR antibody of excitability) can be used as vaccine adjuvant.Adjuvant is to have to strengthen and/or the development of the anti-various antigenic immunne responses of control and the immunomodulatory compounds of characteristic, and described antigen himself has more weak immunogenicity.Cytokine and/or lymphokine can be used as adjuvant.The adjuvant of suitable selection can be induced good humoral and cellullar immunologic response, and described replying lacking under the situation of adjuvant and can not take place.Especially, adjuvant has remarkable efficacy in enhancing aspect subunit in the vaccine and the antigenic immunne response of peptide.Its stimulating activity also is useful to the development at the antigen-specific immune response of proteantigen.Concerning the strong mucous membrane of many requirements reply, high serum titer, CTL (cytotoxic T lymphocyte) the stimulation that adjuvant and cytokine/lymphokine combination provides most of antigen preparations not provide is provided the antigen with the intensive cell response.

As used herein, phrase " vaccine adjuvant " or " vaccine therapy " are meant and (for example use the GITR agonist, the anti-GITR antibody of GITRL polynucleotide, GITRL polypeptide, its active fragments, its fusion rotein and/or excitability) and antigen (for example, virus, parasite and bacterial peptide, albumen and peptide) or polynucleotide enhancing, inhibition or the metering needle of other antigen (for example, tumour or cancer cells polypeptide, albumen or peptide) or coding for antigens to described antigenic immunne response.On the meaning of this definition, " combination " should be meant with antigen and put together use, use (combination or non-combination) or use successively with antigen simultaneously.

Term " vaccine adjuvant composition " is meant that extraly the mode for preparing injectable liquid liquid solution or suspended substance with routine comprises immunology acceptable diluent or carrier.Described vaccine adjuvant composition can be extra the reagent that comprises the immunne response that further enhancing causes by the GITR agonist.For example, described vaccine adjuvant composition can comprise 3-O-extraly and removes acidylate monophosphoryl lipid A (MPL ^_Corixa Corporation, Seattle, WA) or monophosphoryl lipid A and its derivative and analogue.MPL ^_Scope that can 1-100 μ g/ agent is used.

The antigen that is used for vaccine therapy comprises and derives from immunogenicity or the proteic albumen of non-immunogenic, peptide or polypeptide and following any material: carbohydrate, albumen, polynucleotide or oligonucleotide or other macromolecular components or its fragment.So joint is employed, and " peptide " comprises at least 6 amino acid whose series and comprise at least one antigenicity determinant, and " polypeptide " is the molecule longer than peptide, but does not constitute full-length proteins.As used herein, " fragment " comprises part, but less than complete carbohydrate, albumen, polypeptide or oligonucleotide or other macromolecular components.

As used herein, term " effectively adjuvant amount " is meant the dosage of adjuvant combination described herein, and described dosage is adapted at evoking in the vertebrate host enhanced immunne response.The method that specific dosage partly depends on described host's age, body weight and medical condition and described antigen and uses.

Can use to people or non-human vertebrate vaccine adjuvant composition of the present invention by all means, described approach includes but not limited in the nose, per os, vagina, rectum, parenteral, intracutaneous, transdermal (referring to, for example International Application No. WO 98/20734, quotes as a reference herein), intramuscular, intraperitoneal, subcutaneous, intravenously and intra-arterial.The amount of the antigen component of described antigenic composition is partly decided on described antigenic character and experimenter's age, body weight and medical condition and the method for using.Equally, those skilled in the art can easily determine proper dosage.Administration of antigens and adjuvant combination simultaneously is preferred, although optional.Those skilled in the art also determine the dose quantity and the dosage of antigenic composition easily.In some cases, the adjuvant characteristic of adjuvant combination can reduce the time-histories of required dose quantity or dosage.

Adjuvant combination of the present invention a large amount of antigens suitable and from various pathogenic microbes are used in combination, described pathogenic microbes comprises, but be not limited to virus, bacterium, fungi or the parasite microorganism of infected person or non-human vertebrate or from cancer cells or tumour cell (for example, sarcoma, melanoma, lymphoma, leukemia, neuroblastoma and cancer).Described antigen can comprise the fragment that derives from proteic peptide or polypeptide and following any material: carbohydrate, albumen, polynucleotide or oligonucleotide, cancer or tumour cell or other macromolecular components.In some cases, surpass a kind of antigen and be contained in described antigenic composition.

The virus vaccines of wanting that comprises adjuvant of the present invention combination comprises and relates to those that prevent and/or treat disease that described disease is by (being not limited to) human immunodeficiency virus, simian immunodeficiency virus, respiratory syncytial virus, parainfluenza virus 1-3 type, influenza virus, hsv, human cytomegalic inclusion disease virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, human papillomavirus, poliovirus, rotavirus, embedding Calicivirus, Measles virus, mumps virus, rubella virus, adenovirus, rabies virus, canine distemper virus, rinderpest virus, coronavirus, parvovirus, infectious bovine rhinotracheitis virus, feline leukaemia virus, feline infectious peritonitis virus, poultry infectious bursal disease virus, Avian pneumo-encephalitis virus, avian herpetoviruses 1 type, pig reproduction and respiratory complication virus, equine arteritis virus and various encephalitis cause.

The bacterial vaccine of wanting that comprises adjuvant of the present invention combination comprises and relates to those that prevent and/or treat disease, described disease is by (being not limited to) Haemophilus influenzae (Haemophilusinfluenzae) (typical and atypical), Haemophilus somnus (Haemophilussomnus), morazella catarrhalis (Moraxella catarrhalis), streptococcus pneumoniae (Streptococcus pneumoniae), streptococcus pyogenes (Streptococcuspyogenes), streptococcus agalactiae (Streptococcus agalactiae), streptococcus faecium (Streptococcus faecalis), helicobacter pylori (Helicobacter pylori), Neisseria meningitidis (Neisseria meningitidis), Diplococcus gonorrhoeae (Neisseria gonorrhoeae), sand holes chlamydozoan (Chlamydia trachomatis), Chlamydia pneumoniae (Chlamydia pneumoniae), chlamydia psittaci (Chlamydiapsittaci), Bordetella pertussis (Bordetella pertussis), salmonella typhi (Salmonella typhi), Salmonella typhimurium (Salmonellatyphimurium), Salmonella choleraesuls (Salmonella choleraesuis), intestinal bacteria (Escherichia coli), Shigella, vibrio cholerae (Vibriocholerae), corynebacterium diphtheriae (Corynebacterium diphtheriae), mycobacterium tuberculosis (Mycobacterium tuberculosis), mycobacterium avium (Mycobacterium avium)-Mycobacterium intracellulare (Mycobacteriumintracellular) mixture, proteus mirabilis (Proteus mirabilis), proteus vulgaris (Proteus vulgaris), streptococcus aureus (Staphylococcusaureus), clostridium tetani (Clostridium tetani), leptospira interrogans (Leptospira interrogans), B. burgdorferi (Borreliaburgdorferi), haemolysis pasteurella (Pasteurella haemolytica), multocida (Pasteurella multocida), lobar pneumonia actinobacillus (Actinobacillus pleuropneumoniae) and chicken sepsis mycoplasmas (Mycoplasmagallisepticum) cause.

The vaccine of the resistant to fungal pathogens of wanting that comprises adjuvant of the present invention combination comprises and relates to the adjuvant that prevents and/or treats disease, described disease is by (being not limited to) Aspergillus, Blastomyces, candiyeast, ball spore Pseudomonas, Cryptococcus and Histoplasma cause.

The antiparasitic vaccine of wanting that comprises adjuvant of the present invention combination comprises and relates to those that prevent and/or treat disease, described disease is by (being not limited to) Leishmania major, Ascaris, Trichocephalus, giardia, schistosomicide, Cryptosporidium, Trichomonas, mouse bow slurry worm (Toxoplasma gondii) and Pneumocystis carinii cause.

Being used for of wanting evoked therapeutic or preventative antitumous effect vertebrates vaccine (comprise of the present invention adjuvant combination) comprises that the vaccine that utilizes cancer antigen or tumor associated antigen, described antigen include but not limited to prostate specific antigen (PSA), prostate specific membrane antigen (PSMA), carcinomebryonic antigen (CEA), MUC-1, Her2, CA-125, MAGE-3, EGFR, HELP, GCC, CD66-c, prostasin, TMPRSS3, TADG 12 and TADG 15.

Under the situation of HIV and SIV, described antigenic composition comprises at least one albumen from described virus, polypeptide, peptide or fragment.In some cases, antigenic composition comprises a plurality of HIV or SIV albumen, polypeptide, peptide and/or fragment.

Adjuvant combination formulations of the present invention also is suitable as the adjuvant in the polynucleotide vaccine (being also referred to as dna vaccination).These vaccines can further comprise for example bupivacaine (referring to U.S. Patent number 5,593,972, quoting as a reference) of promotor herein.

Following method is known in the art: 1) stimulator antigen is presented for example dendritic cell function of cell function; 2) take out the T cell on one's body from the patient, it is exsomatized stimulates altogether, then it is imported described experimenter again; 3) transfection tumor cell is with the induced tumor immunity; With 4) and the use vaccine adjuvant (ginseng is posted, for example, and people such as Cerundolo (2004) Dendritic cells:a journey from laboratory to clinic.Nat.Immunol.5 (1): 7-10; People such as Ko (2003) Immunotherapy of malignant diseases.Int.Arch.Allergy Immunol.132:294-309; People such as Valmori (1999) Anantigen-targeted approach to adoptive transfer therapy ofcancer.Cancer Res.59:2167-73).

Use the GITR antagonist to reduce immunologic cellular activity

In yet another aspect, the invention provides and be used to keep for example CD4 of effector T cell ⁺And CD8 ⁺T cell or its colony are to CD4 ⁺CD25 ⁺The method of the susceptibility of the inhibition effect that regulatory T cells produces.Described method comprises the T cell colony and is enough to suppress the GITR antagonist of the active dosage of described immunocyte or colony (for example, GITRL inhibitory polynucleotide, antagonism small molecules, the anti-GITR antibody of neutralization and/or the anti-GITRL antibody that neutralizes) contact.The antagonist of GITR also can be wanted the experimenter who suppresses its immunne response to use.These illnesss comprise, for example, and autoimmune disease (for example arthritis disease), inflammation or organ transplantation.

These methods based on, recovered CD4 based on the active reduction of following discovery: GITR (for example, by use neutralization anti-GITRL antibody) to small part ⁺CD25 ⁺The restraining effect (embodiment 13) of mediation, that is, the anti-GITRL antibody that neutralizes has kept for example CD4 of effector T cell ⁺And CD8 ⁺The T cell is to by CD4 ⁺CD25 ⁺The inhibiting susceptibility that regulatory T cells produces.In addition, the applicant has confirmed to have alleviated disease with the anti-GITRL antibody incubation effector T cell of neutralization in the experimental autoimmunization encephalitis of murine (EAE) (embodiment 14).Therefore, the GITR antagonist molecule that promptly suppresses GITR activity (for example, anti-GITRL antibody) can be used for keeping in vivo effector T cell to by CD4 ⁺CD25 ⁺The inhibiting susceptibility that the T cell produces for example is used for the treatment of or the cell-associated pathology of epidemic prevention, comprises transplant rejection, inflammation and autoimmune disease.

Use the method for GITR antagonist also to can be used for retarding effect T cell activity (for example, breed, break up, survive) and therefore can be used for treating or preventing various immune disorders.The indefiniteness example of the illness that can treat or prevent includes but not limited to transplant rejection, autoimmune disease (comprises, for example, diabetes, sacroiliitis (comprises rheumatoid arthritis, juvenile rheumatoid arthritis, osteoarthritis, arthritic psoriasis), multiple sclerosis, encephalomyelitis, myasthenia gravis, systemic lupus erythematous, the autoimmunization thyroiditis, dermatitis (comprising atopic dermatitis and eczematoid dermatitis), psoriasis, the Si Yegeni syndromes, Crohn's disease, aphthous ulcer, iritis, conjunctivitis, keratoconjunctivitis, ulcerative colitis, spondyoarthropathy, ankylosing spondylitis, intrinsic asthma, atopic asthma, lupus erythematosus,cutaneous, scleroderma, vaginitis, rectitis, drug eruption, leprosyreversal reactions, erythema nodosum leprosum, the autoimmune uveitis, allergic encephalitis, acute necrotizing hemorrhagic encephalopathy, idiopathicbilateral progressive sensorineural hearing loss, aplastic anemia, PRCA, idiopathic thrombocytopenia, polychondritis, the wegener granulomatosis knurl, chronic active hepatitis, Stevens Johnson syndrome, idiopathicsprue, lichen planus, Graves disease, sarcoidosis, primary biliary cirrhosis, uveitis posterior, and interstitial pulmonary fibrosis), graft versus host disease (GVH disease), with transformation reactions for example, atopic allergology. can use comprise use the GITR antagonist for example in and the preferred illness of GITRL Antybody therapy comprise arthritis disease (for example, rheumatoid arthritis, juvenile rheumatoid arthritis, osteoarthritis, arthritic psoriasis, and ankylosing spondylitis (being preferably rheumatoid arthritis)), multiple sclerosis, type i diabetes, lupus (SLE), IBD, Crohn disease, asthma, vasculitis, transformation reactions, scleroderma and psoriasis.

In another embodiment, the GITR antagonist individually or with other above-described treatment reagent (for example, the TNF antagonist) can be used for treating multiple myeloma and relevant bone-marrow-derived lymphocyte malignant tumour (Brenne, people such as A. (2002) Blood 99 (10): 3756-62) together.

May regulate immunne response in many ways by using GITR antagonist (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL).Downward modulation can be to suppress or stop in the immunne response of carrying out, and maybe can relate to preventing immune response inducing.Restraining effect by increasing t cell response or by the tolerance of inducing specific in the T cell or can suppress function by the two simultaneously through activated T cells.The immunosuppressive action of t cell response is the process of the non-antigen-specific of activatory normally, and the described range request of crossing is exposed to described T cell in the inhibition reagent continuously.The difference that in the T cell, relates to the tolerance of inducing unresponsiveness and anergy and inhibitive ability of immunity be its normally antigen-specific and wave effect not being exposed to the follow-up supervention of tolerance reagent.Effectively, can be by under the non-existent situation of tolerance reagent, the no t cell response that is exposed to specific antigens again being confirmed tolerance.

Downward modulation or prevent one or more antigen presenting cell antigens (for example, function B7.1) and therefore prevention through the synthetic lymphokine of activated T cells high level can be used for organizing, in the situation and graft versus host disease (GVHD) of skin and organ transplantation.For example, stop the T cell function should in tissue transplantation, cause the disorganization that reduces.Usually, in tissue grafts, transplant rejection is used as foreign matter by the T cell and is then destroyed described graft by immune response and cause owing to it.Before transplanting, (for example use the GITR antagonist together with molecule, the GITRL inhibitory polynucleotide, the antagonism small molecules, and/or at the neutralizing antibody of GITR and/or GITRL) can cause described molecule can not transmit corresponding costimulatory signal with the combining of native ligand on immunocyte surface, described molecule be suppress or the native ligand of blocking-up B7 lymphocyte antigen and its immunocyte (for example independent solubility have the active monomeric form of B7.2 peptide or with have other bone-marrow-derived lymphocyte antigen (for example, the B7.1) peptide of active monomeric form or blocking antibody combination) interaction.Block B7 lymphocyte antigen function by this way and stoped for example effector T cell synthetic cell factor and therefore play immunosuppressive action of immunocyte.In addition, lacking of stimulating altogether also is enough to make T cell anergy, therefore inducing tolerance in the experimenter.Can avoid using repeatedly the needs of these blocking-up reagent by the long-acting tolerance of B7 lymphocyte antigen barrier reagent inductive.For obtain enough immunosuppression or tolerance in the experimenter, the function of blocking-up bone-marrow-derived lymphocyte antigen combination may also be essential.

Can use animal model to estimate the effect of specific blocking-up reagent in preventing organ-graft refection or GVHD, described animal model is used for predicting the validity the people.The example of spendable appropriate system comprises that the xenogenic islets in the heart transplantation of the same race and mouse is transplanted in the rat, has been used to investigate CTLA4Ig fusion rotein immunosuppression effect in vivo as the above-mentioned both described at people (1992) Proc.Natl.Acad.Sci.USA 89:11102-05 such as people such as Lenschow (1992) science 257:789-92 and Turka.In addition, and murine GVHD model (referring to, Paul for example, ed., Fundamental Immunology, RavenPress, New York, 1989, pp.846-47) can be used for determining that blocking-up bone-marrow-derived lymphocyte antigen function is in vivo to the influence of this disease progression.

The antigenic function of blocking-up APC also is used for the treatment of to treatability autoimmune disease.Many autoimmune diseases are that the incorrect activation of T cell causes, and described T cell produces reaction to autologous tissue and improved the output of pathological cytokine of involved in diseases and autoantibody.Stop the activity of autoreactive T cell can reduce or eliminate disease symptoms.With the GITR antagonist (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL) but but use suppressor T cell active and the autoantibody of prevention involved in diseases process or the production of cytokines in T cell source with reagent, wherein said reagent is by the antigenic acceptor of destruction APC: ligand interaction is blocked the common stimulation to the T cell.In addition, with the GITR antagonist (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL) and barrier reagent use the antigen-specific tolerance that can induce autoreactive T cell together, thereby can cause alleviating chronically disease.A large amount of animal models of well-characterized that can be by end user's autoimmune disease determine that these reagent are in prevention or alleviate effect on the autoimmune disease.Example comprise diabetes in systemic lupus erythematous, murine autoimmunity collagen sacroiliitis, NOD mouse and the BioBreeding rat in the experimental autoimmunization encephalitis of murine (EAE), MRL/1pr/1pr mouse or the NZB hybridize mice and the experimental myasthenia gravis of murine (referring to, Paul for example, ed., Fundamental Immunology, Raven Press, New York, 1989, pp.840-56).

In another embodiment, with the GITR antagonist (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL) (comprising its therapeutic composition) promptly use with other reagent (for example therapeutic agent) in the combined therapy mode, described therapeutic agent is used for the treatment of pathological conditions or illness, for example immune disorders and inflammation.Term " combination " is meant that at this paper the basic while (simultaneously or successively) uses reagent.If use successively, when beginning to use second compound, first in two compounds preferably still can be detected with effective concentration at therapentic part.

For example, combined therapy (for example can comprise one or more GITR antagonists, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL), prepare described GITR antagonist and/or therewith use with other therapeutic agent, as below in greater detail, described therapeutic agent is for example one or more cytokines and growth factor receptor inhibitors, immunosuppressor, anti-inflammatory factors, metabolic poison, enzyme inhibitors and/or cytotoxicity or cytostatics.In addition, one or more GITR antagonist described herein (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL) can be used with two or more a plurality of treatment examination described herein.Such combined therapy can advantageously utilize lower therapeutical agent application dosage, has therefore avoided possible toxicity or the complication relevant with various single therapies.In addition, therapeutical agent disclosed herein works with the approach that is different from the GITRL receptor pathway, and therefore expection strengthens and/or works in coordination with the effect that strengthens the GITR antagonist, and promptly wherein effector T cell keeps it to CD4 ⁺CD25 ⁺The inhibiting susceptibility that regulatory T cells produces.

Therapeutical agent preferred and that the GITRL antagonist is used in combination is the reagent of interfering autoimmunization and inflammatory response subsequently in different steps.In one embodiment, available one or more other reagent (is for example prepared one or more GITR antagonist described herein altogether, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL) or therewith use, described other reagent is for example other cytokine or growth factor antagonist (for example, soluble receptors, inhibitor peptides, small molecules, part syzygy); Or in conjunction with the antibody of other target or its Fab the antibody of other cytokine or somatomedin, its acceptor or other cell surface molecule (for example in conjunction with); With anti-inflammatory cytokines or its agonist.Can with GITR antagonist described herein (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL) the indefiniteness example of the reagent that uses together comprises, but be not limited to the antagonist of one or more interleukin-or its acceptor, for example the antagonist of IL-1, IL-2, IL-6, IL-7, IL-8, IL-12, IL-13, IL-15, IL-16, IL-18 and IL-22; The antagonist of cytokine or somatomedin or its acceptor, for example tumour necrosis factor (TNF), LT, EMAP-II, GM-CSF, FGF and PDGF.The GITR antagonist (for example, the GITRL inhibitory polynucleotide, the antagonism small molecules, and/or at the neutralizing antibody of GITR and/or GITRL) also can use with the inhibitor of for example antibody, described antibody is for example CD2 of anti-cell surface molecular, CD3, CD4, CD8, CD25, CD28, CD30, CD40, CD45, CD69, CD80 (B7.1), CD86 (B7.2), CD90 or its part comprise the antibody (people (2002) Med.Res.Rev.22:146-67 such as Yusuf-Makagiansar) of CD154 (gp39 or CD40L) or LFA-1/ICAM-1 and VLA-4/VCAM-1.Preferably can be used for comprising the antagonist of IL-1, IL-12, TNFa, IL-15, IL-17, IL-18 and IL-22 with GITR antagonist described herein (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or the GITRL) antagonist that uses together.

The example of these reagent comprises the IL-12 antagonist, the antibody (or its Fab) of for example chimeric, humanized, people or external generation, and described antibody capable combines with IL-12 (preferably people IL-12), for example at WO 00/56772 disclosed antibody; The antibody of for example anti-people IL-12 of IL-12 acceptor inhibitor acceptor; With the IL-12 acceptor soluble fragments of people IL-12 acceptor for example.The example of IL-15 antagonist comprises the antibody (or its Fab) of anti-IL-15 or its acceptor, for example, the soluble fragments and the protein-bonded antibody of IL-15 of the anti-human IL-15 of chimeric, humanized, people or external generation or its acceptor, IL-15 acceptor.The example of IL-18 antagonist comprises antibody, the anti-human il-18 of for example chimeric, humanized, people or external generation, the protein-bonded antibody of the soluble fragments of IL-18 acceptor and IL-18 (or its Fab) (IL-18BP, people such as Mallet (2001) Circ.Res.28).The example of IL-1 antagonist comprises interleukin 1 converting enzyme (ICE) inhibitor, for example Vx740, IL-1 antagonist, for example IL-1RA (Anikinra, Amgen), sIL1RII (Immunex) and anti-IL-1 receptor antibody (or its Fab).

That the example of TNF antagonist comprises is chimeric, humanized, the antibody (or its Fab) of the anti-TNF (for example people TNFa) of people or external generation D2E7 (people TNFa antibody for example, the U.S. 6,258,562), CDP-571/CDP-870/BAY-10-3356 (humanized anti-TNFa antibody, Celltech/Pharmacia), cA2 (chimeric anti-TNFa antibody; Remicade ^TM, Centocor); The anti-TNF antibodies fragment (for example, CPD870); TNF acceptor soluble fragments is p55 or p75 people TNF acceptor or derivatives thereof 75kd TNFR-IgG (75kDTNF acceptor-IgG fusion rotein, Enbrel for example for example ^TMImmunex; Referring to, for example; Arthritis﹠amp; Rheumatism (1994) 37:S295; J.Invest.Med. p55 kdTNFR-IgG (55kD TNF acceptor-IgG fusion rotein (Lenercept)) (1996) 44:235A); Enzyme antagonist, for example TNFa saccharase (TACE) inhibitor (for example, α sulphonyl hydroxyamino derivative, WO 01/55112 and N-hydroxyl methane amide tace inhibitor GW 3333 ,-005 or-022); And TNF-bp/s-TNFR (soluble TNF is conjugated protein; Referring to for example Arthritis﹠amp; Rheumatism (1996) 39 (9) is (supplement): S284; Amer.J.Physiol.-Heart and Circulatory Physiology (1995) 268:37-42).Preferred TNF antagonist is the soluble fragments of TNF acceptor, for example p55 or p75 people TNF acceptor or derivatives thereof, for example 75kd TNFR-IgG and TNFa saccharase (TACE) inhibitor.

In another embodiment, GITR antagonist described herein can be used with one or more following reagent: the IL-13 antagonist is solubility IL-13 antibody (sIL-13) and/or anti-il-13 antibody for example; The IL-2 antagonist is DAB 486-IL-2 and/or DAB389-IL-2 (IL-2 fusion rotein for example; Seragen; Referring to for example, Arthritis﹠amp; Rheumtism (1993) 36:1223) and/or for example anti-Tac of anti-IL-2R antibody (the anti-IL-2R of humanization; Protein Design Labs, Cancer Res. (1990) 50 (5): 1495-502).Another combination comprises GITR antagonist (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL), and (IDEC-CE9.1/SB 210396 with non-expendable anti-CD4 inhibitor; The anti-CD 4 antibodies of non-expendable primateization; IDEC/SmithKline).Another preferably makes up the antagonist that comprises common stimulation approach CD80 (B7.1) or CD86 (B7.2), comprises antibody, soluble receptors or antagonism part; With p-select protein sugar protein ligands (PSGL), anti-inflammatory cytokines for example IL-4 (DNAX/Schering), IL-10 (SCH 52000; Recombinant il-10 DNAX/Schering); IL-13 and TGF-β and its agonist (for example, agonist antibody).

In another embodiment, one or more GITR antagonists can be prepared altogether and/or use altogether with one or more anti-inflammatory drugs, immunosuppressor or metabolism or enzyme inhibitors.Can with GITR antagonist described herein (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL) medicine that uses together or the example of inhibitor comprise, but be not limited to one or more following materials: nonsteroidal antiinflammatory drug (NSAIDs) for example Ibuprofen BP/EP, tenidap (referring to for example, Arthritis﹠amp; Rheumatism (1996) 39 (9) is (supplement): S280)), naproxen (referring to for example, Neuro.Report (1996) 7:1209-13), meloxicam, piroxicam, diclofenac and indomethacin; The yellow pyridine of willow nitrogen (referring to for example, Arthritis﹠amp; Rheumatism (1996) 39 (9) is (supplement): S281); Reflunomide is prednisolone for example; Cell factor inhibiting anti-inflammatory agent thing (CSAIDs); The Nucleotide biosynthesis inhibitor for example purine biosynthesis inhibitor, antifol (for example, methotrexate (N-[4-[[(2,4-diamino-6-pteridyl) methyl] methylamino-] benzoyl]-L-L-glutamic acid); With the pyrimidine biosynthesis inhibitor, for example dihydroorate dehydrogenase (DHODH) inhibitor (for example, leflunomide (referring to, for example, Arthritis﹠amp; Rheumatism (1996) Vol.39, No.9 (supplement), S131; Inflammation Research (1996) 45:103-07).Be used for the GITR antagonist (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL) the preferred therapeutical agent that uses together (for example comprises NSAIDs, CSAIDs, (DHODH) inhibitor, leflunomide) and antifol (for example, methotrexate).

The example of other inhibitor comprises one or more following materials: reflunomide (per os, suction, local injection); Immunosuppressor is S-Neoral, tacrolimus (FK-506) for example; With mTOR inhibitor for example sirolimus (rapamycin) or rapamycin derivative, solubility rapamycin derivative (for example, rapamycin ester derivative CCI-779 (Elit (2002) Current Opinion Investig.Drugs 3 (8): 1249-53 for example for example; People such as Huang (2002) Current Opinion Investig.Drugs 3 (2): 295-304); The reagent that transmits by the pro-inflammatory cytokine interference signal, for example TNFa or IL-1 (for example IRAK, NIK, IKK, p38 or map kinase inhibitor); The COX2 inhibitor for example fill in examine glycosides, rofecoxib and its variant (referring to for example, Arthritis﹠amp; Rheumatism (1996) Vol.39, No.9 (supplement), S81); Phosphodiesterase inhibitor is R973401 (IV type phosphodiesterase inhibitor for example; Referring to for example, Arthritis﹠amp; Rheumtism (1996) Vol.39, No.9 (supplement), S282)); Phospholipase inhibitor, for example tenuigenin phospholipase 2 inhibitor (cPLA2) (for example, the similar thing of trifluorumethylketone (U.S. Patent number 6,350,892)); The inhibitor of vascular endothelial cell growth factor (ECGF) or growth factor receptors is VEGF inhibitor and/or VEGF-R inhibitor for example; And angiogenesis inhibitor.The preferred therapeutical agent that uses together with GITR antagonist (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL) is for example S-Neoral, a tacrolimus (FK-506) of immunosuppressor; The mTOR inhibitor is sirolimus (rapamycin) or rapamycin derivative for example, for example solubility rapamycin derivative (for example rapamycin ester derivative for example CCI-779); The COX2 inhibitor is celecoxib and its variant for example; With inhibitor of phospholipase enzymes for example tenuigenin Phospholipid hydrolase 2 (cPLA2) inhibitor, for example similar thing of trifluorumethylketone.

The other example of the therapeutical agent that can use with the GITRL antagonist comprises one or more following materials: Ismipur (6-MP); Azathioprine sulphasalazine; Mesalazine; Olsalazine chloroquine/hydroxychloroquine; Trolovol; Aurothiomalate (intramuscular and per os); Azathioprine; Cochicine; Beta-2-adrenoceptor agonist (salbutamol, special his woods, the Salmeterol of going on foot); Xanthine (theophylline, aminophylline); Cromoglycate; Nedocromil; Ketotifen; Ipratropium bromide and oxitropium bromide; Mycophenolate mofetil; Adenosine agonists; Antithrombotic agent; Complement inhibitor; And adrenergic.

Discussion is more at large used GITR antagonist disclosed herein to be used for the treatment of with other therapeutical agent or is prevented specific immune disorders below.

Can use with treatment and prevention arhritis conditions (for example rheumatoid arthritis, inflammatory arthritis, rheumatoid arthritis with the GITR antagonist, juvenile rheumatoid arthritis, osteoarthritis and arthritic psoriasis) the example of reagent comprise that one or more are following: IL-12 antagonist described herein, NSAIDs; CSAIDs; TNFs is TNFa for example, antagonist as described herein; Non-expendable anti-CD 4 antibodies as described herein; IL-2 antagonist as described herein; Anti-inflammatory cytokines is IL-4 for example, IL-10, IL-13 and TGFa or its agonist; IL-1 as described herein or IL-1 receptor antagonist; Phosphodiesterase inhibitor as described herein; Cox 2 inhibitor as described herein; Iloprost (referring to, for example, Arthritis﹠amp; Rheumatism (1996) Vol.39, No.9 (supplement), S82); Methotrexate; The Sa Li polyamines (referring to, for example, Arthritis﹠amp; Rheumatism (1996) Vol.39, No.9 (supplement), S282) medicine relevant with the Sa Li polyamines is (for example, Celgen); Leflunomide; The plasminogen activity inhibitor for example tranexamic acid (referring to, for example, Arthritis﹠amp; Rheumatism (1996) Vol.39, No.9 (supplement), S284); Cytokine inhibitor for example, T-614 (referring to, for example, Arthritis﹠amp; Rheumatism (1996) Vol.39, No.9 (supplement), S282); Prostaglandin E1 (referring to, for example, Arthritis﹠amp; Rheumatism (1996) Vol.39, No.9 (supplement), S282); Azathioprine (referring to, for example, Arthritis﹠amp; Rheumatism (1996) Vol.39, No.9 (supplement), S281); Interleukin 1 saccharase (ICE) inhibitor; Zap-70 and/or 1ck inhibitor (inhibitor of Tyrosylprotein kinase zap-70 or 1ck); The inhibitor of vascular endothelial cell growth factor (ECGF) as described herein or vascular endothelial cell growth factor receptor 2 body; Angiogenesis inhibitor as described here; Reflunomide anti-inflammatory drug (for example SB203580); The TNF converting enzyme inhibitor; IL-11 (referring to, for example, Arthritis﹠amp; Rheumatism (1996) Vol.39, No.9 (supplement), S296); IL-13 (referring to, for example, Arthritis﹠amp; Rheumatism (1996) Vol.39, No.9 (supplement), S308); The IL-17 inhibitor (referring to, for example, Arthritis﹠amp; Rheumatism (1996) Vol.39, No.9 (supplement), S120); Gold; Trolovol; Chloroquine; Hydroxychloroquine; Chlorambucil; Endoxan; S-Neoral; Total lymph radiant matter; Antithyroglobulin; The CD5-toxin; The peptide of dosage forms for oral administration and collagen protein; Lobenzarit Disodium; Cytokine modulators (CRAs) HP228 and HP466 (HoughtenPharmaceuticals, Inc.); (ISIS 2302 for ICAM-1 antisense phosphorothioate ester oligodeoxynucleotide; Isis Pharmaceuticals, Inc.); Soluble complement acceptor 1 (TP10; T Cell Sciences, Inc.); Prednisone; Proteins, orgoteins; The many sulfuric acid of glycosaminoglycan; MINOCYCLINE HCL; Anti-IL2R antibody; Marine organisms and vegetable lipid (fish and plant seed lipid acid; Referring to, for example, people such as DeLuca (1995) Rheum.Dis.Clin.North Am.21:759-77); Auranofin; Phenylbutazone; Meclofenamic acid; Flufenamic Acid; The intravenously immunoglobulin (Ig); Zileuton; Mai Kaofen acid (RS-61443); Tacrolimus (FK-506); Sirolimus (rapamycin); Therafectin (therafectin); CldAdo (2-chlorodeoxyadenosine); And azaribine.Preferred combination (for example comprises one or more GITR antagonists, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL) and methotrexate or leflunomide, under the situation of moderate or serious rheumatoid arthritis, be S-Neoral.

Preferably with the GITR antagonist use with the treatment of arthritis illness inhibitor comprise TNF antagonist (for example, antibody or its Fab of chimeric, humanized, people or external generation in conjunction with TNF; The soluble fragments of TNF acceptor, for example p55 or p75 people TNF acceptor or derivatives thereof, for example 75kd TNFR-IgG (75kD TNF acceptor-IgG fusion rotein, Enbrel ^TM), p55kD TNF acceptor-IgG fusion rotein; TNF enzyme antagonist is TNFa saccharase (TACE) inhibitor for example); IL-12, IL-15, IL-17, IL-18, the antagonist of IL-22; T cell and B cell scavenging agent (for example, anti-CD4 or anti-CD22 antibody); Micromolecular inhibitor is methotrexate and leflunomide for example; Sirolimus (rapamycin) and its analogue, for example CCI-779; Cox-2 and cPLA2 inhibitor; NSAIDs; The p38 inhibitor, TPL-2, Mk-2 and NFkb inhibitor; RAGE or solubility RAGE; P-selection albumen or PSGL-1 inhibitor (for example, micromolecular inhibitor and antibody thereof, for example anti-P-selects proteic antibody); β estrogen receptor (ERB) agonist or ERB-NFkb antagonist.Most preferred can with one or more GITR antagonists (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL) the other therapeutical agent using together and/or prepare comprise following one or more: TNF acceptor soluble fragments, for example p55 or p75 people TNF acceptor or derivatives thereof, 75kdTNFR-IgG (75kD TNF acceptor-IgG fusion rotein, Enbrel for example ^TM); Methotrexate, leflunomide or sirolimus (rapamycin) or its analogue be CCI-779 for example.

The indefiniteness example of the reagent of the treatment that can use with the GITR antagonist or prevention multiple sclerosis comprises following: Interferon, rabbit is interferon-' alpha ' 1a (for example, Avonex for example ^TMBiogen) and IF1 b (Betaseron ^TMChiron/Berlex); Copolymer 1 (Cop-1; Copaxone ^TMTeva Pharmaceutical Industries, Inc.); Hyperbaric oxygen; The intravenously immunoglobulin (Ig); CldAdo; As TNF antagonist described herein; Reflunomide; Prednisolone; Methylprednisolone; Azathioprine; Endoxan; S-Neoral; Methotrexate; 4-aminopyridine and tizanidine.

In addition can comprise the antibody of anti-human cell factor or somatomedin or the antagonist of these factors with the antagonist that GITR antagonist (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL) uses together, the described factor for example is, TNF, LT, IL-1, IL-2, IL-6, IL-7, IL-8, IL-12 IL-15, IL-16, IL-18, EMAP-11, GM-CSF, FGF and PDGF.GITR antagonist described herein (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL) can with anti-other cell surface molecule CD2 for example, CD3, CD4, CD8, CD25, CD28, CD30, CD40, CD45, CD69, CD80, CD86, the antibody of CD90 or its part-rise and use.Described GITR antagonist (for example, GITRL inhibitory polynucleotide, the antagonism small molecules, and/or at the neutralizing antibody of GITR and/or GITRL) also can with for example following reagent coupling: methotrexate, S-Neoral, FK506, rapamycin, mycophenolate mofetil, leflunomide, NSAIDs is Ibuprofen BP/EP for example, reflunomide is prednisolone for example, phosphodiesterase inhibitor, adenosine agonists, antithrombotic agent, complement inhibitor, adrenergic is by the reagent of pro-inflammatory cytokine undesired signal conduction described herein, the IL-Ib converting enzyme inhibitor (for example, Vx740), anti-P7s, PSGL, tace inhibitor, T cell signaling inhibitor is kinase inhibitor for example, metal loproteinase inhibitor, the yellow pyridine of willow nitrogen, azathioprine, Ismipur, angiotensin-convertion enzyme inhibitor, soluble cytokine receptor and its derivative, as described herein, and anti-inflammatory cytokines (IL-4 for example, IL-10, IL-13 and TGF).

Preferably the example of the therapeutical agent that is used for multiple sclerosis that uses together with GITR antagonist (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL) comprises Interferon, rabbit-b for example IFNb-la and IFNb-lb; Copaxone, reflunomide, IL-1 inhibitor, tnf inhibitor, the antibody of anti-CD40 part and CD80 and IL-12 antagonist.

Can with the GITR antagonist (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL) use together be used for the treatment of or prevent inflammatory bowel disease (for example, the indefiniteness example of reagent Crohn disease, ulcerative colitis) comprises following: budenoside; Urogastron; Reflunomide; S-Neoral, the yellow pyridine of willow nitrogen; Aminosallcylic acid; Ismipur; Azathioprine; Metronidazole,clotrimazole and chlorhexidine acetate suppositories; Lipoxygenase inhibitor; Mesalamine; Olsalazine; Balsalazine; Antioxidant; The thromboxan inhibitor; The IL-1 receptor antagonist; Anti-IL-1 monoclonal antibody; Anti-IL-6 monoclonal antibody; Somatomedin; Elastase inhibitor; Pyridyl-imidazolium compounds; TNF antagonist described herein; IL-4, IL-10, IL-13 and/or TGFb cytokine or its agonist (for example, agonist antibody); IL-11; Prednisolone, glucuronic acid or the dextran of dexamethasone or budesonide are puted together precursor; (ISIS 2302 for ICAM-1 antisense phosphorothioate ester oligodeoxyribonucleotide; Isis Pharmaceuticals, Inc.); Soluble complement acceptor 1 (TP10; T Cell Sciences, Inc.); The mesalazine of Shi Fanging at a slow speed; Methotrexate; The antagonist of platelet activating factor (PAF); Ciprofloxacin; And lignocaine.

In some embodiments, the GITR antagonist (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL) can use with one or more antibody, other participates in for example target of transplant rejection or graft versus host disease of immune response regulation described antibody target.Can with GITR antagonist of the present invention (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL) be used for the treatment of together or non-limiting example that epidemic prevention is replied comprises following: the antibody of anti-other cell surface molecule, described cell surface molecule includes but not limited to CD25 (interleukin 2 receptor α), CD11a (LFA-1), CD54 (ICAM-1), CD4, CD45, CD28/CTLA4, CD80 (B7.1) and/or CD86 (B7.2).In another scheme, for example cyclosporin A or FK506 use GITR antagonist (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL) with one or more common immunosuppressor.

In another embodiment, GITR antagonist (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITRL) can be used as the vaccine adjuvant of anti-autoimmune disease, inflammation or transplant rejection.The adjuvant combination that is used for the treatment of these type illnesss is fit to use with antigen widely, and described antigen promptly participates in autoimmune autoantigen, for example myelin basic protein from by the autoantigen of target; The inflammatory autoantigen is 4 amyloid albumen or transplantation antigen isoantigen for example for example.Described antigen can comprise and derives from proteic peptide or polypeptide and following any one fragment: carbohydrate, albumen, polynucleotide or oligonucleotide, autoantigen, 4 amyloid albumen, transplantation antigen, anaphylactogen or other macromolecular components.In some cases, antigenic composition comprises and surpasses a kind of antigen.

For example, want be used for vertebrate host alleviate the vaccine that anaphylactogen is replied comprise comprise anaphylactogen or its segmental those, described vaccine comprises adjuvant combination of the present invention.At U.S. Patent number 5,830,877 and disclosed international patent application no WO 99/51259 in the example of this class anaphylactogen has been described, quote it herein in full as a reference, described example comprises pollen, insect venom, animal soft flocks, fungal spore and medicine (for example penicillin).Described vaccine disturbs the IgE production of antibodies, and described IgE production of antibodies is anaphylactoid known reason.In another embodiment, want comprise adjuvant of the present invention combination be used to prevent or the vaccine for the treatment of disease comprises the vaccine that comprises 4 amyloid albumen (APP), described disease is characterised in that the amyloid deposition in the vertebrate host.This disease has different titles: the disease of Ai Ercihai Mo's disease, amyloidosis or generation starch.Therefore, vaccine of the present invention comprises fragment and anti-A β peptide or its segmental antibody of adjuvant combination of the present invention and A β peptide and A β peptide.

Method: the 1) function of downward modulation antigen presenting cell; With 2) be used to control the combined therapy of immunosuppressive action, well-known in this area (referring to, for example, people (2003) Dendritic cell vaccine design:strategies for elicitingperipheral tolerance therapy of autoimmune diseases.BioDrugs17:103-11 such as Xiao; Kuwana (2002) Induction of anergic and regulatoryT cells by plasmacytoid dendritic cells and other dendritic cellsubsets.Hum.Immunol.63:1156-63; People such as Lu (2002) Manipulationof dendritic cells for tolerance induction in transplantationand autoimmune disease.Transplantation 73:S19-S22; People such as Rifle (2002) Dendritic cells and second signal blockade:a steptoward allograft tolerance.Transplantation 73:S1-S2; People such as Mancini (2004) The management of immunosuppression:the art and thescience.Crit.Care.Nurs.Q.27:61-64).

Therefore another aspect of the present invention relates to and is used for test kit that GITR antagonist (for example, GITRL inhibitory polynucleotide, antagonism small molecules and/or at the neutralizing antibody of GITR and/or GITRL) is used with other treatment compound.In one embodiment, described test kit comprises one or more and is formulated in for example therapeutical agent of correct preparation in one or more separated drug preparations of wedding agent in the pharmaceutical carrier and at least a reagent.

By the following embodiment that relates to new mouse cDNA (be called mouse GITRL cDNA, coding is called the new ligand polypeptide of mouse GITRL) and new anti-GITRL antibody the present invention is described.Those skilled in the art understand all homologues that instruction among the described embodiment can be used for mouse GITRL.

Embodiment

The following example is used for helping to understand the present invention, but and does not mean that and not should be understood to limit by any way its scope.Described embodiment does not comprise the detailed description of ordinary method, for example flow cytometry (for example, FACS), PCR, Norhtern and in situ hybridization, or be used for the carrier structure, the gene of coded polypeptide inserted this class carrier and plasmid, these carriers and plasmid are imported host cell and express method from the polypeptide of these carriers and plasmid at host cell.These methods are known for a person skilled in the art.

Embodiment 1

The evaluation of GITRL dna sequence dna

The evaluation of embodiment 1.1 mouse GITRL cDNA and genome sequence

Adopt two methods to identify murine GITRL homologue.In a method, the aminoacid sequence (from GenBank recording mechanism AX077015) of people GITRL is used at div1; Div2; Div3; Div4; Gbdiv_cu; Celera mouse (cm); Carrying out Tblastn with the draft_mouse-dna database searches.Genome sequence ga_69772862.cm_4 is accredited as an investigated possibility target.By using expected value (E)=10 (default), 100 and 1000, the aminoacid sequence of end user GITRL (GenBank recording mechanism AX077015) has been identified the aminoacid sequence of disappearance at the Tblastn inquiry that does not shield Celera mouse genome set (cm).Genome sequence ga_x5j8b7w7wj5_041.cm_aa_2 is accredited as the genome sequence that comprises described disappearance aminoacid sequence.

In another method, use expected value (E)=10 (default) and 1000, the aminoacid sequence of people GITRL (GenBank recording mechanism NM_005092) is used for inquiring about at the Tdblastn that shields Celera mouse genome set (cm).Gene order ga_x5j8b7w7wj5_041.cm_aa_2 is accredited as the genome sequence that comprises three high score pairings (HSP) zone.

Make up the mouse cDNA sequence of supposition based on three HSP zones that in above-mentioned Tblastn inquiry, obtain.This cDNA sequence of relatively editor based on the comparison between the supposition exon sequence of the mouse of described three people's exon sequences and three deductions, described three people's exon sequences have corresponding to the people's gene group sequence from celera (ga_x2htb13vud5_66.ch_r25h_1), and the supposition exon sequence of the mouse of described deduction has corresponding to the mouse genome sequence from Celera (ga_x5j8b7w7wj5_041.cm_aa_2).This editor has considered that human sequence's splicing connects.Described editor's mouse GITRL cDNA sequence comprises the open reading frame of 519bp (encoding sequence of 522bp), corresponding to 173 amino acid whose albumen.

From the thymus gland cDNA library of mouse, isolate corresponding physical cDNA clone based on the genome sequence design primer of the mouse GITRL exon of supposing and by PCR.The sequence of forward (SEQ IDNO:4) and reverse (SEQ ID NO:5) PCR primer is:

5 ' ATGGAGGAAATGCCTTTGAGAG 3 ' (forward primer) and

5 ' GAATGGTAGATCAGGCATTAAGATG 3 ' (reverse primer).

With the fragment subclone of gained and use standard method to determine described dna sequence dna.The fragment of gained determines to exist the mouse GITRLcDNA of the exon (referring to following) that comprises all three predictions.By this gained cDNA clone's pcr amplification, this fragment is further extended the last encode fragment (2 amino acid) to comprise described cDNA.Forward of this step (SEQ ID NO:6) and inverse PCR primer (SEQ ID NO:7) sequence are:

5′TTTAAAGTCGACCCACCATGGAGGAAATGCCTTTGAGAG?3′

(forward primer)

5′TTTAAAGAATTCTCATTAAGAGATGAATGGTAGATCAGGCAT?3′

(reverse primer)

Described forward PCR primer comprises the SalI site, is used for the Kozak sequence of translation initiation and the ATG of coding initial methionine.Described reverse primer comprises the EcoRI site.Described SalI and EcoRI site are used for directed cloning, and the sequence of carrying out final cDNA clone is determined.

The full length cDNA sequence of mouse GITRL and its derivation aminoacid sequence are listed in SEQID NO:1 and SEQ ID NO:2 respectively.The comparison of people GITRL cDNA (SEQ ID NO:8) and mouse GITRLcDNA sequence shows 69.6% identity.The identity of the comparison demonstration 54.1% of people GITRL amino acid (SEQ ID NO:9) and mouse GITRL aminoacid sequence (Fig. 1) and 60.0% similarity.This amino acid identity degree is similar to the identity degree between the homologue of other TNFR part (people (1998) Int.Immunol.10:517-26 such as Oshima) that is present in people and mouse usually.

The comparison of described clone's mouse GITRL cDNA (SEQ ID NO:1) and public obtainable mouse database has shown single nucleotide polymorphism (SNP) (have the A/C transversion on 470 nucleotide sites of SEQ ID NO:1 in exon 3, cause on 157 amino acid sites of SEQ ID NO:2 arginine to the transformation of Threonine) at the coding region of mouse GITRL.

The GITRL cDNA sequence of described mouse comprises three exons and two introns (referring to following table 2) with relatively demonstration mouse GITRL seat from the mouse genome sequence (ga_x5j8b7w7wj5_041.cm_aa_2) of above-mentioned Celera, wherein has good conservative property between mouse and the people GITRL on exon size and position.Described mouse GITRL genomic dna sequence is listed in SEQ ID NO:3.

Table 2

Zone among the SEQ ID NO:3	Sequence character	Length (bp)	Position among the SEQ ID NO:1
				1-255	5 '-sequence	255	-
256-390	Exon #1	135	1-135
				391-6010	Intron #1	5620	-
6011-6044	Exon #2	34	136-169
				6045-8990	Intron #2	2946	-
8991-9340	Exon #3	350	170-519
				9341-9343	Terminator	3	520-522
9344-10289	3 '-sequence	946	-

On exon size and introne position, there is good conservative property between the GITRL genomic dna sequence that relatively is presented at people and mouse of the genome structure (table 2) of mouse GITR and the genome structure of people GITRL (referring to following table 3).People GITRL genomic dna sequence is shown among the SE ID NO:10.

Table 3

Zone among the SEQ ID NO:10	Sequence character	Length (bp)	Position among the SEQ ID NO:8
				1-421	5 '-sequence	421	-
422-577	Exon #1	156	1-156
				578-7348	Intron #1	6771	-
7349-7379	Exon #2	31	157-187
				7380-9604	Intron #2	2225	-
9605-9948	Exon #3	344	188-531
				9949-9951	Terminator	3	532-534
9952-10331	3 '-sequence	380	-

The hydrophobic character of embodiment 1.2 mouse GITRL

Determine the hydrophobic character of mouse GITRL by TopPred (Claros and von Heijne (1994) Comput.Appl.Biosci.10:685-6).At the curve display of the hydrophobicity of mouse GITRL (SEQ ID NO:2) the amino-acid residue marking hydrophobic region of the single supposition between amino acid 25-50 roughly, be similar to people's GITRL.This hydrophobic fragment is corresponding to the diaphragm area of striding of the II type transmembrane protein of predicting.

Embodiment 2

The tissue expression of mouse GITRL

By Northern hybridization, in situ hybridization and PCR in real time (for example, people (1996) Genome Res.6:986-94 such as Heid; People such as Mullah (1998) Nucleic Acids Res.26:1026-31; People such as Giulietti (2001) Methods 25:386-401) will be used to check the GITRL of several murine tissue samples to express based on the oligonucleotide probe of mouse GITRL cDNA sequence (SEQ ID NO:1).

Have just detectable transcript although Northern hybridization is presented at heart, spleen, lung, lymphoglandula, kidney and liver, in situ hybridization subsequently shows that GITRL expresses in heart, spleen, lymphoglandula and thymus gland.The expression of GITRL in these tissues is limited to the cortex and the medullary substance district of pericardium and endocardium, the white pulp of spleen, the cortex of lymphoglandula, secondary cortex and the medullary substance district and the thymus gland of heart usually.

Further determine the expression of GITRL in thymus gland, spleen and lymphoglandula by the PCR in real time analysis.GITRL expresses with highest level in the splenocyte (mainly being bone-marrow-derived lymphocyte) of spleen and lipopolysaccharides (LPS) stimulation.Detecting low-level GITRL inconspicuous at stomach, brain and kidney expresses.The CD25 that the PCR in real time analysis is also shown in liver, is activated ^-Cell, the CD25 that is activated ⁺There is the GITRL transcript in cell and the concanavalin A activated lymph-node cell, although degree is lower than the splenocyte (blast) of spleen and LPS stimulation.CD25 at tranquillization ^-Or CD25 ⁺Not detecting GITRL in the cell expresses.The PCR in real time of the dendritic cell that derives from marrow (DC) that prematurity and LPS stimulate proves that also the baseline GITRL of immature DC expresses, and this is expressed in the LPS stimulation increased after 24 hours, was lower than baseline but be reduced to after LPS stimulates 48 hours.The expression degree that also detects at all GITRL in the endothelial cell line (bEND3, C166, EOMA, MSI and SVEC4-10) of check is different, when stimulating described cell with LPS, proves that the expression of GITRL keeps constant relatively.On the contrary, in following murine clone, do not detect GITRL cDNA:E10 T clone by PCR without the particular source that stimulates, T2 embryo thymus gland system, T10 plasmoma, EL4 thymoma, BAF3 and PREBpre-B clone, B9 B cell hybridoma, DA1G monocyte, M1 monocyte, the myeloma of FBMD-1 embryonic bone, P19 embryonal carcinoma, MDF liver and E14 embryonic stem cell clone.

Embodiment 3

The functional expression of recombined small-mouse GITRL

Embodiment 3.1GITRL combines with cell surface GITR's

For determining in embodiment 1 whether encoding function GITR part (GITRL) of isolating mouse cDNA, with expressing the Cos cell (IL-21R-Flag-Cos) of the control mice IL-21 acceptor that the Cos cell (GITRL-Flag-Cos) of the mouse GITRL that merges with the FLAG epi-position or expression and FLAG epi-position merge and 293T cell (GITR-293T) cultivation of expression mouse GITR, carry out different time spans.Use the anti-Flag antibody (PE-FLAG) of phycoerythrin mark and the anti-GITR antibody of fluorescein isothiocyanate (FITC) mark to detect cell-cell interaction by flow cytometer.Even at GITR-293T and GITRL-Flag-Cos cell altogether after centrifugal 1 minute, about 90% GITR-293T cell (by the FITC fluoroscopic examination) has dyed FLAG (by the PE fluoroscopic examination) altogether, show that the GITR-293T cell combines with the GITRL-Flag-Cos cell, and this interaction keeps always in whole 60 minutes experiment.On the contrary, all do not catch FLAG significantly altogether with the GITR-293T cell of IL-21R-Flag-Cos co-culture of cells even at centrifugal back 60 minutes.Isolating mouse cDNA coding can be in conjunction with the functional GITRL of cell surface GITR in embodiment 1 in these data acknowledgements.

Embodiment 3.2GITRL combines with soluble g ITR's

Cos cell (GITRL-Cos) by will expressing mouse GITRL or simulate infected Cos cell and determine the ability of mouse GITRL in conjunction with GITR with the reorganization GITR incubation of the Fc part that merges human IgG (GITR-Fc) or contrast IgG (HIgG).Use is puted together the anti-people's antibody of donkey (FITC-Ab) of FITC and is determined the combination of GITR-Fc to GITRL by flow cytometer.Compare with the incubation (7.9%) of contrast HIgG with the GITRL-Cos cell, the incubation of GITRL-Cos cell and GITR-Fc causes the combination of FITC-Ab (28.8%) to increase by 3.6 times.Undyed GITRL-Cos cell, with the GITRL-Cos cell of CTLA-4:Fc fusion rotein and FITC-Ab incubation with do not manifest fluorescence with the GITRL-Cos cell of FITC-Ab incubation separately.That handles does not show any observable fluorescence with untreated simulated infection Cos cell.These data show that isolating mouse cDNA coding can be in conjunction with the functional GITRL of soluble g ITR in embodiment 1.

Embodiment 4

Mouse GITRL causes CD4 with combining of GITR ⁺CD25 ⁺The propagation of cell

Under conjugated protein existence of different concns GITR or non-existent situation, by using about 50,000 splenocyte and 100IU/ml IL-2 that removes the T cell through radiating stimulates about 50,000 murine T cells to determine the influence of GITRL:GITR in conjunction with on cell proliferation in 65-72 hour.Two kinds of conjugated protein these mensuration that are used for of GITR: the anti-GITR antibody of excitability (referring to, for example, people such as McHugh (2002) Immunity 16:311-23; Also referring to U.S. Patent application 10/194,754) or at the mouse GITRL of the surface expression of modified rat YB2/0 cell (GITRL-YB2/0).By at last 6-12 hour that cultivates with 1 μ Ci ³H-thymidine pulse labelling cell is measured with scintillometer then ³The propagation of cell is measured in the integration of H-thymidine.

As shown in Fig. 2 A, CD4 ⁺CD25 ^-The T cell does not produce the anti-GITR antibody of any concentration and replys.On the contrary, anti-GITR antibody is tried to stimulate on the concentration CD4 at all ⁺CD25 ⁺The propagation of T cell.For example, under the situation that the minimum anti-GITR antibody that is tried titre (about 0.02 μ g/ml) exists, cultivate CD4 ⁺CD25 ⁺The T cell causes ³The integration of H-thymidine (about 15,000cpm) surpass under the non-existent situation of anti-GITR antibody about 3 times of cultured cells.Anti-GITR antibody stimulates CD4 ⁺CD25 ⁺It is about 45 that the ability of T cell proliferation reaches when antibody concentration is about 0.3 μ g/ml, and the platform of 000cpm is integrated than culturing cell under the non-existent situation of anti-GITR antibody ³The H-thymidine has increased about 9 times.

Be similar to the result who obtains with anti-GITR antibody, the GITRL-YB2/0 cell does not stimulate CD4 ⁺CD25 ^-The propagation of T cell (Fig. 2 B).On the contrary, the GITRL-YB2/0 cell stimulates CD4 significantly ⁺CD25 ⁺The propagation of T cell.For example, under the situation that about 10,000 GITRL-YB2/0 cells exist, cultivate CD4 ⁺CD25 ⁺Cultured cells increases about 4-5 doubly under the situation that the T cell causes existing than the YB2/0 cell at the unmodified of equal amts ³The H-thymidine is integrated.The number of YB2/0 cell is increased to cultured cells under about 50,000 situations that cause existing than the YB2/0 cell at the unmodified of equal amts to be increased about 15 times ³The H-thymidine is integrated (Fig. 2 B).

Embodiment 5

Mouse GITRL reverses CD4 with combining of GITR ⁺CD25 ⁺T cell-mediated to CD4 ⁺CD25 ^-The effect of T cell inhibiting

The front described the T cytostatics assay method that is used for these embodiment (referring to, for example, Thornton and Shevach (2000) J.Immunol.164:183-90; People such as McHugh (2002) Immunity 16:311-23; Two parts of documents are incorporated herein by reference).In brief, remove the new isolating inhibition CD4 of splenocyte, 0.5 μ g/ml anti-cd 3 antibodies and the various numbers of T cell at 50,000 light radiating ⁺CD25 ⁺Cultivate under the situation that the T cell exists about 50,000CD4 ⁺CD25 ^-Effector T cell.Measure by scintillometer then ³H-thymidine integration amount is measured about 50,000 and is reversed CD4 through the anti-GITR antibody of radiating GITRL-YB2/0 cell or 2 μ g/ml excitabilities ⁺CD25 ^-The ability of inhibition of proliferation effect.

As shown in Fig. 3 A, CD4 ⁺CD25 ⁺Cell reduces CD4 in dosage dependence mode ⁺CD25 ^-The propagation of cell.Anti-GITR antibody and GITRL-YB2/0 cell are at the whole CD4 that tried ⁺CD25 ⁺Can both fully reverse in the number range of SC CD4 ⁺CD25 ^-The inhibition of proliferation effect.Therefore, GITRL resembles with combining of its acceptor GITR and has blocked CD4 the combining of the anti-GITR antibody of excitability and GITR ⁺CD25 ⁺The cell inhibiting sexual function.The inhibiting ability of GITRL-YB2/0 cell reversal takes place in dosage dependence mode, is low to moderate approximately 3 in this mensuration, and the 000GITRL-YB2/0 cell reverses at least in part or reduces restraining effect (Fig. 3 B).The YB2/0 cell of not modified YB2/0 cell and expression GITR is to CD4 ⁺CD25 ⁺The cell-mediated restraining effect of T does not all have observable influence (Fig. 3 A).

With with new isolating CD4 ⁺CD25 ⁺The result that the T cell obtains is opposite, and GITRL:GITR is in conjunction with for by with anti-cd 3 antibodies, the splenocyte of removing the T cell and IL-2 activated CD4 ⁺CD25 ⁺The cell-mediated restraining effect of T has from very little to the influence of not having (Fig. 4).Anti-GITR antibody and about 50, the adding of 000GITRL-YB2/0 cell all can not reverse by 25,000 through activated CD4 ⁺CD25 ⁺The restraining effect that T is cell-mediated.Yet, when still less through activated CD4 ⁺CD25 ⁺When the T cell added described mensuration (for example, about 1,500-12,500 cells), anti-GITR antibody and GITRL-YB2/0 cell can partly reduce but can not eliminate restraining effect fully.

Embodiment 6

Anti-mouse GITRL antibody recovers by CD4 ⁺CD25 ⁺The restraining effect that T is cell-mediated

The separation of embodiment 6.1 anti-mouse GITRL antibody

By producing the specific antibody of mouse GITRL with rat YB2/0 cell (GITRL-YB2/0) immune rat of expressing mouse GITRL cDNA.Use method well known in the art, set up antibody hybridoma and screen anti-hybridoma of expressing the Phoneix cell of mouse GITRL by the use flow cytometer.Identified that two specific specificity ground is in conjunction with the GITRL-Phoenix cell but the antibody 5F1 and the 10F12 of the Phoenix control cells of debond simulated infection.On July 22nd, 2003, these antibody hybridomas were deposited in American type culture collection (American Type Culture Collection) (ATCC); ATCC preserving number PTA-5336 gives hybridoma 10F12 for hybridoma 5F1 and preserving number PTA-5337.

Embodiment 6.2 anti-mouse GITRL antibody blocking GITRL are to CD4 ⁺CD25 ⁺The effect of T cell inhibiting activity

Described in top embodiment 5, can reverse by new isolating CD4 at the YB2/0 cell of its cell surface expression GITRL ⁺CD25 ⁺The inhibition CD4 that T is cell-mediated ⁺CD25 ^-The effect of T cell proliferation.For determining whether anti-GITRL antibody can recover CD4 ⁺CD25 ⁺The restraining effect that T is cell-mediated, the T cell that carries out among the embodiment 5 under 5F1 or the anti-GITRL antibody of 10F12 or control antibodies existence or non-existent situation suppresses to measure.

As seeing among the embodiment 5, under the situation that the GITRL-YB2/0 cell exists, CD4 ⁺CD25 ^-Effector T cell and new isolating CD4 ⁺CD25 ⁺The cultivation of suppressor T cell causes CD4 ⁺CD25 ^-Inhibiting reverse fully (Fig. 5 A and the 5B) of cell proliferation.In measuring thing, add the 10% hybridoma culture supernatant that contains the anti-GITRL antibody of 5F1 and cause partly (Fig. 5 B) extremely almost completely (Fig. 5 A) recovery CD4 ⁺CD25 ⁺The restraining effect of mediation.Add the anti-GITRL antibody of 10F12 and produce similar result.As expection, under the situation that control antibodies (" contrast Ig ") exists, there is not the influence (Fig. 5 B) of the observable inhibiting ability of reverse to the GITRL-YB2/0 cell.These data show anti-GITRL antibody blocking GITRL close CD4 ⁺CD25 ⁺The ability of cell inhibiting activity.

Embodiment 6.3 anti-mouse GITRL antibody are only at CD4 ⁺CD25 ⁺Suppressor T cell is replied under the situation that the T cell exists

Removing CD4 ⁺CD25 ⁺Before the T cell (Fig. 6 A) or afterwards (Fig. 6 B) under the situation that the excitability anti-cd 3 antibodies of various concentration exists, stimulate lymph-node cell culture, measure by scintillometer then ³H-thymidine integration amount is determined propagation.For determining of the influence of anti-GITRL antibody, in parallel culture, add the 10% hybridoma culture supernatant that contains the anti-GITRL antibody of 5F1 to propagation.

As shown in Fig. 6 A, comprise CD4 when stimulating to about 0.75 μ g/ml anti-cd 3 antibodies with about 0.075 μ g/ml ⁺CD25 ⁺During the lymph-node cell of T cell, the adding of anti-GITRL antibody has suppressed the propagation of described cell.Comprise CD4 when stimulating with 1.0 μ g/ml anti-cd 3 antibodies ⁺CD25 ⁺During the lymph-node cell of T cell, under the situation that anti-GITRL antibody exists, do not observe restraining effect.With with comprising CD4 ⁺CD25 ⁺The result that the lymph-node cell of T cell obtains is opposite, and the adding of anti-GITRL antibody is usually to removing CD4 ⁺CD25 ⁺The lymph-node cell culture of T cell does not have retarding effect (Fig. 6 B).Generally speaking, the anti-GITRL antibody blocking of these data suggest at CD4 ⁺CD25 ⁺GITR that expresses on the T cell and the interaction between the GITRL that expresses on other cell, and the interactional blocking-up of this GITR/GITRL has strengthened CD4 ⁺CD25 ⁺The regulatory function of T cellular-restoring immunosuppressive action.

Embodiment 7

The distribution of GITRL express cell in Lymphoid tissue

Use the anti-GITRL antibody of excitability to check the expression of GITRL in mouse tissue by flow cytometer.New isolating express CD4, only express CD8's or express the CD11c of CD4 and CD8 simultaneously ⁺Low-level GITRL (Fig. 7 A) is expressed on spleen dendritic cell (DC) subclass composing type ground.Yet, at CD11c ^LowB220 ⁺The significantly higher GITRL surface expression of performance in plasmocyte dendritic cell people such as (, 2001) Nakano.In Fig. 7 B, with anti-GITRL mAb or isotype control antibodies to described from BALB/c mouse new isolating CD11c ⁺The hypotype of spleen DC dyes.

Similarly, as peritonaeum B-1B cell (perCD11 b ⁺B220 ⁺) the same, new isolating B220 ⁺GITRL (although with higher horizontal expression) (Fig. 7 C, top) is expressed on splenocyte composing type ground.Also find peritoneal macrophages (the perC CD11b of tranquillization ⁺B220 ^-) express this part (Fig. 7 C, below).

But the thymocyte hypotype of selecting is not expressed the GITRL (Fig. 7 D) of measured quantity.On the contrary, as showing among Fig. 7 E, at all CD4 ^-CD8 ^-Detect the expression of GITRL in the hypotype of thymus gland precursor, wherein CD4 ⁺CD25 ⁺(R2) and 44 ^-25 ⁺(R3) the subtype expression level is the highest.

In without the lymph-node cell that stimulates, do not detect GITRL (Fig. 7 F).In without the splenic t-cell that stimulates, do not detect GITRL (data not shown) yet.The expression of these digital proofs GITRL is by special antigen presenting cell (DCs, B cell and scavenger cell; Fig. 7 A-7C) and thymus gland CD4 ^-CD8 ^-Precursor cell (Fig. 7 E) carries out, rather than by the T cell of selecting (Fig. 7 D) or at the tranquillization T of periphery cell (without the lymphoglandula and the splenocyte that stimulate; Fig. 7 F, data not shown) carry out.These data are relevant with the data that obtain by the Northern hybridization described in the embodiment 2, in situ hybridization and PCR in real time.

Embodiment 8

Stimulate back APCs downward modulation GITRL at TLR

After with Toll sample acceptor (TLR) part or anti-CD40 and IL-4 or anti-IgM processing, observe the influence that the B cell activation is expressed GITRL.Spleen B cell (B220 ⁺Splenocyte) or peritonaeum B-1B cell (B220 ⁺CD11b ⁺PerC) stimulation causes the quick but of short duration rise of GITRL, and described rise is handled became in back 4 hours obviously (Fig. 8 A) at great majority.After stimulation 48-60 hour, express and drop to the level that is lower than before stimulating and keep stable.The B-1B cell of handling from the polyI:C of peritoneal cavity is an exception, and described cell is this downward modulation phenomenon of performance on the time point that detects not.As what expect, the level of CD86 increases in whole experiment in all groups, shows that observed GITRL downward modulation is not because (data not shown) that necrocytosis causes.

After the GITRL minimizing hint of handling back B cell expressing with anti-CD40 and IL-4 is providing the T cell help, express and to be regulated.Cultivating the GITRL expression of estimating B cell in all splenocytes in the back with anti-cd 3 antibodies.Under these culture condition, after 48 hours at B220 ⁺The GITRL that expresses on the splenocyte is also by downward modulation (Fig. 8 B).Therefore, the physiology level of T cytoactive also causes the expression of spleen B cell GITRL to descend.

With enrichment with magnetic bead spleen CD11c ⁺DCs also checks the expression of GITRL after cultivating 12 and 36 hours under the condition that LPS exists.The DCs of cultivation in substratum or LPS expressed GITRL at initial 12 hours, and LPC induces the rise of moderate.Yet, after 36 hours, in DCs that LPS handles and the DCs that only in substratum, cultivates, all do not detect the expression of GITRL.Fig. 8 C is presented on the specified time point, is using or is cultivating the CD11c of back by purifying without LPS (0.5 μ g/mt) ⁺GITRL (top histogram) and CD86 (B7.2) (below histogram) that DCs expresses.As shown in the figure, as expected, the up-regulated of CD86 (B7.2) (Banchereau and Steinman, 1998).The expression that decline hint " spontaneous " DC maturation that the GITRL of the spleen DCs of cultivation in substratum expresses is enough to reduce GITRL, described maturation occurs in the vitro culture phase (Vremec and Shortman, 1997).Therefore, only show the post-stimulatory result of LPS, although DCs has accepted the processing the same with the B cell.Similar with the result of another open report people such as (, 2003) Tone, find that the DCs composing type ground that derives from marrow expresses GITRL, and only remarkable decline (not display data) after handling with various TLR parts of this expression.

Spleen cell cultures is not after 48 hours when not having ("+Med. ") at the solubility anti-cd 3 antibodies or having ("+aCD3 "), and CD4 and cd8 t cell have been expressed measurable GITRL level (Fig. 8 D), affirmed the PCR in real time (yet referring to embodiment 2) of front.

Embodiment 9

The interactional blocking-up of GITR/GITRL has suppressed lymphocytic propagation

Because GITRL is expressed on APCs composing type ground, and, GITR/GITRL is considered to eliminate CD4 because interacting ⁺CD25 ⁺Therefore T cell inhibiting sexual function checks anti-GITRL antibody to strengthen by the endogenous CD4 that is present in the secondary lymphatic organ ⁺CD25 ⁺The inhibiting ability of T cell colony mediation.To total lymph-node cell (LN), total splenocyte (Sp) with remove CD25 ⁺The propagation of the LN of cell or Sp (Δ 25) is replied and is compared, and described various types of cells is with anti-GITRL antibody (filled circles) or control antibodies (rat IgG; Open circles) cultivates.The adding of anti-GITRL antibody has reduced the propagation of total lymph-node cell and has replied (Fig. 9 A, upper left side) and reply (Fig. 9 A, lower left) with the propagation that lower degree reduces total splenocyte.Yet, removing CD25 ⁺Retarding effect also clearly (Fig. 9 A, upper right side (LN) in the culture of cell; Lower right (Sp)), might the GITR/GITRL interaction be CD25 like this ^-The T cell provides costimulatory signal.

For this possibility of direct survey, under the situation of YB2/0 cell of expressing GITRL and APCs existence, check the CD4 of purifying ⁺CD25 ^-And CD8 ⁺The propagation of T cell is replied.Under the situation that the cell of expressing GITRL exists, CD4 ⁺CD25 ^-And CD8 ⁺The propagation of T cell has all obtained significantly increasing (Fig. 9 B), this when the anti-CD3 of lower concentration at CD4 ⁺CD25 ^-Especially obvious in the T cell.

Might contradiction be, anti-GITR antibody by with CD4 ⁺CD25 ^-The T cytosis mediates its effect, because tranquillization T cell is only expressed very low-level GITR.Yet, raise (Fig. 9 C) in the expression of GITR behind the t cell activation fast and solve described contradiction reaching highest level after the activation between 48 and 72 hours by proof.These results support GITR/GITRL to interact can influence CD4 ⁺CD25 ^-T cell activation, and do not rely on modulability CD4 ⁺CD25 ⁺The T cell.

Embodiment 10

Inhibiting reverse requires CD25 ^-T cell expressing GITR

Research hint GITR in the past is connected to CD4 ⁺CD25 ⁺Suppress its inhibition ability (people such as McHugh, 2002 on the T cell; People such as Shimizu, 2002).Yet because also express GITR through activated T cells, we wish to determine to cause the GITR bonded relevant cell target of restraining effect elimination.Use is from GITR ⁺/ ⁺And GITR ^-/-The CD4 of mouse (Figure 10) ⁺CD25 ⁺And CD4 ⁺CD25 ^-The combination coculture of T cell is measured propagation under anti-GITR mAb (DTA-1) existence or non-existent situation.As (people such as Shimizu, 2002) of former report, as described CD4 ⁺CD25 ⁺And CD4 ⁺CD25 ^-When the T cell is all expressed GITR,, in coculture, add anti-GITR mAb and cause propagation to reply increase (Figure 10 A, a group) with respect to the coculture of accepting isotype antibody.Work as CD4 ⁺CD25 ^-But not CD4 ⁺CD25 ⁺When the T cell is expressed GITR in coculture, add anti-GITR antibody and cause being similar to and work as CD4 ⁺CD25 ⁺The increase of observed T cell proliferation during T cell expressing GITR (Figure 10 A, b group).Yet, at CD4 ⁺CD25 ^-GITR ^-/-And CD4 ⁺CD25 ⁺GITR ⁺/ ⁺In the coculture of T cell, the adding of anti-GITR antibody is to not influence of propagation (Figure 10 A, c group).As expected, to CD4 ⁺CD25 ^-GITR ^-/-And CD4 ⁺CD25 ⁺GITR ^-/-Add anti-GITR antibody in the coculture of T cell to T cell proliferation also not influence (Figure 10 A, d group).The anti-mGITR antibody preparation of buying with commerce of polyclone can obtain and the similar result of The above results (data not shown).

Use rat effect in front and mouse CD4 ⁺CD25 ⁺The strong evidence of hypothesis below obtaining to support in the research of regulatory T cells people such as (, 2002) Shimizu combination, described hypothesis is: inhibiting elimination is because CD4 ⁺CD25 ⁺The connection of the GITR of T cell expressing.In rat, produce the anti-GITR mAb (DTA-1) that is used for these researchs, so its debond rat cell (id.).Use rat CD4 ⁺CD25 ^-Effector cell, mouse CD4 ⁺CD25 ⁺SC and be similar to the experiment of above-mentioned experiment through the coculture of radiating rat APCs (Figure 10 B, b group).Be total to the mouse CD4 that cultivates ⁺CD25 ⁺Effector cell, mouse CD4 ⁺CD25 ⁺SC and through radiating rat APCs with comparing (Figure 10 B, a group).With from GITR ^-/-The data that obtain in the mouse are similar, unless the GITR crosslinkable is being replied CD25 ^-In the colony (Figure 10 B, a group), otherwise CD4 ⁺CD25 ⁺The restraining effect of mediation can not be eliminated (Figure 10 B, b group).

By the rat CD4 of flow cytometer inspection by common cultivation ⁺CD25 ^-With mouse CD4 ⁺CD25 ⁺The CFSE of T cell dilution finishes the further analysis of rat/mouse system.Under the situation that the isotype control antibodies exists, when cultivating with the ratio of 1: 8 SC pairing effect cell, rat CD4 ⁺CD25 ^-The T cell is just partly by mouse CD4 ⁺CD25 ⁺The T cell suppresses (Figure 10 C, left side histogram).Yet the adding of anti-GITR antibody causes mouse CD4 ⁺CD25 ⁺The amplification that the T cell is extra, the result causes the increase of rat T cyto-inhibition (Figure 10 C, the right histogram).After GITR connects, can partly suppress the mouse CD4 that increases by adding the barrier anti-CD 25 antibody ⁺CD25 ⁺The CFSE dilution of T cell is hinting that this amplification also requires the initial IL-2 (data not shown) that produces of effector T cell.Generally speaking, these results have proved indisputablely needs GITR and effect CD4 ⁺CD25 ^-The joint of T cell overcomes CD4 ⁺CD25 ⁺The restraining effect that T is cell-mediated.

Embodiment 11

The restraining effect of regulating and overcoming endogenous regulatory T cells mediation needs the expression of GITR signal

Because as if CD28 and GITR all provide costimulatory signal in the activation process of T cell, so we attempt to determine whether it plays a part different in primary response.We have compared at endogenous lymphoglandula CD4 ⁺CD25 ⁺The T cell exist and non-existent situation under and external source IL-2 (Figure 11) exists and non-existent situation under the ability of GITR and CD28 raising T cell proliferation.The same sample that after cultivating 72 hours, is used for proliferation research simultaneously with regard to CFSE dilution estimation.Under the non-existent situation of external source IL-2, from GITR ^-/-And CD28 ^-/-The CD4 of animal ⁺And CD8 ⁺The T cell is not bred (Figure 11 A, a group).From GITR ⁺/ ^-The LN cell performance of animal is between wild-type and GITR ^-/-Intermediate phenotype between the phenotype of animal (Figure 11 A, a group) is being removed CD25 ⁺Behind the T cell,, show that restraining effect under these culture condition is by the CD25 that resides in the normal lymphoglandula from the remarkable increase of replying of the T cell of wild-type mice ⁺T cell-mediated (Figure 11 A, relatively a and b group).The most important thing is, at CD4 ⁺CD25 ⁺Under the non-existent condition of T cell, as pass through ³H-thymidine integration (Figure 11 A, b group) and CSFE dilution (Figure 11 B, top picture group) are estimated, from GITR ^-/-The CD4 of mouse ⁺And CD8 ⁺Lymphoglandula T cell reply with wild-type mice quite.Yet, after 72 hours, even at CD4 ⁺CD25 ⁺Under the non-existent situation of T cell, from CD28 ^-/-The CD4 of animal ⁺And CD8 ⁺The T cell is not bred (Figure 11 A, b group).

When external source IL-2 joins in the complete lymph-node cell culture, observe very different answer-modes.As pass through ³The H-thymidine absorbs (Figure 11 A, c group) or is measured CD4 under the non-existent situation of GITR by the lacking of CFSE dilution (Figure 11 B, middle picture group) ⁺And CD8 ⁺T cell proliferation is suppressed fully.On the contrary, by ³The H-thymidine is integrated (Figure 11 A, c group) and is detected from CD28 ^-/-Measurable T cell proliferation of animal is although the CFSE feature shows CD8 ⁺The T cell is responsible for measured propagation (Figure 11 B) to a great extent.Under the situation that IL-2 (50U/ml) exists, as pass through ³H-thymidine integration (Figure 11 A, d group) and CFSE dilution (Figure 11 B, bottom picture group) are measured, from the CD4 that removes of all animals ⁺CD25 ⁺The lymphoglandula of T cell represents similar propagation level.Generally speaking, these results show that the T cell is at GITR ^-/-And CD28 ^-/-Activation defective in the mouse is different.

Under the situation that external source IL-2 exists, be present in GITR ^-/-The ability that total T cell in the lymphatic node of mouse can not be bred is hinting that high-affinity IL-2 receptor expression may be affected in these animals.Because the expression of IL-2R α chain mainly is subjected to its part to induce (people such as Depper, 1985; Malek and Ashwell, 1985), therefore at CD4 ⁺CD25 ⁺The T cell exists or does not exist and checks from GITR under IL-2 (Figure 11 C) existence or non-existent situation ^-/-The anti-CD3 activated CD4 of mouse ⁺CD25 ^-The ability of this chain of T cell expressing.Under the situation that regulatory T cells exists, in culture, add IL-2 and cause, after 24 hours, GITR ⁺/ ⁺But not GITR ^-/-CD4 ⁺CD25 ^-The CD25 of T cell expresses increases (Figure 11 C, lower right histogram).Yet, by removing CD4 ⁺25 ⁺The T cell can easily recover GITR ^-/-CD4 ⁺CD25 ^-The T cell carries out the ability (Figure 11 C, lower-left histogram) that IL-2 inductive CD25 expresses.Therefore, at CD4 ⁺CD25 ⁺Under the situation that the T cell exists, GITR ^-/-The IL-2 of T cell replys weaken be by (to small part be by) its reason that can not express high-affinity IL-2 acceptor under the situation that external source IL-2 concentration is enough to induce the CD25 of wild-type cell to express causes.

Embodiment 12

The CD28 dependency stimulates altogether and strengthens GITR expression and responsiveness

Although data suggest GITR that provides above or CD28 are at CD25 ^-Joint on the T cell provides the permission effector T cell to escape inhibiting signal, but it is still unclear to participate in the signal essence of this process.At CD4 ⁺CD25 ⁺Under the situation that the T cell exists, IL is to CD28 ^-/-CD8 ⁺The part that the propagation of T cell is replied is remedied the conduction of hint CD28/B7 signal may regulate the T cell to the interactional susceptibility of GITR/GITRL.In addition, former research has shown that CD28-CD80/CD86 interacts and can strengthen-a little TNFR family members' expression (people such as Gilfillan, 1998; People such as Rogers, 2001).Therefore, we check this possibility of relevant GITR.Make from CD28 ^-/-Or the CD4 of the purifying of wild-type mice ⁺CD25 ^-And CD8 ⁺The T cell keep irriate state not or the anti-CD28 antibody of plate bonded exist or non-existent situation under activate (Figure 12 A) with the plate bonded anti-cd 3 antibodies of lower concentration.Raised GITR slightly although be exposed to the wild-type T cell of anti-CD3 individually, because the adding of anti-CD28 has greatly increased CD4 ⁺CD25 ^-And CD8 ⁺The GITR of T cell expresses.

Similarly, suppressed CD4 significantly by adding anti-CD80/CD86 (anti-B7.1/7.2) (Figure 12 B, left histogram) ⁺CD25 ^-The rise that GITR expresses in the T cell.In containing the culture of anti-CD80/CD86 to the expression inhibiting effect of GITR because the IL-2 product reduces does not cause because in the culture that contains anti-IL-2/IL-2R mAbs CD4 ⁺CD25 ^-The GITR of T cell raises and is not subjected to stop (Figure 12 B, the right histogram).

The costimulatory signal inductive enhanced GITR that origin comes from CD28 expresses correspondingly to be accompanied by (Figure 12 C) is replied in the enhancing of GITR signal.The adding of anti-GITR antibody has increased the CD4 from wild-type mice significantly ⁺And CD8 ⁺The propagation of effector T cell (Figure 12 C, left figure).Yet in the time will resisting CD80/CD86 to add these cultures, the anti-GITR antibody of existence has just increased GITR a little than the anti-CD3 concentration range of being tried ⁺/ ⁺CD4 ⁺CD25 ^-T cell (Figure 12 C, GITR ⁺/ ⁺, the upper left side; GITR ^-/-, the upper right side) and GITR ⁺/ ⁺CD8 ⁺T cell (Figure 12 C, GITR ⁺/ ⁺, the lower left; GITR ^-/-, the lower right) propagation.Do not influence with anti-GITR processing from GITR ^-/-The CD4 of the purifying of mouse ⁺CD25 ^-And CD8 ⁺The replying of T cell (Figure 12 C, right figure).These data suggest are different with the common stimulation that IL-2 produces, and the signal of CD28 mediation strengthens the signal conduction that GITR expressed and promoted the GITR mediation.

Embodiment 13

GITRL provides costimulatory signal in conjunction with GITR for effector T cell

Under following reagent existence and non-existent situation, cultivate 40,000 effect HT-2T helper (GITR ⁺/ TCR ⁺): 1) the anti-CD3 bag of 1: 1 or 1: 2 ratio is by globule, 2) 10,000 not modified to express GITRL (YB2/0 parental cell) or modified to express the YB/2 cell of GITRL (YB2/0muGITRL), with 3) concentration the isotype control antibodies or 4 the different anti-GITRL antibody (the anti-GITRL antibody of 5F1, MGTL-10, MGTL-15 or polyclone) that increase gradually.In last 5 hours of 44 hours incubation periods, pass through ³The H-thymidine is integrated and is measured propagation.Figure 13 A shows that GITRL has strengthened the propagation of the T cell that stimulates with anti-CD3.In addition, available 5F1 antibody rather than isotype control antibodies (Figure 13 B) and commercial MGTL-10, the MGTL-15 that buys and the anti-GITRL antibody of polyclone (Figure 13 C) stop the increase of the T cell proliferation of GITRL mediation.These data prove that further it is neutralizing antibody at GITRL that GITRL provides costimulatory signal and 5F1.

Embodiment 14

With anti-GITRL antibody blocking GITR-GITRL in conjunction with the adopting property transfer that has stoped the experimental autoimmunization encephalitis of PLP inductive

Female SJL mouse with 9 week of 150 μ gPLP peptides (amino acid/11 39-151) in the complete Freund's adjuvant [HSLGKWLGHPDKF (SEQ ID NO:12)] immunity size.After the immunity ten days, collect splenocyte, and do not exist at 10 μ g/ml antibody (anti-GITRL antibody or control antibodies) under the situation of (being untreated) or existence, exsomatizing with 10 μ g/ml PLP (amino acid/11 39-151) stimulates again.After stimulating again, with 5 * 10 ⁶Adopting property of splenocyte changes big or small first experiment SJL mouse of 10 weeks over to, and monitors described mouse 52 days with regard to experimental autoimmunization encephalitis (EAE), measures by from 0 to 5 grade simultaneously.Accepting the mouse that splenocyte stimulates again under the situation that does not have any antibody (being untreated) and under the situation that control antibodies (CK01) exists, accepting have 40% and 80% EAE (Figure 14) has taken place respectively in the mouse that splenocyte stimulates again.In addition, there is not significant difference on the grade in disease between the animal of the splenocyte that the animal and the acceptance of the untreated splenocyte of acceptance are handled with control antibodies.Importantly, there is not one to produce EAE (p=0.0023 and control antibodies are handled relatively) (Figure 14) in the mouse of the splenocyte that under the situation that is received in anti-GITRL antibody (5F1) existence, stands to stimulate again.The blocking-up of these data suggest GITR/GITRL approach will limit CD25 ^-The T cell overcomes inhibiting ability, therefore reduces the ability that it influences autoimmune response.

Embodiment 15

Experiment flow

Embodiment 15.1 antibody and reagent

All antibody that are used for flow cytometry or functional study are from BD-Pharmingen, except: aCD4 of tricolor marker (clone CT-CD4) and aB220 (clone RA3-6B2) are available from Caltag (Burlingame, CA), with MGTL-10, MGTL-15 and the anti-GITRL antibody of polyclone available from Alexis Biochemicals (San Diego, CA).The F (ab ') of the anti-IgM μ-chain of the goat of purifying ₂Fragment available from Jackson Immunoresearch (West Grove, PA).Anti-IL-2 (clone S4B6) uses with the ascites form.People's recombinant il-2 available from theNational Cancer Institute (Frederick, MD).IL-4, IFN-γ, IL-12 and T cell enrichment post are available from R﹠amp; D Systems (Minneapolis, MN).Poly I:C and LPS are available from Sigma.CpGs available from InvivoGen (San Diego, CA).Anti-GITRL (clone 5F1; With clone 10F12) and anti-GITR (clone DTA-1) and PLP peptide originate from " in the laboratory ".Anti-B220 ,-CD11c ,-CD11b-CD8 ,-CD4 and-the PE magnetic bead available from Miltenyi (Auburn, CA).

Embodiment 15.2: mouse

BALB/c and C57B1/6 mouse (6-8 week size female individuals) available from the NCIFrederick Animal House (Frederick, MD).CD28 ^-/-Mouse is provided by Dr.Alfred Singer (NIH/NCI).GITR ⁺/ ^-(Sv129 * B6) (Perugia University Medical School, Italy) (people such as Ronchetti, 2002) provide the embryo by C.Ricarrdi.To deutero-GITR again ⁺/ ^-Mouse and C57BL/6 mouse are backcrossed once, and the offspring of gained are screened with regard to the allelotrope of sudden change by PCR.Then will be through the GITR of evaluation ⁺/ ^-The offspring hands over mutually to produce GITR ^-/-Mouse.In the facility of under SPF (specified-pathogens free) condition all mouse being fed and closing at NIH/NIAID.

Embodiment 15.3cDNA clone and expression

The aminoacid sequence (GenBank recording mechanism NM_005092) of people GITRL is used for searching record mGITRL at the Celera database.Genome sequence ga_x5j8b7w7wj5_041.cm_aa-2 comprises three high score pairing (HSP) zones.Based on the hypothesis of these zones, be designed for the primer of pcr amplification corresponding to mouse GITRL exon.With the cDNA clone of forward primer (5 '-ATGGAGGAAATGCCTTTGAGAG-3 ') (SEQ ID NO:4) and reverse primer (5 '-GAATGGTAGATCAGGCATTAAGATG-3 ') (SEQ ID NO:5) amplification from the mouse thymus library.Fragment subclone and definite dna sequence dna with gained.Use 5 subsequently '-TTTAAAGTCGACCCACCATGGAGGAAATGCCTTTGAGAG-3 ' (forward) (SEQ ID NO:6) and 5 '-TTTAAAGAATTCTCATTAAGAGATGAATGGTAGATCAGGCAT-3 ' (oppositely) (SEQID NO:7) primer from aforementioned construct by pcr amplification subsequence full-length clone.With the PCR fragment subclone GFP-RV retroviral vector of gained people such as (, 1998) Ouyang, and determine final cDNA clone's sequence.Then this carrier is transfected into Phoenix clone.The supernatant liquor of Phoenix cell of transfection of hanging oneself the in the future YB2/0 clone that is used to transduce.Express the YB2/0 cell of GFP and keep cultivation with the FACS sorting then.The mGITRL aminoacid sequence of prediction and consistent people such as (, 2003) Kim during another is organized are except having replaced Xie Ansuan with L-Ala on the 48th amino acid sites of its sequence.

Embodiment 15.4: the production of monoclonal antibody and purifying

With 100 * 10 among the CFA ⁶The YB2/0-GITRL cell through s.q. immunity Lewis rat once.After two weeks, with 100 * 10 among the IFA ⁶The YB2/0-GITRL cell is through these rats of s.q. immunity.Two week back 50 * 10 among PBS ⁶YB2/0-GITRL cell enhancing immunity rat.After 4 days, people such as (, 2003) Coligan collects splenocyte and carries out cytogamy as previously described.Use Phoenix-GITRL and Phoenix cell by the supernatant liquor of flow cytometer screening from the hybridoma of gained.Use pillar antibody purification from cell culture supernatant of Protein G filling, and the antibody of wash-out is dialysed at PBS.

Experiment 15.5: cell purification

Purifying T cell from the periphery lymphoglandula of mouse.According to manufacturer's experimental program marked by magnetic bead CD25 ⁺The T cell and at autoMACS (Miltenyi Biotech, Auburn CA) go up the described cell of purifying.CD25 ⁺The purity of cell is usually between 97 to 99%.Be retained in the cell in the negative part and on autoMACS, use the positive flow process of selecting to carry out purifying with anti-CD4 or anti-CD8 microballon mark then.Purity is generally 90-95%.By using autoMACS from erythrocyte splitting suspension, to remove Thy1.2 ⁺Cell and prepare the spleen suspended substance of removing the T cell.Use anti-B220 microballon (Miltenyi Biotech, Auburn, CA) purifying B220 from splenocyte in a similar fashion ⁺Cell, the purity of gained preparation is usually greater than 90%.By preparing peritoneal cell with the cold HBSS flushing peritoneal cavity of 10ml (PerC).For spleen DCs, the mode of being described (people such as Vremec, 2000) to be similar to prepares the splenocyte suspended substance.Use anti-CD11c microballon (Miltenyi Biotech, Auburn, CS) purifying spleen DCs from described suspension then.The purity of the DC suspended substance of gained normally 85 to 90%.By using the PE-mouse CD25 of the Chinese People's Anti-Japanese Military and Political College (OX-39) antibody then to use anti-PE microballon to remove CD25 in the rat spleen cells ⁺Thereby, produce rat CD4 ⁺CD25 ^-Cell.After removing, use the mouse CD4 of Chinese People's Anti-Japanese Military and Political College microballon to select CD4 then from the described part that is removed ⁺Cell.

Embodiment 15.6: in-vitro multiplication is measured

Measure as the restraining effect of carrying out described in (Thornton and Shevach, 1998).In brief, under the situation that the anti-CD3 mAb of 0.5 μ g/ml (2C11) exists, in 96 hole flat undersides, with (5 * 10 ⁴) cell with through the splenocyte of removing the T cell (5 * 10 of radiation (3000R) ⁴) cultivate altogether the RPMI 1640 that contains FBS (Atlanta Biologicals, Atlanta, GA) in.For some cultures, add antibody or the rat Ig isotype antibody of specificity at GITR with the final concentration of 2 μ g/ml.Add the CD4 that crosses number through titrimetry with the final inhibitor of 0: 1,1: 2,1: 4 or 1: 8 than the ratio of effector ⁺CD25 ⁺Cell.In last 5-8 hour of 72 hours incubation periods with 1 μ Ci's ³H-thymidine pulse labelling culture carries out three times except as otherwise noted and repeats.Except the rat spleen cells of removing CD4 through radiating (3000R) is used as the APCs, with the common cultivation that similar methods is set up rat and mouse T cell hypotype, use mixture stimulation in rats and the mouse T cell of mouse CD3 of the Chinese People's Anti-Japanese Military and Political College (0.25 μ g/ml) and anti-mouse CD3 (0.25 μ g/ml) mAbs.

The vitro culture of embodiment 15.7 lymph-node cell and CFSE mark

CD25 is removed in preparation on autoMACS as mentioned above ⁺The lymph-node cell suspended substance.In 37 ℃ of water-baths with the CFSE labeled cell of 2 μ M concentration 8 minutes.Cleaning cell among the RPMI1640 fully then.Then rhIL-2 (50U/ml) exist and non-existent situation under with cell (5 * 10 ⁴/ aperture) cultivates in 96 orifice plates.In last 5-8 hour of cultivating in 72 hours with 1 μ Ci ³The double hole of H-thymidine pulse labelling or double hole is used for the CFSE dilution analysis.

Embodiment 16

Discuss

Can from the proof result, release GITR at CD4 ⁺CD25 ⁺Role in the function of T cell, described proof result is: as polyclone and the common CD25 that cultivates of monoclonal antibody adding of GITR ⁺And CD25 ^-T cell (people such as McHugh, 2002; People such as Shimizu, 2002) reversed CD4 in the time of) ⁺CD25 ⁺The effect of T cell inhibiting.CD4 ⁺CD25 ⁺The target of the seemingly anti-GITR reactant of T cell is because the CD25 of outer planting just ⁺The level of T cell expressing GITR is than tranquillization CD25 ^-T cellular expression levels height, and because anti-GITR antibody and IL-2 trigger CD25 together under the situation that lacks the TCR signal ⁺(but not CD25 ^-) propagation.In addition, when adding rat anti mGITRmAb (not with the rat cell reaction), people such as Shimizu extremely cultivate mouse CD25 altogether ⁺When suppressing son and rat effector T cell, observe inhibiting reverse.These researchs cause following hypothesis: produced inhibition CD4 by the anti-GITR antibody of excitability (with supposing by its physiology part) in conjunction with GITR ⁺CD25 ⁺T cell inhibiting activity and reverse CD25 ⁺The T cell is to the non-signal of replying effect of external source IL-2.

By cloning mouse GITRL, analyzing its tissue distribution and pass through and use from wild-type and GITR ^-/-The CD25 of mouse ⁺And CD25 ^-The mixture of T cell determines that clearly the target of the anti-GITR antibody of excitability comes contrived experiment to attempt expansion and to confirm these research.Generally speaking, described having studies have shown that by being CD25 ^-Distinct signal is provided, and (this signal has improved CD4 ⁺CD25 ⁺The threshold value of T cell inhibiting effect), anti-GITR antibody and GITRL have eliminated CD4 ⁺CD25 ⁺The effect of T cell inhibiting.Studies show that GITRL optionally at the cell surface expression of APC, the expression that in the B-1B lymphocyte, has highest level; At B-2B lymphocyte, scavenger cell and B220 ⁺Has medium level among the DCs; In the B220-DC hypotype, has lower level.GITRL is unique in the TNF superfamily member, because it expresses in tranquillization APC, and reduces its expression by triggering B-cell receptor, CD40 or different Toll sample acceptors.On tranquillization APC, can not detect other member (4-1BB-L, OX40-L, LIGHT, CD70, CD30-L) of TNF superfamily, and activate (Croft, 2003) APC by Toll sample receptor for stimulating and raise its expression.The present invention does not have to explain whether downward modulation that the GITRL from cell surface expresses follows the secretion of soluble g ITRL, stimulates the downward modulation that causes GITRLmRNA but people such as Tone (2003) have reported the LPS of DC, scavenger cell and B cell.The expression of GITRL hints its playing a role in early days in the t cell activation process consumingly in the APC of tranquillization.Other cell type comprises endotheliocyte (people such as Gurney, 1999; People such as Kwon, 1999), activated T cells and some DN thymocyte hypotype also show expresses GITRL, and this molecule still need be determined the function of the cell type of these back.

The cell of anti-GITR antibody and expression GITRL all strengthens CD25 individually ^-The activated ability of T cell and at CD25 ⁺Anti-GITRL partly suppresses 25 under the non-existent situation of T cell ^-The activated ability of T cell has promoted the procuratorial work meticulously again to the cellular targets of these reagent.To from wild-type and GITR ^-/-The CD25 of mouse ⁺And CD25 ^-Add anti-GITR in the coculture of T cell and proved that the target of described antibody-mediated reverse inhibition effect is CD25 ^-The T cell.In coculture, use rat CD25 ^-Effect and mouse CD25 ⁺This conclusion is further supported in the experiment of suppressor T cell, and described experiment proves fatefully at CD25 ⁺Its inhibition function is not eliminated in the GITR connection on the T cell subsets.In fact, Inspection Certificate GITR connection promotion CD25 in the coculture that dilutes by CFSE ⁺The amplification of T cell, it has finally strengthened rat CD25 ^-Effector cell's restraining effect.Therefore, the increase of breeding in the rat/mouse coculture that the anti-GITR that is reported by people such as Shimizut (2002) handles (supposition is owing to rat T cell causes) may in fact reflect mouse CD25 ⁺The propagation of SC.This can not be by passing through measurement individually ³The H-thymidine is integrated to determine.

Report hint GITR defective type T cell before one stimulates and has hyperergy people such as (, 2002) Ronchetti to TCR.Yet from above-mentioned observation inference to observations of the present invention is very difficult, because this report is not analyzed the CD4 of purifying ⁺, CD8 ⁺T is lymphocytic to be replied, also not to CD4 ⁺CD25 ⁺The effect of T cell is estimated.In this research, highly purified from GITR ^-/-The CD4 of mouse ⁺CD25 ^-And CD8 ⁺The T cell reply and contrast reply quite.Yet, under the situation of physiology number regulatory T cells, from GITR ^-/-The CD4 of animal ⁺And CD8 ⁺The T cell is not replied fully to CD3 is crosslinked.These results prove that clearly restraining effect accounts for leading under the interactional situation of GITR/GITRL not having.In fact, to from GITR ^-/-The CD4 of mouse ⁺CD25 ^-The activated restraining effect of T cell is so strong so that can not overcome this restraining effect by adding high density external source IL-2, and described external source IL-2 eliminates the much higher CD25 of number usually ⁺The T cell is to wild-type CD4 ⁺CD25 ^-The inhibition effect of replying of T cell (people such as Takahashi, 1998; Thornton and Shevach, 1998).Produce and CD4 by suppressing IL-2 ⁺CD25 ^-GITR ^-/-The expression of the CD25 of effect colony has mediated CD4 ⁺CD25 ⁺The inhibition effect, its be similar to that the front described about CD4 ⁺CD25 ⁺The T cell is to normal CD8 ⁺The effect of t cell response (Piccirillo and Shevach, 2001).

Seemingly different by the costimulatory signal that GITR or CD28 send, but relevant.Under the non-existent situation of regulatory T cells, from GITR ^-/-The CD4 of mouse ⁺And CD8 ⁺Replying all of T cell with identical from replying of the cell of wild-type mice.On the contrary, be used under the culture condition of this research, from CD28 ^-/-The CD4 of mouse ⁺And CD28 ⁺The T cell is non-responsiveness.On the contrary, when IL-2 being joined in the culture that contains regulatory T cells, from GITR ^-/-The CD4 of mouse ⁺And CD8 ⁺Not replying of T cell is restored, although from CD28 ^-/-The CD8 of mouse ⁺Replying of cell partly recovered.On the other hand, between CD28 and the GITR significant conspiracy relation and the signalling system shared all by following real example support: (1) CD4 ⁺CD25 ^-Can not exist under the crosslinked situation of CD28 going up of raising that GITR and (2) anti-CD80/CD86 antibody suppresses significantly that GITR expresses to be in harmonious proportion replying with the GD8T cell at anti-GITR antibody.Therefore, described result hint other critical function of CD28-CD80/CD86 signal pathway in T cell activation process is that expression by strengthening GITR and function are to give the T cell to CD25 ⁺The inhibiting resistance of mediation.

Be similar to by other disclosed research (people such as Shimizu, 2002; People such as Tone, 2003) conclusion that is hinted, these studies show that GITR is at CD25 under the non-existent situation of regulatory T cells ^-Connection on the T cell provides common stimulation to a certain degree.But, to stimulate CD25 with the CD28 same way as ^-Do not require on the T cell that GITR connects, because from GITR ^-/-The CD4 of mouse ⁺CD25 ^-Reply to make with cd8 t cell with the similar mode of wild-type T cell.We support following viewpoint, that is, in the process of immunne response, GITR and the CD4 by GITRL mediation in early days ⁺CD25 ^-And CD8 ⁺The joint of effector T cell mainly plays and makes opposing (for example not being subject to) CD4 of effect colony ⁺CD25 ⁺The influence of the inhibition effect that the T cell produces.In described answering, the downward modulation that the inflammation signal finally causes GITRL to express, thereby increased described effector cell to CD25 ⁺The inhibiting susceptibility of mediation.Although it is obtainable about CD25 in vivo ⁺The data that when take place of immunosuppressive action at infectious factor of mediation are very limited, but some researchs have hinted that it replys initial phase rather than tailend with the disorganization that prevents strong inflammation and cause people such as (, 2003) Suvas.Should be understood that under the situation that IL-2 exists GITR and CD25 ⁺The cross induction of T cell its amplification (people such as McHugh, 2002).In early days under the situation that effector T cell excretory IL-2 exists, the GITR by the mediation of the GITRL on the tranquillization APC is at CD25 in vivo in immunne response ⁺Joint on the T cell may cause the non-specific amplification of regulatory T cells.This non-specific amplification may be vital to producing antigen-specific SC storehouse subsequently, and described antigen SC is being replied retarding effect cell activity in late period.

It is the effective ways (McHugh and Shevach, 2002) of operating the regulatory T cells function in vivo that our front has proposed the interactional operational verification of GITR/GITRL.Although this notion is based on hint CD4 ⁺CD25 ⁺The T cell is the data of the target of anti-GITR antibody, but important treatment target is still represented in the GITR/GITRL interaction.Therefore, the treatment of carrying out with anti-GITR antibody of excitability or excitability GITRL-Fc should make the effector cell resist (for example not being subject to) CD4 ⁺CD25 ⁺The influence of the inhibition effect that the T cell produces, and should prove that to treatment cancer and infectious diseases be effectively, as improve to cancer (use individually or with other cancer therapeutic agent for example tumor vaccine use) immunne response and improve the immunne response that infectious pathogen is comprised virus, bacterium etc. (use individually or use) with other therapeutical agent (vaccine adjuvant that for example is used for the weak immunity of infectious factor) that is used for infectious pathogen.Similarly, for example interactional inhibition should reduce the inhibition threshold value of effector T cell to GITR/GITRL by using anti-GITRL antibody of neutralization or GITR-Fc with the GITR antagonist, thereby is used to prevent and/or treat autoimmune disease, inflammation, transplant rejection and graft versus host disease (GVH disease).

Reference

Following reference is whole the quoting of quoting in the several author/times in the specification sheets:

Aseffa，A.，Gumy，A.，Launois，P.，MacDonald，H.R.，Louis，J.A.，and?Tacchini-Cottier，F.(2002).The?early?IL-4?response?to?Leishmania?major?and?the?resultingTh2?cell?maturation?steering?progressive?disease?in?BALB/c?mice?are?subject?to?thecontrol?of?regulatory?CD4+CD25+T?cells.J?Immunol?169，3232-3241.

Banchereau，J.，and?Steinman，R.M.(1998).Dendritic?cells?and?the?control?ofimmunity.Nature?392，245-252.

Belkaid，Y.，Piccirillo，C.A.，Mendez，S.，Shevach，E.M.，and?Sacks，D.L.(2002).CD4+CD25+regulatory?T?cells?control?Leishmania?major?persistence?andimmunity.Nature?420，502-507.

Coligan，J.E.，Kruisbeek，A.M.，Margulies，D.H.，Shevach，E.M.，and?Strober，W.，eds.(2003).Current?Protocols?in?Immunology(John?Wiley&Sons，Inc.).

Croft，M.(2003).Co-stimulatory?members?of?the?TNFR?family：keys?to?effectiveT-cell?immunity？Nat?Rev?Immunol?3，609-620.

Depper，J.M.，Leonard，W.J.，Drogula，C.，Kronke，M.，Waldmann，T.A.，andGreene，W.C.(1985).Interleukin?2(IL-2)augments?transcription?of?the?IL-2receptor?gene.Proc?Natl?Acad?Sci?U?S?A?82，4230-4234.

Gavin，M.A.，Clarke，S.R.，Negrou，E.，Gallegos，A.，and?Rudensky，A.(2002).Homeostasis?and?anergy?of?CD4(+)CD25(+)suppressor?T?cells?in?vivo.NatImmumol?3，33-41.

Gilfillan，M.C.，Noel，P.J.，Podack，E.R.，Reiner，S.L.，and?Thompson，C.B.(1998).Expression?of?the?costimulatory?receptor?CD30?is?regulated?by?both?CD28and?cytokines.J?Immunol?160，2180-2187.

Godfrey，D.I.，Kennedy，J.，Suda，T.，and?Zlotnik，A.(1993).A?developmentalpathway?involving?four?phenotypically?and?functionally?distinct?subsets?of?CD3-CD4-CD8-triple-negative?adult?mouse?thymocytes?defined?by?CD44?and?CD25expression.J?Immunol?150，4244-4252.

Gumey，A.L.，Marsters，S.A.，Huang，R.M.，Pitti，R.M.，Mark，D.T.，Baldwin，D.T.，Gray，A.M.，Dowd，A.D.，Brush，A.D.，Heldens，A.D.，et?al.(1999).

Identification?of?a?new?member?of?the?tumor?necrosis?factor?family?and?itsreceptor，a?human?ortholog?of?mouse?GITR.Curr?Biol?9，215-218.

Hisaeda，H.，Maekawa，Y.，Iwakawa，D.，Okada，H.，Himeno，K.，Kishihara，K.，Tsukumo，S.，and?Y?asutomo，K.(2004).Escape?of?malaria?parasites?from?hostimmunity?requires?CD4(+)CD25(+)regulatory?T?cells.Nat?Med?10，29-30.

Kim，J.D.，Choi，B.K.，Bae，J.S.，Lee，U.H.，Han，I.S.，Lee，H.W.，Youn，B.S.，Vinay，D.S.，and?Kwon，B.S.(2003).Cloning?and?characterization?of?GITRligand.Genes?Immun?4，564-569.

Kursar，M.，Bonhagen，K，Fensterle，J.，Kohler，A.，Hurwitz，R.，Kamradt，T.，Kaufmann，S.H.，and?Mittrucker，H.W.(2002).Regulatory?CD4+CD25+T?cellsrestrict?memory?CD8+T?cell?responses.J?Exp?Med?196，1585-1592.

Kwon，B.，Yu，K?Y.，Ni，J.，Yu，G.L.，Jang，I.K.，Kim，Y.J.，Xing，L.，Liu，D.，Wang，S.X.，and?Kwon，B.S.(1999).Identification?of?a?novel?activation-inducibleprotein?of?the?tumor?necrosis?factor?receptor?superfamily?and?its?ligand.J?BiolChem?274，6056-6061.

Lundgren，A.，Suri-Payer，E.，Enarsson，K.，Svennerholm，A.M.，and?Lundin，B.S.(2003).Helicobacter?pylori-specifie?CD4+CD25high?regulatory?T?cells?suppressmemory?T-cell?responses?to?H.pylori?in?infected?individuals.Infect?Immun?71，1755-1762.

Malek，T.R，and?Ashwell，J.D.(1985).Interleukin?2upregulates?expression?of?itsreceptor?on?a?T?cell?clone.J?Exp?Med?161，1575-1580.

Maloy，K.J.，Salaun，L.，Cahill，R，Dougan，G.，Saunders，N.J.，and?Powrie，F.(2003).CD4+CD25+T(R)cells?suppress?innate?immune?pathology?through.cytokine-dependent?mechanisms.J?Exp?Med?197，111-119.

McHugh，R.S.，and?Shevach，E.M.(2002).The?role?of?suppressor?T?cells?inregulation?of?immune?responses.J?Allergy?Clin?Immunol?110，693-702.

McHugh，R.S.，Whitters，M.J.，Piccirillo，C.A.，Young，D.A.，Shevach，E.M.，Collins，M.，and?Byrne，M.C.(2002).CD4(+)CD25(+)immunoregulatory?T?cells：gene?expression?analysis?reveals?a?functional?role?for?the?glucocorticoid-inducedTNF?receptor.Immunity?16，311-323.

Nakano，H.，Yanagita，M.，and?Gunn，M.D.(2001).CD1lc(+)B220(+)Gr-1(+)cells?in?mouse?lymph?nodes?and?spleen?display?characteristics?of?plasmacytoiddendritic?cells.J?Exp?Med?194，1171-1178.

Ouyang，W.，Ranganath，S.H.，Weindel，K.，Bliattacharya，D.，Murphy，T.L.，Sha，W.C.，and?Murphy，K.M.(1998).Inhibition?of?Th1?development?mediated?byGATA-3?through?an?IL-4-independent?mechanism.Immunity?9，745-755.

Piccirillo，C.A.，and?Shevach，E.M.(2001).Cutting?edge：control?of?CD8+T?cellactivation?by?CD4+CD25+immunoregulatory?cells.J?Immunol?167，1137-1140.

Rogers，P.R.，Song，J.，Gramaglia，I.，Killeen，N.，and?Croft，M.(2001).OX40promotes?Bcl-xL?and?Bcl-2?expression?and?is?essential?for?long-term?survival?ofCD4?T?cells.Immunity?15，445-455.

Ronchetti，S.，Nocentini，G.，Riccardi，C.，and?Pandolfi，P.P.(2002).Role?of?GITRin?activation?response?of?T?lymphocytes.Blood?100，350-352.

Sakaguchi，S.，Sakaguchi，N.，Asano，M.，Itoh，M.，and?Toda，M.(1995).Immunologic?self-tolerance?maintained?by?activated?T?cells?expressing?IL-2receptor?alpha-chains(CD25).Breakdown?of?a?single?mechanism?of?self-tolerancecauses?various?autoimmune?diseases.J?Immunol?155，1151-1164.

Shimizu，J.，Yamazaki，S.，Takahashi，T.，Ishida，Y.，and?Sakaguchi，S.(2002).Stimulation?of?CD25(+)CD4(+)regulatory?T?cells?through?GITR?breaksimmunological?self-tolerance.Nat?Immunol?3，135-142.

Suvas，S.，Kumaraguru，U.，Pack，C.D.，Lee，S.，and?Rouse，B.T.(2003).CD4+CD25+T?cells?regulate?virus-specific?primary?and?memory?CD8+T?cellresponses.J?Exp?Med?198，889-901.

Takahashi，T.，Kuniyasu，Y.，Toda，M.，Sakaguchi，N.，Itoh，M.，Iwata，M.，Shimizu，J.，and?Sakaguchi，S.(1998).Immunologic?self-tolerance?maintained?byCD25+CD4+naturally?anergic?and?suppressive?T?cells：induction?of?autoimmunedisease?by?breaking?their?anergic/suppressive?state.Int?Immunol?10，1969-1980.

Thornton，A.M.，and?Shevach，E.M.(1998).CD4+CD25+immunoregulatory.Tcells?suppress?polyclonal?T?cell?activation?in?vitro?by?inhibiting?interleukin?2production.J?Exp?Med?188，287-296.

Tone，M.，Tone，Y.，Adams，E.，Yates，S.F.，Frewin，M.R.，Cobbold，S.P.，andWaldmann，H.(2003).Mouse?glucocorticoid-induced?tumor?necrosis?factorreceptor?ligand?is?costimulatory?for?T?cells.Proc?Natl?Acad?Sci?U?S?A?100，15059-15064.

Uranshihara，K.，Kanai，T.，Ko，K.，Totsuka，T.，Makita，S.，Iiyama，R.，Nakamura，T.，and?Watanabe，M.(2003).Regulation?of?murine?inflammatory?bowel?diseaseby?CD25+and?CD25-CD4+glucocorticoid-induced?TNF?receptor?family-relatedgene+regulatory?T?cells.J?Immunol?171，708-716.

Vremec，D.，Pooley，J.，Hochrein，H.，Wu，L.，and?Shortman，K.(2000).CD4?andCD8?expression?by?dendritic?cell?subtypes?in?mouse?thymus?and?spleen.J?Immunol164，2978-2986.

Vremec，D.，and?Shortman，K.(1997).Dendritic?cell?subtypes?in?mouse?lymphoidorgans：cross-correlation?of?surface?markers，changes?with?incubation，anddifferences?among?thymus，spleen，and?lymph?nodes.J?Immunol?159，565-573.

Yu，K.Y.，Kim，H.S.，Song，S.Y.，Min，S.S.，Jeong，J.J.，and?Youn，B.S.(2003).Identification?of?a?ligand?for?glucocorticoid-induced?tumor?necrosis?factor?receptorconstitutively?expressed?in?dendritic?cells.Biochem?Biophys?Res?Commun?310，433-438.

Sequence table

<110>Wyeth

The?Government?of?the?United?States?of?America?as

represented?by?the?Secretary?of?the?Depatment?of?Health?and?Human

Services

Collins，Mary

Shevach，Ethan?M.

McHugh，Rebecca?S.

Whitters，Matthew?J.

Young，Deborah?A.

Byrne，Michael?C.

Reddy，Padmalatha?F.

Stephens，Geoffrey?L

Carreno，Beatriz?M.

＜120〉GITR part and GITR ligand-related molecules and antibody and application thereof

<130>01997.028500

<150>US?60/472,844

<151>2003-05-23

<150>US?60/547,975

<151>2004-02-26

<160>12

<170>PatentIn?version?3.3

<210>1

<211>522

<212>DNA

<213>Mus?musculus

<220>

<221>CDS

<222>(1)..(522)

<400>1

atg?gag?gaa?atg?cct?ttg?aga?gag?tca?agt?cct?caa?agg?gca?gag?agg 48

Met?Glu?Glu?Met?Pro?Leu?Arg?Glu?Ser?Ser?Pro?Gln?Arg?Ala?Glu?Arg

1 5 10 15

tgc?aag?aag?tca?tgg?ctc?ttg?tgc?ata?gtg?gct?ctg?tta?ctg?atg?ctg 96

Cys?Lys?Lys?Ser?Trp?Leu?Leu?Cys?Ile?Val?Ala?Leu?Leu?Leu?Met?Leu

20 25 30

ctc?tgt?tct?ttg?ggt?aca?ctg?atc?tat?act?tca?ctc?aag?cca?act?gcc 144

Leu?Cys?Ser?Leu?Gly?Thr?Leu?Ile?Tyr?Thr?Ser?Leu?Lys?Pro?Thr?Ala

35 40 45

atc?gag?tcc?tgc?atg?gtt?aag?ttt?gaa?cta?tca?tcc?tca?aaa?tgg?cac 192

Ile?Glu?Ser?Cys?Met?Val?Lys?Phe?Glu?Leu?Ser?Ser?Ser?Lys?Trp?His

50 55 60

atg?aca?tct?ccc?aaa?cct?cac?tgt?gtg?aat?acg?aca?tct?gat?ggg?aag 240

Met?Thr?Ser?Pro?Lys?Pro?His?Cys?Val?Asn?Thr?Thr?Ser?Asp?Gly?Lys

65 70 75 80

ctg?aag?ara?ctg?cag?agt?ggc?aca?tat?tta?arc?tac?ggc?caa?gtg?att 288

Leu?Lys?Ile?Leu?Gln?Ser?Gly?Thr?Tyr?Leu?Ile?Tyr?Gly?Gln?Val?Ile

85 90 95

cct?gtg?gat?aag?aaa?tac?ata?aaa?gac?aat?gcc?ccc?ttc?gta?gta?cag 336

Pro?Val?Asp?Lys?Lys?Tyr?Ile?Lys?Asp?Asn?Ala?Pro?Phe?Val?Val?Gln

100 105 110

ata?tat?aaa?aag?aat?gat?gtc?cta?caa?act?cta?atg?aat?gat?ttt?caa 384

Ile?Tyr?Lys?Lys?Asn?Asp?Val?Leu?Gln?Thr?Leu?Met?Asn?Asp?Phe?Gln

115 120 125

atc?ttg?cct?ata?gga?ggg?gtt?tat?gaa?ctg?cat?gct?gga?gat?aac?ata 432

Ile?Leu?Pro?Ile?Gly?Gly?Val?Tyr?Glu?Leu?His?Ala?Gly?Asp?Asn?Ile

130 135 140

tat?ctg?aag?ttc?aac?tct?aaa?gac?cat?att?cag?aaa?aat?aac?aca?tac 480

Tyr?Leu?Lys?Phe?Asn?Ser?Lys?Asp?His?Ile?Gln?Lys?Asn?Asn?Thr?Tyr

145 150 155 160

tgg?ggg?atc?atc?tta?atg?cct?gat?cta?cca?ttc?atc?tct?taa 522

Trp?Gly?Ile?Ile?Leu?Met?Pro?Asp?Leu?Pro?Phe?Ile?Ser

165 170

<210>2

<211>173

<212>PRT

<213>Mus?musculus

<400>2

Met?Glu?Glu?Met?Pro?Leu?Arg?Glu?Ser?Ser?Pro?Gln?Arg?Ala?Glu?Arg

1 5 10 15

Cys?Lys?Lys?Ser?Trp?Leu?Leu?Cys?Ile?Val?Ala?Leu?Leu?Leu?Met?Leu

20 25 30

Leu?Cys?Ser?Leu?Gly?Thr?Leu?Ile?Tyr?Thr?Ser?Leu?Lys?Pro?Thr?Ala

35 40 45

Ile?Glu?Ser?Cys?Met?Val?Lys?Phe?Glu?Leu?Ser?Ser?Ser?Lys?Trp?His

50 55 60

Met?Thr?Ser?Pro?Lys?Pro?His?Cys?Val?Asn?Thr?Thr?Ser?Asp?Gly?Lys

65 70 75 80

Leu?Lys?Ile?Leu?Gln?Ser?Gly?Thr?Tyr?Leu?Ile?Tyr?Gly?Gln?Val?Ile

85 90 95

Pro?Val?Asp?Lys?Lys?Tyr?Ile?Lys?Asp?Asn?Ala?Pro?Phe?Val?Val?Gln

100 105 110

Ile?Tyr?Lys?Lys?Asn?Asp?Val?Leu?Gln?Thr?Leu?Met?Asn?Asp?Phe?Gln

115 120 125

Ile?Leu?Pro?Ile?Gly?Gly?Val?Tyr?Glu?Leu?His?Ala?Gly?Asp?Asn?Ile

130 135 140

Tyr?Leu?Lys?Phe?ASn?Ser?Lys?Asp?His?Ile?Gln?Lys?ASn?Asn?Thr?Tyr

145 150 155 160

Trp?Gly?Ile?Ile?Leu?Met?Pro?Asp?Leu?Pro?Phe?Ile?Ser

165 170

<210>3

<211>10289

<212>DNA

<213>Mus?musculus

<400>3

tcaggagaca?gctataccag?gctcctagct?gcaagcactc?acaaaccaca?tgaaactcaa 60

aaagtaagac?caaagtgtgg?atgcttcaat?ccttcctaga?agggtgaaca?aaatacccat 120

ggaccaaagg?aaaactccac?ctcctacacc?cacggggcta?attactataa?aacatgacat 180

tgcatcgttc?atccatcact?tgtgggtatc?tgctttcccc?agttctcatt?ccatcagaga 240

acgagttcta?gcctcatgga?ggaaatgcct?ttgagagagt?caagtcctca?aagggcagag 300

aggtgcaaga?agtcatggct?cttgtgcata?gtggctctgt?tactgatgct?gctctgttct 360

ttgggtacac?tgatctatac?ttcactcaag?gtaaggtggt?catagagtct?acagctgcta 420

attatatcat?ataaaggtta?tttatttgtt?agtctggtta?ttatcactgc?cattcagcat 480

tgctagaggt?agtgggaagg?aagacatttg?acagtacaaa?cagtgtaagc?aatttaagcc 540

ttgtaatgac?atggctcttc?aaatgtgttt?ttattcatcg?aatgttttaa?gacaaaagac 600

actagaaaat?actatatatt?ctctgtaggt?gtgagctaga?tagaactaca?tgtttaaact 660

gagcctttag?gtgtctgtgg?aagttctttt?gtccttcctg?ggactctact?agaaccttct 720

tgattggcaa?agaaaagacc?tgaaccatgg?tactaatctt?cgggtaaccc?cagacaagct 780

gtagtctcat?tgggggaaga?gatacaaaac?agtaatgggg?gacagtgaca?ggaagcaact 840

gcatgctgag?gaagggcatg?gtgtcaaagt?agaaaaaaag?gaaatcctgg?gttccagttc 900

tagattagcc?tccccataac?cagctgtgca?aatttgagta?agttgtatcg?ttgttctgat 960

tctagttttt?aggtctgcaa?catggtgata?agggaatggc?tctgtttact?tggcatcctg 1020

ctagctgtaa?ttatagcgcg?cagtaattga?cctaggagaa?ggataaacca?tatagttgtg 1080

gtttatgagg?ggaataactt?tgggcttggg?tgaccaggga?aggcttcatg?gaggagggag 1140

gagcacatgt?ctgtttggga?agcccctgat?ggttatcagg?aatttcccat?tgaactctag 1200

tgtaaattgt?gggtctagat?gggatatgaa?ctggaaatgt?atatcaatta?ggtttttcta 1260

gaagtgttct?ctcatacaga?acagccaggg?ctgcagagag?agagagagag?aaaaaaaaac 1320

agcaaaaacc?aaaccaaaac?aaacagacaa?aaaaaaaaaa?aaacaacaaa?acaaaacaaa 1380

acaaaaaaaa?ccaaaaaaag?cattgaccag?aaaagccaga?aaggaatcaa?atattaaata 1440

agacattata?taattcaagg?gttggcctat?ttatattaaa?atatactaaa?tcttgggcag 1500

aattaaatga?cgcatagctg?tgtaagaaag?ggttgtgatg?tgagcccagg?aacatttttc 1560

taaagagacc?aaccagagat?ggtcttaaag?gtatggttct?atattggcaa?gatattgaga 1620

aaagatgcag?gaggaagtaa?tgcactgttg?attcgaggtt?acttagtatg?gtactggcta 1680

aagacttaca?taggagccca?ttaatctgta?gtctgtaact?gtacaaatgg?atcaaaggca 1740

gagggagttc?taaccccagc?cccacccttc?caaagaatga?accaagacac?gaactttctg 1800

aagcaatgag?tgttgagagg?actctcagca?ttctcaaggg?tttaaaggag?gaaggctgag 1860

gatgcattaa?gttcacactg?aaagggcttt?ttcctcaggc?aaacttcctc?aagtcttatt 1920

aatcaggtgg?ctctgagcat?cagtgagtct?aggtgccgct?gactcctgct?ggtgaggagt 1980

ggccgaggga?aatgcctttc?cgagtgacat?ctcttcccac?aatcaaacct?tggtaattca 2040

tgattgctga?aactttgatt?ccaggttggc?ctctcaaaag?aacacatccc?tttcaatgaa 2100

gggttcctct?tctaaacgta?aaagttatcc?caaatttaag?gaagtaaaaa?gttttggagt 2160

ctcttttcct?gtcaggatgc?ttggcagcgt?agttactatg?gaaacgacac?tggctttcag 2220

ggttagcttc?agtattacac?ttcccttatt?ggctacaaat?aaatgtcttg?agcagagaga 2280

tctgagtggc?tggcaggtgc?tgagttattg?tgaggtggtt?gcttccacct?tttcatactt 2340

aagaacttag?aagttttttt?tttctttctt?ttttgatgca?aatctccatt?tttaaaagtc 2400

tcttctaaaa?aaagaagact?tccctctttt?tttttttttt?ttttataaat?aaccctctta 2460

tgtttaaaag?taagatatga?agcttggttt?ctttcagatt?tttttttctc?tctatctcct 2520

aggagacatc?tagttaagag?actagactgg?agctcaaggc?ggttggccaa?ctcctccatg 2580

aaagcagctc?acaaaagttg?tctctgaagc?atccaaatag?tcaggaaagt?ccctttcttc 2640

agtgaggaag?ggtggaattc?cagaagggaa?aatggaattt?gtacaattgt?acttgcaaac 2700

agacggagta?gattttcttt?ccaaacatat?gaggttagga?ttagcctgga?gtctgccttg 2760

gtcattctga?gacaaaacaa?gtcaatctgg?tcttcaacca?aagtgaggtt?agaagaccaa 2820

ctgatccttc?taaataaaag?caaaactaga?gtaaactgaa?agctttgtat?gtagcttttc 2880

gtaacatcaa?ttgaattata?aatagaaact?gccccagtga?gtcgtagggg?tgagagagag 2940

agagagagag?agagagtttt?gaataagagt?ctggttgagg?atgccagcct?ttcttatcag 3000

ccatatgacc?ttgggcttat?tacttcatca?ccgtgctctc?atttcctcat?ctgcagaagg 3060

aacgtggtaa?ttcttacaga?gttgccttaa?ggaataagga?ggcagtaatg?tgcctgaccc 3120

tcctgactca?tgctaggctc?tagatggctg?tgattaatat?ttatgccacg?gttacttata 3180

aggtttacaa?tgaatacaaa?caacaaggtc?atttaaaata?tacatggctt?gtctgacctc 3240

ccttcctcag?taaaagacct?cttctctcaa?ccaaaatgat?aattttccaa?ttatatttta 3300

acttatggca?atagttatgg?atgaactcag?tggcattttc?taactctaaa?tagatattaa 3360

agccactcga?aataggcttt?ctggatgctt?ttctctgtca?gttcatttgt?ctattgattt 3420

agattttctg?tgtacttctt?acacatggtg?atagctggaa?caaaatccaa?gacatttgta 3480

ttttgctggc?tacttaattg?cttcctatgt?atgatcatgt?cagtctagct?agattacaaa 3540

cttcctgaga?gataacaatt?gtacattaaa?tgtgtctttc?ttgcttagaa?tgctagtata 3600

atgttgggac?tataggtaat?taagttgttt?atttaacttg?tttttataat?cagcatcatt 3660

atcaaaatag?ctgatattta?ctgagaagct?tcaggtagcc?tgtctggaga?aaccctctcc 3720

aagaatcaga?gtggtaaagt?aagaacaaac?ggtttagtga?ttccccgctc?ttactccctg 3780

cttaatagat?aaggaaattg?gaattctgga?agcccctgct?ataaccttgt?cagtctttgt 3840

gctgaactga?ctttggacat?ctcttttaag?aaaacccaaa?atgtggatga?aataattgca 3900

agagtagagt?gggtttcagg?aaatccagtg?tcttttagtt?tttagagtca?tggcttctcc 3960

ccttttttat?tgcaccgcct?tattggtata?aaatgctctt?attataactt?ctaacatatg 4020

tatactagat?agtatctcac?gtctgagtat?aaaaccatgt?acacaaaaga?tgtgtacaca 4080

cacaagatgg?aaagtctaaa?agtttaatac?agattttccc?gtctaagtct?attttgcttt 4140

agttaagttg?ttaagttgtc?tataatatat?taacattgat?gcaaacataa?tacagtaatt 4200

gaaatattgt?ttctttggtg?ctgatctctt?agtcacattc?agagccctag?tgatttgata 4260

ttatttgttt?tatttcctta?attttagctt?aacattttat?aatacagtaa?cttgagattt 4320

atattctaat?ttatcttgat?ttatgatttt?gactgtacca?attgaaaatt?accttcttgg 4380

acttgatgtt?cacatataat?ttcatgtcta?aaagcaatga?atcttggcat?catatatcta 4440

actacctact?tgatatctaa?taagcaacac?aaacccacac?cttcaaaagt?tgtcatggtt 4500

cccctcttac?tttctttcta?ttagtctttc?gaatttgggt?aattaactta?atttttttca 4560

atgactgcag?tcccaaatct?tggagttatc?tttcttttat?tgcattgcct?catgctagta 4620

ttcatgtcag?gaactccagt?tacttcttgc?ttccttctcc?atatagccta?gcttgatctg 4680

aaagtcacag?ttctcctgct?tcaacctaag?tgctattaag?acaggcgtgc?atctctctgt 4740

tggaccctct?gccagcacct?tggtcagagc?catgtgcttt?ccagtttata?gactccatcc 4800

agtccatgcc?taactgactt?cattgctttt?accttctgtt?ctctttgttt?tttttttttt 4860

cctagcataa?tagctggaaa?aatcctttaa?aaggatcata?gatcagtctc?catgcttaaa 4920

aaaagtcttt?tgagcacttt?gctcccagga?aaccaatgca?ttctcagtac?ccaaaacttt 4980

aatgtttggg?ccttattttt?aaccctgaag?catttaacag?catttaagtg?attgtatttg 5040

taaattagcc?ataattaatg?ttacctttca?gcatgtcgca?gacattttga?aacacttgtt 5100

tctgattctg?aaggcattcc?atttattata?catggcctgt?gatttttcta?tacattaaat 5160

atttctggag?ctaatgctgt?tgttttaagt?aaagggaaaa?caaagataag?cagaggtccc 5220

attatttttc?ccacatgcaa?cagatcatct?tgggaaatga?ttgatgggga?tatggagact 5280

gctgtttgta?gtgaactaga?gaggaagaac?ccagcttcat?cacttgcctt?gtgtgtcaaa 5340

ggaaaacgaa?caggatgaga?caccaaagtc?ttggataaaa?gacaccctcc?aaaaagatct 5400

gctacctttc?ttctcatgat?taaatctatc?attccatgac?accattttaa?aaattaaaac 5460

aatgctgctc?accaccctta?ttcatgcttt?ctttcccttt?ttaagattta?tttattatat 5520

gtatgtacac?tgtagcaatc?ttcagacgct?ccagaagaag?gcgtcagagc?tcgttataga 5580

tggttgtgag?ccaccaggta?gttgctggga?tttgaactca?ggacctttgg?aagagcattc 5640

agtgctctta?actgctgaac?catctttgct?gccctctctt?catgctttct?tttgtctctg 5700

tatacagcta?aattcgtgtg?tctaatatac?ctctgcccac?acatccttat?tcacttgctt 5760

cctcatgtct?tcctaaaact?ctcatgtaag?tcaaatgtaa?aggacagaac?cagtcatctg 5820

tagagggaaa?tgaagaagta?tgtcaggtgt?acaggtgtct?gtgtttgtgt?gttgggagga 5880

ggggcatatt?ttcgggaggg?gtttgggggt?tggaaaatag?tttgcttcag?aaactttaaa 5940

ctctaagtaa?ttagtcaagc?atgtagcagt?ggtgccatca?ttctgaccag?ttcttctttt 6000

ccttcaacag?ccaactgcca?tcgagtcctg?catggttaag?tttggtgagt?aacccatctc 6060

ccatggtttc?ctttcatttt?ccttagattc?tgaggcaaga?aggccagtgc?cagtgccctc 6120

ggaaagcccg?tgcatccttt?agttcacttt?cagtgattgt?ttattacaat?tactcacccc 6180

atacttgctg?tctgcccagt?gagaactgag?gctccagggc?tgagcccgat?tgacaagccc 6240

acaccaggtg?acactcttgg?caggcataga?catcccacta?acaagagcct?tgtggatctg 6300

catacagcaa?tcagctttta?gtttggtagt?ttattaagga?tatttttcag?attcctacaa 6360

ccttttgtca?gagcatttct?tatatttcat?acatgtctag?tgtctagtag?agcatatggg 6420

aaccattact?gctgttagta?agtgcagaga?agagaaggaa?gaagcgcttc?ctctttgctt 6480

ctgagtcact?tttcgtgaca?gtcacctgat?attcgctcag?aaaacatgga?aaacagtgct 6540

gctgagtgtt?ttagtttcat?ttctgttgct?tttataagat?accctgtcaa?aaaacaactt 6600

ttggagaaaa?aggatttgtt?ttattcacaa?gtgcaaatta?tagtccctca?accgtggaga 6660

aatcatggcc?acaggagttt?gaagcatcta?gtcacattca?gtcaagagca?gaggaaaacg 6720

aagtgcactt?gcttattgct?tgcttttttt?taattggata?ttttatttat?ttacatttca 6780

aatgttattc?cctttcccga?ttgccccaca?gaaccccccc?tttccatctc?tctccccctg 6840

cttctatgag?ggtgttcccc?cacccaccca?catactcctg?cctccctgac?ctcacactct 6900

cctacactga?ggcatagagc?cttcactgga?ccaagggcct?cttctcccat?tgatgcccga 6960

caaggccatc?ctctgctaca?tatgtagttg?gagccatggg?tccctccatg?tgtactcctt 7020

ggttagtggt?ttagaccctg?ggagctctgg?ttggttcata?ctgttgttct?tgctatgggg 7080

ttgcaaatcc?cttcagctct?ctcattactt?tctctaactc?ctccattggg?gacttcatga 7140

tcagttcaat?ggttggcttc?gagcatctgt?atttgtgtat?gtcaggctct?ggcagagcct 7200

ctcaggaggc?agttatgtca?ggctcctgtt?agctcagttc?cttttctcta?cttctttaca 7260

gttcaggaca?tcttgcctag?ggaatggcac?caaccatagt?gggctggatt?ttcccatatc 7320

taataactta?attaaaatac?tctataagac?caacttgata?tagacaattc?tttcttgggt 7380

cctcttctct?ggtgactata?gattgtgtca?atttgacaag?gaaagctaac?taccataccg 7440

agtctcagaa?tatttcttag?agcacatgaa?aaatatcaag?tgtatacatt?tgtgattgct 7500

tgtaccacat?tttcatttga?cactagacaa?tttctttagt?tcagtttttc?actctcctat 7560

cttttgctcc?agtttttaaa?aatactttgg?tccccagagg?ttaggacagt?ttttgaatgt 7620

gtcccactct?gattttgtgt?tttgtttttt?cagtgaaaac?aagagagtat?ataatgtgtt 7680

caaatttctc?cttaatgtga?taaaaatcaa?gtgtttttta?aaattccata?actggattaa 7740

ataggaaaaa?atagactttc?ccatggtgtg?ccaccaagaa?aaaaatgcag?agttcactgg 7800

agatgcagcg?agtttttgtt?ttgcttataa?cactccattc?ctcttgctca?ttcctctatt 7860

ctcttccagc?atctacctcc?aagtcttatc?ctagttattt?tatgtgtgaa?tgagaatcta 7920

agtcagtctt?acctctttta?ggctatgccc?tctataacta?aagttatgga?gaattagaga 7980

aacattcaga?taactttgaa?tcaataaaaa?cacctgttgg?gggccttgaa?gttacatagc 8040

tgtacaaaac?cactaacatt?agggaaatat?ttcaatgtaa?tacacaggaa?aagaaatgac 8100

taaatttgta?cacatatccc?actttccatg?tggcaatatt?agacttagga?tagttacaat 8160

taaatacata?tatattaatt?aaattaattt?atagcagtaa?ataattggaa?ataagctaga 8220

taatgttatg?ttaagttgaa?agtgacacag?agaatcatat?tttagataca?aagcatcaaa 8280

atcagaaata?cagacctgtc?aatcaattta?gagctaatta?ctgatactga?gctgggaaga 8340

ttatttgaac?tcagcaattt?gagcccagac?agcaatacag?caagactccc?atatcaaaat 8400

aaaagaaaag?tttgttgagc?acacacaatt?ctgctagctt?atttaggtga?tgagaatata 8460

gcaattggaa?aaaatggaga?atacttatta?tcaaagacac?cacactcaag?tagatgtgag 8520

acactagaaa?aatggccaaa?ttaattgata?acatacttct?tgctaacacc?ttacatgaag 8580

aaaattacag?caatgcagag?cacggtagtc?agaggagaac?aatgctgagt?gttgattgtc 8640

tatgtaatgt?gttattggca?aagcaccata?gagtaaacag?tatttgaata?agaaagatat 8700

ggggacgcct?agattataag?cggttcttat?tctagtcttg?tgtgatttgt?ctctccattc 8760

cactcccttc?ctcattcata?ttacctgaga?tgagatacag?agttattaag?atctgaagcc 8820

tctcaaaaac?agagagatag?tttattctct?caatagattc?gaaatatggt?ctgggaaaag 8880

tagtatatat?agtccaggta?aagaagccac?ctgaaggcag?taaaacatat?agaggatgga 8940

atagtcatgg?aaacatgatc?tttttcttcc?tctttttcaa?tttcttatag?aactatcatc 9000

ctcaaaatgg?cacatgacat?ctcccaaacc?tcactgtgtg?aatacgacat?ctgatgggaa 9060

gctgaagata?ctgcagagtg?gcacatattt?aatctacggc?caagtgattc?ctgtggataa 9120

gaaatacata?aaagacaatg?cccccttcgt?agtacagata?tataaaaaga?atgatgtcct 9180

acaaactcta?atgaatgatt?ttcaaatctt?gcctatagga?ggggtttatg?aactgcatgc 9240

tggagataac?atatatctga?agttcaactc?taaagaccat?attcagaaaa?ctaacacata 9300

ctgggggatc?atcttaatgc?ctgatctacc?attcatctct?tagagattgg?gtttggtctc 9360

ctcatcttct?tctttgtatc?ccgagatgct?ggtgggtggg?ttggaggggg?atgattgatg 9420

gcaatgcaca?cagtttgtga?gggcttacaa?attgacacaa?tcagagcctc?ttggcatata 9480

aaattttagc?cctcatatct?gtctgaagag?gactcagcaa?atgggccaat?ccctaatgtt 9540

gggtctgcaa?atggacttgt?acaatccatg?ataaaaagga?gtatgggcca?cagaagacag 9600

aaactcttcc?aaagaatgtc?tttctaacct?tgatccctgg?gtagaatgag?atcctgtttc 9660

catgggagtc?ttacttggct?tgcaaaaaag?ggtgtagggc?agtagcttgg?ccttttttcc 9720

atcataattt?ccttgagctg?ttttacctta?atccctccaa?actctcacct?tctgagagcc 9780

tcctaatgaa?acattgttag?actggtgggg?tggccaagac?atgccaacaa?cacccttctt 9840

tagaggtggt?gtttttagag?gacagagaac?attatgaagc?ctagagcagc?agaggtcaag 9900

atgccacgaa?atggaattga?tctgggaatt?tttttttttt?ttcattctca?ggatgcaggt 9960

tcattctgaa?ctttccccta?ggccttcatt?gcttttgtgt?gtatgtgtgc?ataaattctg 10020

caaatagaaa?aatgagagtt?tgcaccagta?ctcactagat?ttaacaccag?aaagtggtac 10080

ttttctggct?gtattatgcc?atgatagcac?attttctgtt?ggtgttccct?aactgacaag 10140

tataacagtt?ttcctaaacc?acacaacaat?gctatgatgt?taatggggta?gatatttttg 10200

gaaaaaaatt?gcacagtgag?aacatgggta?gatgaaccct?aagactctta?cctcaattca 10260

gaactcgcaa?ggagttaagt?gagtggggt 10289

<210>4

<211>22

<212>DNA

＜213〉artificial

<220>

＜223〉Mus musculus GITRL forward PCR primer

<400>4

atggaggaaa?tgcctttgag?ag 22

<210>5

<211>25

<212>DNA

＜213〉artificial

<220>

＜223〉Mus musculus GITRL inverse PCR primer

<400>5

gaatggtaga?tcaggcatta?agatg 25

<210>6

<211>39

<212>DNA

＜213〉artificial

<220>

＜223〉contain the Mus musculus GITRL forward PCR primer in SalI site

<400>6

tttaaagtcg?acccaccatg?gaggaaatgc?ctttgagag 39

<210>7

<211>42

<212>DNA

＜213〉artificial

<220>

＜223〉contain the Mus musculus GITRL inverse PCR primer in EcoRI site

<400>7

tttaaagaat?tctcattaag?agatgaatgg?tagatcaggc?at 42

<210>8

<211>534

<212>DNA

＜213〉homo sapiens

<220>

<221>CDS

<222>(1)..(534)

<400>8

atg?tgt?ttg?agc?cac?ttg?gaa?aat?atg?cct?tta?agc?cat?tca?aga?act 48

Met?Cys?Leu?Ser?His?Leu?Glu?Asn?Met?Pro?Leu?Ser?His?Ser?Arg?Thr

1 5 10 15

caa?gga?gct?cag?aga?tca?tcc?tgg?aag?ctg?tgg?ctc?ttt?tgc?tca?ata 96

Gln?Gly?Ala?Gln?Arg?Ser?Ser?Trp?Lys?Leu?Trp?Leu?Phe?Cys?Ser?Ile

20 25 30

gtt?atg?ttg?cta?ttt?ctt?tgc?tcc?ttc?agt?tgg?cta?atc?ttt?att?ttt 144

Val?Met?Leu?Leu?Phe?Leu?Cys?Set?Phe?Ser?Trp?Leu?Ile?Phe?Ile?Phe

35 40 45

ctc?caa?tta?gag?act?gct?aag?gag?ccc?tgt?atg?gct?aag?ttt?gga?cca 192

Leu?Gln?Leu?Glu?Thr?Ala?Lys?Glu?Pro?Cys?Met?Ala?Lys?Phe?Gly?Pro

50 55 60

tta?ccc?tca?aaa?tgg?caa?atg?gca?tct?tct?gaa?cct?cct?tgc?gtg?aat 240

Leu?Pro?Ser?Lys?Trp?Gln?Met?Ala?Ser?Ser?Glu?Pro?Pro?Cys?Val?Asn

65 70 75 80

aag?gtg?tct?gac?tgg?aag?ctg?gag?ata?ctt?cag?aat?ggc?tta?tat?tta 288

Lys?Val?Ser?Asp?Trp?Lys?Leu?Glu?Ile?Leu?Gln?Asn?Gly?Leu?Tyr?Leu

85 90 95

att?tat?ggc?caa?gtg?gct?ccc?aat?gca?aac?tac?aat?gat?gta?gct?cct 336

Ile?Tyr?Gly?Gln?Val?Ala?Pro?Asn?Ala?Asn?Tyr?Asn?Asp?Val?Ala?Pro

100 105 110

ttt?gag?gtg?cgg?ctg?tat?aaa?aac?aaa?gac?atg?ata?caa?act?cta?aca 384

Phe?Glu?Val?Arg?Leu?Tyr?Lys?Asn?Lys?Asp?Met?Ile?Gln?Thr?Leu?Thr

115 120 125

aac?aaa?tct?aaa?atc?caa?aat?gta?gga?ggg?act?tat?gaa?ttg?cat?gtt 432

Asn?Lys?Ser?Lys?Ile?Gln?Asn?Val?Gly?Gly?Thr?Tyr?Glu?Leu?His?Val

130 135 140

ggg?gac?acc?ata?gac?ttg?ata?ttc?aac?tct?gag?cat?cag?gtt?cta?aaa 480

Gly?Asp?Thr?Ile?Asp?Leu?Ile?Phe?Asn?Ser?Glu?His?Gln?Val?Leu?Lys

145 150 155 160

aat?aat?aca?tac?tgg?ggt?atc?att?tta?cta?gca?aat?ccc?caa?ttc?atc 528

Asn?Asn?Thr?Tyr?Trp?Gly?Ile?Ile?Leu?Leu?Ala?Asn?Pro?Gln?Phe?Ile

165 170 175

tcc?tag 534

Ser

<210>9

<211>177

<212>PRT

＜213〉homo sapiens

<400>9

Met?Cys?Leu?Ser?His?Leu?Glu?Asn?Met?Pro?Leu?Ser?His?Ser?Arg?Thr

1 5 10 15

Gln?Gly?Ala?Gln?Arg?Ser?Ser?Trp?Lys?Leu?Trp?Leu?Phe?Cys?Ser?Ile

20 25 30

Val?Met?Leu?Leu?Phe?Leu?Cys?Ser?Phe?Ser?Trp?Leu?Ile?Phe?Ile?Phe

35 40 45

Leu?Gln?Leu?Glu?Thr?Ala?Lys?Glu?Pro?Cys?Met?Ala?Lys?Phe?Gly?Pro

50 55 60

Leu?Pro?Ser?Lys?Trp?Gln?Met?Ala?Ser?Ser?Glu?Pro?Pro?Cys?Val?Asn

65 70 75 80

Lys?Val?Ser?Asp?Trp?Lys?Leu?Glu?Ile?Leu?Gln?Asn?Gly?Leu?Tyr?Leu

85 90 95

Ile?Tyr?Gly?Gln?Val?Ala?Pro?Asn?Ala?Asn?Tyr?Asn?Asp?Val?Ala?Pro

100 105 110

Phe?Glu?Val?Arg?Leu?Tyr?Lys?Asn?Lys?Asp?Met?Ile?Gln?Thr?Leu?Thr

115 120 125

Asn?Lys?Ser?Lys?Ile?Gln?Asn?Val?Gly?Gly?Thr?Tyr?Glu?Leu?His?Val

130 135 140

Gly?Asp?Thr?Ile?Asp?Leu?Ile?Phe?Asn?Ser?Glu?His?Gln?Val?Leu?Lys

145 150 155 160

Asn?Asn?Thr?Tyr?Trp?Gly?Ile?Ile?Leu?Leu?Ala?Asn?Pro?Gln?Phe?Ile

165 170 175

Ser

<210>10

<211>10331

<212>DNA

＜213〉homo sapiens

<400>10

attaatctca?aactttattt?tttcttataa?aaagtgattt?tcttatctag?aaataatctg 60

gaatactttc?ttagatgaga?gcacaccact?ttattctccc?aagcctcctc?tacacgtgca 120

ctgtactgcc?gtttgattta?ggaaagaaat?ttttttcccc?tctgaacttc?ccttgtgctt 180

ttttttttat?gttctgagtt?tgtgttggct?ttcagccttc?cgttcctttt?gttgtatttg 240

atctggtgcc?aaatgagagt?cagcacttaa?gttataagta?tcattttcta?acacagtgac 300

agaaggaaaa?ctccgccttc?cacacccact?actaattacc?atattgctac?aaaacatgac 360

attgcatcct?tcacccatca?cttgtgaatt?tttgttttcc?acagctctca?tttctccaaa 420

aatgtgtttg?agccacttgg?aaaatatgcc?tttaagccat?tcaagaactc?aaggagctca 480

gagatcatcc?tggaagctgt?ggctcttttg?ctcaatagtt?atgttgctat?ttctttgctc 540

cttcagttgg?ctaatcttta?tttttctcca?attagaggta?aggaggcaat?tgtacctaag 600

gttactattt?gctataatcc?tctatttatt?tgtttttcta?gttgttatca?ttgtcactca 660

gtattgttag?caatagttgg?aaggaagaga?tgtgtataca?taatgtaaat?acaattctaa 720

tattgtcatg?acatggcgtt?tgaagtttat?ctaaaggttt?tgagataaaa?ggtatcagaa 780

aatgctaaat?gttagctgca?gaactctgtt?agatagagag?aactggttaa?gccaattgac 840

aggggcctgt?ggagtatttt?tccttccctc?tgctatagct?cttggtggaa?taaaaaaggt 900

aaaaatatga?atgaatatca?aggaatggga?tgcaagctat?agtcttattt?atggaaaaga 960

cttaaaaaaa?tagtgaaaga?caggattaag?taaatgacag?gtggtttgtg?tgtctttgag 1020

gagggaagtg?gccctgagct?aggtgtaaga?agatctggat?tctggttctg?ggtctcctaa 1080

taaccagctg?tataaatttg?ataaagacat?ttaatctctc?tagtttgcag?cttctttatc 1140

taaaaaaact?ggtggtaggg?gaatggattt?attatgatgt?ttcttctagc?tataaaatgt 1200

catgatcaag?aatttattta?agggtagtat?gaagaataaa?tgcctaagtc?actcaaaagc 1260

agggaacaat?gactttagat?tgagttgatc?agggaagact?tcatggagga?atgagaaagc 1320

ccatatctat?ttgggaagcc?cctgatgctt?gtcaggaatt?tcccattgag?atgcaggcca 1380

agctgtgggc?ctagagaatg?ggatggtaca?ctgggaatgg?agattagttt?tgttctttac 1440

taaaaaatct?ttcctcacag?ttaactacgt?agcactgatc?aaaaagaaaa?taagaaatgc 1500

tttatttatt?tcaggattta?gcctatttct?ggctaaattt?gaagactcta?agttttgggg 1560

agaataaagt?ggcatatgtc?catctgagaa?agagttgaaa?tgtgactgca?gaaacacttt 1620

tcttaaggga?actgaccagc?aaagatttca?aagatatagt?tctaccactt?aagataagta 1680

aaagtaattg?agaaaagatg?caggaggaag?cagtccccta?ttgatattaa?tttagagtag 1740

gtatagcttt?ggccaatttt?tccacagtag?cccattaatt?tgtattccat?aactgtatac 1800

aaggcttatg?tgcaacagag?gcatttctaa?ttacaaccct?gctctctcaa?gaaatgtatg 1860

aagcagaagt?gtgaactttc?tgggtcagtg?aagttgaaag?aaagaattgt?cagaaattct 1920

tagtgtctag?atttctgaag?aagaggaagg?gtgagaatag?caataactta?aatttggaag 1980

tgcttctttc?ttctaaaaat?tataagatta?attagccaga?taaccctgaa?gaacactgaa 2040

tataagcatc?atcagttcct?acatatgact?caggaatgaa?tacacagaag?cctttcccaa 2100

aggcacccag?cagttcttgc?aaagggaaag?agaaagtcta?ataatgccag?atcatctggg 2160

acacctctct?tcagaatcaa?actggattaa?tcccatgtgt?ttgagctctg?attctggttt 2220

ctctctccta?gatccagttt?ctcaatgaaa?tgttctacct?ctaaagataa?cccagagttt 2280

gtttcaaatt?tggggaagta?taaaatgttt?ttagaatatt?gttctgacag?gacacttgca 2340

ggatttgttt?ctatgggaaa?agccagtggc?ctggccaacc?atacatgata?ttagcttctg 2400

catttcactt?tccacttacc?tgtacttccc?tttccctatt?ggccacaaat?aaatatctct 2460

ggaaaagaag?tctgagaggc?tggcagatag?tgattcatta?tgatgtggcc?acttccacat 2520

tgtcacaata?cccatgaacc?gtgaagtttt?attttggtct?ccactctagt?ttttacatac 2580

aaagtcccac?tttccagatt?gtctagacac?tactttaaaa?agtgtacact?taaaagaaag 2640

tgtaacactt?taaaaagtgt?tagatgggaa?gcttggctcc?ttgggtcaat?ttttttcttt 2700

ttttctctct?tctttgagaa?aatatttaac?taaaaggata?gctgtgagtc?caaggagttt 2760

ggtcaatccc?tcagtgaaaa?taatctcaca?ggaattatca?ctaagaaatc?aaatgttcag 2820

cagagtctga?acttcagcaa?aatgaaggat?actttcagaa?ggggaagttg?tacttatact 2880

taaaagcaga?gcagatttta?ttttcactga?tgatttgatt?agggttggtt?tggagagaga 2940

atgattgttt?tggccatttt?gagccgaact?acgtaaatct?agccttaaat?caagaagagg 3000

ttacaaaagc?aactgatcct?tctaagcaaa?aataacgaac?ccatatgtgt?ctttaaaagt 3060

gggtatttac?tacttccaaa?catcagcaga?attataaata?gaaacttacc?ccacagagtg 3120

gtagaggtga?gagtgttgac?ccagacaggc?tgggtgtaga?tctcattctt?gccttttatt 3180

ggctgcatga?ccttaggcta?gttacttaat?ccctctcatc?ctcatttcct?catctgcaaa 3240

atgagcaacc?taatttttgt?agagttgtgc?taaggattaa?tgagacagta?gagtatctga 3300

cataaagtag?ctcccagtag?aggggagtga?ttaatatttg?ccccattact?attaatgaga 3360

taataatggg?caaaaattta?acaagaccat?ttaacaatat?ggatagtctt?tgcctaccta 3420

tatcactctc?tcaatcaaac?actatatctc?agagccaaat?ttatgatttt?gcaattagat 3480

ggatttttag?tggtggcaat?aattagagag?tatcacagtg?atggtctctg?tagcgctaaa 3540

tagacataaa?gcagcctgca?gtatattata?cggaatttct?gactctggaa?attagtttgg 3600

acttaggttg?tctatagctt?aggtttctct?gagcacatct?catacatgct?agtagatggt 3660

gcagatacta?tctgtggcac?gtattttggc?actcattcat?atttagattg?ttaccaaatt 3720

gctttgggtg?tgtaatcatg?tctttctaga?aagattataa?acttcttgag?aagcaaggac 3780

caaaaattac?atttgtttct?catgcttaca?atgctgtaca?atgttggaaa?tatggatgct 3840

taaattgtag?ttcaattctt?cattacaatc?accatcatca?cccaaacagc?taatatttat 3900

tgaacaggtc?caggcaggat?atctaggcaa?agcccttatt?aaaaacgacc?tcatttaacc 3960

ccaacaactt?caacaagcta?ggtgctatta?tttctcccat?tttatagatg?aggaaattgg 4020

ggttaaggga?gtctttgtca?cgtccctatc?atgggttgaa?ctaaattgaa?tttcaacatc 4080

tcctccagga?aacaccaaaa?tgaggatgaa?ataattgcaa?gaggccaggc?acagtggctc 4140

acgcctataa?tcccagcact?ttgggaggct?gaggcgggta?gattgcttga?ggtcaagagt 4200

ttgagaccag?cctgggcaac?atggcaaaac?cctgtctcta?caaaaaaata?caaaaaaaat 4260

agctgggctt?ggtggcatgc?acctgtagtc?ccagctactc?agggggctga?cgtgggagaa 4320

ttggttgagt?ccaggaggat?gaggctgtag?tgaactgaga?taacaccact?gcactccagc 4380

ctgggcaacg?gaatgagacc?ctgtctcaaa?aaacaacaac?aacaacaaca?acaacaaaaa 4440

aaaacaagtg?tagggaatca?aaaaatttat?ttcctagaat?agtggctttc?agacttttta 4500

attgcacctc?cctttcaata?acatattatc?agtataattc?ccaacatttg?tatgctaatt 4560

attatactat?atacaagtac?taataatatg?tacactaaag?agatacacaa?aatatatatt 4620

tataagggtg?agccaaataa?tatattcaat?gtaactctca?caatgcaaaa?ccattttgct 4680

ttcaccaaaa?tgttatattt?tctataatca?ttaatatgtc?ataaacatta?ctaaaataag 4740

taaaatattt?taataacgtg?gtgaatgcat?ttattttatt?ttttaatctg?agcttaacac 4800

tatgtgatac?agcaatttga?agtttgatat?gttaatttac?cttgtttcat?gattttgacc 4860

atcatgactg?aaaaattacc?cgacaaacaa?atatagatta?aaatggaaga?acacatcttt 4920

ggatattctt?atcatgtcat?accacttaat?tttcaatcca?tcattcaatg?atggatgcct 4980

ctctttcctt?ccttccacaa?ctaaattcca?agatctatag?ctttaacacc?tccctcgcat 5040

aaactcactc?acttgcttct?ctctatcttc?attatactct?aatgacaaaa?gctcgactat 5100

ggaaaacctc?caatgctgat?taaatccaac?tgctctgtct?ctttcactgt?tgaatatatc 5160

tgaagaaaaa?cataaaattt?tttgaaaggt?cttactttaa?attcacagcc?actgccttca 5220

agtggatttc?attgttgctc?tggaaacagc?ccatgtttcc?ccagtccatt?cactctcctc 5280

tactggatga?tttcatacct?ttagcttctc?ttcaaacatc?taataactct?tccccattct 5340

cactctccac?tgataacgtt?gcctccatat?tttaagagaa?aatagaagta?cggaggaaag 5400

aagttccaat?atcaacaact?cattggcatt?tgtgtccagg?tatactgtta?ttctgtcttg 5460

tcactatgga?taaattgtcc?atgcatctat?ccaagccatc?tatgaactaa?atcttatcct 5520

ctcttgccta?ctcagggaca?ttgctgcaac?agttctctcc?tcgctcttac?atattatgcc 5580

tcatccattt?tacagaaaca?tttccatcaa?atggaaatag?aaaaacgtgt?tgtcatttct 5640

ctcacattaa?aacgtaacaa?caacaacaac?aacaacaaca?acaaaaaacc?tctttgatct 5700

ctcatcctca?tccaaactcc?actcattttt?ttctgctctc?cctacagcaa?aattcctcca 5760

acttctcttg?tcccatttac?ccttaaattt?attttaacta?agcttctgcc?ctcttcacat 5820

atcacagaaa?ctaattttgt?caagaactcc?agtgactacc?atgttgctca?atctatcagt 5880

caattcactg?tactcttctt?acttgatcta?tcaacagcat?ttgacaccag?ctgatcactc 5940

gtccttcatg?aaatactttc?ttttcttggc?ttccaaacat?cagactctcc?tagtttcctt 6000

tcagactcag?cttttccttt?ctattgtccc?ttgcttgttc?tttctcattc?tccgacctct 6060

aaacatcaca?acgccccagt?gttcctctcc?atctacaccc?actaacatga?tggcctcata 6120

caatctcaca?gcttaaaaca?tcaactatga?gcttaagact?cttaaatgta?tatcaccaga 6180

gctccttaaa?tttcagcctg?cttgacacac?ttacttggat?ttataataag?catcacaaac 6240

taatatgtcc?acaaccaaac?tcatcattgt?tcccctcccc?atttattcct?cttacatctt 6300

atccatttta?gtgaataaca?actttatctt?tccaattatg?caggcctaaa?atactggagt 6360

catctttgtt?tcttctcatt?ccctacccca?tatccatgtc?aggaacttct?gttggctcta 6420

ttttccaacc?aagtatcacc?atctacagag?ctagcacctt?ggtcagagac?accatgctct 6480

cttgcctaga?tgaatgactg?taatgatctc?ttagctagtc?tcactacatt?tgcccttgcc 6540

tctgtttaat?ttgttcctag?catagcagcc?agagaaatcc?tacaaaagga?aagtgtgcaa 6600

cacgtttaag?ttcaaaaagt?cttttaagca?ctttgccatt?aggaaaccaa?taacctttgg 6660

gtgatacaaa?aaatgtttgt?ggttatgcct?gaatttacta?caacgtattt?ttgagcattt 6720

agcattaact?acttgtgttt?gtaaaattaa?ccacacactg?atggcatctt?gtagcatgtg 6780

aactgccgta?cattgcagta?gtctgaaact?tggaactgtt?tttcagggta?tctcagatac 6840

tgtatatgac?atgtagttat?ctgaatatta?tacatgggtg?gtttcatcaa?tctgagttgt 6900

aaatatttct?agggcttaat?ttactgtttt?aaataaaata?aacataaata?gaagcttcac 6960

tattttcctt?tcacatgcca?acagatcacc?ttgtgcagtc?actggggtgt?ggaaactgct 7020

attttgttga?aaaactttta?gagcccaagg?ttgggggggg?ggtccgatat?caaatagttg 7080

tcctgtaggt?atagattagg?taatggaatg?agatcttgac?ctttgtctaa?aagacctaaa 7140

agggaagcta?ggtaataaaa?ggtaaaggat?ggagccactc?aactttaaag?ggaggctgag 7200

agggctgaga?catggtgaag?ggaaggattt?tttttatggt?tatagaacac?tagtttgctt 7260

caggaattca?aagctctaaa?taaatcaatc?aaaaaaatta?atgacactgt?catcatccta 7320

atcaattcat?cttttatttc?cccaacagac?tgctaaggag?ccctgtatgg?ctaagtttgg 7380

tgagtaacct?atcttgcatg?tcttttactt?ttcttagttt?ttgatgcaag?aaggcaggtg 7440

tcagtgatct?caagaaaacc?tgtattttct?tttattcatt?tctgagctac?tatgtataat 7500

tacttatcat?gtactgggca?gttgcccaag?agctgaggct?ttcagaggta?aaccaggcaa 7560

aagaagccca?tgccctgata?aagcttatgt?tgaaggctgc?atctctggcc?aggaatgagc 7620

atctctctta?ctggcctatg?aatctgagat?ccgggaatct?ccttttaatt?ctgtgtttta 7680

ataaacacaa?caagtttcag?atttctacaa?cctttcctta?aagtctttct?catgtttcac 7740

atattgctaa?tgtccaatgg?agtatgtgag?agagtgccat?tgttgtttct?aaatgtatag 7800

aagagcaatg?agagttggaa?aagtggccac?ttcctctact?attttctctt?ctaagcttag 7860

cttctgagtc?attttccctt?gtggtcacct?gatatttgct?tagaaaacac?accagtttac 7920

agttacactg?agccttagat?tcttagaata?catggaaaat?ttcagataaa?tacatttttt 7980

ttaaagttgt?ttataggttt?caggccaaac?atacattttc?agttgagaac?agaccatttc 8040

tagagttaac?tctgcaaccc?ctgtgttcct?atatagttta?aaccagtagg?tttccttggc 8100

ttgtgggaat?tagaaaatgt?ccttttgcct?gtctctttct?ttgtgttttg?tttttgtttt 8160

gcccataagt?ggaatggaat?gcatggcatg?tgtgaaatta?tgccttgatg?tggtaaaagt 8220

tgagaaactc?aagtgatgct?aaggtggtct?ttaaatgacc?ccctttcaca?gaattaaatg 8280

ggagaaccaa?tgacacttct?tcctggtgac?ctgcctattg?cctattacat?gtcaaggaag 8340

aagaaattta?ctgggctccg?agctcattgg?cgatactggg?tggctttgtc?ttttgttcta 8400

gtgatcgctc?tttcattctc?ctccagaatc?taccttcaga?gtcttatatt?agtcattcat 8460

atgaatgagc?attgaagtaa?aaatgttacc?tcttccaggg?tgtttcctca?tcaagttttc 8520

tttttaatta?tgggacaaag?gacaaaaatt?atggagaatt?gcagaacaga?taagcattct 8580

gggtggtaaa?agcacctccc?ggggctgtga?gatcacactg?ctgtgcaaaa?ccaagtaatg 8640

ttaggcaaac?atctaagttt?catatgtgct?aatgaaaatg?aatgattagg?tctttacctt 8700

ttctttacca?tttgggacag?tattgcacta?gggatcctta?tatttaaata?gtcaagttat 8760

ttctatttat?aaactcataa?atttacaatt?agctattttt?gggggattta?tttaatgaat 8820

cctaagtagg?tcttaaatga?tatataccta?caaactgagg?agaacagcca?taatttagac 8880

acaaagcacc?taattcagga?acatggaagt?atcattcaat?caataaatat?ttatggaaca 8940

tctaccaggt?accagggact?ttttcaggtg?ctgaaaatac?aagaatgaac?aaaatagaga 9000

tatatttgtc?ctaaaaaatt?ttacattcaa?agtgatacaa?gatggacaat?aaacaaatga 9060

acaatttagt?ttataacatc?ctagacactg?acacacttta?tgaagaaaac?tcaagcaagg 9120

taaaatgagg?gaatgatagg?agaacacttt?ttaatatagc?ataattaagg?aaagccacac 9180

tgataaagtg?ataaacagcc?agtggtattt?acaccgaaaa?tgcctggaaa?ggcatggact 9240

gccaaccctg?gttttcaaaa?ttttggcttg?tgatttcttt?ctccattagt?cttttcttct 9300

cctttctttt?tcccacaaat?attaatcaac?aagagatgcg?aagtcactta?agtcattttt 9360

ctattccaaa?ttcttttcct?tagaattctt?gctccaagca?agaaatactc?tttggatttg 9420

caatttctct?aaaacaagga?gtagataggt?acttaaaata?gaaaaattct?gcttgaagag 9480

aactagtgta?gatcaggtaa?agaaacaaca?tgtatgtggt?aaataattaa?ctacaatctg 9540

gaaaaggatg?aaataatgaa?ataactatgc?tttcatcttt?tttatccttg?tatatttctt 9600

ataggaccat?taccctcaaa?atggcaaatg?gcatcttctg?aacctccttg?cgtgaataag 9660

gtgtctgact?ggaagctgga?gatacttcag?aatggcttat?atttaattta?tggccaagtg 9720

gctcccaatg?caaactacaa?tgatgtagct?ccttttgagg?tgcggctgta?taaaaacaaa 9780

gacatgatac?aaactctaac?aaacaaatct?aaaatccaaa?atgtaggagg?gacttatgaa 9840

ttgcatgttg?gggacaccat?agacttgata?ttcaactctg?agcatcaggt?tctaaaaaat 9900

aatacatact?ggggtatcat?tttactagca?aatccccaat?tcatctccta?gagacttgat 9960

ttgatctcct?cattcccttc?agcacatgta?gaggtgccag?tgggtggatt?ggagggagaa 10020

gatattcaat?ttctagagtt?tgtctgtcta?caaaaatcaa?cacaaacaga?actcctctgc 10080

acgtgaattt?tcatctatca?tgcctatctg?aaagagactc?aggggaagag?ccaaagactt 10140

ttggttggat?ctgcagagat?acttcattaa?tccatgataa?aacaaatatg?gatgacagag 10200

gacatgtgct?tttcaaagaa?tctttatcta?attcttgaat?tcatgagtgg?aaaaatggag 10260

ttctattccc?atggaagatt?tacctggtat?gcaaaaagga?tctggggcag?tagcctggct 10320

ttgttctcat?a 10331

<210>11

<211>21

<212>PRT

<213>Apis?mellifera

<400>11

Met?Lys?Phe?Leu?Val?Asn?Val?Ala?Leu?Val?Phe?Met?Val?Val?Tyr?Ile

1 5 10 15

Ser?Tyr?Ile?Tyr?Ala

20

<210>12

<211>13

<212>PRT

＜213〉artificial

<220>

＜223〉synthetic PLP peptide

<400>12

His?Ser?Leu?G1y?Lys?Trp?Leu?G1y?His?Pro?Asp?Lys?Phe

1 5 10

Claims (54)

1. isolated nucleic acid molecule, described nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO:1 or SEQ IDNO:3.

2. the isolated nucleic acid molecule of claim 1, wherein said nucleic acid molecule connects at least one expression control sequenc effectively.

3. with the nucleic acid molecule conversion of claim 2 or the host cell of transfection.

4. isolated nucleic acid molecule, described nucleic acid molecule under high stringent condition with SEQ IDNO:1 or the listed nucleotide sequence of SEQ ID NO:3 or its complementary sequence hybridization.

5. isolated nucleic acid molecule, described nucleic acid molecule encoding comprise the albumen of active fragments of the aminoacid sequence of the aminoacid sequence of SEQ ID NO:2 or SEQ ID NO:2.

6. the isolated nucleic acid molecule of claim 5, wherein said nucleic acid molecule connects at least one expression control sequenc effectively.

7. with the isolated nucleic acid molecule conversion of claim 6 or the host cell of transfection.

8. non-human transgenic animal, somatocyte and sexual cell contain the DNA of the nucleotide sequence that comprises SEQ ID NO:1 or SEQ ID NO:3 in described transgenic animal.

9. isolating albumen, described albumen comprises the aminoacid sequence of the isolating nucleic acid encoding of claim 4.

10. isolating albumen, described albumen comprises aminoacid sequence or its active fragments of SEQ ID NO:2.

11. an isolated nucleic acid molecule, described nucleic acid molecule comprise and SEQ ID NO:1 or the nucleotide sequence of SEQ ID NO:3 or the nucleotide sequence of its fragment complementation, the expression of wherein said nucleic acid molecule in cell causes the GITRL output that reduces.

12. the isolated nucleic acid molecule of claim 11, wherein said nucleic acid molecule connects at least one expression control sequenc effectively.

13. antisense oligonucleotide, described oligonucleotide with corresponding to the nucleotide sequence that comprises SEQ ID NO:1 or SEQ ID NO:3 or the mRNA complementation of its segmental nucleic acid molecule, wherein said oligonucleotide suppresses the expression of GITRL.

14.siRNA molecule, described siRNA molecule is corresponding to the nucleotide sequence that comprises SEQ ID NO:1 or SEQID NO:3 or its segmental nucleic acid molecule, the expression of wherein said siRNA molecules in inhibiting GITRL.

15. isolated antibody, described antibody can be specifically in conjunction with the albumen of claim 10.

16. the antibody of claim 15 is in the wherein said antibody and the GITRL activity.

17. the antibody of claim 16, wherein said antibody are the 10F12 that has the 5F1 of ATCC preserving number PTA-5336 or have ATCC preserving number PTA-5337.

18. be used to screen the method for test-compound, described test-compound can suppress the interaction of GITRL and GITR, comprises step:

The sample that will comprise GITRL and GITR contacts with described compound; With

Determine with respect to not with sample that described compound contacts in GITRL and the interaction of GITR, whether the interaction of GITRL and GITR reduces in the described sample,

Thus with sample that described compound contacts in GITRL and the interactional reduction of GITR show that described compound is for suppressing the interactional compound of GITRL and GITR.

19. the method for screening test-compound, described test-compound can strengthen or simulate the interaction of GITRL and GITR, comprises step:

The sample that will comprise GITRL and GITR contacts with described compound; With

Determine with respect to not with sample that described compound contacts in GITRL and the interaction of GITR, whether the interaction of GITRL and GITR increases in the described sample,

Thus with sample that described compound contacts in GITRL and the interactional increase of GITR show that described compound is for strengthening or the interactional compound of simulation GITRL and GITR.

20. a method of diagnosing autoimmune disease, inflammation or transplant rejection in the experimenter, it comprises step:

Detection is measured from the examination that is subjected to of GITRL gene product in described experimenter's the sample; With

The described normal amount of the GITRL gene product in examination amount and the control sample that is subjected to is compared,

The examination amount that is subjected to that is significantly higher than normal amount thus provides positive index in the diagnosis of autoimmune disease, inflammation or transplant rejection.

21. be used for the method at experimenter's diagnosing cancer or infectious diseases, it comprises step:

Detection is measured from the examination that is subjected to of GI TRL gene product in described experimenter's the sample; With

The described normal amount of the GITRL gene product in examination amount and the control sample that is subjected to is compared,

The examination amount that is subjected to that significantly is lower than normal amount thus provides positive index in the diagnosis of cancer or infectious diseases.

22. one kind is used for the treatment of the method that has autoimmune disease, inflammation or transplant rejection after diagnosing or be in the experimenter in the above-mentioned disease risks, it comprises to described experimenter uses the GITR antagonist.

23. comprising, the method for claim 22, wherein said method use the GITR antagonist to keep experimenter's effector T cell to by CD4 ⁺CD25 ⁺The inhibiting susceptibility that regulatory T cells produces.

24. the method for claim 22, wherein said GITR antagonist are selected from the anti-GITRL antibody of neutralization, the anti-GITR antibody of neutralization, the fusion rotein that comprises GITR, the fusion rotein that comprises the active fragments of GITR, antagonism small molecules, antisense GITRL nucleic acid molecule and siRNA GITRL nucleic acid molecule.

25. the method for claim 22, wherein said autoimmune disease or inflammation are selected from rheumatoid arthritis, encephalomyelitis, osteoarthritis, multiple sclerosis, autoimmunity gastritis, systemic lupus erythematous, psoriasis and other inflammatory dermatosis, type i diabetes, asthma, allergy and inflammatory bowel disease, comprise Crohn's disease and ulcerative colitis.

26. the method for claim 22, wherein said autoimmune disease is a multiple sclerosis.

27. one kind is used for the treatment of the method that has cancer or infectious diseases after diagnosing or be in the experimenter in the described disease risks, comprises to the experimenter and uses the GITR agonist.

28. comprising, the method for claim 27, wherein said method use the GITR agonist so that the GITR agonist provides costimulatory signal and make it not be subject to experimenter's CD4 for experimenter's effector T cell ⁺CD25 ⁺The inhibiting influence that regulatory T cells produces.

29. the method for claim 27, wherein said GITR agonist are selected from the active fragments of GITRL, GITRL, the fusion rotein that comprises GITRL, the fusion rotein that comprises the GITRL active fragments and excitability GITR antibody.

30. a method that is used to induce the cell colony propagation that comprises effector T cell, it comprises to described cell colony uses the GITR agonist.

31. the method for claim 30, wherein said GITR agonist are selected from the active fragments of GITRL, GITRL, the fusion rotein that comprises GITRL, the fusion rotein that comprises the GITRL active fragments and excitability GITR antibody.

32. the method for claim 30, wherein said effector T cell is CD4 ⁺T cell or CD8 ⁺The T cell.

33. a method that is used to suppress comprise the cell colony propagation of effector T cell, it comprises to described cell colony uses the GITR antagonist.

34. the method for claim 33, wherein said GITR antagonist are selected from the anti-GITRL antibody of neutralization, the anti-GITR antibody of neutralization, the fusion rotein that comprises GITR, the fusion rotein that comprises the GITR active fragments, antagonism small molecules, antisense GITRL nucleic acid molecule and siRNA GITRL nucleic acid molecule.

35. the method for claim 33, wherein said effector T cell is CD4 ⁺T cell or CD8 ⁺The T cell.

36. one kind is used at CD4 ⁺CD25 ⁺Blocking-up comprises the inhibiting method of the cell colony of effector T cell under the situation that regulatory T cells exists, and it comprises to described cell colony uses the GITR agonist.

37. comprising, the method for claim 36, wherein said method use the GITR agonist so that the GITR agonist provides costimulatory signal and it is not subject to by CD4 for described effector T cell ⁺CD25 ⁺The inhibiting influence that regulatory T cells produces.

38. the method for claim 36, wherein said GITR agonist are selected from the active fragments of GITRL, GITRL, the fusion rotein that comprises GITRL, the fusion rotein that comprises the GITRL active fragments and excitability GITR antibody.

39. the method for claim 36, wherein said effector T cell is CD4 ⁺T cell or CD8 ⁺The T cell.

40. one kind is used at CD4 ⁺CD25 ⁺Inhibition comprises the method for the cell colony of effector T cell under the situation that regulatory T cells exists, and it comprises to described cell colony uses the GITR antagonist.

41. comprising, the method for claim 40, wherein said method use the GITR agonist to keep described effector T cell to by described CD4 ⁺CD25 ⁺The inhibiting susceptibility that regulatory T cells produces.

42. the method for claim 40, wherein said GITR antagonist are selected from the anti-GITRL antibody of neutralization, the anti-GITR antibody of neutralization, the fusion rotein that comprises GITR, the fusion rotein that comprises the GITR active fragments, antagonism small molecules, antisense GITRL nucleic acid molecule and siRNA GITRL nucleic acid molecule.

43. the method for claim 40, wherein said effector T cell is CD4 ⁺T cell or CD8 ⁺The T cell.

44. be used for the method at experimenter treatment cancer or infectious diseases, described method comprises the step of obtaining effector T cell colony, handling described colony and described treated colony is used to the experimenter who suffers from cancer or infectious diseases with the GITR agonist.

45. the method for claim 44, wherein said GITR agonist are selected from the active fragments of GITRL, GITRL, the fusion rotein that comprises GITRL, the fusion rotein that comprises the GITRL active fragments, excitability small molecules and the anti-GITR antibody of excitability.

46. the method for claim 44, wherein said experimenter suffers from cancer, and wherein said treated colony is as tumor vaccine.

47. comprise the pharmaceutical composition of GITR agonist and drug acceptable carrier.

48. the pharmaceutical composition of claim 47, wherein said GITR agonist are selected from the active fragments of GITRL, GITRL, the fusion rotein that comprises GITRL, the fusion rotein that comprises the GITRL active fragments, excitability small molecules and the anti-GITR antibody of excitability.

49. comprise the pharmaceutical composition of GITR antagonist and drug acceptable carrier.

50. the pharmaceutical composition of claim 49, wherein said GITR antagonist are selected from the anti-GITRL antibody of neutralization, the anti-GITR antibody of neutralization, the fusion rotein that comprises GITR, the fusion rotein that comprises the GITR active fragments, antagonism small molecules, antisense GITRL nucleic acid molecule and siRNA GITRL nucleic acid molecule.

51. a vaccine adjuvant, described vaccine adjuvant comprises GITR agonist and antigen, and described antigen is selected from virus antigen, bacterial antigens, fungal antigen, parasite antigen, cancer antigen, tumor associated antigen and its fragment.

52. the vaccine adjuvant of claim 51, wherein said GITR agonist are selected from the active fragments of GITRL, GITRL, the fusion rotein that comprises GITRL, the fusion rotein that comprises the GITRL active fragments, excitability small molecules and the anti-GITR antibody of excitability.

53. a vaccine adjuvant, described vaccine adjuvant comprises GITR antagonist and antigen, and described antigen is selected from autoantigen, 4 amyloid albumen, isoantigen, transplantation antigen, anaphylactogen and its fragment.

54. the adjuvant of claim 53, wherein said GITR antagonist are selected from the anti-GITRL antibody of neutralization, the anti-GITR antibody of neutralization, the fusion rotein that comprises GITR, the fusion rotein that comprises the GITR active fragments, antagonism small molecules, antisense GITRL nucleic acid molecule and siRNA GITRL nucleic acid molecule.

Images