CN1806055A - Pygopus in diagnosis and treatment of cancer - Google Patents
Pygopus in diagnosis and treatment of cancer Download PDFInfo
- Publication number
- CN1806055A CN1806055A CN 200480016906 CN200480016906A CN1806055A CN 1806055 A CN1806055 A CN 1806055A CN 200480016906 CN200480016906 CN 200480016906 CN 200480016906 A CN200480016906 A CN 200480016906A CN 1806055 A CN1806055 A CN 1806055A
- Authority
- CN
- China
- Prior art keywords
- pygopus
- gene
- cell
- expression
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
Expression of pygopus mRNA and Pygopus protein in established cancer cell lines and in patient tumors is described. Pygopus is shown to be a feasible diagnostic and prognostic indicator. Pygopus is also useful in cancer treatment therapy, for example in disrupting strategies that specifically target the activity of pygopus in cancer cells.
Description
The related application of quoting
The application requires to enjoy the preference of No. the 60/496th, 012, the U.S. Provisional Application of No. the 60/463rd, 309, U.S. Provisional Application submitting on April 17th, 2003 and submission on August 19th, 2003, and its content is incorporated herein for your guidance.
Technical field
The present invention relates to Pygopus gene and the application in the Clinics and Practices cancer of tumour thereof.
Background technology
Stable mark is the key of accurate diagnosing cancer in the malignant tumour differentiation.In addition, many such marks have also proved the target spot that can be used as treatment, when these marks are growth of tumour cell or to shift institute all the more so when essential.Comprise operation, radiotherapy and chemotherapy for the cancer prior treatment method.To a great extent, chemotherapy all relates to uses nonspecific DNA synthetic inhibitor, dna structure damage agent and DNA to mix agent, and DNA mixes agent and is meant in original dna molecular and mixes chemicals.The problem that these methods exist is that these chemotherapeutics are not special in cancer cells, thus can bring the serious adverse effects of much following chemotherapy, as vomiting, alopecia, gastrointestinal disturbance and destroy normal brain function.
Existing known road Wnt signal pathway has abnormal activation sometimes in colorectal carcinoma.Pygopus is a downstream effect molecule in this signal pathway.The problem that we faced is how human pygopus to be applied in the middle of the diagnosis and treatment of cancer.
Under the normal circumstances, (it is required that the signal pathway of β-catenin) is that fetal development and adult stem have in the breeding of control for classical Wnt/ β-chain of rings element.β-a chain of element is a reporter molecule crucial in this approach, and it is a kind of multifunctional protein, and its activity depends on its location in tenuigenin.Under the non-existent situation of Wnt signal, most of β-a chain of plain molecule is combined on the cytolemma, and it and E-cadherin (E-cadherin) all are that cytoadherence is necessary together.The plain tenuigenin level of free β-chain of rings is regulated and control by a degraded complex body, this complex body by comprise glycogen synthase kinase-3 β (GSK-3 β), cancer suppressor protein (APC) and casein kinase i that axle albumen (Axin), adenomatous polyp of colon are relevant constitute at interior tumour cancer suppressor protein, they cause the degradation process that the proteoplast of β in the tenuigenin-chain of rings element mediates jointly.The combination of Wnt and its acceptor can reduce the plain degraded of β in the tenuigenin-chain of rings, make it to be able in nucleus, to accumulate and be combined to one can be relevant with the cell cycle gene bonded complex body in.This complex body is made up of with nuclear protein Pygopus leukemia enhancement factor/T cytokine-1 (LEF/TCF-1), B-cell lymphoma-9 albumen (BCL-9).It is believed that Pygopus and BCL-9 combine the local destructurization of the chromatin that causes specifically, the basic transcription function that allows this startup target gene transcribe is achieved.
Summary of the invention
We have described in cancerous cell line of having set up and patient tumors at this, pygopusmRNA and Pygopus protein expression are assessed its effect as diagnosis and prognostic indicator, and determine the effect that it is brought into play with special at the active destruction strategy of pygopus in cancer.
With cancer cells for survival and unique cytology process that adopts is a target spot, adopt emerging technology to carry out rational medicinal design.Such as, be a focus of biomedical research for the functional study of the required gene of early embryo development, because important function of gene also has effect in cancer in growth.It equally also is the cancer cells necessary activity of surviving that some that are appreciated that embryonic cell have activity such as the propagation of control and intrusion/migration.Conversely, many cancers are again because the improper activation of some cell processes that once worked in fetal development and function causes, not only they are optional for the function of adult's cell, and are deleterious.
Applied molecular biology is analyzed and Antisense RNA Technique, and we have determined that human Pygopus is the needed a kind of nuclear protein of human malignancies cell proliferation.The valid data that the expression analysis that carries out with nucleic acid probe and special Pygopus antibody obtains show Pygopus high-caliber cross to express of all making peace in comprising the high malignancy cancer cells of ovarian cancer, mammary cancer, colorectal carcinoma and cervical cancer.All different with other any albumen is that Pygopus is essential new the conventional sign thing and the factor of cancer cells existence.The embryonic cell of therefore, not expressing and adult's cell of not expressing are insensitive to the measure that destroys the Pygopus function.Like this, Pygopus can be used for the specific drugs target spot of diagnostic purpose and the multiple cancer of conduct opposing.
Pygopus albumen contains two different structural domains, and 50 amino acid whose sequences of N-end are called the terminal homeodomain (NHD) of N-or N box and the terminal PHD structural domain (plant homeodomain) of C-.PHD motif (being also referred to as the white or LAP structural domain of leukemia associated protein), be the class Zinc finger domain (zinc finger-like domains) that a class contains the Cys4-His-Cys3 conserved sequence, see in the transcription regulatory protein of some chromatin allosteric types (Fig. 1).
The NHD of Pygopus is the structural domain that activates the Wnt signal pathway.This structural domain comprises N box (about 47 residues), and may extend to the terminal side of N-of Pygopus molecule.For example, the NHD of human Pygopus may contain up to about 1-232 amino acids.The NHD structural domain can use under the situation that does not have endogenic nuclear localization signal (NLS), and perhaps endogenic NLS can be replaced by the NLS of heterology.Therefore, in one embodiment, NHD has comprised at least 47 amino acid in the terminal side of Pygopus molecule N-, and has kept the ability that activates the Wnt signal.
The target spot that Pygopus and the polypeptide that is derived by it and nucleotide sequence can be used as cancer therapy (as chemistry or hormonotherapy etc.).Antibody can be used for the detection of all pre-neoplastics or tumour cell with other molecular designing relevant with Pygopus and diagnoses so that prognosis information to be provided.Sense-rna, RNA interfering (RNAi) and antibody can be used for destroying the function of Pygopus.Pygopus and derived peptide thereof and nucleotide sequence can be used for the examination of tumour and pre-neoplastic cell.
Our extremely sensitive antibody and nucleic acid probe will be used for as pathology sample, surgical biopsy tissue or for example other of Pap smear (pap smears) detect and distinguish cancer cells specifically based on cytological diagnostic method.Can obtain to be used for the new diagnostic reagent of cancer clinical prognosis diagnosis thus.Such diagnostic tool can be used as a prognostic indicator, be used for assessing exactly the classification of tumour with by stages so that more economical and tackle cancer and preceding cancer patients effectively.
We prove and destroy the growth that Pygopus can stop cancer cells specifically.Therefore interact specifically with Pygopus and make the molecule of its functionally inactive will can be used for cancer therapy.
We have described a kind of method of screening the Pygopus activity inhibitor by the specific binding capacity that detects testing inhibitor and NHD.Determinand illustrates that with combining of NHD determinand is a kind of pygopus activity inhibitor.Block for example ability of the transcriptional activation of the Wnt effector of cyclin D1 (Cyclin D1) by detecting determinand by NHD, can determine that this determinand is a kind of Pygopus inhibitor.Using the TOPFLASH system is to detect a kind of method (seeing example, Korinek etc., 1997 Science 275:1784-1787) of Wnt effector transcriptional activation.
We have also described the antisense sequences at human pygopus, comprise hPygo1 (SEQ IDNOs:3 and 4) and hPygo2 (SEQ ID NOs:1 and 2).Antisense sequences may be the sequence at pygopus-2; Promptly only and pygopus-2 combination and other human source gene sequence bonded antisense sequences of getting along well.Antisense sequences comprises and human pygopus-2 coding region or non-coding region, particularly 3 ' non-coding region bonded sequence.The length of antisense sequences may be at least 10,12,15,18,20,25,30,35 or 50 Nucleotide.It should be noted that hPygo1 and hPygo2 may be (Thompson, B. etc., Nat.Cell Biol.4, the 367-373 (2002)) that can exchange on function.
Except human pygopus full-length proteins, we have also described some other albumen, comprise the fragment of human pygopus.These fragments can be used as antigen at least and cause immune response and produce antibody.These fragments comprise the zone that human pygopus-2 is exclusive.These fragments may be derived by 1-45 position or the 74-312 amino acids of human pygopus-2.These fragments should have enough sizes with the antigenic determinant that constitutes function and cause antibody response.An antigenic determinant may be as short as 8 to 10 amino acid.
Containing these segmental albumen may be fusion rotein, and it comprises the foreign protein that forms with above-mentioned fragment frame endomixis.These fragments, particularly 8-30 amino acid whose small peptide section, also may with the crosslinked antibody response that causes of carrier molecule.
We have also described the antibody of human pygopus, comprise polyclonal antibody and monoclonal antibody.In one embodiment, antibody combines with the fragment of human pygopus-2.This fragment comprised human pygopus-2 exclusive pygopus zone, for example by 1-45 or the 74-312 amino acids institute deutero-amino acid fragment of human pygopus-2.In preferred embodiment, antibody can both reach enough titres in position or in the body, can with tumor cell specific combine.
We have also described the method for preparing human pygopus antibody.This method comprises foregoing human pygopus fragment or comprises the segmental fusion rotein of human pygopus or excite antibody response with the human pygopus fragment of carrier molecule bonded.
We have also described one and have judged whether cell is the method for cancer cells.This method comprises and detects in the cell whether overexpression of pygopus.In one embodiment, cell is the human cell.In another embodiment, cancer is ovarian cancer, epithelial ovarian cancer, mammary cancer, cervical cancer, neck cancer, lung cancer or colorectal carcinoma.Cell can accept that pygopus mRNA crosses detection of expression or pygopus protein is crossed detection of expression.
We have also described the method and the test kit of diagnosing cancer.Method and test kit are used to detect the pygopus overexpression.In one embodiment, cell is the human cell.In another embodiment, cancer is ovarian cancer, epithelial ovarian cancer, mammary cancer, cervical cancer, neck cancer, lung cancer or colorectal carcinoma.Cell can accept that pygopus mRNA crosses detection of expression or pygopus protein is crossed detection of expression.
We have also described the method that reduces the growth of tumour cell of expressing pygopus.This method comprises the activity of destroying pygopus in the cell.In one embodiment, destroy the activity of pygopus by the method for antisense polynucleotide.In another embodiment, use RNA to disturb the activity of destroying pygopus.
Therefore, the present invention relates to and judge whether the patient suffers from the method for malignant tumour, this method may further comprise the steps: the level that (a) detects Pygopus genetic expression from the biological specimen that this patient obtains, and (b) Pygopus gene expression dose in the biological specimen and predetermined threshold value are compared, judge whether the Pygopus genetic expression in the biological specimen is excessive; Thereby judge in this patient, whether there is malignant tumour.
The invention further relates to the method for monitoring patient's cancer progression situation.This method may further comprise the steps: (a) detect from the Pygopus gene expression dose in patient's the biological specimen, and (b) Pygopus gene expression dose in the biological specimen and predetermined threshold value are compared, judge whether the Pygopus genetic expression in the biological specimen is excessive; Thereby judge in this patient, whether there is malignant tumour; (c) in the time thereafter, use from this patient's biological specimen repeating step (a) and (b); And (d) detected Pygopus gene expression dose in step (c) and step (b) relatively; Monitor this patient's cancer progression situation thus.Predetermined threshold value can be the Pygopus gene expression dose of normal biological sample.
In some embodiments, cancer is an ovarian cancer, and biological specimen is the biopsy sample that comprises ovarian epithelial cell; Or cancer is mammary cancer, and biological specimen is the biopsy sample that comprises mammary gland cell.
In some embodiments, the Pygopus gene is the hPygo2 gene shown in the SEQ ID NO:1, or at the hPygo1 gene shown in the SEQ ID NO:3.
In some embodiments, the gene expression dose of Pygopus is determined by the amount of proteic amount of Pygopus or Pygopus mRNA.
The invention further relates to and detect the test kit that whether has malignant tumour among the patient, this test kit has comprised and can detect from Pygopus albumen in patient's biological specimen or the reagent of mRNA, and how to use this reagent to judge whether the Pygopus gene expression dose in the biological specimen is higher than predetermined threshold value, thereby judge the operation instruction that whether has malignant tumour among this patient.
In some embodiments, this reagent is the antibody with Pygopus albumen specific reaction.
In some embodiments, this reagent be can with a part of bonded polynucleotide of Pygopus gene or Pygopus gene.
In some embodiments, predetermined threshold value is the Pygopus gene expression dose in the normal biological sample.
The invention further relates to the human pygopus polypeptide that lacks PHD structural domain (PHD) sequence and NHD structural domain sequence.
In some embodiments, this polypeptide is hPygo-2 (the SEQ ID NO:2) polypeptide that lacks the 89-328 amino acids, or lacks hPygo-1 (SEQ IDNO:4) polypeptide of 85-341 amino acids.
The invention further relates to the nucleic acid of polypeptide in the code book invention, for example comprise the nucleic acid of 253-1023 position Nucleotide among 437-1156 position Nucleotide among the SEQ IDNO:1 or the SEQ ID NO:3.
The invention further relates to the antibody that can carry out specific reaction with polypeptide of the present invention.This antibody can be monoclonal antibody.
The invention further relates to the method for the compound that to suppress tumor cell proliferation, this tumor cells expression Pygopus wherein, this method comprises: (a) testing compound is detected, filter out and Pygopus expression of gene product bonded compound; (b) its inhibition ability of compound test in (a), filtering out to the Wnt-effector transcriptional activation of Pygopus mediation; And randomly (c) detects the compound that the filters out inhibition ability to these cell proliferations from (b) in ovarian epithelium cancer cells or breast cancer cell.
In some embodiments, the testing compound in the step (a) is by detecting and screen with proteic combination of Pygopus.
In some embodiments, the testing compound in the step (a) is by detecting and screen with combining of PygopusmRNA.
In some embodiments, in step (b), detect the restraining effect of testing compound to the cyclin D1 transcriptional activation of Pygopus mediation.
The invention further relates to the method for the antisense polynucleotide that obtains the inhibition tumor cell proliferation, this tumor cells expression Pygopus wherein, this method comprises: (a) provide with the Pygopus gene antisense or with the polynucleotide of a part of antisense of Pygopus gene; (b) this polynucleotide is joined in epithelial ovarian cancer or the breast cancer cell; And whether the polynucleotide that (c) measure to add has restraining effect to the propagation of cancer cells.
The invention further relates to the method for the compound that obtains the inhibition tumor cell proliferation, this tumor cells expression Pygopus wherein, this method comprises: (a) providing with the part of Pygopus gene or Pygopus gene is the short interfering rna (siRNA) or the class siRNA molecule of target spot; (b) siRNA or class siRNA molecule are joined in epithelial ovarian cancer or the breast cancer cell; And whether the siRNA that (c) measure to add or class siRNA molecule have restraining effect to the propagation of cancer cells.
The invention further relates to the method that suppresses tumor cell proliferation, this method comprise make tumour cell with breed amount of suppression can reduce that the active compound of Pygopus contacts in this cell.
In some embodiments, this tumour cell is ovarian epithelium cancer cells or breast cancer cell.
In some embodiments, it is active and suppress the transcriptional activation of Wnt-effector that this compound reduces Pygopus.
In some embodiments, this Wnt-effector is a cyclin D1.
The invention further relates to the method that suppresses tumor cell proliferation, this method comprises the compound of the expression of nucleic acid that can reduce coding Pygopus that adds the propagation amount of suppression in tumour cell.
In some embodiments, this compound be with the Pygopus gene antisense or with the polynucleotide of a part of antisense of Pygopus gene.
In some embodiments, this compound is the short interfering rna (siRNA) or the class siRNA molecule of target spot for the part with Pygopus gene or Pygopus gene.
The Nucleotide zone, 437-1156 position that the invention further relates to SEQ ID NO:1 in hPygo2 (the SEQ ID NO:1) sequence is the antisense oligonucleotide of target spot, wherein said antisense oligonucleotide and the hybridization of described Nucleotide regiospecificity ground, and the expression of reduction hPygo2.
The Nucleotide zone, 253-1023 position that the invention further relates to SEQ ID NO:3 in hPygo1 (the SEQ ID NO:3) sequence is the antisense oligonucleotide of target spot, wherein said antisense oligonucleotide and the hybridization of described Nucleotide regiospecificity ground, and the expression of reduction hPygo1.
The Nucleotide zone, 437-1156 position that the invention further relates to SEQ ID NO:1 in hPygo2 (the SEQ ID NO:1) sequence is the short interfering rna (siRNA) or the class siRNA molecule of target spot, and wherein said siRNA or class siRNA molecule have reduced the expression of hPygo2.
The Nucleotide zone, 253-1023 position that the invention further relates to SEQ ID NO:3 in hPygo1 (the SEQ ID NO:3) sequence is the short interfering rna (siRNA) or the class siRNA molecule of target spot, and wherein said siRNA or class siRNA molecule have reduced the expression of hPygo1.
In some embodiments, this antisense oligonucleotide has the sequence that is selected from SEQ ID NOS:5-14.
In some embodiments, this siRNA or class siRNA molecule have the sequence that is selected from SEQ IDNOS:15-19.
Description of drawings
Fig. 1: the aminoacid sequence of human hPygo2.Theoretic nuclear localization signal (KKRRK) is represented with runic.The PHD of C-end double underline mark, and NHD is with single underscore mark.
Fig. 2: the sequence contrast of human hPygo1 and hPygo2.
Fig. 3: the ability of anti-hPygo2 immune serum identification hPygo2 different zones.
(a) structure of Gal-4-hPygo2 fusion rotein.
(b) antiserum(antisera) with anti-hPygo2 detects immunoblotting (Western) analysis that Gal-4-hPygo2 makes up transient transfection HeLa cell.
(c) immunoblotting assay that makes up with anti-Gal-4 antibody test Gal-4-hPygo2.
(d) and (e) and the similar experiment of Flag peptide construction of fusion protein.
(f) with anti-hPygo2 antibody and the plain immunocytochemical assay that 4 OvCa clones are carried out of β-chain of rings.
(g) comparison of antisense oligonucleotide and hPygo2 cDNA segment total length.
(h) Antisense OligodeoxynucleotideTransfection Transfection HeLa cell and carry out RT-PCR and detect the relative closure of assessing the hPygo2 rna level.Densitometric scan shows the hPygo2 comparison of level and the relative level of GAPDH relatively.RT-does not add the negative control of reversed transcriptive enzyme.
Fig. 4: the overexpression of hPygo2 unanimity in the epithelial ovarian cancer.
(a) immunoblotting assay to normal (hOSE-1 ,-2) and malignant clone shows that the expression of composition in different clones in the Wnt signal pathway is different.
(b) (Northern blot NB) detects hPygo2 RNA and immunoblotting (IB) and detects proteic expression the RNA trace, shows that they cross expression at pernicious EOC clone camber.External synthetic hPygo2 (IVT) is as positive control.
(c) with the stroma cell be contrast, to painted density of neoplastic cell nuclei and ratio, classification is carried out in proteic expression to hPygo2 in the tumour according to the hPygo2 antiserum(antisera).Nonmalignant ovarian epithelium adenoma is that hPygo2 expresses negative (-).The dyeing of malignant tumour be from weak (+) to (++) to strong (+++).
(d) the plain example of in adjacent tumor biopsy, expressing of hPygo2 and β-chain of rings.Above two β-a chain of plain tenuigenin dyeing that show the weak and moderate of strong hPygo2 nuclear staining correspondence.Below two hPygo2 nuclear stainings and negative β-a chain of uniformly dyeing looks that show consistent moderate.
Fig. 5: the protein blocking in checking SK-OV-3 and the OV-CAR-3EOC clone.
(a) with antisense hPygo2 (α s) or unmatched contrast (mm) oligonucleotide transfectional cell, and with the cell (Cont.) or simulation transfectional cell (Reag.) contrast of untransfected.The expression of hPygo1 or β-chain of rings element is all uninfluenced, and the specificity of oligonucleotide (ON) is described.The expression of GAPDH is as the internal reference of RT-PCR, and ERK-1 is as the internal reference of immunoblotting.
(b) with β-chain of rings plain special siRNA and two siRNA (Hpy2A, D) transfection SK-OV-3 and OV-CAR-3 cells that hPygo2 is special.Immunoblotting detects hPygo2 and the plain expression of β-chain of rings, and as internal reference, external synthetic hPygo2 (IVT) is as positive control with ERK-1.
Fig. 6: observe hPygo2 and the plain sealing of β-chain of rings in the EOC clone with Laser Scanning Confocal Microscope.Among the figure of color version, the red fluorescence indication β-plain expression of the chain of rings, the expression of green fluorescence indication hPygo2.
(a) the SK-OV-3 cell of contrast transfection shows that β-chain of rings element mainly combines with cytolemma, and hPygo2 is then exclusively in nucleus.
(b) cell dyes with the hPygo2 preimmune serum.
(c) the unmatched contrast of SK-OV-3 cell transfecting ON.
(d) the antisense ON of SK-OV-3 cell transfecting hPygo2.
(e) β in the OV-CAR-3 control cells-a chain of element is incorporated into cytolemma, and hPygo2 is positioned at nucleus.
(f) and (j) the OV-CAR-3 cell dyes with preimmune serum.
(g) the unmatched ON of OV-CAR-3 cell transfecting.
(h) the antisense ON of OV-CAR-3 cell transfecting hPygo2.
(i) non-specific siRNA is to hPygo2 in the OV-CAR-3 cell or the plain not influence of expression of β-chain of rings.
(k) seal β-chain of rings element in the OV-CAR-3 cell expression of hPygo2 is not had influence.
(l) in the OV-CAR-3 cell, seal hPygo2.Arrow is indicated the unicellular of a hPygo2 normal expression.
Fig. 7: hPygo2 is that the EOC cells survival is required.
(a) transfection hPygo2 antisense ON (α s) and unmatched contrast ON (mm) are after 48 and 72 hours, and the growth of SK-OV-3 and OV-CAR-3 cell detects.
(b) dna content of the SK-OV-3 cell of transfection β-chain of rings element and hPygo2 siRNA, compare with simulation transfection (reagent) cell with contrast, be presented at the inferior G1 phase cell that higher proportion is arranged in the cell of hPygo2 disappearance, dna content calculates by measuring area under curve.
Fig. 8: the immunohistochemical analysis of hPygo2 in the mammary cancer.
(a) negative staining of the hPygo2 of normal galactophore tissue.
(b-d) infitrating ductal carcinoma is dyeed by hPygo2.The weak dyeing (b) of hPygo2 in the tenuigenin, the strong dyeing (c) of hPygo2 in the tenuigenin, the moderate stain (d) of hPygo2 in the strong dyeing of hPygo2 and the tenuigenin in the nuclear.Scale=100 micron.
Fig. 9: the expression of hPygo2, β in the clone-a chain of element and Bcl-9.(β-Actin) carries out stdn with GAPDH and beta-actin for RNA and protein level.
(a) expression of hPygo2 mRNA among the total RNA of rna blot analysis.The position of 28s shown in the figure and 18s ribosome-RNA(rRNA).
(b) immunoblotting shows the specificity of hPygo2 protein antibodies.According to the indication of left side molecular weight marker, the proteic approximate size of hPygo2 is 50kDa.The total length hPygo2 albumen (hPygo2) of in-vitro transcription and translation is as positive control.
(c) detect hPygo2 and the plain expression of β-chain of rings in the total lysate of cell of various clones with immunoblotting assay.
(d) expression of the conjugated protein Bcl-9 of Pygo.Use primer total RNA to be detected by RT-PCR at Bcl-9.-RT does not add the negative control of reversed transcriptive enzyme.
(e) expression of human Pygopus albumen in pernicious cancerous cell line do not rely on the factor in the Wnt signal pathway.The total protein that extracts from 8 different clones is represented 4 kinds of different tumor types, and uses antibody and anti-hPygo2 antibody at Wnt target protein and transducer to carry out immunoblotting assay.
(f) anti-hPygo2 antibody is used for the immunohistochemical analysis of MCF-7 breast cancer cell and SK-OV-3 ovarian cancer cell.The pair cell nuclear staining specifically of anti-hPygo2 antibody.
Figure 10: show hPygo2 and the plain Subcellular Localization in normal breast cell (Hs-574) and malignant galactophore cancer cells (Bt-474, Mcf-7) of β-chain of rings by using immunofluorescence and Laser Scanning Confocal Microscope.Preimmune serum use with the same extent of dilution of hPygo2 immune serum as negative control.
Figure 11: it is plain to seal β-chain of rings with RNAi in the Mcf-7 cell.Contrast of reagent shown in the figure (Oligofectamine) and non-specific siRNA contrast.
(a) immunoblotting assay shows the sealing of β-a chain of fibroin in the Mcf-7 cell of handling with siRNA.Make the albumen unanimity of load by beta-actin re-detection trace.
(b) the propagation situation of β-a chain of plain siRNA first treated cell cell after 72 hours.Shown in the result be based on 3 result of experiment, each experiment is carried out three parts.
Figure 12: in the HeLa cell, seal endogenous hPygo2 mRNA and albumen with antisense ON.(mismatch) contrast of the contrast of reagent shown in the figure (Oligofectamine), antisense Africa xenopus Pygopus2 (non-specific) and 4 base mispairings.CDNA and protein level carry out stdn with GAPDH and beta-actin.Experiment divides three parts and carries out.
(a) RT-PCR to pretreated human two the Pygo family members of antisense ON analyzes, and shows and seals hPygo2 specifically.RT-does not add the negative control of reversed transcriptive enzyme.
(b) immunoblotting assay shows the proteic sealing of hPygo2.
Figure 13: use antisense ON in the Mcf-7 cell, to seal hPygo2.(mismatch) contrast of the contrast of reagent shown in the figure (Oligofectamine), antisense Africa xenopus Pygopus2 (non-specific) and 4 base mispairings.
(a), confirm that hPygo2 albumen is closed to the immunoblotting assay of the total lysate of Mcf-7 cell after the antisense ON processing.
(b) the propagation situation of antisense ON first treated cell cell after 72 hours.Shown in the result be based on 3 result of experiment, each experiment divides three parts and carries out.
Figure 14: in the Mcf-7 cell, seal hPygo2 with siRNA.The contrast of reagent shown in the figure (Oligofectamine), non-special contrast siRNA (NS), β-a chain of element and hPygo2AsiRNA and hPygo2D siRNA.Growth of 72 hours mensuration cells and protein blocking after the transfection.Shown in the result based on 3 experiments, each experiment divides three parts and carries out.
Figure 15: in immunohistochemical analysis with the malignant cell in anti-hPygo2 antibody identification of ovarian epithelial cancer, mammary cancer and the lung cancer.Use anti-hPygo2 antibody that the file tumor specimen of being determined by the pathology expert who holds license is dyeed, the result shows that Pygopus has specific the mistake to express in various epithelial ovarian cancer (A, C), malignant breast carcinomas (G) and lung cancer (H).The negative staining that uses preimmune serum and only add two anti-contrasts has confirmed the specificity of antibody.
Figure 16: with the endogenous hPygo2 in the antisense ON sealing HeLa cervical cancer cell.(mismatch) contrast of the contrast of reagent shown in the figure (Oligofectamine), antisense Africa xenopus Pygopus2 (non-specific) and 4 base mispairings.
(a) transfection antisense ON 48 and the HeLa cell count after 72 hours.
(b) RT-PCR analyzes hPygo2 mRNA and relevant Pygo family member hPygo1.RT-does not add the negative control of reversed transcriptive enzyme.
(c) immunoblotting assay detects endogenic hPygo2 albumen.CDNA and protein level carry out stdn with GAPDH and beta-actin respectively.
Embodiment
I. polypeptide, nucleic acid and use thereof:
The nucleic acid and the polypeptide of the dna homolog that the term in the text " Pygopus " expression and SEQ ID NO:1 are discerned.In the mankind, have two Pygopus genes at least, hPygo1 gene (SEQ ID NOS:3 and 4) and hPygo2 gene (SEQ ID NOS:1 and 2); See Fig. 1 and Fig. 2.Pygopus also refers to the anomaly that this gene is natural, and these anomaly genes and original gene are very close, and keeps original genotypic function.
Term " isolating polynucleotide or polypeptide " is defined as polynucleotide or the polypeptide of separating from naturally occurring environment.For example, the dna molecular that is present in the n DNA molecule in the live bacteria genome or exists as the part of gene library is not separated, but because such as the mode of cloning (amplification), the same molecule of separating from bacterial genomes is isolating.Typically, isolated DNA molecule is to be free on outside the DNA zone (for example, the coding region), in natural genome then 5 ' or 3 ' end closely link to each other with these zones.These isolating polynucleotides might be the part of carrier or the part of composition, and still are defined as " isolating ", because such polynucleotide is not present in the such carrier or composition under natural condition.
Polynucleotide among the present invention is RNA or DNA (DNA of cDNA, genomic dna or synthetic), perhaps modifies body, varient, autoploid or fragment for it.These DNA can be double-stranded or strand, if strand, then can be coding strand, or noncoding strand (antisense)." polypeptide " or " albumen " is used to represent any amino acid chain, and no matter its length or post transcriptional modificaiton (for example, glycosylation or phosphorylation) is not arranged.These two terms can exchange in this application.
As used herein, " homologous amino acid sequence " is meant by under the condition of 25-35 ℃ subcritical melting temp (Tm), with the whole nucleotide sequence of any part hybridization in SEQ ID No:1 or the 3 amplifying nucleic acid sequences or any polypeptide of part nucleic acid sequence encoding.Homologous amino acid sequence is in one or more conservative aminoacid replacement and the different sequence of aminoacid sequence shown in SEQ ID No:2 or 4.Such sequence comprises that those have kept former polypeptide natural characteristics such as immunogenic sequence.Preferably, such sequence and SEQ ID No:2 or 4 have 75% homology at least, more preferably 80% homology, and 90% homology most preferably.
Homologous amino acid sequence comprises the identical and essentially identical sequence with SEQ ID No:2 or 4." aminoacid sequence is basic identical " is meant that sequence and reference amino acid sequence have at least 90% homology, preferred 95%, more preferably 97%, 99% homology most preferably, and preferably this sequence mainly distinguishes over reference sequences, the replacement between the amino acid of same type just in conservative aminoacid replacement.
Homology is measured with sequence analysis software, such as University of Wisconsin's biotechnology center (University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705) the sequence analysis software bag (Sequence Analysis Software Package) of hereditary computer group (the Genetics Computer Group).Aminoacid sequence is compared by the highest mode of homology.May in sequence, introduce some vacancies artificially in order to reach suitable comparison mode like this.
In this article, the stringent condition of prehybridization and hybridization reaches (i) in containing 6 * SSC solution of 50% methane amide, in 42 ℃, and 4-16 hour, or (ii) in 6 * SSC aqueous solution (pH 7.0 for 1M NaCl, 0.1M Trisodium Citrate), in 65 ℃, 4-16 hour.Typical hybridization carries out at 60-68 ℃, such as 65 ℃.Under this temperature, in 6 * SSC, can reach strict hybridization conditions, preferably in 2 * SSC or 1 * SSC, more preferably in 0.5 * SSC, 0.3 * SSC or 0.1 * SSC (not containing methane amide).1 * SSC contains 0.15M NaCl and 0.015M Trisodium Citrate.
SEQ ID No:2 or 4 partial sequence or its homologous amino acid sequence have the characteristic of full length sequence.The length of such polypeptide fragment preferably is at least 12 amino acid, preferably be at least 15,20,25,30,35,40,45,50 amino acid, more preferably at least 55,60,65,70,75 amino acid most preferably are at least 80,85,90,95,100 amino acid.
The segmental polynucleotide of coded polypeptide the and inner polypeptide of disappearance is on a large scale arranged is (Ausubel etc., Current Protocols in Molecular Biology, the JohnWiley ﹠amp that the method by standard makes up; Sons Inc., 1994).The method (Kunkel etc., Proc.Natl.Acad.Sci.USA (1985) 82:448) that these methods comprise that the restriction enzyme of Standard PC R, inverse PCR, clone's dna molecular is handled or people such as Kunkel uses.The component of these methods and operation instruction can obtain easily from different commercial sources.
In this article, fusion polypeptide is meant and contains polypeptide of the present invention or polypeptide derivative and in its N-end or the terminal fusion polypeptide that merges with any other polypeptide (being called the peptide chain tail hereinafter) of C-.A simple method that obtains such fusion polypeptide is the frame endomixis of translation polymerized nucleoside acid sequence, i.e. fusion gene.The fusion gene of coding fusion polypeptide inserts an expression vector and is used for transforming or transfection host cell.Perhaps, the polymerized nucleoside acid sequence of coded polypeptide or polypeptide derivative is inserted the expression vector of the polynucleotide that has had encoded peptide chain tail.Such carrier and operation instructions all can be bought from the market.
Coding Pygopus and varient thereof and segmental nucleic acid molecule can be used as probe, primer, chemical intermediate and are used for biological test among the present invention.These nucleic acid molecule can be used as the hybridization probe of messenger RNA(mRNA), transcription product/cDNA and genomic dna, are used for separation energy to produce varient (allelotrope, directly to homologue etc.) the pairing cDNA and the genomic clone of identical or related polypeptide.
These nucleic acid molecule also can be used for making up recombinant vectors.These carriers comprise the expression vector of expressing part or all of peptide chain-ordering.These carriers also comprise the insertion carrier, are used to be integrated into other sequence of nucleic acid molecules, for example in cellular genome, to revise the expressed in situ of gene and/or gene product.For example, by homologous recombination, an endogenous encoding sequence can be replaced with all or part of coding region that contains one or more specificitys introducing sudden changes.
These nucleic acid molecule can be used for the antigen part of expressing protein, also can be used for designing antisense polynucleotide, class siRNA molecule or corresponding to the ribozyme by all or part of mRNA that nucleic acid molecule described herein produced.
These nucleic acid molecule also can be used for the carrier of the part or all of Pygopus of construction expression, also can be used for the host cell of part or all of nucleic acid molecule of construction expression and polypeptide.
These nucleic acid molecule can also detect the having or not of expression of nucleic acid, level, form and distribution as hybridization probe.Show Pygopus overexpression in multiple human tumor in this experimental data that provides.Therefore, these probes can be used for surveying the existence of Pygopus in cell, tissue and body, and measure its level.The determined nucleic acid of level can be DNA or RNA.Therefore, the probe corresponding with polypeptide described herein can be used for assessing the copy number of expression of gene in specific cells, tissue or the body and/or gene.Compare with normal data, these application are relevant with the diagnosis of the disease of increase that relates to the Pygopus expression or minimizing.
The technology of vitro detection mRNA comprises RNA hybridization and in situ hybridization.The technology of vitro detection DNA comprises DNA hybridization and in situ hybridization.
Probe can be used as the integral part of diagnostic kit of the cell or tissue of recognition expression Pygopus, for example, by the nucleic acid level of measurement from coding Pygopus in the cell sample of the organism of for example mRNA or genomic dna, or whether detection Pygopus gene variation has taken place.
The expression of nucleic acid check can be used to discern the compound that can regulate Pygopus genetic expression, and is used for drug screening.Therefore the present invention provides a kind of certain compound of differentiating whether can be used for the treatment of the method for the disease relevant with Pygopus genetic expression, particularly biology and the pathological process that is mediated by Pygopus in cell of expressing Pygopus and tissue.Typical method comprises the ability of this compound adjusting of check Pygopus genetic expression, and and then differentiates whether a kind of compound can be used for treating with disadvantageous Pygopus genetic expression the disorder that is feature.These checks can be carried out in based on the system of cell, also can carry out in cell-free system.Comprise the cell of natural expression Pygopus gene based on the check of cell, perhaps through genetic engineering modified and reconstitution cell that express special Pygopus sequence.
The check of Pygopus genetic expression can relate to the direct detection to nucleic acid level, for example mRNA level, perhaps related attached cpd in the Wnt signal pathway.Further, the rise of the genetic expression of response Wnt signal pathway or downward modulation also can be verified.In this embodiment, the regulation and control zone of these genes can be carried out operability and is connected with the reporter gene such as luciferase gene.
So, the conditioning agent of Pygopus genetic expression can differentiate with a kind of like this method, wherein makes testing compound act on cell and measures the expression of mRNA.The expression level of Pygopus mRNA in the presence of this compound, the expression level of PygopusmRNA does not compare when not existing with this testing compound.Determine that according to comparative result this testing compound whether can be as a kind of expression of nucleic acid conditioning agent, and be used for the treatment of, for example show as the unusual disease of expression of nucleic acid.The expression of mRNA when testing compound exists, statistically when testing compound did not exist, then this testing compound was confirmed as the expression of nucleic acid agonist.Expression of nucleic acids when testing compound exists is starkly lower than testing compound when not existing on the statistics, then this testing compound is confirmed as the expression of nucleic acid inhibitor.
These nucleic acid molecule also are used in the qualitative change of check Pygopus genetic expression in the diagnosis, particularly cause the qualitative change of cancer pathology.These nucleic acid molecule can be used for surveying Pygopus gene and gene expression product, for example the sudden change among the mRNA.These nucleic acid molecule can be used as hybridization probe and are used for surveying the abiogenous transgenation of Pygopus gene, and and then assess the danger that this sudden change bring disease whether can for the carrier of sudden change.Sudden change comprises disappearance, insertion or the replacement of one or more Nucleotide in the gene, chromosome rearrangement, and for example inversion or transposition, the modification of genomic dna, unusual such as the mode of methylating, or the gene copy number change, such as amplification.When disease is to be crossed expression, expressed not enough or express when changing institute and causing by Pygopus, the detection of the Pygopus transgenation form relevant with dysfunction provides the diagnostic activities disease or to the instrument of disease susceptibility.
The sequence that betides specific position changes also available nucleic acid enzyme protection method and detects, and such as RNA enzyme (RNase) and S1 protection, perhaps detects with chemical break method.In addition, the sequence difference of Pygopus mutator gene and wild type gene can directly be determined by dna sequencing.Multiple automatization order-checking program can be used for diagnostic check (Naeve, C.W., (1995) Biotechniques19:448), comprises using the mass spectrum order-checking (to see example, PCT International Publication No.WO 94/16101; Cohen etc., Adv.Chromatogr.36:127-162 (1996); With Griffin et al., Appl.Biochem.Biotechnol.38:147-159 (1993)).
Detect other method of suddenling change in the gene and comprise method (Myers etc., the Science 230:1242 (1985) that uses the protection of fracture reagent to detect base mismatch in RNA/RNA or the RNA/DNA two strands; Cotton etc., PNAS 85:4397 (1988); Saleeba et al., Meth.Enzymol.217:286-295 (1992)), the electrophoretic mobility of mutant and wild-type nucleic acid is compared (Orita etc., PNAS 86:2766 (1989; Cotton etc., Mutat.Res.285:125-144 (1993); With Hayashi etc., Genet.Anal.Tech.Appl.9:73-79 (1992)), suddenly change or the migration (Myers etc., Nature 313:495 (1985)) of wild-type fragment in the polyacrylamide gel that contains the gradient denaturing agent with observing with the gradient denaturing gel electrophoresis.The technical examples of other check point sudden change comprises optionally oligonucleotide hybridization, optionally amplification and primer extension optionally.
The present invention also comprises the test kit that is used for the existence of detection of biological sample kinase nucleic acid.But this test kit can comprise the reagent that maybe can detect Pygopus-2 gene in the biological specimen or mRNA as nucleic acid mark or mark; Measure the method for Pygopus mRNA in the sample; Reach the method for Pygopus mRNA content in comparative sample and the standard substance.These compounds or reagent can be packed in the suitable containers.Also can further comprise the specification sheets that how to use this test kit to detect Pygopus mRNA or DNA in this test kit.
II. antisense polynucleotide
In other embodiments, the invention provides antisense molecule and ribozyme, mix degraded and/or the inhibition that influences Pygopus mRNA translation by external source.Treatment is incorporated herein by reference with the example of antisense polynucleotide, comprising: No. the 5th, 135,917, the United States Patent (USP) of authorizing on August 4th, 1992; No. the 5th, 098,890, the United States Patent (USP) of authorizing on March 24th, 1992; No. the 5th, 087,617, the United States Patent (USP) of authorizing on February 11st, 1992; No. the 5th, 166,195, the United States Patent (USP) of authorizing on November 24th, 1992; No. the 5th, 004,810, the United States Patent (USP) of authorizing on April 2nd, 1991; No. the 5th, 194,428, the United States Patent (USP) of authorizing on March 16th, 1993; No. the 4th, 806,463, the United States Patent (USP) of authorizing on February 21st, 1989; No. the 5th, 286,717, the United States Patent (USP) of authorizing on February 15th, 1994; United States Patent (USP) the 5th, 276, No. the 5th, 264,423, No. 019 and United States Patent (USP).
Preferred, in antisense molecule, want enough high with the complementary degree of Pygopus mRNA to avoid antisense molecule with non-target sequence non-specific combination to take place under given conditions, the required condition of specific combination for taking place in this certain conditions, during such as when experiment in the body or treatment or the physiological condition during experiment in vitro, and the condition when experimentizing.Antisense molecule bonded said target mrna not only can comprise the information of proteins encoded, also comprises relevant Yeast Nucleic Acid, forms the Yeast Nucleic Acid of 5 '-non-translational region, 3 '-non-translational region, 5 ' cap district and intron/exon joining region such as it.At United States Patent (USP) the 5th, 932, the method that screening can be used for providing the antisense nucleic acid and the ribozymal nucleic acid of these molecules is disclosed in No. 435.
Here the term of Shi Yonging " target nucleic acid " comprises dna encoding and transcribes the RNA (comprising premessenger RNA and mRNA) that obtains from this DNA, also comprises the cDNA that obtains from these RNA.The normal function of this nucleic acid is disturbed in oligomeric compound and the specific hybridization of its target nucleic acid.Come modulation target nucleic acid function by the compound of hybridizing target nucleic acid specifically, be commonly referred to " antisense ".The function for the treatment of interferential DNA comprises duplicates and transcribes.The function for the treatment of RNA interfering comprises all important function; place, the RNA that inserts to protein translation such as, RNA transfer in the cell apart from place far away, the synthetic place of RNA, by RNA translated protein, RNA montage to produce one or more mRNA and to bear or auxiliary catalytic activity by RNA.These are the modulation that Pygopus is expressed to target nucleic acid function interferential overall function.In the context of the present invention, " modulation (modulation) " means the increase (stimulation) of genetic expression or reduces (inhibition).In the context of the present invention, the optimal way of genetic expression modulation is to suppress, and preferred target position is mRNA.
In the context of the present invention, an antisense compounds " target " is a multistage process to a specific nucleic acid.This process starts from the identification to the nucleotide sequence of desiring its function of modulation usually.In the present invention, target position is the nucleic acid molecule of coding Pygopus.The target process also comprises determining of one or more sites in this gene, disturbs in order to antisense to take place, and gets a desired effect, as the disappearance and the modulation of protein expression.In the context of the present invention, the site is the zone that comprises middle translation initiation of this gene open reading frame (ORF) or terminator codon in the preferred gene.Because as known in the art, typical translation initiation codon is 5 '-AUG is (on the mRNA molecule after transcribing; And on the corresponding D NA molecule be 5 '-ATG), this translation initiation codon is also referred to as " AUG codon ", " initiator codon " or " AUG initiator codon ".Have the translation initiation codon of minority gene to have following RNA sequence: 5 '-GUG, 5 '-UUG or 5 '-CUG and 5 '-AUA, 5 '-ACG and 5 '-CUG, function is proved in its body.So, term " translation initiation codon " and " initiator codon " can comprise multiple codon sequence, and however, initial amino acid all is typical methionine(Met) (in eukaryotic cell) or formylmethionine (in prokaryotic cell prokaryocyte) in all cases.This area is known equally, protokaryon and eukaryotic gene can have two or more selectable initiator codons, in the type or tissue of specific cells, perhaps under the certain conditions group, wherein any one initiator codon all may preferentially be used for transcription initiation.In the context of the present invention, " initiator codon " and " translation initiation codon " refers to be used for the one or more codons of initial in vivo translation from the mRNA molecule of the genetic transcription of coding Pygopus, and irrelevant with the sequence of these codons.
This area is known equally, and translation stop codon of gene (or " terminator codon ") can have one of 3 kinds of sequences, promptly 5 '-UAA, 5 '-UAG and 5 '-UGA (corresponding DNA sequence is respectively 5 '-TAA, 5 '-TAG and 5 '-TGA).Term " initiation codon subarea " and " translation initiation codon district " are meant the part at for example mRNA or gene, and it comprises from each about 25 to 50 successive Nucleotide of translation initiation codon upstream and downstream (promptly 5 ' and 3 ').Similarly, term " termination codon subarea " and " translation termination codon region " are meant the part at for example mRNA or gene, and it comprises from each about 25 to 50 successive Nucleotide of the sub-upstream and downstream of translation stop codon (promptly 5 ' and 3 ').
Open reading frame known in the art (ORF) or " coding region " are meant the zone between translation initiation codon and translation stop codon, also are possible by the zone of efficient targeting.Other target area comprises 5 '-non-translational region (5 '-UTR), be meant in the part on translation initiation codon 5 '-direction on the mRNA molecule known in the art, therefore comprise that mRNA goes up corresponding Nucleotide on Nucleotide between 5 '-cap district and the translation initiation codon or gene, target region also comprises 3 '-non-translational region (3 '-UTR), be meant in the part on translation stop codon 3 '-direction on the mRNA molecule known in the art, comprise that therefore mRNA goes up on Nucleotide between translation stop codon and the 3 '-end or gene Nucleotide accordingly.5 ' of mRNA-cap comprises the N7-methyl guanosine residue that links to each other with mRNA 5 '-distal-most end residue by 5 '-5 ' triphosphoric acid key.5 ' of mRNA-cap district is considered to comprise 5 '-cap sequence self and initial 50 Nucleotide that are attached thereto.5 '-cap district also may be preferred target region.
Although some eukaryotic mrna transcription product is directly translation, many transcription products all contain the zone of one or more known being called " intron ", and these zones can cut off from transcription product before translation.(will translate thus) zone known being called " exon " of being left, then be spliced a successive mRNA of formation sequence.The shearing site of mRNA, that is intron-exon junction also may be preferred target regions, particularly be applied to the aberrant splicing diseases associated or with the special too much diseases associated of mRNA montage product.The junction of the unusual fusion that reorganization or disappearance produce also is preferred target region.Known being called of mRNA transcription product " fusion transcription product " that is produced by montage process from two (or more) mRNA in different genes source.Also have and find to show that intron can be effectively, and be the target region of preferred antisense compounds target DNA or premessenger RNA thus.
The same known optionally rna transcription product in this area can result from the same genome area of DNA.These optionally transcription product be called " mRNA varient " usually.More specifically, " premessenger RNA varient " is the transcription product that comes from same genomic dna, and this same genomic dna is with different by the initial or termination site of other transcription product of its generation, and contains intron and exon region.
In the montage process, owing to cut off one or more introns or exon region or its part, the premessenger RNA varient produces less " mRNA varient ".Therefore, the mRNA varient is the premessenger RNA varient that processes, and the montage result is that each unique premessenger RNA varient always produces unique mRNA varient.These mRNA varients also are called " alternative splicing varient ".If montage does not take place the premessenger RNA varient, then this premessenger RNA varient and mRNA varient are equal to.
The same known varient in this area can signal comes initial or stops transcribing producing by using optionally, and premessenger RNA and mRNA can have more than one initiator codon or terminator codon.Come from the premessenger RNA of use selectivity initiator codon or the varient of mRNA, be called " the initial varient of selectivity " of this premessenger RNA or mRNA.Those use the transcription product of selectivity terminator codon then to be called this premessenger RNA or mRNA " selectivity termination varient ".It is " polyA varient " that a kind of concrete selectivity stops varient, and wherein by choice mechanism, multiple transcription product produces the optionally selection from one of " polyA termination signal ", therefore produces the transcription product that ends at unique polyA site.
In case one or more target sites are identified, just can select the oligonucleotide that fully mates with target site, that is can fully hybridize, have enough specificitys, thereby get a desired effect.
In the context of the present invention, " hybridization " is meant the hydrogen bonded between complementary nucleosides or the nucleotide base, can be the Watson-Crick hydrogen bond, Hoogsteen hydrogen bond or inverse Hoogsteen hydrogen bonded.For example, adenine and thymine is a pair of complementary base, and they match by forming hydrogen bond.This paper employed " complementary " is meant accurate paired ability between two Nucleotide.For example, if the Nucleotide on oligonucleotide molecule on a certain specific position can with same locational Nucleotide on a DNA or the RNA molecule by hydrogen bond action, so just think that this oligonucleotide and this DNA or RNA are complementary on this position.If enough corresponding positions are arranged by can be occupied by the Nucleotide of interaction of hydrogen bond on two molecules, then this oligonucleotide and this DNA or RNA molecule are exactly complementary.So, " the energy specific hybridization " and " complementary " are used to represent the complementary of enough degree or pairing accurately as term, and they make between oligonucleotide and target DNA or the RNA firm and special combination has taken place.
When antisense compounds combines and disturbs their normal function with its target DNA or RNA molecule and makes its inactivation, antisense compounds is a specific hybridization, and under the required condition of specific combination, be the physiological condition in vivo test or when treatment and the condition when carrying out in vitro tests, and the condition that experimentizes, there is the complementation of enough degree non-specific combination to take place to avoid antisense compounds and non-target sequence.
Antisense compounds among the present invention and other can and suppress the compound of its expression with target gene hybridization, are determined by experiment, and the representative sequence of these compounds is used as among the present invention preferred embodiment hereinafter.These preferred antisense compounds complementary sites are called " easily hybridization site " hereinafter, and therefore are called preferred target site.Term used herein " easily hybridization site " is defined as the part that is easy in the gene region with at least 8 bases of the complementary sequence hybridization of nucleic acid.
The particular sequence of special easy hybridization site can be represented by the reverse complementary sequence of the antisense oligonucleotide series in the table 2, and those skilled in the art can determine that they are to be used to the embodiment illustrating and describe in scope of the present invention.Other easy hybridization site can be differentiated out by those of ordinary skill.
At least eight (8) the individual continuous base fragments that easy hybridization site from illustration is selected also are considered to the easy hybridization site that is fit to, even show low Tm value.And about 8 to the DNA or the RNA fragments of about 80 continuous bases, comprise the part 5 ' of easy hybridization site-or during 3 '-end sequence, for the purposes of the present invention, also be considered to easy hybridization site.Exemplary good easy hybridization site comprises following DNA or RNA sequence, it contains at least 8 successive bases since 5 ' of an easy hybridization site-end (remaining base is the continuous sequence that same DNA or RNA start from easy hybridization site 5 '-terminal upstream, and extend up to this DNA or RNA comprise about 8 till about 80 bases).Similarly good easy hybridization site is by following DNA or the representative of RNA sequence, it contains from least 8 successive bases of easy hybridization site 3 '-end beginning (remaining base is the continuous sequence that same DNA or RNA start from easy hybridization site 3 '-terminal upstream, and extend up to this target position comprise about 8 till about 80 bases).
On treatment was used, the specificity of antisense molecule and susceptibility were also utilized by those skilled in the art.Antisense oligonucleotide has been used as the treatment part of disease treatment in the animal and human.The antisense oligonucleotide medicine comprises ribozyme, has imposed on the mankind safely and effectively, and in the middle of a large amount of clinical trials carrying out.Therefore, can determine that oligonucleotide can be a kind of effective form of therapy, be used for the treatment of cell, tissue and animal body, particularly in the Ren Lei treatment plan.
In the context of the present invention, term " oligonucleotide " is meant the oligomer or the polymer of Yeast Nucleic Acid (RNA) or thymus nucleic acid (DNA) or its mimicry.These terms have comprised the oligonucleotide of being made up of (skeleton) covalent linkage between natural base, sugar and nucleosides, also comprise the oligonucleotide that those have functionally similar non-natural part.Such modification or the oligonucleotide of replacing are compared with natural form usually has some advantages,, takes in the avidity of enhancing and target nucleic acid, and the stability of raising in the presence of nuclease because they have Ideal Characteristics such as increasing cell.
Although antisense oligonucleotide is the preferred form of antisense compounds, also comprise the oligomeric antisense compounds of other among the present invention, the oligonucleotide mimicry that includes but are not limited to: hereinafter describe.Preferably contain according to antisense compounds of the present invention and to have an appointment 8 to about 80 bases the nucleosides of about 80 connections (promptly about 8 to).Particularly preferred antisense compounds is about 8 antisense oligonucleotides to about 50 bases, is more preferably to contain and has an appointment 12 to about 30 bases.Antisense compounds comprises ribozyme, external guide sequence (EGS) oligonucleotide (oligomerization ribozyme), and other short RNA that catalysis is arranged or with target nucleic acid hybridization and regulate the oligonucleotide that catalysis is arranged of its expression.
Length is the antisense compounds of 8-80 base, contains the fragment of at least eight (8) individual continuous bases in the antisense compounds that is selected from example, also deemed appropriate antisense compounds.
Exemplary preferred antisense compounds comprises following DNA or RNA sequence, it contains from 8 successive bases of 5 ' of one of preferred antisense compounds of example-end beginning (remaining base is that same DNA or RNA start from the continuous sequence with 5 '-terminal upstream of the antisense compounds of target nucleic acid specific hybridization, and extend up to this DNA or RNA comprise about 8 till about 80 bases) at least.Similar preferred antisense compounds is then by following DNA or the representative of RNA sequence, it contains from 8 successive bases of 3 ' of one of preferred antisense compounds of example-end beginning (remaining base is that same DNA or RNA start from the continuous sequence with 3 '-terminal downstream of the antisense compounds of target nucleic acid specific hybridization, and extend up to this DNA or RNA comprise about 8 till about 80 bases) at least.
At antisense compounds of the present invention with target spot hybridization and suppress it and express other compound and determined by experiment, and the representative sequence of these compounds is considered among the present invention preferred embodiment at this.The concrete sequence of antisense compounds is listed at this paper, and those skilled in the art can determine that they can be used for illustrating and describing concrete embodiment in scope of the present invention.
As known in the art, nucleosides is the combination of base and sugar.The base portion of nucleosides is heterocyclic base normally.Modal two classes are purine and pyrimidine in these heterocyclic bases.Nucleosides is the nucleosides that further comprises the phosphate group of covalently bound glycosyl part to nucleosides.Contain the nucleosides of furan type five-carbon sugar for these, phosphate group can be connected on 2 ', 3 ' or 5 ' hydroxyl of glycosyl.In the formation of oligonucleotide, phosphate group is the poly-compounds of a linearity of the covalently bound each other formation of adjacent nucleosides.Then, two ends of this linearity poly structure can further connect and compose a ring texture, and but, open linear structure generally is preferred.In addition, can also there be the complementary base inside of linear structure, and can fold thus and form duplex structure.In the oligonucleotide structure, phosphate group is commonly used to constitute the skeleton between the nucleosides on the oligonucleotide.RNA and DNA be connected or skeleton normally 3 '-to 5 '-phosphodiester bond.
The specific examples of the preferred antisense compounds of using among the present invention comprises the oligonucleotide of bonding between the skeleton that contains modified or non-natural nucleoside.Define as this specification sheets, the oligonucleotide that contains the skeleton of modified comprise keep phosphorus atom in those skeletons with skeleton in do not keep phosphorus atom.For the purpose of this specification sheets, and sometimes as the reference of this area, the oligonucleotide that does not contain the modified of phosphorus atom in the skeleton between nucleosides also can be considered to oligonucleotide.
Antisense molecule of the present invention (oligonucleotide) may comprise, contain just like being connected or containing between short chain heteroatomic ring or heterocyclic glycosyl between skeleton connection between the glycosyl of phosphotriester, methylphosphonate, short-chain alkyl and cycloalkyl glycosyl and connect, contain thiophosphatephosphorothioate and those have CH
2--NH--O--CH
2, CH
2--N (CH
3)--O--CH
2(also claiming methylene radical (auxotox radical) or MMI skeleton), CH
2--O--N (CH
3)--CH
2, CH
2--N (CH
3)--N (CH
3)--CH
2And O--N (CH
3)--CH
2--CH
2(at this phosphodiester is O--P--O--CH to skeleton
2) antisense molecule.The oligonucleotide that contains the morpholinyl skeleton structure also may be employed (United States Patent (USP) the 5th, 034, No. 506).In another embodiment, antisense oligonucleotide may have peptide nucleic acid(PNA) (PNA, be sometimes referred to as " protein nucleic acid ") skeleton, wherein the phosphodiester backbone of oligonucleotide can be replaced by the multi-polyamide skeleton, link to each other with nitrogen heteroatom or methylene group on the multi-polyamide skeleton directly or indirectly (Nielsen etc., 1991, Science 254:1497 and United States Patent (USP) the 5th of nucleoside base wherein, 539, No. 082).Phosphodiester bond can be substituted by structure some chiralitys or that chirality is special.Those of ordinary skill in the art can choose other connection in practical application of the present invention.
The oligonucleotide skeleton of preferred modified comprises, for example, thiophosphatephosphorothioate, the chirality thiophosphatephosphorothioate, phosphorodithioate, phosphotriester, the aminoalkyl group phosphotriester, comprise phosphonic acids 3 '-alkylene ester, the methyl of phosphonic acids 5 '-alkylene ester and chiral phosphonate and other phosphonate ester, phosphinate, the phosphamide that comprises 3 '-amino phosphamide and aminoalkyl group phosphonic amide, thio-phosphamide, the sulfydryl phosphonic acid ester, the sulfydryl phosphotriester, seleno phosphoric acid ester and boron substituted phosphate, it has normal 3 '-5 ' and connects, similar with it 2 '-5 ' connects, and the connection of those polarity reversals, be connected to 3 '-3 ' between one of them or the more Nucleotide, 5 '-5 ' or 2 '-2 ' connects.Preferably having reversing polar oligonucleotide connects between 3 '-terminal nucleotide and contains 3 '-a 3 ' independent connection, i.e. independent inverse nucleosides residue, its can be irremovable (base lose or on its position, have an oh group).Also comprise various salts, mix salt and free acid form.
Oligonucleotide may comprise that also those have the type of the nucleotide base of at least one modified.Thus, can use the common purine of occurring in nature and purine outside the pyrimidine and pyrimidine.Similarly, the modification to five carbofuran glycosyls of Nucleotide subunit also may be effective.The example of such modification is 2 '-O-alkyl-and 2 '-halo Nucleotide.2 ' some object lesson of modifying of glycosyl part useful among the present invention are OH, SH, SCH
3, F, OCN, O (CH
2)
nNH
2Or O (CH
2)
nCH
3, wherein n is between 1 to about 10; C
1To C
10Low alkyl group, low alkyl group, alkaryl or the aralkyl of replacement; Cl; Br; CN; CF
3OCF
3O-, S-or N-alkyl; O-, S-or N-alkenyl; SOCH
3SO
2CH
3ONO
2NO
2N
3NH
2Heterocyclylalkyl; The heterocycle alkaryl; Amino alkylamino; Poly-alkylamino; The silyl that replaces; The RNA group that ruptures; Reporter group; Intercalating agent; Be used to improve the group of oligonucleotide pharmacokinetic property; Perhaps be used to improve the group of oligonucleotide pharmacokinetic property and other has the substituting group of similarity.One or more furan type five-carbon sugar bases can be replaced by other sugar, sugared mimicry such as cyclobutyl or other group that replaces glycosyl.
In some embodiments, can contain from about 5 to about 100 nucleotide units according to antisense oligonucleotide of the present invention.Be appreciated that a nucleotide unit is a base-glycosyl combination (or combination of other similar structures), it forms skeleton structure by phosphodiester bond or other chemical bond and suitable the combining of the nucleotide unit that closes on.
Can and create routinely by known solid phase synthesis technique convenience according to antisense compounds of the present invention.Can additionally or alternatively use in any other synthetic method known in the art.Oligonucleotide technology of preparing like the application class as thiophosphatephosphorothioate method and alkyl derivative method, all is that people know.
Compound of the present invention also may be a blended, tunicary or be connected or bonded with molecule, molecular structure or the mixture of other compound, for example liposome, receptor target molecule, oral, rectum, part or other preparation are taken in, are distributed and/or absorb in order to auxiliary.The United States Patent (USP) that representational guidance prepares such auxiliary absorption, distribution and/or absorption-auxiliary agent comprises, but is not limited to: 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; With 5,595,756, these patents are incorporated herein by reference.
III.RNA disturbs
The nucleic acid of coding Pygopus or the available RNA of its segmental expression disturb (RNAi) technology to suppress or stop, and this is a kind of PTGS technology.RNAi can be used for producing plan " gene knockout (knockout) " or " gene sealing (knock down) ", the expression of the coded product of goal gene or coding region has been lowered in this system of base, and then causes the activity reduction generally of coded product in this system.Therefore, RNAi can carry out target at purpose nucleic acid molecule or its fragment or varient, in order to reduce the activity level of its expression and coded product thereof successively.Such system can be used for the research of this product function, also can be used for treating the disease relevant with the activity of this product.RNAi describes in following document, for example (2001), (2001), Sedlak (2000) and laid-open U.S. Patents application 20020173478 (Gewirtz such as Sharp (2001), Caplen such as Hammond; On November 21st, 2002 is open) and 20020132788 (Lewis etc.; On November 7th, 2002 is open), these are incorporated herein by reference.Be used to carry out reagent and all commercializations of test kit of RNAi, and can from for example Ambion Inc. (Austin, TX, USA) and New England Biolabs Inc. (Beverly, MA buy in USA).
The present invention relates to disturb (RNAi), be used to regulate compound, composition and the method that Pygopus expresses by using short interfering nucleic acid (siNA) to carry out RNA.SiNA of the present invention can be a unmodified, also can be through chemically modified.SiNA of the present invention can be chemosynthesis, vector expression or the enzyme catalysis synthetic.Use the siNA molecule expection of chemically modified the tolerance and/or the increase cell of nuclease degradation to be taken in, improved many-sided performance of natural siNA molecule by improving in vivo.SiNA molecule of the present invention useful reagent and the method for providing is provided for multiple diagnosis and treatment.
The present invention has described one or more siNA molecules and method, their independence or unite the expression of regulating Pygopus.
The present invention has also described to contain the siNA molecule of bonding between 2 '-5 ' nucleosides.Bonding can be positioned at 5 ' of a chain of siNA sequence or two chains-end, 3 '-end between 2 '-5 ' nucleosides, or be positioned at 5 ' simultaneously-and 3 '-end.In addition, bonding can come across other different position on one of siNA sequence or two chains between 2 '-5 ' nucleosides, for example, about 1,2,3,4,5,6,7,8,9,10 or comprise that more bonding can contain bonding between 2 '-5 ' nucleosides between each nucleosides of the pyrimidine nucleotide on one of siNA molecule or two chains, perhaps about 1,2,3,4,5,6,7,8,9,10 or comprise that more bonding can contain bonding between 2 '-5 ' nucleosides between each nucleosides of the purine nucleotides on one of siNA molecule or two chains.
In another embodiment, the siNA molecule of chemically modified of the present invention comprises the duplex structure with two chains, chemically modified can betide a chain or two chains, wherein the length of each bar chain between about 18 to about 27 (as, about 18,19,20,21,22,23,24,25,26 or 27) individual Nucleotide, its double center chain then between about 18 to about 23 (as, about 18,19,20,21,22 or 23) individual base pair.
In another embodiment, siNA molecule of the present invention comprises hair clip (hairpin) structure of strand, wherein the length of siNA between about 36 to about 70 (as, about 36,40,45,50,55,60,65 or 70) individual Nucleotide, have about 18 to about 23 (as, about 18,19,20,21,22 or 23) individual base pair, wherein this siNA can comprise chemically modified to improve the performance of natural siNA molecule each side.
In another embodiment, the linear siNA molecule with hairpin structure of the present invention contains stem cyclic group preface (stem loop motif), and wherein the circular part of siNA molecule is biodegradable.For example, linear hair clip siNA molecule of the present invention makes its circular part degradation in vivo through design, and can produce and have 3 '-terminal outstanding double-stranded siNA molecule, contains the outstanding of 2 Nucleotide of having an appointment such as 3 '-end.
In another embodiment, siNA molecule of the present invention comprises the circular nucleic acid molecule, wherein the length of siNA molecule between about 38 to about 70 (as, about 38,40,45,50,55,60,65 or 70) individual Nucleotide, have about 18 to about 23 (as, about 18,19,20,21,22 or 23) individual base pair, wherein this siNA can comprise chemically modified to improve the performance of natural siNA molecule each side.
In another embodiment, ring-type siNA molecule of the present invention contains two cyclic group prefaces (loop motif), and wherein one or two circular part of siNA molecule is biodegradable.For example, a ring-type siNA molecule of the present invention makes its circular part degradation in vivo through design, and can produce and have 3 '-terminal outstanding double-stranded siNA molecule, contains the outstanding of 2 Nucleotide such as 3 '-end.
Term as used herein " short interfering nucleic acid ", " siNA ", " short interfering rna ", " siRNA ", " short interfering nucleic acid molecule ", " the short oligonucleotide molecule that disturbs " or " the short interfering nucleic acid molecule of chemically modified " are meant any can mediate rna interference or the nucleic acid molecule of gene silencing.For example siNA can be double-stranded polynucleotide molecule, and it comprises self complementary justice and antisense district, and wherein the antisense district comprises and target nucleic acid molecule complementary part.SiNA can be the strand polynucleotide of hairpin structure, and it has self complementary justice and antisense zone, and wherein this antisense district comprises and target nucleic acid molecule complementary part.SiNA can be the cyclic single strand polynucleotide, it has the stem that two or more ring texturees and are contained self complementary justice district and antisense district, wherein this antisense district comprises and target nucleic acid molecule complementary part, and wherein this ring-type polynucleotide can be in vivo or external generation can mediate rna i active siNA.As used herein, the siNA molecule need not be confined to only contain the molecule of RNA, can further include the Nucleotide and the non-nucleotide of chemically modified.In some embodiments, short interfering nucleic acid molecule of the present invention lacks and contains 2 '-hydroxyl (Nucleotide of 2 '-OH).In some embodiments, short interfering nucleic acid does not need to exist the Nucleotide with 2 '-hydroxyl to come mediate rna i, and is same, short interfering nucleic acid molecule of the present invention do not contain alternatively any ribonucleotide (as, have the Nucleotide of 2 '-OH group).The short interfering nucleic acid molecule of modifying among the present invention also can be described as the short oligonucleotide of modifying " siMON " that disturbs.As used herein, the implication of term siNA is equal to other term that is used to describe the nucleic acid molecule with the sequence-specific RNAi ability of mediation, for example short interfering rna (siRNA), double-stranded RNA (dsRNA), micro rna, short hairpin RNA (shRNA), short oligonucleotide, short interfering nucleic acid, the weak point of disturbing disturb the oligonucleotide of modifying, siRNA, the PTGS RNA (ptgsRNA) of chemically modified, and other term.In addition, as used herein, the implication of term RNA i is equal to other and is used to describe sequence-specific RNA interferential term, for example PTGS.
The implication of " adjusting " is an expression of gene herein, the perhaps level of the RNA molecule or the one or more proteic RNA of the being equal to molecules of encoding, perhaps one or more proteic activity are upward or downward, and the observed value when promptly there are not conditioning agent in these expression, level or specific activity raises or reduced.For example, term " adjusting " can be represented " inhibition ", but the use of " adjusting " speech is not limited to this definition.
The implication of " inhibition " is the rna level that is equal to of the activity or the RNA of gene expression product or the one or more gene products of encoding herein, and the observed value when not having nucleic acid molecule of the present invention has reduced.In one embodiment, preferably to the inhibition level of siNA molecule, be lower than exist inactivation or active reduce can not mediate rna i response the observation level of the branch period of the day from 11 p.m. to 1 a.m.
In some system, the initial molecule that is used for RNAi is considered to and the corresponding dsRNA molecule of target nucleic acid.This dsRNA molecule is believed to cutting and forms short interfering rna (siRNA), and its length is 21-23 Nucleotide (two strands of 19-21bp, 3 '-end respectively has the outstanding of 2 Nucleotide).The enzyme that works in initial cutting step is called as " Dicer ", and it is the special nuclease of dsRNA, belongs to RNase III family member.In addition, RNAi can work by direct transfered cell, perhaps produces in cell by import suitable siRNA or class siRNA molecular precursor (as the carrier of coding precursor etc.) to cell.The siRNA molecule can combine and then form RNA inductive silencing complex (RISC) with intracellular other composition.SiRNA composition that the RISC of Xing Chenging next can be by wherein and the base pair interaction target purpose transcription product between the homologous target transcription product cause the target transcription product to rupture at about 12 the Nucleotide places of distance siRNA 3 '-end like this.So said target mrna is cut, and the level of its encoded protein product has also just reduced.
SiNA molecule of the present invention can be designed to suppress the Pygopus expression of gene by target different RNA RNA molecule i.In one embodiment, siNA molecule of the present invention is used for the different RNA of target corresponding to the Pygopus gene.The non-circumscribed example of such RNA comprises the RNA, the premessenger RNA and/or the RNA template of target gene of post transcriptional modificaiton of selectivity RNA splicing variants, the target gene of messenger RNA(mRNA) (mRNA), target gene.If alternative splicing produces the transcription product family by adopting suitable exon to distinguish, then can suppress or distinguish this gene family member's function by these suitable exons specifically, thus inhibition of gene expression.
In another embodiment, siNA molecule of the present invention can be used for the pairing conserved sequence of target Pygopus gene family.So, the siNA molecule of a plurality of Pygopus genes of target can produce better effect.
The effect of RNAi can be by realizing suitable external synthetic siRNA or class siRNA molecule transfered cell.RNAi can be for example finishes with the RNA of chemosynthesis.In addition, suitable expression can be used to transcribe such RNA in external or body.The in-vitro transcription of positive-sense strand and antisense strand (by the sequence encoding on same or the different carriers) can the T7 RNA polymerase realizes by for example using, and this carrier can comprise the suitable encoding sequence that is connected with T7 promotor operability in this case.In embodiment, the RNA of in-vitro transcription can become to be of value to the molecular size of RNAi in external processing (as by using intestinal bacteria RNase III).Justice and antisense transcription product are combined into the RNA two strands and are imported into the target cell.Also can use other carrier, it expresses bobby pin RNA (shRNA), and this shRNA can be processed to class siRNA molecule.Various method existing descriptions in this area based on carrier.No matter be in external or (as gene therapy) in vivo, the whole bag of tricks of these carrier transfered cells is being known in the art.
Therefore, in some embodiments, the expression of Pygopus can suppress by siRNA or class siRNA molecule corresponding to Pygopus coding nucleic acid or its fragment or its homologous nucleic acid transfered cell or that produce in cell." class siRNA molecule " is meant the nucleic acid molecule that also can bring into play the siRNA effect with siRNA similar (as molecular size and structure), promptly brings into play the expression inhibiting effect of RNAi mediation.In different embodiments, this method can be that pair cell is directly used siRNA or class siRNA molecule, or uses above-mentioned method based on carrier.In one embodiment, the length of siRNA or class siRNA molecule is less than about 30 Nucleotide.In another embodiment, siRNA or class siRNA molecular length are about 21-23 Nucleotide.In one embodiment, siRNA or class siRNA molecule contain the double-stranded part of 19-21bp, and 3 ' of each bar chain-end has the outstanding of 2 Nucleotide.In some embodiments, siRNA or class siRNA molecule and the coding nucleic acid of Pygopus or its fragment or varient (or fragment of varient) are identical basically.Such varient can be encoded and be had the active albumen of class Pygopus.In some embodiments, the positive-sense strand of siRNA or class siRNA molecule is identical (the T residue of dna sequence dna is substituted by U in RNA) with Pygopus nucleotide sequence or its fragment basically.
IV. pair cell transmits nucleic acid molecule
SiNA molecule list of the present invention with or with the coupling of other treatment method, can be used for anticancer propagation.For example the siNA molecule can comprise administration media, and this administration media comprises liposome, for to the acceptor administration, also can comprise carrier and thinner and its esters, and/or can be present in pharmaceutically acceptable formulation.
The medication of nucleic acid molecule is in Akhtar etc., 1992, Trends Cell Bio., 2,139; Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed.Akhtar, 1995; Maurer etc., 1999, Mol.Membr.Biol., 16,129-140; Hofland and Huang, 1999, Handb.Exp.Pharmacol., 137,165-192; With Lee etc., 2000, ACS Symp.Ser., 752, description is arranged among the 184-192, all these documents are incorporated herein by reference.In the PCT WO94/02595 of No. the 6th, 395,713, the United States Patent (USP) of Beigelman etc. and Sullivan etc., further described the ordinary method of transmitting nucleic acid molecule.These schemes can be used for the medication of any nucleic acid molecule in fact.
Nucleic acid molecule can be by the administration of various method known to those skilled in the art pair cell, these methods include but are not limited to: the liposome packing, electron ion penetrates or be integrated into other administration media, for example hydrogel, cyclodextrin, biodegradable nanocapsule and the microballoon of bioadhesive effect is arranged, or protein carrier (the international pct application WO 00/53722 of O ' Hare and Normand).Perhaps, this nucleic acid/dielectric composite both can pass through the direct injection topical, can pass through the infusion pump administration again.Direct injection nucleic acid molecule of the present invention, no matter be subcutaneous injection, intramuscularly or intradermal injection, all can use standard needle and syringe method, also can use for example Conry etc., 1999, Clin.Cancer Res., 5, the needleless technology of describing among the international pct application WO 99/31262 of 2330-2337 and Barry etc.Nucleic acid molecule useful as drug preparation of the present invention.Pharmaceutical preparation prevention, control morbidity or treatment disease of patient (alleviate a certain symptom to a certain extent, preferably alleviate all symptoms).
The invention is characterized in like this that in suitable carrier for example stablizer, buffer reagent and other reagent comprise the pharmaceutical composition of one or more nucleic acid of the present invention.Polynucleotide of the present invention, no matter have or not stablizer, buffer reagent and other reagent to make pharmaceutical composition, all can be by any standard method to (for example RNA, DNA or albumen) and import in patient's body.When using liposome administration mechanism even more ideal, can use the standard method of making liposome.Pharmaceutical composition of the present invention also can be made preparation, for example as tablet, capsule or be used for oral elixir, be used for suppository, sterile solution, injection suspensoid, and other composite preparation methods known in the art of anum administration.
The present invention also comprises the pharmaceutically acceptable preparation of described compound.These preparations comprise the salt of above-claimed cpd, hydrochlorate form for example, example hydrochloric acid salt, hydrobromate, acetate and benzene sulfonate.
" pharmaceutically acceptable preparation " is meant that composition or preparation can make the nucleic acid molecule among the present invention reach effective distribution in vivo, make it be suitable for having given play to ideal activity most.
Feature of the present invention also is to use the composition of the liposome that contains finishing, and these liposomes comprise poly-(ethylene glycol) fat (PEG modify or long circulating liposomes or hidden liposome).These preparations provide increases the method for medicine in the target tissue accumulation.This class pharmaceutical carrier is not subjected to conditioning and the scavenging(action) of mononuclear phagocyte system (MPS or RES), thereby prolongs the time in blood circulation, increases the exposure of tissue to the packaging medicine.These liposomes show in tumour optionally accumulation, this may with the target tissue that is rich in new vessel oozing out and catch relevant to liposome.Long circulating liposomes strengthens pharmacokinetics and the pharmacodynamic properties of DNA and RNA, compares more outstandingly with the cationic-liposome of routine, and known cationic-liposome can be accumulated in the MPS tissue.Long circulating liposomes is compared with cationic-liposome, more can protect medicine not by nuclease degradation effectively, because having, these liposomes avoid in the active MPS tissue of metabolism, and for example in liver and the spleen, the ability of accumulating.
V. screening experiment
On the other hand, the present invention relates to use Pygopus to carry out screening experiment as target spot, this screening can be used for discerning the compound that can be used as the Pygopus inhibitor, is used for prevention and treatment cancer.In some embodiments, such screening experiment can comprise the steps:
(a) provide testing compound;
(b) provide a Pygopus source; And
(c) measuring testing compound exists and the Pygopus activity that does not exist under the situation, illustrate that this compound is the inhibitor of the signalling system of Pygopus dependence, can be used for preventing and/or treating of cancer if the activity that records when wherein having testing compound to exist is low.
This paper employed " Pygopus activity " is meant the observable any type of phenomenon that is attributable to Pygopus, for example the transcriptional activation by the Wnt-effector or to the restraining effect of cancer cell multiplication.Transcriptional activation to the Wnt-effector can detect with any methods known in the art.Usually these methods relate to the activity of measuring the reporter gene that is connected with the promotor operability, and himself operability is connected to the Wnt-effect regulatory region that generally is present in by in the Wnt path activated gene.In one embodiment, these transcriptional activities record by luciferase reporter gene that (TOPFLASH is provided by Upstate: Cell SignallingSolutions, Charlottesville VA, USA; β-a chain of plain luciferase reporter gene makes up; Korinek, V. etc., 1997, Science 275:1784-1787 is incorporated herein for your guidance), this reporter gene comprises a plurality of T cytokines (TCF) binding site, can directly be activated by TCF/ β-a chain of plain mixture.For controlling nonspecific inhibition or activation,, and thus the uciferase activity data that recorded by the TOPFLASH reporter gene are carried out standardization processing with the alternative TOPFLASH of the reporter gene of Lef-1 binding site (FOPFLASH) with sudden change.
Detection method of the present invention can be used for being identified in the compound that in the biosystem Pygopus is had regulating effect, for example restraining effect.In embodiment, above-mentioned biosystem can be a mammals, and is for example human, or suitable animal model system, for example Africa xenopus.
The present invention further provides according to identification and can regulate the compound that (for example suppressing) Pygopus expresses, thereby identification prevents and/or treats the method for the compound of cancer.Such method can be included under testing compound existence and the non-existent situation and measure the Pygopus expression of gene.This genetic expression can pass through to detect effect RNA or proteic amount, or records by using suitable reporter gene to make up, and this report links to each other with the Pygopus gene gene constructed comprising usually, and the transcription regulatory element that is connected with the reporter gene operability.When first nucleotide sequence and second nucleotide sequence generation functional relationship, first nucleotide sequence and second nucleotide sequence " operability is connected ".Illustrate, if a promotor has influenced transcribing or expressing of an encoding sequence, then this promotor is that operability is connected with this encoding sequence.Usually the dna sequence dna that operability connects in the reading frame adjoins, and can insert in two protein-coding regions when being necessary.Yet, for instance and since enhanser usually with promotor between just function can be arranged when separating by several thousand bases, and the length of sequence is not to wait in this gene, some polynucleotide section can be the operability connection, but does not adjoin.
" transcription regulatory element " is a technical term, is meant transcribing of the albumen coded sequence that can be operatively connected with it induced or the dna sequence dna of control action kou, as initial sum termination signal, enhanser, promotor, splicing signal, polyadenylation signal.The expression of such reporter gene can be by transcribing or translation skill detection, for example RNA of Chan Shenging or protein content.RNA can (concrete example be seen (1989) Molecular Cloning:ALaboratory Manual (second edition) such as Sambrook by for example rna blot analysis or by the detection of reverse transcription polymerase chain reaction (RT-PCR) method, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA).Protein level can (for example [example of concrete grammar be referring to Harlow for antibody or its fragment by directly using affinity reagent, E. and Lane, D (1988) Antibodies:A Laboratory Manual, Cold Spring Harbor LaboratoryPress, Cold Spring Harbor, NY]; With protein bound aglucon) detect, perhaps utilize other character to detect (for example fluorescence in the green fluorescent protein), or, just utilize the detectable product (for example spectrophotometric character of Gai Bianing) of enzymic activity generation or can detect (for example change of cell growth) by detected phenotype by measuring the protein-active detection.Suitable reporter gene includes but are not limited to: E.C. 2.3.1.28, β-D tilactase, luciferase or green fluorescent protein.
Above-mentioned method and detection can be used for single or multiple testing compounds, or testing compound storehouse (for example combinatorial libraries).In the later case, the synergistic effect that coupling is brought to testing compound also can be discerned with qualitative.Above-mentioned compound can be used for suppressing Pygopus, prevents and/or treats cancer, also can be used as the lead compound of the additional compound of specificity, curative effect and/or pharmacy characteristic (as pharmacokinetic properties) that development﹠ testing has improvement.In some embodiments, but one or more step automatizations of screening/measuring method of the present invention finish.
These detection systems can comprise the various means that make useful detection can carry out and make its condition optimizing.These means include but are not limited to:: suitable damping fluid, for example control pH value and ionic strength, the essential composition (for example proteinase inhibitor) that makes Pygopus activity and optimal stability is provided, make the temperature control condition of Pygopus activity and/or optimal stability and make the Pygopus determination of activity become possible means of testing.Various such means of testing all can be used, and include but are not limited to: the use of uniting of following one or more means: isotopic labeling (for example
32P), based on detection of antibodies, fluorescence, chemoluminescence, spectrophotometer method (for example, producing the product of spectrophotometric characteristic changing), various report enzyme or albumen (for example horseradish peroxidase, green fluorescent protein), specific binding reagents (biological example element/streptavidin) and other.Also available usual way known in the art is analyzed combination, for example on polyacrylamide gel, carry out non-sex change electrophoretic analysis, and based on the analysis of fusion rotein, such as two assorted systems of yeast or external binding analysis, or, discern the conjugated protein of Pygopus based on the means of protein group.
This screening experiment can utilize the Pygopus source to carry out experiment in vitro, and Pygopus can comprise natural isolating or Pygopus that reorganization produces, both can be unprocessed also can be purifying.Reorganization Pygopus can produce by a series of protokaryons known in the field or eukaryotic expression system.These screening experiments can be undertaken by the square formation mode.In some embodiments, one or more screening steps are finished by automatization.
Keep former activated Pygopus analogue, variant and/or fragment, particularly activated the activity of Wnt-effector or anticancer propagation, also can be used for method of the present invention.Analogue comprises the aminoacid sequence basically identical with Pygopus, with the main identical protein sequence of 26S Proteasome Structure and Function of Pygopus.Variant includes but are not limited to: replace, lack or insert the protein or the peptide of deriving and getting by any modification and/or amino acid to Pygopus.These variants comprise fusion rotein, and for example target protein or its a part of and suitable integration region (for example glutathione-S-transferase merges, reaches other) merge.Modification can occur in any position that comprises polypeptide backbone (being aminoacid sequence), amino acid side chain and N end or C end.These replacements, disappearance or insertion can relate to one or more amino acid.Fragment comprises a fragment or the part of Pygopus, or a fragment of Pygopus analogue or variant or a part.
Screening experiment can use proper host cell to carry out as the Pygopus source in certain embodiment.Such host cell can be by introducing the DNA of coding Pygopus in host cell, and the condition of expressing Pygopus is provided and makes.These host cells can be protokaryon or eukaryotic cell, bacterium, yeast cell, amphibious or mammalian cell.
Above-mentioned screening method can comprise further whether detect the arbitrary compound that filters out can be used for prevention or treatment cancer, such as detect its curative effect to disease symptoms in suitable animal model for cancer system.Similarly, aforesaid method also can be used for being identified in the compound that can regulate and control Pygopus in the system and qualitative to it.
VI. in conjunction with experiment
Pygopus can be used in the experiment relevant with function information provided herein: with the experiment that produces antibody or induce other immunne responses to be correlated with; In being used for the experiment of protein level in the quantitative assay biological fluid, design uses as reagent (comprising isotope-labeled reagent); And action effect albumen is preferentially expressed the marker of the tissue of (as the basic comprising of protein expression in the tissue or only occur when certain particular stage of tissue differentiation or growth or the morbid state).When albumen and another albumen aglucon combines or may in conjunction with the time, this albumen can be used for discerning conjugated protein/aglucon, thereby develops into the system of identification binding interactions inhibitor.Any or all these application all can be used to develop into the commerical prod of reagent grade or kit form.
The working method of the listed application in front is known for those skilled in the art.The document that discloses these methods comprises " Molecular Cloning:A Laboratory Manual ", 2d ed., Cold Spring Harbor Laboratory Press, Sambrook, J., E.F.Fritsch and T.Maniatis eds., 1989 and " Methods in Enzymology:Guide to MolecularCloning Techniques ", Academic Press, Berger, S.L.and A.R.Kimmel eds., 1987.
Pygopus albumen of the present invention (comprise may before the present invention disclosed varient and fragment) can be used for the biological test relevant with cancer with the Wnt-signal.These checks relate to the diagnosis that can be used for cancer and Pygopus function, activity or the characteristic of treatment, particularly in cell of expressing Pygopus and tissue.Show that in this experimental data that provides in the tumor tissues of Pygopus the mankind be overexpression.
Pygopus and fragment, particularly NHD district also are used in the medicament screening experiment that carries out in cell based or the acellular system.The cell based system can be natural, and promptly the cell of normal expression Pygopus launches as biopsy sample or in cell cultures.In another embodiment, the check of cell based system relates to recombinant host cell, and it expresses Pygopus or its fragment, particularly NHD district.
Pygopus and fragment, particularly NHD district also can be used for discerning the compound of regulation and control state of nature or the proteic Wnt-signal activation of other form function.Pygopus and suitable varient and fragment thereof can be used for checking testing compound and Pygopus and fragment thereof, the particularly high flux screening of the binding ability in NHD district experiment.Can further screen the Pygopus that function is arranged to these compounds, to determine that this compound is to the active influence of Pygopus.Further, these compounds can or not have in the vertebra system animal, Africa xenopus particularly, or detect in the cancerous cell line, to determine antitumour activity/curative effect.The compound that the Wnt signal is effectively activated (agonist) or suppresses (antagonist) effect can be screened comes out.
Further, Pygopus and fragment, particularly NHD district, can be used for screening can stimulate or suppress Pygopus and with Pygopus normal interactional molecule (conjugated protein) be arranged, Bcl-2 for example, between interactional compound.These detections typically comprise the steps: in Pygopus and fragment, NHD district particularly, with conjugated protein can interactional condition under, with Pygopus and fragment, particularly the NHD district combines with testing compound, and detect Pygopus and conjugated protein between the formation situation of mixture, or detection two-way interaction's biochemical result, for example activation of Wnt signal.
Testing compound comprises 1) peptide, as soluble peptide, comprise the fusogenic peptide that has the Ig tail, and the random peptide library that constitutes by the amino acid of D-and/or L-configuration and the member in combinatorial chemistry derived molecules storehouse; 2) phospho-peptide (as, at random with the member in partially denaturing, directed phospho-peptide storehouse); 3) antibody (as, polyclonal antibody, monoclonal antibody, humanized antibody, antiidiotypic antibody, chimeric antibody and single-chain antibody, and Fab, F (ab ')
2, Fab expression library fragment and antibody the antigenic determinant binding fragment); With 4) small organic molecule or inorganics (as, from the molecule in combination and natural product storehouse).
In conjunction with and/or activated compounds also can screen by using fusion rotein, the N-end structure territory of these fusion roteins or its part and C-end structure territory or its part can be replaced by heterologous polypeptide.These are commonly referred to chimeric protein or fusion rotein.
Chimeric protein and fusion rotein comprise Pygopus and fragment, NHD district particularly, and its operability is connected to aminoacid sequence and the very low heterologous protein of Pygopus homology that is merged." operability connection " shows that the Pygopus and the heterologous protein that are merged carry out the frame endomixis.Heterologous protein can merge with N-end or the C-end of the Pygopus that is merged.
In some applications, fusion rotein does not influence the activity of the Pygopus that is merged.For example, fusion rotein can include but are not limited to: enzyme fusion proteins, and for example beta-galactosidase enzymes fusion, the two assorted GAL of yeast merge, poly-His merges, the MYC-mark, the HI-mark and Ig fusion.These fusion roteins, particularly poly-His merge, and can help recombinate Pygopus and fragment, particularly the purifying in NHD district.In some host cell (for example mammals host cell), proteic expression and/or secretion can be merged the raising of allos signal sequence by using.
Chimeric or fusion rotein can obtain by the DNA recombinant technology of standard.For example, utilize routine techniques linking together in the dna fragmentation frame of the different protein sequences of coding.In another embodiment, fusion gene can be synthetic by routine techniques, comprises automatic dna synthesizer.In addition, also can utilize anchor primer that gene fragment is carried out pcr amplification, between two consecutive gene fragments, produce complementary fragment, produce chimeric gene sequence by scalding fire continuously in order to remove hairs and increasing again then.In addition, much encoded now expression vector commercialization of merging part (for example GST albumen).Coding Pygopus and fragment, the particularly nucleic acid in NHD district can be cloned in this expression vector, so that be connected to Pygopus in the allos frame segment.
Pygopus and fragment, particularly NHD district, also can be used for the competition in conjunction with the experiment, find can with the interactional compound of Pygopus (for example, conjugated protein and/or aglucon).Like this, compound and polypeptide can in conjunction with or interactional condition under, make compound and Pygopus and fragment, particularly NHD district contact.A kind of known conjugated protein, for example Bcl-9 or antibody, particularly the Pygopus monoclonal antibody also joins in the mixture.If testing compound and Pygopus have interaction, the amount of Pygopus and the known mixture that forms between conjugated protein will reduce.This typical experimental technique is particularly useful when searching can have interactional compound with the specific region of Pygopus.Like this, conjugated protein being designed to the testing compound competition can combine with the purpose area relative peptide sequence on the Pygopus.
In one embodiment, the competition thing be known can be conjugated protein with the Pygopus bonded, as antibody, peptide, aglucon etc.In some cases, exist competition to combine at testing compound with conjugated protein, bound fraction replaces testing compound.
The competition screening experiment can carry out like this: make Pygopus and fragment in first increment basis, particularly the NHD district combines with testing compound.Second increment then comprises testing compound, Pygopus and fragment in this, NHD district particularly, and known conjugated protein.Measure combining of conjugated protein and Pygopus in two samples, in two samples bonded change or difference all illustrate exist a kind of can with Pygopus bonded reagent, and might regulate its activity, promptly and known conjugated protein interaction.That is to say, if second increment this originally compare with first increment, to be measured dose in conjunction with different, testing compound just can combine with Pygopus.
In one embodiment, testing compound has been carried out mark.No matter be testing compound or conjugated protein, or the two has, all should join earlier in Pygopus and the fragment, particularly NHD district, have time enough to carry out combination.Hatch and under any temperature that helps reaching optimum activity, to carry out, normally between 4 ℃ to 40 ℃.Incubation time can be selected according to optimum activity, also can be from helping reaching the angle Selection of fast high-flux screening.Usually just enough between 0.1 to 1 hour.Usually unnecessary reagent will be removed or flush away.Add second composition then, whether have markd composition, show bonding state by detecting.
One preferred embodiment in, add earlier conjugated proteinly, add testing compound then.Protein-bonded replacement represents that determinand combines with Pygopus, thereby can be associated with the active potentiality of adjusting Pygopus with the Pygopus knot.In this embodiment, two kinds of compositions can be labeled.Like this, for instance, if conjugated protein being labeled, the existence of marker shows by testing compound and has replaced in the washing fluid.Conversely, if determinand has been labeled, exist description of symbols replacement to occur on the carrier.
In another embodiment, add testing compound earlier, hatch and wash the back and add conjugated protein.Not combined protein binding can illustrate that testing compound combines with Pygopus with very high avidity.Like this, if testing compound is labeled, underlined existence on the carrier, shortage combines with protein-bonded again simultaneously, can illustrate that testing compound can combine with Pygopus.
Carry out acellular medicament screening experiment, sometimes preferably Pygopus and fragment, NHD district particularly, or it is conjugated protein fixing, thereby help also making the automatization of experiment become possibility simultaneously separating in conjunction with the not combining form of mixture and one or both compositions.
The technology of ankyrin can be applicable to medicament screening experiment on matrix.In one embodiment, can provide a fusion rotein, its adding makes the structural domain of protein binding on the matrix.For example, the glutathione-S-transferase fusion rotein can be adsorbed on glutathione agarose pearl gel or the gsh deutero-microtiter plates (microtitre plate), then with cell pyrolysis liquid (for example
35The S-mark) and the testing compound combination, mixture (physiological condition that for example comprises salt and pH value) under the condition that helps mixture formation is hatched.Hatch post-flush pearl gel and remove any unconjugated marker, fixedly matrix and isotopic labeling directly detected perhaps detects in the supernatant liquor of removing in conjunction with mixture.In addition, can also separate mixture from matrix, separate with SDS-PAGE, that finds on the pearl gel is undertaken quantitatively by the electrophoretic technique of standard with the available gel of the proteic level of Pygopus bonded.For example, all available technology well known in the art of polypeptide or its target molecule utilizes vitamin H to fix with combining of streptavidin.In addition, have with albumen to interact but do not disturb albumen and target molecule bonded antibody, can be embedded in the hole of foraminous plate, by antibodies proteopexy in the hole.Conjugated protein preparation with testing compound is hatched in the aperture that has Pygopus2 to exist, can carry out quantitative assay the amount of staying in the aperture in conjunction with mixture.Detect the method for these mixtures, and the method that detects above-mentioned GST fixed mixture, comprise the immunodetection of utilizing antibody that mixture is carried out, and to measure the euzymelinked immunosorbent assay (ELISA) of the enzymic activity that links with mixture.
Regulate or inhibition Pygopus and fragment, the particularly reagent in NHD district, can discern by using one or more above-mentioned experiments, can singly use also can combined utilization.General preferred thin matrix system or the cell-free system method of at first adopting, checking is active in animal or other model systems then.These model systems make known in this area, can be applied to this paper easily.
In the present invention on the other hand, Pygopus and fragment, particularly NHD district can be at yeast be used as " bait albumen " to discern other albumen, these albumen and Pygopus and fragment, particularly combination of NHD district or interaction in the two assorted or three assorted experiments.These conjugated protein transmission that may in the Wnt path, participate in signal.In addition, these conjugated protein also may be the inhibitor of Pygopus.
Two assorted systems are made up of the DNA combination and the active region that can distinguish based on the molecular characterization of most of transcription factors.Briefly, experiment has utilized two different DNA to make up.In a structure, coding Pygopus and segmental gene, the gene in the NHD district of particularly encoding, (for example, DNA GAL-4) merges in conjunction with the gene in territory with known transcription factor of coding.In another kind makes up,, merge with the gene of the activation domain of coding known transcription factor from the dna sequence dna of an agnoprotein of coding (" prey " or " sample ") in the dna sequence dna storehouse.If " bait " and " prey " albumen can interact in vivo, the DNA-of transcription factor just can be approaching mutually in conjunction with territory and activation domain.This near a kind of reporter gene (for example LacZ) is transcribed, this report gene is operably connected to the transcriptional regulatory position to this transcription factor response.Can measure this report expression of gene situation, the separable cell clone that goes out to include the transcription factor of function is used to obtain coding and Pygopus and fragment, particularly the interactional proteic clone gene in NHD district.
The invention further relates to preparation by above-mentioned screening experiment identification.Correspondingly, the preparation by method identification described herein is further used for also belonging to category of the present invention in the suitable animal model.For example, preparation by method described herein identification (for example, the antisense nucleoside acid molecule of Pygopus conditioning agent, Pygopus, the specific antibody of Pygopus or Pygopus are conjugated protein) can be used for animal model or other models, to detect curative effect, toxicity or the untoward reaction of using the said preparation treatment.In addition, the preparation of method identification described herein can be used for animal model or other models, to determine the mechanism of action of this compound.Further, the invention still further relates to a new preparation of discerning by the screening experiment of preceding retouching and be applied to treatment mentioned in this article.
Pygopus and fragment, particularly NHD district can also be as the target spots of diagnosing cancer or cancer susceptible physique.Similarly, the invention provides the method that whether has certain albumen (or coding mRNA) and protein level in cell, tissue or the body that detects.In this experimental data that provides shows various tumor tissues the mankind, the Pygopus overexpression is arranged all.These methods relate to biological specimen and can contact with the interactional compound of Pygopus and fragment, particularly NHD district, so that this interaction can detect.This experimental technique can carry out in the mode of single detection, also can detect in the mode of a plurality of detections, such as the antibody chip square formation.
Be used for detecting the proteic a kind of reagent of tissue and be can with the antibody of albumen selective binding.Biological specimen comprises from the isolating tissue of organism, cell and biological fluid, and the tissue in the organism, cell and body fluid.
Pygopus and fragment, particularly NHD district also provide the target spot of activity, disease or the cancer susceptible physique of diagnosis activated protein.Like this, can from biological specimen, separate Pygopus, detect whether there is the transgenation that can cause paraprotein to produce.It comprises the incorrect modification after (result that montage is unusual) and translation are replaced, lack, insert, reset to amino acid.Analytical procedure comprises that electrophoretic mobility changes, the active altered activation of Wnt-signal in tryptic peptide digestion change, cell based or the cell free assay, change with the mode of substrate or antibodies, iso-electric point changes, directly amino acid sequencing and other known detection techniques that is used to detect protein variations.This detection method can be carried out in the mode of single detection, also can detect in the mode of a plurality of detections, such as the antibody chip square formation.
Detect Pygopus or segmental ex vivo technique and comprise enzyme-linked immunosorbent assay (ELISA), immunoblotting, immunoprecipitation and immunofluorescence assay, it uses detection reagent, as antibody or protein binding reagent.In addition, albumen also can carry out detecting in the body in organism by introducing the detection reagent of isotope-labeled antibody or other types in vivo.For example, antibody can carry out mark with the marker that radioactivity is arranged, and its existence and location in vivo can record by the imaging technique of standard.The method of the allelic variation of the peptide of those detection expression in vivo and those segmental methods that detects certain peptide in samples are particularly useful.
Pygopus and fragment, particularly NHD district, also useful in analyzing with the pharmacogenomics of related to cancer.The heritable variation of pharmacogenomics research clinical manifestation, its relative medicine distributes and changes and the unusual performance of medicine in the individuality of getting involved.The clinical effectiveness that these variations bring is the serious toxicity that causes medicine in some individuality, or generation individual variation and the pharmacological agent that causes failure in some individuality because aspect the metabolism.Therefore, Ge Ti genotype can determine to treat compound to the mode of action of body or the body metabolic way to compound.Further, the activity of drug metabolism enzyme is all influential to pharmaceutically-active intensity and time length.Therefore, Ge Ti pharmacogenomics analysis can select the effective dose of active compound and these compounds to prevent or treat according to the genotype of individuality.Though the discovery of the gene pleiomorphism of some drug metabolism enzymes has been explained standard dose that some patients why have accepted medicine and has not but been obtained the medication effect of expecting, perhaps shown the reaction of overdose of medicine thing, or serious toxicity occurred.Polymorphism can show as excitometabolic phenotype and weak metabolic phenotype.Similarly, gene pleiomorphism can cause the equipotential protein variant of Pygopus-2, makes the one or more Pygopus-2 functions in the population different with another population.In like manner, the dosage that can adjust certain medicine in containing the specific crowd of polymorphism makes result of treatment reach best.As other gene type, can discern specific polymorphism peptide.
VII. antibody
The present invention also provides the antibody with Pygopus and varient and fragment (target peptide) selective binding.As used herein, when antibody combines with the target peptide, be combined into optionally combination, the albumen of nothing to do with does not have remarkable combination.But as long as the structural domain of these albumen and target peptide fragment or target peptide has homology, thereby and when between the target peptide common antigenic determinant being arranged, antibody can not be that very high albumen combines with other and target peptide homology yet, but even so antibody still is considered to optionally in conjunction with the target peptide.In this case, although can be understood as to a certain degree cross reaction, the antibody of binding peptide remains optionally.
As used herein, the definition of antibody is consistent with definition recognized in the art: antibody is the many substructures albumen group who produces when mammalian organism is reacted to antigenic stimulation.Antibody of the present invention comprises polyclonal antibody and monoclonal antibody, and the fragment of these antibody, includes but are not limited to: Fab or F (ab ')
2And Fv fragment.
There have been now a lot of currently known methodss to be used for producing and/or differentiated antibody at a certain specific antigen.By mammalian immune being produced antibody with Pygopus or its fragment.These antibody may be polyclonal or monoclonal.Producing polyclone or monoclonal antibody method is being known in the art.Concrete grammar sees also " Antibodies, A Laboratory Manual, ColdSpring Harbor Laboratory, Eds.E.Harlow and D.Lane (1988) and D.E.Yelton etc., 1981.Ann.Rev.Biochem.50:657-680.Produce monoclonal antibody method, see also Kohler ﹠amp; Milstein (1975) Nature 256:495-497.
Generally, producing antibody needs a kind of isolating peptide to give mammalian organism as immunogen and injection, such as rat, rabbit or mouse.Can gather in the crops antibody from these mammalian organisms then.Full-length proteins, there are antigenic peptide fragment or fusion rotein all can use.The fragment of particularly important is, those cover for example fragment of the functional zone of NHD structural domain, and cover Pygopus and fragment thereof the fragment in exclusive zone, use zones that albumen comparison methods can identify easily and the zone that proposes at this paper as those.
In one embodiment, produced can with Pygopus or its fragments specific bonded monoclonal antibody.This method comprises with Pygopus or its fragment immune animal and produces collectable immunocyte thus; From immune animal, obtain immunocyte, as splenocyte; And immunocyte and myeloma cell are merged, from fused cell, filter out the hybridoma that can produce monoclonal antibody thus.
The preferred antibody that obtains by Pygopus or its segmental zone or discontinuous fragment.Antibody can be made by any one zone in the peptide described here.Yet, preferred zone should comprise those Pygopus exclusive zone, as zone outside the N-box and PHD zone.
One typically has immunogenic antigenic determinant to comprise at least 8 adjacent amino acids residues.But the immunogen peptide can comprise that minimum is 10,12,14,16 or more amino-acid residue.These fragments can be selected according to physical property, are positioned at the fragment of the protein surface band of position such as correspondence, and for example hydrophilic region perhaps can be selected according to the uniqueness of sequence.
By making antibody and detectable substance coupling connection (being physical connection), can be convenient to detect antibody of the present invention.These detectable substances comprise different enzymes, prothetic group, fluorescent substance, luminophore, noclilucence material and radioactivity material.The example of suitable enzyme comprises horseradish peroxidase, alkaline phosphatase, beta-galactosidase enzymes or acetylcholinesterase; The example of suitable prothetic group mixture comprises streptavidin/vitamin H and avidin/biotin; The example of suitable fluorescent substance comprises umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazine base amine fluorescein (dichlorotriazinylamine fluorescein), dansyl chloride or phycoerythrin; The example of a luminophore is a luminol,3-aminophthalic acid cyclic hydrazide; The noclilucence examples of substances comprises Luci, luciferin and aequorin; And suitable radioactivity examples of substances comprises
125I,
131I,
35S or
3H.
VIII. antibody is used
Antibody can be by adopting standard technique, and for example affinity chromatography or immunoprecipitation is used to separate Pygopus or Pygopus fragment.The proteic purifying that the reorganization that antibody can help to express in the native protein and host cell in the cell produces.In addition, these antibody can be used for detecting and have or not one of albumen of the present invention to exist in the cell or tissue, thereby determine in the different tissues of certain organism and this proteic expression pattern in the normal development process.
Show that in this experimental data that provides Pygopus has the phenomenon of overexpression in the different tumor tissues of the mankind.These antibody are used in original position, external, cell pyrolysis liquid or the supernatant liquor and detect albumen, thus assessment this proteic expression amount and expression pattern.The mistake detection of expression of Pygopus can be used for diagnosing cancer.These antibody also can be used for assessing certain biological aspect grow or progress in unusual tissue distribution situation and unusual expression situation.
Say that further these antibody can be used for the expression in the assess disease state, for example the individuality of the active period of cancer or the cancer susceptible relative with the protein function diseases associated.When disease is caused by unusual tissue distribution, growth expression, protein expression level or expression/cooked mode, can prepare out antibody at this normal protein.If certain disease can be used for detecting the existence of this species specific mutain with proteic specific specific when sporting feature at the antibody of this mutain.
These antibody also can be used for the arrestin function, for example block Pygopus or its fragment and combine with the protein-bonded of for example Bcl-9.These application also can be used in the treatment relevant with the arrestin function.Such as a kind of antibody can be used for blocking combination, thereby regulates the activity of (excitement or antagonism) Pygopus.Can prepare at the specific segmental antibody that contains the function related locus, or at the antibody of cell or cytolemma bonded intact proteins.
The present invention also comprises the test kit that whether exists with certain albumen in the antibody test biological specimen.But this test kit can comprise the antibody of antibody mark or mark for example and in order to proteic compound or medicine in the detection of biological sample; Detect the method for protein content in the sample; The method that protein content in the sample and standard are compared; And operation instruction.Such test kit can be used for detecting single albumen or antigenic determinant, or is provided with to detect one of antigenic determinant group, for example antibody test square formation.In the square formation nucleic acid square formation below detailed introduction is arranged, developed the antibody square formation with similar method.
Embodiment 1:Pygopus is the target spot of diagnosis and treatment epithelial ovarian cancer
(1)
Detailed method
(a) cell cultures: (ATCC, USA), (GIBCO BRL is USA) in the substratum to be incubated at the DMEM that contains 10% foetal calf serum (FCS), 100U/ml penicillin, 100 μ g/ml Streptomycin sulphates from American Type Culture Collection for clone.Normal ovarian superficial epithelium (OSE) cell is scraped from the ovary surface and is got (obtaining the patient agrees), cultivation is at the MCDB105 (Sigma that contains 15%FCS, 100U/ml penicillin and 100 μ g/ml Streptomycin sulphates, USA) and 199 (Sigma, USA) in (1: 1) substratum, method is as (Wong, A.S.﹠amp as described in the document; Auersperg, N.Ovarian surface epithelium:family history and earlyevents in ovarian cancer.Reprod.Biol.Endocrinol.1,70 (2003)).Cell is counted with blood counting instrument.
Table 1: the feature that different ovarian epithelial cells (EOC) are.
Ovarian epithelial cell system | Tissue |
OVCAR-3 | Ovary; Epithelium; Gland cancer |
OV-90 | Ovary; Metastasis: the pernicious papillary serous adenocarcinoma of ascites |
TOV-21G | Ovary; Clear cell carcinoma |
ES-2 | Ovary; Clear cell carcinoma |
TOV-112D | Ovary; Endometrioid carcinoma |
SKOV-3 | Ovary; Metastasis: ascites gland cancer |
OSE-2 | Ovary; Epithelium is normal |
IOSE-397 | Ovary; Epithelium, level of differentiation is low |
(b) RNA extracts and rna blot analysis: (CANADA) test kit extracts cell total rna for Qiagen, QP with RNeasy Mini Kit.Rna blot analysis is following to carry out, and uses
32The cDNA probe of P-dCTP mark temperature in 65 ℃ of Rapid-Hyb damping fluids was incubated 1 hour, then in the 0.1X damping fluid 65 ℃ thoroughly cleaned 15 minutes, method is as (Lake, B.B.﹠amp as described in the document; Kao, K.R.Pygopus is required for embryonic brain patterning inXenopus.Dev.Biol.261,132-148 (2003)).
(c) protein extraction and immunoblotting assay: for protein extraction, the transfection that 80-90% converges or the monolayer cell of untransfected wash with cold phosphate buffered saline buffer salt (PBS), use the cracking of 2X sodium lauryl sulphate (SDS) sample-loading buffer immediately, remove viscosity DNA and go up sample to the sds page of the sex change of 10-12% by the 21G syringe needle.Then fractionated albumen by semidrying transfer to Hybond enhanced chemoluminescence (ECL) nitrocellulose filter (Amersham Pharmacia Biotech, PQ, CANADA) on.(Amersham Pharmacia Biotech, PQ CANADA) detects to use the ECL chemiluminescence system again.Anti-hPygo2 polyclonal antiserum is pressed described methods such as Reynolds (Developmental expression of functional GABAA receptors containing thegamma 2 subunit in neurons derived from embryonal carcinoma (P19) cells.Brain Res.Mol.Brain Res.35 such as Reynolds, 11-18 (1996)) in new zealand white rabbit, obtains, what this method was used is external synthetic polypeptide, the 89-328 amino acids residue of its corresponding hPygo2 molecule, conserved regions (the Kramps that lacks NHD and PHD, T. wait Wnt/winglesssignaling requires BCL9/legless-mediated recruitment of pygopus to thenuclear beta-catenin-TCF complex.Cell 109,47-60 (2002)), this polypeptide is by obtaining the hPygo2 cDNA sequence subclone that is got by PCR to pGex4T1 (Amersham) from people EST clone (I.M.A.G E.), and detects by immunoprecipitation and immunoblotting assay.Anti-β-a chain of element, anti-c-Myc and anti-Erk-1 antibody are available from SantaCruz.Anti-GSK-3 β and anti-phospho-GSK-3a/ β antibody are available from Cell SignalingTechnology.
(d) immunohistochemical analysis: the paraffin-embedded tumour that filing is preserved is cut into slices with 5 microns thickness, be fixed on (Surgipath) on the slide glass, and by using Citric Acid antigen recovery method (Rorke, S., Murphy, S., Khalifa, M., Chernenko, G , ﹠amp; Tang, S.C.Prognostic significance of BAG-1 expression in nonsmall cell lung cancer.Int.J.Cancer 95,317-322 (2001)) and with hPygo2 one antiserum(antisera) (dilution 1000X), β-a chain of plain mouse monoclonal antibody (Santa Cruz, dilution 2000X), the anti-mouse and the anti-rabbit two anti-(Amersham) of diluting 1/250 times HRP-coupling connection handled, carry out counterstaining with phenodin, according to described method (front) Permount glue (Fisher) mounting.An anti-concentration of using is defined as the level of dye-free, uses preimmune serum and only add two not observe background or non-specific staining when anti-.
(e) immunofluorescence analysis: cell is layered on the slide, fixes 30 minutes in 4% Paraformaldehyde 96, and (PBS) washes twice with phosphate buffered saline buffer, washes 10 minutes with the PBS (tPBS) that contains 0.2% triton-X100 then.Cell seals in 10% normal donkey or sheep blood serum, then in containing the PBS solution of 1.5% normal serum under 4 ℃ of conditions with an anti-overnight incubation.Slide glass was washed in 0.2% tPBS 30 to 40 minutes in second day, then with 1.5% normal serum in the anti-rabbit of biotin labeled donkey (Amersham) or the anti-mouse of Cy3 donkey (JacksonImmunoResearch Laboratories, Inc.) two anti-at room temperature hatching together 30 minutes.After in 0.1-0.2% tPBS, washing 30-40 minute, cell was hatched in 1.5% normal serum that contains streptavidin fluorescein (Amersham)/PBS 30 minutes, in 0.1-0.2%tPBS, washed then 30-40 minute, and in 10% glycerine/PBS or at Vectashield (VectorLaboratories, Inc.) fixing in, under Laser Scanning Confocal Microscope, use the filter disc observation of being convenient to observe fluorescein and Cy3.
(f) gene blocking test: design antisense oligonucleotide (table 2) at hPygo2.
The antisense oligonucleotide of table 2:hPygo2
The oligonucleotide title | Sequence (5 '-3 ') | Target region (SEQ ID NO:1) |
Hpy1 | GAGCTGCAGCAACCACAAAG(SEQ ID NO:5) | 55-74 |
Hpy2 | GGACCCGGGTTAGCGGCAGCG(SEQ ID NO:6) | 144-164 |
Hpy3 | CCACCTCCCTCCAGCTTGTCC(SEQ ID NO:7) | 198-219 |
Hpy4 | GGAGGACTAAAGTTTTGAC(SEQ ID NO:8) | 687-705 |
Hpy5 | GGCTGAGCAAATCGTTGGG(SEQ ID NO:9) | 807-825 |
Hpy6 | GAAAAGCAGTAGAAGCAGGT(SEQ ID NO:10) | 967-986 |
Hpy7 | CTCACGGATGTAGACAGA(SEQ ID NO:11) | 1340-1357 |
Hpy8 | CCTCTGGCCAGAAACCTTT(SEQ ID NO:12) | 1817-1835 |
Hpy9 | CTCTTCTACCTTTGAGTAC(SEQ ID NO:13) | 2434-2452 |
Hpy10 | CACTGTATCTTGAGCTGG(SEQ ID NO:14) | 2720-2737 |
5 * 10
4SK-OV-3 cell and 6 * 10
4The NIH-OVCAR-3 cell be seeded in 12 orifice plates in preceding 24 hours in transfection.100-200nM 19 base oligonucleotides contain 3 phosphorothioate bonds (*) at two ends, start from hPygo2 (SEQ ID NO:1) coding region (nt no.807-825) (5 '-G*G*C*TGAGCAAATCGTT*G*G*G-3 '; Hpy5) and its mismatch (5 '-G*C*C*TGAGCTAATCATT*G*G*T-3 '; SEQ ID NO:20) or Africa xenopus Pygo2 antisense oligonucleotide (5 '-T*T*T*GCGCCGTTTCTT*C*T*C-3 '; SEQ ID NO:21), (USA) transfection is to NIH-OVCAR-3 for Invitrogen, CA, and (CANADA) transfection is to SK-OV-3 for Qiagen, QP with Effectene Transfection Kit with Oligofectamine Transfection Kit.Changed substratum after the transfection in 24 hours and 48 hours.
β-a chain of plain siRNA is made of 4 blended siRNA available from Upstate company.The hPygo2 siRNA of chemosynthesis is from Qiagen company.The active ability of single siRNA sealing hPygo2 detects by immunoblotting.
Hpy2A:5′-r(CGAUGACCAGGAUGCCAUU)d(TT)-3′
Hpy2B:5′-r(AGAAGCGAAGGAAGUCAAA)d(TT)-3′
Hpy2C:5′-r(UGGGAACCAGCCCAGUUUC)d(TT)-3′
Hpy2D:5′-r(CCAGCCUCUGGGUCAAAAC)d(TT)-3′
Hpy2E:5′-r(CUUUCCCAGCCAACCCUUC)d(TT)-3′
Two (Hyp2A, Hyp2D) among 5 siRNA can effective closure hPygo2.
The same Oligofectamine of use of the transfection of siRNA or RNAiEasy (Qiagen) and carry out with antisense ON.100nM siRNA transfectional cell was washed cell and is renewed bright substratum with PBS after 6 hours, repeated transfection once with 100nM siRNA after 24 hours.Fixed cell with the dyeing of iodine third ingot, is measured dna content by using the fluorescent activation cell sorter to count again then.
(2)
The specificity of anti-hPygo2 antibody
The different zones of hPygo2 and Gal-4 merge, and should make up transient transfection HeLa cell.Extract albumen and analyze these expression after making up transfection.Immunoblotting assay is carried out in sample electrophoresis and transfer on the identical protein content.The Gal-4-hPygo2 fusion rotein that Fig. 3 (a) has described transfection HeLa cell makes up.Fig. 3 (b) has shown the immunoblotting that detects the Gal-4-hPygo2 structure with anti-hPygo2 antiserum(antisera); See example 1 (1).Fig. 3 (c) has shown the immunoblotting that makes up with anti-Gal-4 antibody test Gal-4-hPygo2.Gal-4 antibody can be discerned all Gal-4-hPygo2 albumen and make up.
Fig. 3 (d) and (e) show to use the Flag peptide to merge the similar experiment of carrying out.
Fig. 3 (f) has described with anti-hPygo2 antibody and the plain immunohistochemical analysis that detects 4 OvCa clones of β-chain of rings.The result shows that 4 clones all express hPygo, but has only two to express β-chain of rings element.Therefore Pygopus is closer than the dependency of other composition in the Wnt signal pathway and pernicious ovarian epithelium cancer cells.
(3)
The overexpression of hPygo2 in EOC clone
We at first in six pernicious EOC clones (OV-90, NIH-OVCAR-3, TOV-21G, TOV-112D, SK-OV-3 and ES-2) detected the expression of the plain and GSK-3 β of β-chain of rings, (Fig. 4 is a) with the effect of Wnt signalling system in malignant tumour of determining classics.With respect to normal ovarian surface epithelial cell (OSE), β-chain of rings is plain to have overexpression in the TOV-112D cell, but hangs down expression or do not have expression in other clones.Have only two EOC clones equally, TOV21G and SKOV-3 have expressed the GSK-3 β of activated phosphorylation.Like this, plain and its regulatory factor GSK-3 β of the β-chain of rings to be expressed in these EOC clones be different.
The unusual major part of Wnt path derives from the inactivation sudden change of the gene of coding β-a chain of plain regulatory factor in the cancer, perhaps the plain activated mutant of β-chain of rings own.In both cases, the target gene expression that the result that the overstimulation of path brings relates to the cell cycle process increases, and this target gene comprises cyclin D1 and c-myc.(Fig. 4 a) with the plain expression of β-chain of rings of the corresponding to synchronous generation of these target genes yet we fail to find in EOC clone.This expression at the Wnt of Pygopus upstream and downstream path composition is lack of consistency and does not support the classical generally effect of Wnt signalling system in EOC, so we have detected this inconsistent whether also appearing on the hPygo2.Different with other compositions is that hPygo2 mRNA and albumen (Fig. 4 b) all had expression in every kind of EOC clone that we detect.The level of hPygo2mRNA has increasing of significance with respect to the normal surface epithelial cell in cancerous cell line.In addition, although the expression of hPygo2 albumen in cancerous cell line is very high, in normal cell, but detect less than.These observations show that it is a feature of EOC cell that Pygopus crosses expression.
(4)
Pygopus, rather than β-chain of rings element has conforming the mistake to express in patient tumors
In order to assess the effect of Pygopus in disease, we have carried out the proteic expressed in situ of hPygo2 to 125 tumor samples from the surgery sample of filing and have detected.We have carried out half-quantitative detection (Fig. 4 c) according to intensity and the percentage ratio that accounts for tumour cell to expression after tumour cell having been carried out tenuigenin dyeing and nuclear staining.We have analyzed all EOC tumors subtypes, comprise serosity, mucous, hyaline cell, endometrioid and undifferentiated, but the same with what expect, great majority all are the serosity hypotypes.HPygo2 does not express in the carcinoid nuclear as endometriosis (data not shown), or as in the Noninvasive tumour of optimum cystadenoma (Fig. 4 c) very weak expression is being arranged.On the other hand, 82% is consistent with pernicious EOC through the tumour of pathological diagnosis, and to severe accumulation (table 3), dyeing only was confined to tumour cell during hPygo2 albumen had in nuclear, the matrix around not seeing.Minority EOC tumour shows the dyeing of intensive tenuigenin, does not have which kind of hPygo2 to express more outstanding in arbitrary tumors subtypes.Effect in malignant change is consistent to the result of these analyses with Pygopus.
In our 87 increments in the tumor sample that is diagnosed as pernicious EOC patient from the above-mentioned 125 parts contiguous slices originally, plain expression with hPygo2 compares (Fig. 4 c, table 4) to β-chain of rings.The hPygo2 nucleus dyeing of 84 parts or 97% tumour is positive.Wherein, have only the nucleus of 8 (9%) tumours that β-a chain of uniformly dyeing look is arranged.Tenuigenin β-a chain of uniformly dyeing look the positive that surpasses half (56%) or 49 parts of tumor samples, wherein 47 (54%) nucleus hPygo2 stained positive.The nucleus of no tumor sample is only by β-a chain of uniformly dyeing look, has only 2 tumor samples that tenuigenin β-a chain of uniformly dyeing look is arranged and do not have hPygo2 dyeing.Has only a tumor sample not by any protein staining.These observationss show that the hPygo2 nucleus excessive accumulation of EOC tumour medium-high frequency degree in most of the cases do not follow the plain nuclear staining of the β-chain of rings.
(5)
Be used for gene sealing specifically at antisense oligonucleotide and the siRNA of hPygo2
We reach by the observed hPygo2 high frequency kilsyth basalt plain with respect to β-chain of rings in tumour and clone, show that Pygopus has universal significance in EOC, are important treatment target spots therefore.
We use the hPygo2 in antisense oligonucleotide (ON) the sealing EOC clone that contains phosphorothioate bond.We identify and can seal the antisense oligonucleotide that hPygo2 expresses.Fig. 3 (g) has drawn the antisense oligonucleotide of designing according to hPygo2 cDNA sequence total length, and it avoids conserved sequence, for example NHD and PHD district.In Fig. 3 (h), antisense oligonucleotide is with the concentration transfection HeLa cell of 250nM.Extract RNA after 24 hours, analyze the relative closure level of assessing hPygo2 RNA with RT-PCR.By densitometry (Densitometry) according to GAPDH relatively level to hPygo2 relatively level carried out stdn.RT-, negative control do not add reversed transcriptive enzyme.
Tumors subtypes
Optimum | Mucous | Endometrioid | Serosity | Hyaline cell | Undifferentiated | Amount to | ||
Karyocyte matter | -+++ +++-+++ +++Zong meter | 7(100) 0 0 0 5(72) 0 1(14) 1(14) 7(100) | 3(21) 1(7) 7(50) 3(21) 4(29) 6(43) 3(21) 1(7) 14(100) | 0 1(12) 5(63) 2(25) 0 5(63) 3 0(37) 8(100) | 2(2) 8(9) 46(53) 31(36) 12(14) 53(61) 21(24) 1(1) 87(100) | 0 0 4(80) 1(20) 0 5(100) 0 0 5(100) | 0 0 3(75) 1(25) 0 1(25) 2(50) 1(25) 4(100) | 12(10) 10(8) 65(52) 38(30) 21(17) 70(56) 30(24) 4(3) 125(100) |
Table 3: the EOC tumour is examined and the tenuigenin immunohistochemical staining according to tumors subtypes.Numeral in the bracket is shared percentage ratio in the sum shown in next row.
Nuclear hPygo2
- | + | ++ | +++ | Amount to | ||
Nuclear β-a chain of plain tenuigenin β-a chain of plain tumour sum | - + ++ - + ++ | 3 0 0 1 2 0 3 | 8 1 0 4 3 2 9 | 43(90) 4(8) 1(3) 22(46) 21(44) 5(10) 48(100) | 25(93) 1(4) 1(4) 11(41) 11(41) 5(19) 27(100) | 79(91) 6(7) 2(2) 38(44) 37(43) 12(14) 87(100) |
Table 4: based on relevant nuclear and the plain painted EOC tumour distribution situation of tenuigenin β-chain of rings of nuclear hPygo2 dyeing.The scoring of β-a chain of uniformly dyeing look divide negative (-), weak (+), in (++) to strong (+++) four grades.Numeral in the bracket is shared percentage ratio in the sum that next row shows.
(table 2 in the ON of 10 leap hPygo2 and 8 leap hPygo2 coding region total lengths; Fig. 3 (g) and (h)), have three significantly to seal endogenous hPygo2 (Hpy5, Hpy8 and Hpy10), we are used for experiment to wherein the most effective one (Hpy5).
Compared with the control, hPygo2 mRNA and protein level are significantly reduced by antisense ON, and (Fig. 5 a) and do not influence the expression of hPygo1 RNA or β-a chain of fibroin.In two clones of testing, ON makes endogenous hPygo2 albumen reduce by 40% in SK-OV-3 clone, and (Fig. 5 a) to make endogenous hPygo2 protein level reduce about 30% in the OVCAR-3 cell.
We test as the alternative route of sealing hPygo2 short interfering rna (siRNA) then.In 5 siRNA sequences, there are two (Hpy2A and Hpy2D) effective, in OVCAR-3 and SK-OV3 cell, make the hPygo2 level be reduced to 50% (Hpy2A) and 32% (Hpy2D) (Fig. 5 b) respectively with respect to false transfection control level (mock transfectedcontrol).This reduction is that hPygo2 is specific, because compare with the cell of transfection negative control siRNA, and β-a chain of plain level and there was no significant difference.It is required to detect the plain hPygo2 of being of β-chain of rings to experimentize with commercially available anti-β-a chain of plain siRNA, and result's endogenous β-a chain of element in two kinds of clones significantly is reduced to below 10%, and does not influence the hPygo2 level.These experiments show that antisense ON and siRNA are the effective means of hPygo2 among the sealing EOC.
(6)
The plain positioning phenomenon that is not total to of hPygo2 and β-chain of rings
(Fig. 4 a), β-chain of rings is plain all has expression in SKOV-3 and OVCAR-3 cell according to our immunoblotting data.Coexist in nuclear owing to confirm hPygo2 and β-chain of rings element, hPygo2 can be provided related evidence in the Wnt signalling system of EOC clone classics.Because the high-self fluorescence level and the low resolution of traditional fluorescent microscope adopt the research of traditional fluorescent microscope to complicate the issue.Therefore we have adopted normal expression that Laser Scanning Confocal Microscope makes original position in SK-OV-3 and the OVCAR-3 EOC clone and ON and siRNA all can know hPygo2 and the β-sealing of chain of rings element to manifest (Fig. 6).In (Fig. 6 c, g) cell of untreated (Fig. 6 a, e, i) and contrast transfection, β-a chain of element is positioned on the cytoplasmic membrane, and hPygo2 then always accumulates in the nuclear.Yet in specific antisense ON of hPygo2 and siRNA cells transfected, the concentration of hPygo2 significantly reduces (Fig. 6 d, h, 1) in the nuclear.In these situations, the β-chain of rings is plain still to express and is continuing to be positioned on the point of contact of cell-cell (Fig. 6 d, h).What is interesting is that the plain sealing of β in the SK-OV-3 clone-chain of rings makes the slight dispersion from nuclear of hPygo2 albumen come out, but cell was still continuing expression hPygo2 (Fig. 6 k) significantly.Therefore, the plain altogether localized shortage explanation of hPygo2 and β-chain of rings these proteic activity and function in EOC clone is not the coupling connection.
(7)
HPygo2 is that the EOC cells survival is needed
To after hPygo2 and the plain expression sealing of β-chain of rings, we have set up the demand of cell to Pygopus in SKOV-3 and OVCAR-3 clone.Compare with the cell of transfection contrast ON with untreated cell, after 48 hours and 72 hours, the cell growth has all had tangible minimizing, and (Fig. 7 a) at transfection hPygo2 antisense ON for these two EOC clones.The clone of transfection hPygo2 siRNA cell count after 48 hours and 72 hours has also had significant minimizing (Fig. 7 b).On the other hand, β-a chain of plain siRNA can cause the remarkable minimizing of OVCAR-3, but SK-OV-3 is had only faint influence.What is interesting is that the β-a chain of element in the sealing SK-OV-3 cell causes the minimizing of hPygo2 appropriateness, cell count also has part to reduce thereupon.In this case, whether the influence of cell growth is because β-disappearance of chain of rings element or the part of hPygo2 reduce not clear, but the existence of EOC cell may rely on the expression of hPygo2, the latter partly depends on the Wnt signal again, this be that the discovery of the target gene of Wnt is consistent before about TCF/LEF.
The minimizing of EOC cell count both can be experienced necrocytosis by the siRNA cells transfected, or cell-cycle arrest.For instance, dna content is lower than the increase of the cell count of G1 phase cell DNA content, means the loss of DNA, and this is that necrocytosis causes, is in the minimizing showed cell Cycle Arrest then of the cell count of M phase and S phase.In order to distinguish these possibilities, we handle sealing hPygo2 or the plain cell of β-chain of rings, the wherein content (Fig. 7 b) that dyes and show DNA with iodine third ingot with fluorescein activated cell sorting (FACS).After the transfection 48 hours, the cell of untreated cell and control treatment shows the difference of appropriateness in G1, S and the distribution of M phase.The ratio of the SKOV-3 that hPygo2 siRNA handles and the inferior G1 phase cell of OVCAR-3 cell has all had significant increase.Consistent with the counting experiment, we find to have only the OVCAR-3 cell very responsive to β-a chain of plain siRNA, and the SKOV-3 cell that β-a chain of plain siRNA handles is compared with untreated contrast, and the ratio of inferior G1 phase cell has only the increase of appropriateness.These discoveries show that the hPygo2 that removes in the EOC cell causes necrocytosis, has pointed out the effect of Pygopus in the EOC cell survival.
(8)
Mechanism Hypothesis
The previous Pygopus that researchs and proposes plays a role in Wnt/ β-a chain of plain approach, and our results suggest it can also be in the EOC cell by not relying on the mode functionating of β-chain of rings element.Therefore, Pygopus active or its independent crossing in cancer cells outside the Wnt approach is expressed, and is enough to activate the Wnt target gene expression, make β-chain of rings plain may be separately or with other albumen unite the function that causes karyomit(e) part allosteric become unnecessary.The composition of other non-standard Wnt can combine with TCF/LEF such as Plakoglobin (γ-chain of rings is plain), and therefore may be raised by Pygopus.Perhaps, Pygopus may relate to other non-classical Wnt process, and such as Wnt/Ca2+ and plane cell polarization (PCR) passage, it is very important in fetal development, and not clear in cancer.Yet the situation of these alternatives can not be got rid of under the plain non-existent situation of β-chain of rings, and Pygopus that mistake is expressed and the interaction between other Wnt composition may be still impregnable, and may be enough to activate the Wnt target gene expression.
We find to seal the growth (seeing below) that hPygo2 can suppress breast cancer cell line (MCF-7), two other ovarian cancer cell line (TOV-112D, TOV21G) and cervical cancer tumer line (HeLa), and this supports Pygopus to play the generally hypothesis of effect in malignant tumour.
The high frequency that is expressed in the malignant tumour of Pygopus takes place, and the EOC cell survival shows that to its demand the activity that suppresses Pygopus is at one of cancer feasible strategy.
Embodiment 2:Pygopus is the target spot of mammary cancer, ovarian cancer and cervical cancer diagnosis and treatment.
(1)
Detailed method
(a) hPygo2 clone and production of antibodies: the 89-328 amino acids of coding hPygo2 and the zone of not containing NHD and PHD conserved sequence with pcr amplification come out (F:5 '-GCATCCAACCCTTTTGAAGATGAC SEQ ID NO:22; R:5 '-TCAGCCAGGGGGTGCCAAGCTGTTG SEQ ID NO:23), template is the hPygo2 cDNA clone (CloneIDs:41570072 and 3627860) of I.M.A.G.E.Consortium (LLNL), provided by Incyte Genomics Inc. company, the PCR product connects into pGEX-4T1 (Amersham).The albumen of purifying synthesizes and separates from BL-21 (RIL) cell (being so kind as to give by doctor G.Paterno) with GST Gene Fusion System (Amersham), and it is undertaken by the methodology that the manufacturer provides.Preimmune serum is collected from rabbit (Charles RiverLaboratories), and the 500 μ g that this rabbit is injected purifying thereafter are suspended in the GST-hPygo2 fusion rotein of phosphate buffered saline buffer.Serum collect with the booster immunization operation according to reference (Ryan PJ and Gillespie LL. (1994) .Dev Biol, 166,101-111).
(b) RNA trace and RT-PCR: from clone, extract total RNA with Nucleospin RNA II Kit (Clontech).Rna blot analysis is according to previous description (Lake and Kao2003), and the PCR product that uses employed hPygo2 in the Antibody Preparation is through random labelling (Prime-a-Gene; Promega) obtain the radiolabeled probe.Blotting membrane is with thoroughly washing of damping fluid (60 ℃ in 0.1% SDS and 0.1XSSC), again under identical hybridization conditions with GAPDH probe (pTRI-GAPDH; Ambion) survey again.
Sxemiquantitative RT-PCR such as previous description (Lake BB and Kao KR. (2003) .DevBiol, 261,132-148) the aforesaid hPygo2 oligonucleotide primer of use.The hPygo2 primer (Kramps etc. (2002) .Cell, 109,47-60) (F:5 '-GCCACGACAACCAAGAGGTG SEQ ID NO:24; R:5 '-CCAGTACAGATCCGATGAAACC SEQID NO:25), the Bcl-9 primer (Willis etc. (1998) .Blood, 91,1873-1881) (F:5 '-GATGTTGTCCTGGTGTCTTG SEQ ID NO:26; R:5 '-GGTCACGACACTGCAGTGCTC SEQ ID NO:27) and the GAPDH primer (Ju etc. (1995) .Nature, 373,444-448) synthetic by Invitrogen company.
(c) immunoblotting: mono-clonal and polyclone β-a chain of plain antibody is available from Santa CruzBiotechnology company, and mono-clonal beta-actin antibody is available from Sigma company, and the cyclin D1 monoclonal antibody is available from BD Biosciences company.Total protein from tissue culture cells extracts from the protein sample damping fluid.In vitro translated hPygo2 albumen as positive control prepares with cell-free transcription/translation association system (Promega).The lysate that contains the total cell of 50 μ g is approximately transferred to nitrocellulose filter (Hybond-ECL after SDS-PAGE separates
TMAmersham) upward and with the chemoluminescence of strengthening (Amersham) develop.Beta-actin equates as internal reference proof protein sample amount.
(d) immunocytochemistry and immunohistochemical methods: for immunofluorescence analysis, Hs-574-mg, Bt-474 and Mcf-7 cell wash twice with 4% the fixing back of Paraformaldehyde 96 (30 minutes) with PBS, wash 10min with the PBS (tPBS) that contains 0.2% Triton-X 100 again.After the normal donkey/sheep blood serum sealing of cell with l0%, in the PBS that contains 1.5% normal serum, resist overnight incubation with one.After tPBS with 0.2% washed 30-40 minute, cell always resists with two at the normal serum that contains 1.5% hatched 30 minutes.For hPygo-2, use the anti-rabbit antibody of biotin labeled donkey (Amersham), plain for β-chain of rings, use Cy3 donkey anti-mouse antibody (JacksonImmunoResearch Laboratories, Inc.).Wash 30-40 minute in 0.1-0.2%tPBS after, cell was hatched in 1.5% normal serum that contains streptavidin fluorescein (Amersham)/PBS 30 minutes.Cell is after the tPBS with 0.1-0.2% washes 30-40 minute, at the PBS that contains 10% glycerine or Vectashield (Vector Laboratories, Inc.) middle mounting.Picture is taken with Laser Scanning Confocal Microscope (Olympus).
The operation of immunohistochemical methods substantially according to previous description (Rorke etc. (2001) .Int J Cancer, 95,317-322).The mammary cancer section is provided by medical experiment portion of Memorial university.
(e) antisense oligonucleotide and siRNA: the antisense oligonucleotide (Invitrogen) at hPygo2 is designed to respectively contain three phosphorothioate bonds at two ends, as asterisk institute mark, to improve their tolerances to nuclease.Employed sequence is as follows: the hPygo2 antisense oligonucleotide; 5 '-G*G*C*TGAGCAAATCGTT*G*G*G (Hpy5; SEQ ID NO:9), the special contrast oligonucleotide of Africa xenopus Pygo2; 5 '-T*T*T*GCGCCGTTTCTT*C*T*C, SEQ ID NO:21, the oligonucleotide of 4 base mispairings; 5 '-(underscore is labeled as base mismatch to G*U*C*TGAGCUAATCATT*G*G*T; SEQ ID NO:28).Whole oligonucleotides is designed to avoid occurring 4 successive G and multiple CG sequence, because they may cause non-specific antisense effect.β-a chain of plain siRNA and non-special contrast siRNA are from the β-a chain of plain siRNA/siAB that buys
TMAssay Kit (Upstate).The just sequence of synthetic use (Xeragon-Qiagen) of hPygo2siRNA:
Hpy2A;5′-r(CGAUGACCAGGAUGCCAUU)dTT-3′(SEQ ID NO:15)
Hpy2D;5′-r(CCAGCCUCUGGGUCAAAAC)dTT-3′(SEQ ID NO:18)。
(f) cell cultures and transfection: the whole clones except that (HEN) cell in the normal cervix and normal ectocervix (HEC) clone (Tsutsumi etc. 1992) are all available from AmericanType Culture Collection.T98G and Sk-N-Sh cell cultures are in the Minimal Essential Media substratum (Gibco) that contains 10% foetal calf serum.HEN and HEC cell cultures are in the Keratinocyte of serum-free substratum (Gibco).Remaining cell cultures is in Dulbecco ' s modified Eagle ' the s substratum (Gibco) that contains 10% foetal calf serum.
All Oligofectamine (Invitrogen) is all used in transfection, the specification sheets that operation provides according to the manufacturer, growth medium of replacing in per 24 hours.HPygo2 antisense/contrast oligonucleotide transfection is to the final concentration of 250nM, and all siRNA transfections are to the final concentration of 100nM.SiRNA repeats transfection once in the transfection first time after 24 hours.Analyze for RT-PCR, cell is by 1.5 * 10
5The density of cells/well is inoculated in 6 orifice plates, transfection collecting cell and extract RNA after 24 hours.For immunoblotting assay, cell is inoculated in 12 orifice plates by the density of 105 cells/well, and transfection is collecting cell after 48 hours.For cell growth analysis, cell is by 7.5 * 10
4The density of cells/well is inoculated in three group of 12 orifice plate, and transfection is dyeed with trypan blue (Sigma) after 48 hours and 72 hours, and counts with blood counting instrument.
(2)
Pygopus expresses in malignant breast carcinomas
The expression of hPygo2 in the mammary cancer surgery sample of filing, the antiserum(antisera) with the non-conserved domain reaction of hPygo2 albumen for preparing with us carries out immunohistochemical analysis and determines.We have obtained mammary cancer sample and a normal mammary gland section of 22 filings, and have carried out dye (Fig. 8) with hPygo2.In 14 tumours, the dyeing of hPygo2 is arranged in the malignant cell, and not dyeing in the non-tumor cell around it.In the sample of these 14 positive stainings, 6 have the dyeing of different nucleus/tenuigenin hPygo2, and 8 have tenuigenin hPygo2 dyeing.HPygo2 in normal breast section, detect less than.We have also obtained 4 mammary cancer patients' lymph node section.Wherein two sections that have tumour cell to shift are the hPygo2 stained positive, and two other section that does not contain tumour cell does not then have hPygo2 dyeing.HPygo2 consistent expression explanation Pygopus in the malignant cell of these tumours has important effect in mammary cancer.
In order to study the effect of Pygopus in the malignant galactophore cancerous cell line, we have measured the expression of hPygo2 mRNA among breast cancer cell line Bt-474 and the Mcf-7, and compare by rna blot analysis with the multiple clone that comes from healthy tissues and other malignant tumour that (Fig. 9 a).At ovarian cancer (Sk-Ov-3, Es-2), cervical cancer (HeLa, CaSki), breast cancer cell line (BT-474, Mcf-7), and all observe high expression level in normal ectocervix (HEC) cell.Different is, hPygo2 mRNA expresses very low in (HEN) and normal breast (Hs-574) clone in neuroblastoma (T98G, Sk-N-Sh), normal uterus or do not express.
HPygo2 albumen migrates to the size (Fig. 9 b) of about 50kDa of expection.The proteic expression of hPygo2 is consistent (Fig. 9 c) with the expression of hPygo2 mRNA in the clone, high expression level in ovarian cancer, cervical cancer, normal ectocervical cell and breast cancer cell, and low expression in neuroblastoma, normal cervix inner cell and normal breast cell.The investigation that β-a chain of fibroin is expressed proves, being expressed in of it and hPygo2 very similar in most clones (Fig. 9 c).It should be noted that hPygo2 does not express in MCF-10 (Hs-574), and in two breast cancer cell lines (Bt-474, Mcf-7) high expression level.
(3)
β-chain of rings element and hPygo2 locate in Mcf-7 and Bt-474 cell altogether
We next with indirect immunofluorescence and Laser Scanning Confocal Microscope detected Pygopus and β-chain of rings plain at mammary gland the Subcellular Localization in the normal and malignant clone.Endogenous hPygo2 albumen mainly is positioned nucleus (Figure 10) in two breast cancer cell lines of being analyzed (Bt-474 and Mcf-7).On the contrary, hPygo2 mainly is positioned tenuigenin (Figure 10) in MCF-10 (Hs-574).Beyond expectation is, different with hPygo2, and β-chain of rings is plain all to come across tenuigenin in tumour and normal cell system, and combines with intracellular film system, and in nucleus seldom.So, the plain navigation watch in breast cancer cell of Pygopus and β-chain of rings reveals a kind of difference that is easy to distinguish.
(4)
Bcl-9 does not express in breast cancer cell line and is irrelevant with Pygopus
Studies show that the interaction between Pygopus albumen and β-a chain of element is mediated by Legless/Bcl-9.Yet hPygo2 and β-chain of rings is plain irrelevant on Subcellular Localization, is indicating that beyond expectationly Wnt/ β in mammary cancer-a chain of plain complex body does not have related with hPygo2.Because Pygopus interacts by Bcl-9 and β-a chain of plain complex body, so we have measured the relative expression's level (Fig. 9 d) of Bcl-9 in the various kinds of cell system by RT-PCR.Bcl-9mRNA is high expression level in a cervical cancer (HeLa), two ovarian cancers (Sk-Ov-3, Es-2) and two neuroblastomas (T98G, Sk-N-Sh), and low expression in all detected clones at other.Surprisingly, almost there is not dependency between the expression of the expression of Bcl-9 and hPygo2 and β-chain of rings element.In addition, the expression ratio of Bcl-9 in breast cancer cell line is low in the normal breast cell.When these results suggest hPygo2 exercises its function in mammary cancer, may not need and β-a chain of plain transcription complex between interaction.
(5)
β-a chain of element is not that the growth of MCF-7 cell is needed
Previous studies show that the MCF-7 cell shows that Wnt relies on transcribe expression with Wnt target gene cyclin D1.So we seal the plain expression of β-chain of rings by siRNA, whether the growth of investigating the MCF-7 cell needs β-chain of rings plain.Plain sealing causes β-a chain of fibroin amount significantly to reduce to siRNA to the β-chain of rings, detects with the immune marking of applying to have less than it that (Figure 11 a).Yet this is accompanied by cell count and compares not obvious variation (Figure 11 b) with non-special siRNA control group with the transfection reagent control group.After the plain sealing of β-chain of rings, the protein level of hPygo2 and cyclin D1 is compared not change, and (Figure 11 a) with non-special siRNA control group.These results provide direct evidence, show that β-chain of rings element is not that cell proliferation is necessary in the MCF-7 cell, neither express necessary by Wnt target gene cyclin Dl.
(6)
Pygopus is that Mcf-7 cell proliferation is required
The growth of Mcf-7 cell does not need β-chain of rings plain, mainly is positioned the observations consistent (Figure 10) of Mcf-7 and Bt-474 cell membrane system about this albumen with us.On the other hand, because hPygo2 mainly is positioned at nucleus in the Mcf-7 cell, its growth needs is different from and β-a chain of plain function associated.In order to verify this possibility, we have determined the needs of cell growth to Pygopus with the sense-rna enclosed experiment.In primary experiment, we have designed the carrier of a coding and hPygo2 complementary sense-rna, and it can suppress the logarithmic growth of HeLa cell.We have also designed the special antisense ON (Fig. 3) of some hPygo2 mRNA.The ability that one of them oligonucleotide (hpy5) sealing hPygo2 mRNA expresses is the strongest, and it is selected in the HeLa cell and further analyzes.We use two contrast ON, one with Africa xenopus Pygo2 complementation (non-specific), another is with (hyp5) complementary but have 4 base-pair sequences to change (mispairing).(hpy5) transfection was compared with contrast ON after 24 hours, and the expression of hPygo2mRNA is sealed specifically, and do not influence other but the expression relevant with Pygo family member hPygo1 (Figure 12 a).Hpy5 can also seal the proteic expression of endogenous hPygo2, makes its level reduce to below 50% of contrast (Figure 12 b).
As in the HeLa cell, compare with non-special and mispairing contrast ON, (hpy5) the ON transfection causes that to the Mcf-7 cell hPygo2 protein level descends significantly, (Figure 13 is a) and the level of β-chain of rings element remains unchanged.The most meaningfully, the Mcf-7 cell of the special ON of transfection hPygo is compared with the non-special cell with mispairing contrast ON of transfection, and the growth of Mcf-7 cell has had considerable decline (Figure 13 b).Compare with reagent (oligofectamine) contrast, special closed group cell count is reduced to 52%, and non-special control group is 93%, and the mispairing control group is 83%.These results prove that the proteic ability of hpy5 oligonucleotide sealing hPygo2 is special, and can cause the minimizing of cell proliferation.Such cell count reduces simultaneously reduction with cyclin CyclinD1 level, and (Figure 13 a), the minimizing of hint cell growth may come from cell-cycle arrest.These results prove that hPygo2 is that the growth of Mcf-7 cell is required, and it is plain not rely on β-chain of rings.
For definite antisense ON sealing hPygo2, and cause Mcf-7 cell proliferation to reduce, we have used the siRNA special to hPygo2.We find have two (Hpy2A and Hpy2D) can effectively reduce the protein level (Figure 14) of hPygo2 in 6 siRNA at hPygo2 of design, and do not influence the plain protein level of β-chain of rings, so we are used for further experiment with them.With protein level reduce consistent, we find these two siRNA separately or combined action can both cause that the Mcf-7 cell count reduces (Figure 14 b) significantly, so proved conclusively the result that we obtain with antisense ON.
(7)
Mechanism Hypothesis
Our experimental result shows that Pygopus crosses expression in mammary gland and other tumour, and it is not by relying on the plain mechanism of β-chain of rings, is that the growth of Mcf-7 cell is necessary.Comprehensive our experimental result illustrates that Pygopus albumen may be crossed to express in cancer cells, and except the Wnt signal pathway that mediates above-mentioned classics by β-a chain of element/Bcl-9, also may bring into play other effect.
The plain expression of the expression level that our experimental result confirms Pygopus and β-chain of rings is relevant, and has nothing to do with its unique known binding partners Bcl-9.The verified Wnt of having of the breast cancer cell that uses in this research relies on transcribes, the expression of cyclin D1 and the formation of β-a chain of element/Tcf complex body.Therefore, the shortage that Bcl-9 expresses in breast cancer cell is beyond expectation, because Pygopus needs Bcl-9 just can incorporate in β-a chain of element/Tcf complex body.Perhaps Pygopus is to be controlled by different regulatory factors on transcriptional level with Bcl-9, and we see the different reason of this a pair of chaperone expression and Here it is.
The frequency of sudden change appears in the gene of coding Wnt signal pathway required composition, and is relatively low in breast cancer cell, but has hypothesis to think crossing to express and having caused crossing of target gene to be expressed of composition in the Wnt signal pathway, and then may promote the formation of mammary cancer.For example, independently study for two and reported that respectively the plain dyeing of β-chain of rings is arranged in the nucleus/tenuigenin in about 60% breast cancer tissue.This phenomenon may come from the β-a chain of plain expression regulation that does not rely on Wnt, and to the plain regulation and control of β-chain of rings, and GSK3 does not rely on the regulation and control of Wnt such as fibroblast growth factor and epidermal growth factor family member.
What is interesting is that Hs-574 compares with the normal breast cell, Pygopus mRNA among breast cancer cell line Bt-474 and the Mcf-7 and albumen high expression level show that Pygopus is that these cell proliferations are necessary.Known Pygopus also can be used as the cell nuclear protein and plays a role; We are confirmed this point by detecting the endogenous Subcellular Localization.The enrichment in neoplastic cell nuclei of this albumen is distributed in tenuigenin or does not express in normal cell.This shows that crossing of Pygopus expressed and Subcellular Localization may work in cell malignization process.The expression that occurs nuclear Pygopus in some patient's tumour cells is consistent with this effect.
Previous studies show that, the expression level of target gene cyclin D1 in the Mcf-7 cell of Wnt signal and Wnt is than the level height in other breast cancer cell lines at some.Because it is necessary that we have proved that β-a chain of element is not that cyclin D1 is expressed in these cells, so the expression of cyclin D1 can not be as the true index of Wnt signal level.In fact, studies show that the expression of cyclin D1 is that the cell growth is necessary, and the protein regulation that is relied on by other non-Wnt, such as estrogen receptor and Pexoxisome proliferator activated receptor γ (PPAR γ) in the Mcf-7 cell.As if the most of β in breast cancer cell Bt-474 and Mcf-7-chain of rings is plain to be present in the complex body with the E cadherin more, rather than is in the constitutively activate state in nucleus.Though as if in the Mcf-7 cell, the transcriptional level that Wnt relies on is very low, and this obviously is not sufficient to the expression of Wnt target gene cyclin D1 is worked.But then, the reduction that the expression of sealing Pygopus causes cyclin D1 to be expressed, and cyclin D1 is the crucial modulin of cell cycle from G1 phase to S phase transition.Therefore, the minimizing of the Mcf-7 cell count that the minimizing of Pygopus causes, this may be owing to caused cell cycle arrest.
Suppress the plain growth that does not influence the HeLa cell of β-chain of rings with ICAT, this uses β-viewed result of a chain of plain siRNA with us in the MCF-7 cell be consistent.As if these data show that at least two cancerous cell lines classical Wnt signal pathway cell growth is unimportant.These data suggest Pygopus has the other effect that does not rely on β-chain of rings element and Wnt signal.
The effect of Pygopus albumen in Wnt signal and normal development summarized in limited research at present.The function of hPygo in the Wnt signal also studied in some colon cancer cells, and these cells show the Wnt signal of composition owing to the sudden change of APC and the plain identification of β-chain of rings.Therefore, as if plain as β-chain of rings, the sealing that Pygopus expresses also suppresses the growth of colon cancer cell.
Our data show that the minimizing of Mcf-7 cell proliferation may be the result of cell cycle arrest, and Pygopus may have the important function that does not rely on β-chain of rings element.These results provide the new knowledge that Pygopus is acted on to us in tumour, and explanation Pygopus is a suitable oncotherapy target spot.
Embodiment 3:Pygopus is the target spot in cervical cancer diagnosis and the treatment.
Figure 16 is presented in the cervical cancer HeLa clone and with antisense ON endogenous hPygo2 is sealed.(mismatch) contrast of reagent contrast (Oligofectamine), antisense Africa xenopus Pygopus2 (non-specific) contrast and 4 base mispairings all marks.Cause transfection 48 and HeLa cell count minimizing after 72 hours by antisense ON sealing hPygo2.Cell count is determined with the blood counting instrument direct census by trypan blue dyeing back.RT-PCR analyzes and has shown the sealing special to hPygo2 mRNA, and the expression of relevant Pygo family member hPygo1 is not influenced.RT-is a negative control, does not contain reversed transcriptive enzyme.Immunoblotting assay shows the proteic sealing of endogenous hPygo2.CDNA and proteic level are come stdn by using GAPDH and beta-actin.Experiment divides 3 groups of parallel carrying out.
Embodiment 4: anti--hPygo2 antibody identifies the malignant cell in ovarian cancer, mammary cancer and the lung cancer.
Anti--hPygo2 antibody is used for immunohistochemical analysis, to identify from the malignant cell in epithelial ovarian cancer, mammary cancer and the lung cancer.The filing tumour of being determined by the pathology expert who holds license is in advance dyeed, show that Pygopus crosses expression specifically in multiple ovarian epithelium tumour (Figure 15 A, C), malignant breast carcinomas (Figure 15 G) and lung cancer (Figure 15 H).Preimmune serum dyes and only adds the specificity that two anti-negative controls show antibody.
Sequence table
<110〉NUS
<120〉effect of PYGOPUS in diagnosis and treatment cancer
<130>50680-4
<150>US 60/463 309
<151>2003-04-17
<150>US 60/496 012
<151>2003-08-19
<160>28
<170>PatentIn version 3.3
<210>1
<211>3190
<212>DNA
<213〉homo sapiens
<220>
<223>hPygo-2
<220>
<221>CDS
<222>(173)..(1393)
<400>1
gtctggagag agcgcgcagt ttgcgcggcg gctcggcgct tccctgtcgt cgcactttgt 60
ggttgctgca gctcgggggc ctgggctgcc cctgacaccc cttctgggcg atggtgcagc 120
ccaagggcgc ctccatcccc cgccgctgcc gctaacccgg gtcccccact cc atg gcc 178
Met Ala
1
gcc tcg gcg ccg ccc cca ccg gac aag ctg gag gga ggt ggc ggc ccc 226
Ala Ser Ala Pro Pro Pro Pro Asp Lys Leu Glu Gly Gly Gly Gly Pro
5 10 15
gca ccg ccc cct gcg ccg ccc agc acc ggg agg aag cag ggc aag gcc 274
Ala Pro Pro Pro Ala Pro Pro Ser Thr Gly Arg Lys Gln Gly Lys Ala
20 25 30
ggt ctg caa atg aag agt cca gaa aag aag cga agg aag tca aat act 322
Gly Leu Gln Met Lys Ser Pro Glu Lys Lys Arg Arg Lys Ser Asn Thr
35 40 45 50
cag ggc cct gca tac tca cat ctg acg gag ttt gca cca ccc cca act 370
Gln Gly Pro Ala Tyr Ser His Leu Thr Glu Phe Ala Pro Pro Pro Thr
55 60 65
ccc atg gtg gat cac ctg gtt gca tcc aac cct ttt gaa gat gac ttc 418
Pro Met Val Asp His Leu Val Ala Ser Asn Pro Phe Glu Asp Asp Phe
70 75 80
gga gcc ccc aaa gtg ggg gtt gca gcc cct cca ttc ctt ggc agt cct 466
Gly Ala Pro Lys Val Gly Val Ala Ala Pro Pro Phe Leu Gly Ser Pro
85 90 95
gtg ccc ttc gga ggc ttc cgt gtg cag ggg ggc atg gcg ggc cag gta 514
Val Pro Phe Gly Gly Phe Arg Val Gln Gly Gly Met Ala Gly Gln Val
100 105 110
ccc cca ggc tac agc act gga ggt gga ggg ggc ccc cag cca ctc cgt 562
Pro Pro Gly Tyr Ser Thr Gly Gly Gly Gly Gly Pro Gln Pro Leu Arg
115 120 125 130
cga cag cca ccc ccc ttc cct ccc aat cct atg ggc cct gct ttc aac 610
Arg Gln Pro Pro Pro Phe Pro Pro Asn Pro Met Gly Pro Ala Phe Asn
135 140 145
atg ccc ccc cag ggt cct ggc tac cca ccc cca ggc aac atg aac ttt 658
Met Pro Pro Gln Gly Pro Gly Tyr Pro Pro Pro Gly Asn Met Asn Phe
150 155 160
ccc agc caa ccc ttc aac cag cct ctg ggt caa aac ttt agt cct ccc 706
Pro Ser Gln Pro Phe Asn Gln Pro Leu Gly Gln Asn Phe Ser Pro Pro
165 170 175
agt ggg cag atg atg ccg ggc cca gtg ggg gga ttt ggt ccc atg atc 754
Ser Gly Gln Met Met Pro Gly Pro Val Gly Gly Phe Gly Pro Met Ile
180 185 190
tca ccc acc atg gga cag cct ccc aga gca gag ctg ggc cca cct tct 802
Ser Pro Thr Met Gly Gln Pro Pro Arg Ala Glu Leu Gly Pro Pro Ser
195 200 205 210
ctg tcc caa cga ttt gct cag cca ggg gct cct ttt ggc cct tct cct 850
Leu Ser Gln Arg Phe Ala Gln Pro Gly Ala Pro Phe Gly Pro Ser Pro
215 220 225
ctc cag aga cct ggt cag ggg ctc ccc agc ctg ccg cct aac aca agt 898
Leu Gln Arg Pro Gly Gln Gly Leu Pro Ser Leu Pro Pro Asn Thr Ser
230 235 240
ccc ttt cct ggt ccg gac cct ggc ttt cct ggc cct ggt ggt gag gat 946
Pro Phe Pro Gly Pro Asp Pro Gly Phe Pro Gly Pro Gly Gly Glu Asp
245 250 255
ggg ggg aag ccc ttg aat cca cct gct tct act gct ttt ccc cag gag 994
Gly Gly Lys Pro Leu Asn Pro Pro Ala Ser Thr Ala Phe Pro Gln Glu
260 265 270
ccc cac tca ggc tcc ccg gct gct gct gtt aat ggg aac cag ccc agt 1042
Pro His Ser Gly Ser Pro Ala Ala Ala Val Asn Gly Asn Gln Pro Ser
275 280 285 290
ttc ccc ccg aac agc agt ggg cgg ggt ggg ggc act cca gat gcc aac 1090
Phe Pro Pro Asn Ser Ser Gly Arg Gly Gly Gly Thr Pro Asp Ala Asn
295 300 305
agc ttg gca ccc cct ggc aag gca ggt ggg ggc tcc ggg ccc cag cct 1138
Ser Leu Ala Pro Pro Gly Lys Ala Gly Gly Gly Ser Gly Pro Gln Pro
310 315 320
ccc cca ggc ttg gtg tac cca tgt ggt gcc tgt cgg agt gag gtg aac 1186
Pro Pro Gly Leu Val Tyr Pro Cys Gly Ala Cys Arg Ser Glu Val Asn
325 330 335
gat gac cag gat gcc att ctg tgt gag gcc tcc tgc cag aaa tgg ttc 1234
Asp Asp Gln Asp Ala Ile Leu Cys Glu Ala Ser Cys Gln Lys Trp Phe
340 345 350
cac cgt gag tgc aca ggc atg act gag agc gcc tat ggg ctg ctg acc 1282
His Arg Glu Cys Thr Gly Met Thr Glu Ser Ala Tyr Gly Leu Leu Thr
355 360 365 370
act gaa gct tct gcc gtc tgg gcc tgc gat ctc tgc ctc aag acc aag 1330
Thr Glu Ala Ser Ala Val Trp Ala Cys Asp Leu Cys Leu Lys Thr Lys
375 380 385
gag atc cag tct gtc tac atc cgt gag ggc atg ggg cag ctg gtg gct 1378
Glu Ile Gln Ser Val Tyr Ile Arg Glu Gly Met Gly Gln Leu Val Ala
390 395 400
gct aac gat ggg tga cgctggtgaa gtggcccagg gaagtgcaca tgtctctccc 1433
Ala Asn Asp Gly
405
tgctcttcca gggtgatttt tttgatgttt ggctcttggt ccttgtttcc actggctttc 1493
catccccatg gggcagaaac agtggctcct gggagcagaa aaggaattga ggtgggcagg 1553
cagaagagcc tggattgctc actgttttgg gaaacttaca tgttgagatc tacagagatc 1613
caggaaacca aagccctgct gagcagagcc attttgtggc tatttctgga ggcccaggag 1673
tgtggctgca agagaaaagg ggctggagga agatccggag ggcaggggtg ttccctctgc 1733
tgatgatgga tgcccctaac acctgtgcct aacaccccta ctgaacccca cagctccagc 1793
cttagttttt ggagtcaagt gttaaaggtt tctggccaga ggaattgggg tcttgccatc 1853
cctgcaatag cccttttatg ggctctggga gacagcttta gggaataaat ggggattttc 1913
ccctttttct acccactcct ttgcttcctc caagacttac ccaactcctt ccccctcaga 1973
gaaccaaata gcctgaggaa gcaggagagt tcctggttat ggcagtttct tggtgatttg 2033
gggcttcaag acagtaggtg agagatgctg tcaggacgta tcttcttcat accaaagtca 2093
ctggtccttt ctcagcctct ctcgtgcttt tctcctaatg accatatttt tgccaaaaat 2153
tgggatatgt tatctgacag accagaatat ttgaagtttg ggctgtcctg aaagtctgga 2213
ctttggtggt accctcctcc cccagcccat ctgttgcaca ttatactccg tgtgttcttc 2273
aactttcggc gcccttattc ccctgccttc ctggcttgat tgaaggaaag cttgaaaagg 2333
cgcagagccc tatacctcat ttcctccatg ataaaaggat ccaagtgagg ccctgtcaca 2393
gcctgtgggt aggggatgcg gcgggatcct cattgccatg gtactcaaag gtagaagagc 2453
ctggagtttg ttgcttctct ttgctattct ttcatatcct cttgggcctg gtgattaatt 2513
agcaattctc attcctctca gccaaaggcc tgcactgggc tttatttgtc tttttttatt 2573
ttttaagcac tgcctgccag agatgggcct ggggcctgat gaggacctta gcgctgctcg 2633
ttctcctttt ctgttcatgc acacattcct ccatggggtg gggaaggcag gcatggggtg 2693
tggccctcgg agaagttagg agtcccccag ctcaagatac agtggcaaag acctagtggt 2753
cccctacccc cacttctctc agttcctggc atgaggagag aagaccctgc tctggtggag 2813
ctgacaacct ttgaggctgg gaggagagca gcctctgggc atcgttccca gtgtccctca 2873
cactaaaacg gcgtagatgg caacccccca cccccacccc gctgctcaac tcttgtgttt 2933
gttgttctgt ttgccccatt tatctgttgc tgtttttgtg ttgtcttccc ctgctccgca 2993
ttttgtaaaa tggcccctgg gggagtgttt ttgctggatc tgctccctct cgctctctca 3053
ctccactact ttttggacaa agtgatggca gaatgcggtg gtggtggggg tcttttgtac 3113
tgttggatta ataaaatgat tttaaaatcc caaaaaaaaa aaaaaaaaaa aaaaaaaaaa 3173
aaaaaaaaaa aaaaaaa 3190
<210>2
<211>406
<212>PRT
<213〉homo sapiens
<220>
<223>hPygo-2
<400>2
Met Ala Ala Ser Ala Pro Pro Pro Pro Asp Lys Leu Glu Gly Gly Gly
1 5 10 15
Gly Pro Ala Pro Pro Pro Ala Pro Pro Ser Thr Gly Arg Lys Gln Gly
20 25 30
Lys Ala Gly Leu Gln Met Lys Ser Pro Glu Lys Lys Arg Arg Lys Ser
35 40 45
Asn Thr Gln Gly Pro Ala Tyr Ser His Leu Thr Glu Phe Ala Pro Pro
50 55 60
Pro Thr Pro Met Val Asp His Leu Val Ala Ser Asn Pro Phe Glu Asp
65 70 75 80
Asp Phe Gly Ala Pro Lys Val Gly Val Ala Ala Pro Pro Phe Leu Gly
85 90 95
Ser Pro Val Pro Phe Gly Gly Phe Arg Val Gln Gly Gly Met Ala Gly
100 105 110
Gln Val Pro Pro Gly Tyr Ser Thr Gly Gly Gly Gly Gly Pro Gln Pro
115 120 125
Leu Arg Arg Gln Pro Pro Pro Phe Pro Pro Asn Pro Met Gly Pro Ala
130 135 140
Phe Asn Met Pro Pro Gln Gly Pro Gly Tyr Pro Pro Pro Gly Asn Met
145 150 155 160
Asn Phe Pro Ser Gln Pro Phe Asn Gln Pro Leu Gly Gln Asn Phe Ser
165 170 175
Pro Pro Ser Gly Gln Met Met Pro Gly Pro Val Gly Gly Phe Gly Pro
180 185 190
Met Ile Ser Pro Thr Met Gly Gln Pro Pro Arg Ala Glu Leu Gly Pro
195 200 205
Pro Ser Leu Ser Gln Arg Phe Ala Gln Pro Gly Ala Pro Phe Gly Pro
210 215 220
Ser Pro Leu Gln Arg Pro Gly Gln Gly Leu Pro Ser Leu Pro Pro Asn
225 230 235 240
Thr Ser Pro Phe Pro Gly Pro Asp Pro Gly Phe Pro Gly Pro Gly Gly
245 250 255
Glu Asp Gly Gly Lys Pro Leu Asn Pro Pro Ala Ser Thr Ala Phe Pro
260 265 270
Gln Glu Pro His Ser Gly Ser Pro Ala Ala Ala Val Asn Gly Asn Gln
275 280 285
Pro Ser Phe Pro Pro Asn Ser Ser Gly Arg Gly Gly Gly Thr Pro Asp
290 295 300
Ala Asn Ser Leu Ala Pro Pro Gly Lys Ala Gly Gly Gly Ser Gly Pro
305 310 315 320
Gln Pro Pro Pro Gly Leu Val Tyr Pro Cys Gly Ala Cys Arg Ser Glu
325 330 335
Val Asn Asp Asp Gln Asp Ala Ile Leu Cys Glu Ala Ser Cys Gln Lys
340 345 350
Trp Phe His Arg Glu Cys Thr Gly Met Thr Glu Ser Ala Tyr Gly Leu
355 360 365
Leu Thr Thr Glu Ala Ser Ala Val Trp Ala Cys Asp Leu Cys Leu Lys
370 375 380
Thr Lys Glu Ile Gln Ser Val Tyr Ile Arg Glu Gly Met Gly Gln Leu
385 390 395 400
Val Ala Ala Asn Asp Gly
405
<210>3
<211>1260
<212>DNA
<213〉homo sapiens
<220>
<221>CDS
<222>(1)..(1260)
<220>
<223>hPygo-1
<400>3
atg ccc gcc gag aac tct cca gct ccc gct tac aaa gtt tcc tcg cat 48
Met Pro Ala Glu Asn Ser Pro Ala Pro Ala Tyr Lys Val Ser Ser His
1 5 10 15
ggt ggt gat agt gga ctg gat ggg tta gga gga cca ggt gta caa cta 96
Gly Gly Asp Ser Gly Leu Asp Gly Leu Gly Gly Pro Gly Val Gln Leu
20 25 30
gga agc cca gat aag aaa aag cgc aag gca aat aca cag gga cct tct 144
Gly Ser Pro Asp Lys Lys Lys Arg Lys Ala Asn Thr Gln Gly Pro Ser
35 40 45
ttc cct cca ttg tct gag tat gct cca cca ccg aat cca aac tct gac 192
Phe Pro Pro Leu Ser Glu Tyr Ala Pro Pro Pro Asn Pro Asn Ser Asp
50 55 60
cat cta gtg gct gct aat cca ttt gat gac aac tat aat act att tcc 240
His Leu Val Ala Ala Asn Pro Phe Asp Asp Asn Tyr Asn Thr Ile Ser
65 70 75 80
tat aaa cca cta cct tcg tca aat cca tat ctt ggc cct ggt tat cct 288
Tyr Lys Pro Leu Pro Ser Ser Asn Pro Tyr Leu Gly Pro Gly Tyr Pro
85 90 95
ggc ttt gga ggc tat agt aca ttc aga atg cca cct cac gtt ccc cca 336
Gly Phe Gly Gly Tyr Ser Thr Phe Arg Met Pro Pro His Val Pro Pro
100 105 110
aga atg tct tcc cca tac tgt ggt cct tac tca ctc agg aac cag cca 384
Arg Met Ser Ser Pro Tyr Cys Gly Pro Tyr Ser Leu Arg Asn Gln Pro
115 120 125
cac cca ttt cct cag aat cct ctg ggc atg ggt ttt aat cga cct cat 432
His Pro Phe Pro Gln Asn Pro Leu Gly Met Gly Phe Asn Arg Pro His
130 135 140
gct ttt aac ttt ggg cca cat gat aat tca agt ttc ggt aat cca tct 480
Ala Phe Asn Phe Gly Pro His Asp Asn Ser Ser Phe Gly Asn Pro Ser
145 150 155 160
tat aat aat gca cta agt cag aat gtc aac atg cct aat caa cat ttt 528
Tyr Asn Asn Ala Leu Ser Gln Asn Val Asn Met Pro Asn Gln His Phe
165 170 175
aga caa aat cct gct gaa aat ttc agt caa att cct cca cag aat gct 576
Arg Gln Asn Pro Ala Glu Asn Phe Ser Gln Ile Pro Pro Gln Asn Ala
180 185 190
agc caa gtt tct aac ccc gat ttg gca tct aat ttt gtt cct gga aat 624
Ser Gln Val Ser Asn Pro Asp Leu Ala Ser Asn Phe Val Pro Gly Asn
195 200 205
aat tca aat ttt act tct ccg tta gaa tct aat cat tct ttt att cct 672
Asn Ser Asn Phe Thr Ser Pro Leu Glu Ser Asn His Ser Phe Ile Pro
210 215 220
ccc cca aac act ttt ggt caa gca aaa gca cca ccc cca aaa caa gac 720
Pro Pro Asn Thr Phe Gly Gln Ala Lys Ala Pro Pro Pro Lys Gln Asp
225 230 235 240
ttt act caa gga gca acc aaa aac act aat caa aat tcc tct gct cat 768
Phe Thr Gln Gly Ala Thr Lys Asn Thr Asn Gln Asn Ser Ser Ala His
245 250 255
cca cct cac ttg aat atg gat gac aca gtg aat cag agt aat att gaa 816
Pro Pro His Leu Asn Met Asp Asp Thr Val Asn Gln Ser Asn Ile Glu
260 265 270
tta aaa aat gtt aat cga aac aat gca gta aat cag gag aac agc cgt 864
Leu Lys Asn Val Asn Arg Asn Asn Ala Val Asn Gln Glu Asn Ser Arg
275 280 285
tca agt agc act gaa gcc aca aac aat aac cct gca aat ggg acg cag 912
Ser Ser Ser Thr Glu Ala Thr Asn Asn Asn Pro Ala Asn Gly Thr Gln
290 295 300
aat aag cca cga caa cca aga ggt gca gca gat gcc tgc acc aca gaa 960
Asn Lys Pro Arg Gln Pro Arg Gly Ala Ala Asp Ala Cys Thr Thr Glu
305 310 315 320
aaa agc aat aaa tcc tct ctt cac cca aac cgt cat ggc cat tcg tct 1008
Lys Ser Asn Lys Ser Ser Leu His Pro Asn Arg His Gly His Ser Ser
325 330 335
tct gac cca gtg tat cct tgt gga att tgt aca aac gag gtg aac gat 1056
Ser Asp Pro Val Tyr Pro Cys Gly Ile Cys Thr Asn Glu Val Asn Asp
340 345 350
gat cag gat gcc atc tta tgt gag gcc tct tgt cag aaa tgg ttt cat 1104
Asp Gln Asp Ala Ile Leu Cys Glu Ala Ser Cys Gln Lys Trp Phe His
355 360 365
cgg atc tgt act gga atg act gaa aca gct tat ggc ctc tta act gca 1152
Arg Ile Cys Thr Gly Met Thr Glu Thr Ala Tyr Gly Leu Leu Thr Ala
370 375 380
gaa gca tct gca gta tgg ggc tgt gat acc tgt atg gct gac aaa gat 1200
Glu Ala Ser Ala Val Trp Gly Cys Asp Thr Cys Met Ala Asp Lys Asp
385 390 395 400
gtc cag tta atg cgt act aga gaa act ttt ggt cca tct gca gtg ggc 1248
Val Gln Leu Met Arg Thr Arg Glu Thr Phe Gly Pro Ser Ala Val Gly
405 410 415
agt gat gct taa 1260
Ser Asp Ala
<210>4
<211>419
<212>PRT
<213〉homo sapiens
<220>
<223>hPygo-1
<400>4
Met Pro Ala Glu Asn Ser Pro Ala Pro Ala Tyr Lys Val Ser Ser His
1 5 10 15
Gly Gly Asp Ser Gly Leu Asp Gly Leu Gly Gly Pro Gly Val Gln Leu
20 25 30
Gly Ser Pro Asp Lys Lys Lys Arg Lys Ala Asn Thr Gln Gly Pro Ser
35 40 45
Phe Pro Pro Leu Ser Glu Tyr Ala Pro Pro Pro Asn Pro Asn Ser Asp
50 55 60
His Leu Val Ala Ala Asn Pro Phe Asp Asp Asn Tyr Asn Thr Ile Ser
65 70 75 80
Tyr Lys Pro Leu Pro Ser Ser Asn Pro Tyr Leu Gly Pro Gly Tyr Pro
85 90 95
Gly Phe Gly Gly Tyr Ser Thr Phe Arg Met Pro Pro His Val Pro Pro
100 105 110
Arg Met Ser Ser Pro Tyr Cys Gly Pro Tyr Ser Leu Arg Asn Gln Pro
115 120 125
His Pro Phe Pro Gln Asn Pro Leu Gly Met Gly Phe Asn Arg Pro His
130 135 140
Ala Phe Asn Phe Gly Pro His Asp Asn Ser Ser Phe Gly Asn Pro Ser
145 150 155 160
Tyr Asn Asn Ala Leu Ser Gln Asn Val Asn Met Pro Asn Gln His Phe
165 170 175
Arg Gln Asn Pro Ala Glu Asn Phe Ser Gln Ile Pro Pro Gln Asn Ala
180 185 190
Ser Gln Val Ser Asn Pro Asp Leu Ala Ser Asn Phe Val Pro Gly Asn
195 200 205
Asn Ser Asn Phe Thr Ser Pro Leu Glu Ser Asn His Ser Phe Ile Pro
210 215 220
Pro Pro Asn Thr Phe Gly Gln Ala Lys Ala Pro Pro Pro Lys Gln Asp
225 230 235 240
Phe Thr Gln Gly Ala Thr Lys Asn Thr Asn Gln Asn Ser Ser Ala His
245 250 255
Pro Pro His Leu Asn Met Asp Asp Thr Val Asn Gln Ser Asn Ile Glu
260 265 270
Leu Lys Asn Val Asn Arg Asn Asn Ala Val Asn Gln Glu Asn Ser Arg
275 280 285
Ser Ser Ser Thr Glu Ala Thr Asn Asn Asn Pro Ala Asn Gly Thr Gln
290 295 300
Asn Lys Pro Arg Gln Pro Arg Gly Ala Ala Asp Ala Cys Thr Thr Glu
305 310 315 320
Lys Ser Asn Lys Ser Ser Leu His Pro Asn Arg His Gly His Ser Ser
325 330 335
Ser Asp Pro Val Tyr Pro Cys Gly Ile Cys Thr Asn Glu Val Asn Asp
340 345 350
Asp Gln Asp Ala Ile Leu Cys Glu Ala Ser Cys Gln Lys Trp Phe His
355 360 365
Arg Ile Cys Thr Gly Met Thr Glu Thr Ala Tyr Gly Leu Leu Thr Ala
370 375 380
Glu Ala Ser Ala Val Trp Gly Cys Asp Thr Cys Met Ala Asp Lys Asp
385 390 395 400
Val Gln Leu Met Arg Thr Arg Glu Thr Phe Gly Pro Ser Ala Val Gly
405 410 415
Ser Asp Ala
<210>5
<211>20
<212>DNA
<213〉artificial
<220>
<223〉Hpy1 antisense oligonucleotide
<400>5
<210>6
<211>21
<212>DNA
<213〉artificial
<220>
<223〉Hpy2 antisense oligonucleotide
<400>6
ggacccgggt tagcggcagc g 21
<210>7
<211>21
<212>DNA
<213〉artificial
<220>
<223〉Hpy3 antisense oligonucleotide
<400>7
ccacctccct ccagcttgtc c 21
<210>8
<211>19
<212>DNA
<213〉artificial
<220>
<223〉Hpy4 antisense oligonucleotide
<400>8
ggaggactaa agttttgac 19
<210>9
<211>19
<212>DNA
<213〉artificial
<220>
<223〉Hpy5 antisense oligonucleotide
<400>9
ggctgagcaa atcgttggg 19
<210>10
<211>20
<212>DNA
<213〉artificial
<220>
<223〉Hpy6 antisense oligonucleotide
<400>10
<210>11
<211>18
<212>DNA
<213〉artificial
<220>
<223〉Hpy7 antisense oligonucleotide
<400>11
ctcacggatg tagacaga 18
<210>12
<211>19
<212>DNA
<213〉artificial
<220>
<223〉Hpy8 antisense oligonucleotide
<400>12
cctctggcca gaaaccttt 19
<210>13
<211>19
<212>DNA
<213〉artificial
<220>
<223〉Hpy9 antisense oligonucleotide
<400>13
ctcttctacc tttgagtac 19
<210>14
<211>18
<212>DNA
<213〉artificial
<220>
<223〉Hpy10 antisense oligonucleotide
<400>14
cactgtatct tgagctgg 18
<210>15
<211>19
<212>RNA
<213〉artificial
<220>
<223>Hpy2A siRNA
<400>15
cgaugaccag gaugccauu 19
<210>16
<211>19
<212>RNA
<213〉artificial
<220>
<223>Hpy2B siRNA
<400>16
agaagcgaag gaagucaaa 19
<210>17
<211>19
<212>RNA
<213〉artificial
<220>
<223>Hpy2C siRNA
<400>17
ugggaaccag cccaguuuc 19
<210>18
<211>19
<212>RNA
<213〉artificial
<220>
<223>Hpy2D siRNA
<400>18
ccagccucug ggucaaaac 19
<210>19
<211>19
<212>RNA
<213〉artificial
<220>
<223>Hpy2E siRNA
<400>19
cuuucccagc caacccuuc 19
<210>20
<211>19
<212>DNA
<213〉artificial
<220>
<223〉Hpy5 mismatch
<400>20
gcctgagcta atcattggt 19
<210>21
<211>18
<212>DNA
<213〉artificial
<220>
<223〉anti-xenopous laevis pygo2
<400>21
tttgcgccgt ttcttctc 18
<210>22
<211>24
<212>DNA
<213〉artificial
<220>
<223〉hPygo2 forward primer
<400>22
gcatccaacc cttttgaaga tgac 24
<210>23
<211>25
<212>DNA
<213〉artificial
<220>
<223〉hPygo2 reverse primer
<400>23
tcagccaggg ggtgccaagc tgttg 25
<210>24
<211>20
<212>DNA
<213〉artificial
<220>
<223〉hPygo1 forward primer
<400>24
<210>25
<211>22
<212>DNA
<213〉artificial
<220>
<223〉hPygo1 reverse primer
<400>25
ccagtacaga tccgatgaaa cc 22
<210>26
<211>20
<212>DNA
<213〉artificial
<220>
<223〉Bcl-9 forward primer
<400>26
<210>27
<211>21
<212>DNA
<213〉artificial
<220>
<223〉Bcl-9 reverse primer
<400>27
ggtcacgaca ctgcagtgct c 21
<210>28
<211>19
<212>DNA
<213〉artificial
<220>
<223〉Hpy5 mismatch
<400>28
gtctgagcta atcattggt 19
Claims (53)
1. whether there is the method for malignant tumour in definite patient's body, said method comprising the steps of:
(a) detect Pygopus expression of gene level from the biological specimen that described patient obtains, and
(b) Pygopus expression of gene level in the described biological specimen and predetermined threshold value are compared, whether excessive to judge the Pygopus expression in this biological specimen;
Determine in described patient's body, whether have malignant tumour thus.
2. method of monitoring patient's cancer progression situation said method comprising the steps of:
(a) detect Pygopus expression of gene level from the biological specimen that described patient obtains, and
(b) Pygopus expression of gene level in the described biological specimen and predetermined threshold value are compared, whether excessive to judge the Pygopus expression in this biological specimen; And determine in this patient's body, whether have malignant tumour thus;
(c) in the time thereafter, use from this patient's biological specimen and repeating step (a) and (b); And
(d) compare detected Pygopus gene expression dose in step (c) and step (b); And monitor described patient's cancer progression situation thus.
3. method according to claim 1 and 2, wherein said predetermined threshold value are Pygopus expression of gene levels in the normal biological sample.
4. according to any one described method in the claim 1 to 3, wherein said cancer is an ovarian cancer, and described biological specimen is the biopsy sample that contains ovarian epithelial cell.
5. according to any one described method in the claim 1 to 3, wherein said cancer is a mammary cancer, and described biological specimen is the biopsy sample that contains mammary gland cell.
6. according to any one described method in the claim 1 to 5, wherein said Pygopus gene is the hPygo2 gene shown in the SEQ ID NO:1.
7. according to any one described method in the claim 1 to 5, wherein said Pygopus gene is the hPygo1 gene shown in the SEQ ID NO:3.
8. according to any one described method in the claim 1 to 7, wherein said Pygopus expression of gene level is determined by the proteic amount of Pygopus.
9. according to any one described method in the claim 1 to 7, wherein said Pygopus expression of gene level is determined by the amount of Pygopus mRNA.
10. the test kit that whether has malignant tumour in definite patient's body, described test kit comprises the reagent that can detect from the biological specimen that described patient obtains Pygopus albumen or mRNA, and use described reagent to judge whether the Pygopus gene expression dose in the described biological specimen is higher than the operation instruction of predetermined threshold value, and determine whether there is malignant tumour in described patient's body thus.
11. test kit according to claim 10, wherein said reagent are the antibody with Pygopus albumen specific reaction.
12. test kit according to claim 10, wherein said reagent be can with a part of bonded polynucleotide of Pygopus gene or Pygopus gene.
13. according to any one described test kit in the claim 10 to 12, wherein said predetermined threshold value is a Pygopus expression of gene level in the normal biological sample.
14. according to any one described test kit in the claim 10 to 13, wherein said cancer is an ovarian cancer, described biological specimen is the biopsy sample that contains ovarian epithelial cell.
15. according to any one described test kit in the claim 10 to 13, wherein said cancer is a mammary cancer, described biological specimen is the biopsy sample that contains mammary gland cell.
16. according to any one described test kit in the claim 10 to 15, wherein said Pygopus gene is the hPygo2 gene shown in the SEQ ID NO:1.
17. according to any one described test kit in the claim 10 to 15, wherein said Pygopus gene is the hPygo1 gene shown in the SEQ ID NO:3.
18. a human Pygopus polypeptide, it lacks PHD structural domain sequence and terminal homeodomain (NHD) sequence of N-.
19. polypeptide according to claim 18, it is the hPygo-2 (SEQ ID NO:2) that lacks the 89-328 amino acids.
20. polypeptide according to claim 18, it is the hPygo-1 (SEQ ID NO:4) that lacks the 85-341 amino acids.
21. a nucleic acid, it is encoded according to any one described polypeptide in the claim 18 to 20.
22. nucleic acid according to claim 21, it comprises the 437-1156 position Nucleotide of SEQ ID NO:1.
23. nucleic acid according to claim 21, it comprises the 253-1023 position Nucleotide of SEQ ID NO:3.
24. an antibody, its with react specifically according to any one described polypeptide in the claim 18 to 20.
25. antibody according to claim 24, it is a monoclonal antibody.
26. a method that obtains to suppress the compound of tumor cell proliferation, wherein said tumor cells expression Pygopus, described method comprises:
(a) testing compound is detected, filter out and Pygopus expression of gene product bonded compound;
(b) compound that filters out in the detection step (a) is to the inhibition ability of the Wnt-effector transcriptional activation of Pygopus mediation; And randomly
(c) in ovarian epithelium cancer cells or breast cancer cell, the compound that detection filters out from step (b) is to the inhibition of proliferation ability of described cell.
27. method according to claim 26, wherein in step (a), the protein bound described testing compound of detection and screening and Pygopus.
28. method according to claim 26, wherein in step (a), detection and screening and the described testing compound of Pygopus mRNA bonded.
29., wherein in step (b), detect the inhibition ability of described testing compound to the cyclin D1 transcriptional activation of Pygopus mediation according to any one described method in the claim 26 to 28.
30. a method that obtains to suppress the antisense polynucleotide of tumor cell proliferation, wherein said tumor cells expression Pygopus, described method comprises:
(a) provide polynucleotide with a part of antisense of Pygopus gene or Pygopus gene;
(b) described polynucleotide is added in ovarian epithelium cancer cells or the breast cancer cell; And
(c) whether the polynucleotide of mensuration adding has restraining effect to the propagation of described cancer cells.
31. a method that obtains to suppress the compound of tumor cell proliferation, wherein said tumor cells expression Pygopus, described method comprises:
(a) providing with the part of Pygopus gene or Pygopus gene is the short interfering rna (siRNA) or the class siRNA molecule of target spot;
(b) described siRNA or class siRNA molecule are added in ovarian epithelium cancer cells or the breast cancer cell; And
(c) whether the siRNA of mensuration adding or class siRNA molecule have restraining effect to the propagation of described cancer cells.
32. according to any one described method in the claim 26 to 31, wherein said Pygopus gene is a Human genome.
33. method according to claim 32, wherein said Pygopus gene are hPygo2 gene (SEQ ID NO:1) or hPygo1 gene (SEQ ID NO:3).
34. according to claim 30 or 31 described methods, wherein in step (a), the part of described Pygopus gene is the Nucleotide zone, 437-1156 position of SEQ ID NO:1, perhaps the Nucleotide zone, 253-1023 position of SEQ ID NO:3.
35. a method that suppresses tumor cell proliferation, described method comprise described tumour cell is contacted with the active compound of Pygopus in this cell of reduction of breeding amount of suppression.
36. method according to claim 35, wherein said tumour cell are ovarian epithelium cancer cells or breast cancer cell.
37. according to claim 35 or 36 described methods, wherein said compound reduces the ability that Pygopus suppresses the transcriptional activation of Wnt-effector.
38. according to the described method of claim 37, wherein said Wnt-effector is a cyclin D1.
39. a method that suppresses tumor cell proliferation, described method comprise the compound of the expression of nucleic acid of the reduction coding Pygopus that adds the propagation amount of suppression in described tumour cell.
40. according to the described method of claim 39, wherein said tumour cell is ovarian epithelium cancer cells or breast cancer cell.
41. according to claim 39 or 40 described methods, wherein said compound be with the Pygopus gene antisense or with the polynucleotide of a part of antisense of Pygopus gene.
42. according to claim 39 or 40 described methods, wherein said compound is the short interfering rna (siRNA) or the class siRNA molecule of target spot for the part with Pygopus gene or Pygopus gene.
43. according to any one described method in the claim 39 to 42, wherein said Pygopus gene is a Human genome.
44. according to the described method of claim 43, wherein said Pygopus gene is hPygo2 gene (SEQ ID NO:1) or hPygo1 gene (SEQ ID NO:3).
45. according to claim 41 or 42 described methods, the part of wherein said Pygopus gene is the Nucleotide zone, 437-1156 position of SEQ ID NO:1, perhaps the Nucleotide zone, 253-1023 position of SEQ ID NO:3.
46. the Nucleotide zone, 437-1156 position with SEQ ID NO:1 among the hPygo2 (SEQ ID NO:1) is the antisense oligonucleotide of target spot, wherein said antisense oligonucleotide and the hybridization of described regiospecificity ground, and the expression of reduction hPygo2.
47. the Nucleotide zone, 253-1023 position with SEQ ID NO:3 among the hPygo1 (SEQ ID NO:3) is the antisense oligonucleotide of target spot, wherein said antisense oligonucleotide and the hybridization of described regiospecificity ground, and the expression of reduction hPygo1.
48. the Nucleotide zone, 437-1156 position with SEQ ID NO:1 among the hPygo2 (SEQ ID NO:1) is the short interfering rna (siRNA) or the class siRNA molecule of target spot, wherein said siRNA or class siRNA molecule reduce the expression of hPygo2.
49. the Nucleotide zone, 253-1023 position with SEQ ID NO:3 among the hPygo1 (SEQ ID NO:3) is the short interfering rna (siRNA) or the class siRNA molecule of target spot, wherein said siRNA or class siRNA molecule reduce the expression of hPygo1.
50. according to the described antisense oligonucleotide of claim 46, it has the sequence that is selected from SEQ IDNOS:5-14.
51. according to the described antisense oligonucleotide of claim 50, it has sequence SEQ IDNO:9.
52. according to described siRNA of claim 48 or class siRNA molecule, it has the sequence that is selected from SEQ ID NOS:15-19.
53. according to described siRNA of claim 52 or class siRNA molecule, it has sequence SEQ ID NO:15 or 18.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US46330903P | 2003-04-17 | 2003-04-17 | |
US60/463,309 | 2003-04-17 | ||
US60/496,012 | 2003-08-19 |
Publications (1)
Publication Number | Publication Date |
---|---|
CN1806055A true CN1806055A (en) | 2006-07-19 |
Family
ID=36867487
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 200480016906 Pending CN1806055A (en) | 2003-04-17 | 2004-04-16 | Pygopus in diagnosis and treatment of cancer |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1806055A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106771259A (en) * | 2017-03-06 | 2017-05-31 | 湖北工业大学 | ELISA kit, application method and purposes for detecting Pygo2 protein contents in human serum |
-
2004
- 2004-04-16 CN CN 200480016906 patent/CN1806055A/en active Pending
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106771259A (en) * | 2017-03-06 | 2017-05-31 | 湖北工业大学 | ELISA kit, application method and purposes for detecting Pygo2 protein contents in human serum |
CN106771259B (en) * | 2017-03-06 | 2019-01-29 | 湖北工业大学 | For detecting the ELISA kit, application method and purposes of Pygo2 protein content in human serum |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN100343280C (en) | CUDR as biomarker for cancer progression and therapeutic response | |
CN1674929A (en) | Use of protein kinase N beta | |
CN1898563A (en) | Method of diagnosing breast cancer | |
CN1310942C (en) | Suppressor gene | |
CN1922332A (en) | Methods for predicting and overcoming resistance to chemotherapy in ovarian cancer and for predicting colon cancer occurrence | |
CN1890382A (en) | Method for diagnosing hepatocellular carcinomas | |
CN1646917A (en) | Method of identifying transmembrane protein-interacting compounds | |
CN101065501A (en) | Method for determining genotoxicity | |
CN1571850A (en) | Methods and compositions to evaluate antibody treatment response | |
CN1977168A (en) | Compound and method for diagnosing lung cancers | |
CN1798579A (en) | Targets for tumor growth inhibition | |
CN1807623A (en) | Positive regulation gene for cell cycle and its coded protein and uses | |
CN101068935A (en) | Genes and polypeptides relating to breast cancers | |
CN1492875A (en) | TTK in diagnosis and as a therapeutic target in cancer | |
CN1705746A (en) | Factor involved in metastasis and uses thereof | |
CN1882698A (en) | Hypoxia-inducible protein 2 (HIG2), a novel therapeutic potential target of renal cell carcinoma (RCC) | |
CN101061239A (en) | Method for diagnosing non-small cell lung cancers by tRNA-dihydrouridine synthase activity of URLC8 | |
CN1688364A (en) | Use of murine genomic regions identified to be involved in tumor development for the development of anti-cancer drugs and diagnosis of cancer | |
CN1378552A (en) | Novel transcription factor BP1 | |
CN1711361A (en) | Methods to predict edema as a side effect of drug treatment | |
CN1761472A (en) | Regulation of cell surface proteins | |
CN1806055A (en) | Pygopus in diagnosis and treatment of cancer | |
CN1708589A (en) | CRH responsive genes in CNS | |
CN1295331C (en) | Oncogene, recombinant protein derived therefrom, and uses thereof | |
CN1816745A (en) | Method for diagnosing and treating cancer |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |