CN1795275A

CN1795275A - Compositions and methods for detecting certain flaviviruses, including members of the japanese encephalitis virus serogroup

Info

Publication number: CN1795275A
Application number: CNA2004800147903A
Authority: CN
Inventors: K·K·Y·杨
Original assignee: F Hoffmann La Roche AG
Current assignee: F Hoffmann La Roche AG
Priority date: 2003-03-31
Filing date: 2004-03-30
Publication date: 2006-06-28
Anticipated expiration: 2024-03-30
Also published as: CN100557027C

Abstract

The present invention provides rapid and accurate methods, primers, probes and kits for identifying the presence of a certain flaviviruses in a sample. Flaviviruses that can be detected include members of the Japanese encephalitis virus serogroup, Dengue virus, St. Louis encephalitis virus, Montana myotis leukoencephalitis virus, Modoc virus, ad Yellow Fever virus. The primers and probes of the invention can hybridize to regions in the 3' untranslated region of the viral genomes to be detected.

Description

Be used to detect the composition and the method for some flavivirus that comprises japanese encephalitis virus serogroups member

Background of invention

Flaviviridae family and Flavivirus comprise that many is the virus of potential deadly human pathogen.These viruses comprise dengue fever virus, yellow fever virus, Modoc virus, and the virus in the japanese encephalitis virus serogroups.The japanese encephalitis virus serogroups comprises some kinds of closely-related viruses, such as japanese encephalitis virus (JEV), west nile virus (WNV), Saint Louis' encephalitis virus, Murray river valley encephalitis and Kunjin virus.The reason that Kunjin virus is considered to the WNV variant usually is the conservative degree of the sequence between these two kinds of viruses.According to The sequencing results, the WNV bacterial strain that has characterized can be divided into two groups, i.e. I pedigree and II pedigree.First human WNV of the U.S. infected in 1999 and reported.From then on begin annual eruption and prevalence.In August, 2002, when 4 organ acceptor coverlet organ donors infect, confirmed that WNV can propagate by other approach except mosquito bite.This virus is found thus and can propagates with blood products (21 have confirmed case) and breast-feeding by defeated.

It is difficult that detection of active WNV infects, because its symptom is nonspecific, and special viral antibody only just can be detected after the phase in viremia usually.In addition, the WNV-specific IgM is sustainable more than 1 year, makes people be difficult to distinguish active infect and the past contacts.Therefore, need more Sensitive Detection method, such as the method for direct detection viral nucleic acid.For the early detection of WNV and other flaviviridae infections, the method that detects viral nucleic acid is sensitiveer than the serological method of using at present.

Other flavivirus that comprises japanese encephalitis virus serogroups member also is a human pathogen.These pathogenic agent comprise Japanese encephalitis serogroups member, such as japanese encephalitis virus, Saint Louis' encephalitis virus (SLEV) and Murray river valley encephalitis, and other flavivirus, such as dengue fever virus, yellow fever virus and Modoc virus.Other member in the japanese encephalitis virus serogroups except that WNV does not have record as yet by the propagation of blood products.But, this propagation is possible, and more and more might take place, because the distribution of these viruses is more extensive.Therefore, highly need to detect and above-mentionedly be flavivirus novel, sensitive of human pathogen and have specific method.In addition, also be starved of the single test method that can detect some Japanese encephalitis serogroups members.

The invention summary

The invention provides composition, method and test kit that whether the nucleic acid that is used to detect some flavivirus that comprises some japanese encephalitis virus serogroups members exists.The compositions and methods of the invention are based in part on the discovery of specific oligonucleotides, and this oligonucleotide can be used as, and for example primer and probe are used to detect japanese encephalitis virus serogroups member.For example, available oligonucleotide of the present invention detects west nile virus, Kunjin virus, japanese encephalitis virus, Saint Louis' encephalitis virus (SLEV) and Murray river valley encephalitis.Oligonucleotide of the present invention can be further used in and detect the extraneous flavivirus of japanese encephalitis virus serogroups, for example comprises dengue fever virus, Meng Taina mouse ear bat leukoencephalitis virus, Modoc virus and yellow fever virus.According to methods described herein, oligonucleotide of the present invention can be used as primer and probe, is used to detect above-mentioned flavivirus.

In some aspects, the invention provides the method for the nucleic acid that is used to detect some japanese encephalitis virus serogroups members.This method be with the detectable label oligonucleotide of the present invention that hereinafter describes in detail as probe, be used to detect some japanese encephalitis virus serogroups members' nucleic acid.This probe can with nucleic acid or its complementary sequence hybridization shown in the SEQ ID NO.:16, this is a conserved sequence region in the flavivirus nucleic acid 3 ' non-translational region, can detect according to the present invention.In certain embodiments of the invention, the template dependent form nucleic acid polymerase with 5 '-3 ' exonuclease activity can make above-mentioned probe fracture, and wherein there is Japanese encephalitis serogroups member's nucleic acid in the fracture of this detectable label probe explanation.

In certain embodiments, described method is included in the following amplification of the existence condition japanese encephalitis virus serogroups member's of detectable label nucleic acid probe nucleic acid, and detectable label nucleic acid probe wherein comprises at least 20 continuous nucleotides in sequence shown in the SEQ ID NO.:17 or its complementary sequence.In other embodiments, described method is included in the following amplification of the existence condition japanese encephalitis virus serogroups member's of detectable label oligonucleotide nucleic acid, and detectable label oligonucleotide wherein comprises sequence or its complementary sequence shown in the SEQ ID NO.:18.SEQ ID NO.:18 be can with the oligonucleotide sequence of the conserved regions of present known flavivirus nucleic acid hybridization, can detect according to the present invention.In other embodiments, described method is included in the following amplification of the existence condition japanese encephalitis virus serogroups member's of detectable label nucleic acid probe nucleic acid, and detectable label probe wherein comprises sequence or its complementary sequence shown in the SEQ ID NO.:28.SEQ IDNO.:28 is the specific probe nucleotide sequence that can be used to detect flavivirus according to the present invention.

In certain embodiments, but described probe comprises the test section.Do not add restriction, but but should the test section can be test section arbitrarily well known by persons skilled in the art.For example, but should test section can be the fluorescence part.In certain embodiments, the plain family of the optional autofluorescence of described fluorescence part dyestuff, many halogen fluorescein family dyestuff, chlordene fluorescein family dyestuff, tonka bean camphor family dyestuff, rhodamine family dyestuff, Hua Jing family dyestuff, piperazine family dyestuff, thiazine family dyestuff, squaraine family dyestuff, chelating lanthanon family's dyestuff and BODIPY  family dyestuff.In a kind of preferred embodiment, described fluorescence partly is the 6-Fluoresceincarboxylic acid.

In certain embodiments, described probe comprises the quencher part.Do not add restriction, this quencher part can be any quencher part well known by persons skilled in the art.In certain embodiments, the plain family of the optional autofluorescence of described quencher part dyestuff, many halogen fluorescein family dyestuff, chlordene fluorescein family dyestuff, tonka bean camphor family dyestuff, rhodamine family dyestuff, Hua Jing family dyestuff, piperazine family dyestuff, thiazine family dyestuff, squaraine family dyestuff, chelating lanthanon family dyestuff, BODIPY  family's dyestuff and non-fluorescence quencher part.In certain embodiments, described non-fluorescence quencher part can be BHQ ^TM-family dyestuff, IowaBlack ^TMOr Dabcyl.In a kind of preferred embodiment, described quencher partly is Cy5 ^TM

In certain aspects, available oligonucleotide of the present invention detects japanese encephalitis virus serogroups member's nucleic acid.In certain embodiments, can be used as primer, the japanese encephalitis virus serogroups member's that is used to increase nucleic acid with first kind of oligonucleotide of nucleic acid hybridization shown in the SEQ ID NO.:1.SEQ ID NO.:1 is based on the discovery of particular sequence, and this sequence is japanese encephalitis virus serogroups member's a conserved sequence, can detect according to the present invention.In certain embodiments, described first kind of primer comprises at least 16 continuous nucleotides in the sequence shown in the SEQ ID NO.:2.In other embodiments, described first kind of primer comprises sequence shown in the SEQ ID NO.:3.SEQ ID NO.:3 is the primer sequence that is found to be the basis with specific conserved regions, and this conserved regions is present all known conserved regions that derive from japanese encephalitis virus serogroups member's sequence, can detect according to the present invention.In other embodiments, described first kind of primer comprises sequence shown in the SEQ ID NO.:8.SEQ ID NO.:8 is can be used to according to the present invention the to increase specific primer sequence of Japanese encephalitis serogroups member nucleic acid.

In certain embodiments, can be used as primer, the japanese encephalitis virus serogroups member's that is used to increase nucleic acid with second kind of oligonucleotide of nucleic acid hybridization shown in the SEQ ID NO.:9.SEQID NO.:9 is the consensus sequence that is found to be the basis with particular sequence, and this particular sequence is japanese encephalitis virus serogroups member's a conserved sequence, can detect according to the present invention.In certain embodiments, described second kind of primer comprises at least 16 continuous nucleotides in the sequence shown in the SEQ ID NO.:10.SEQ ID NO.:10 is the complementary sequence of SEQ ID NO.:9.In other embodiments, described second kind of primer comprises sequence shown in the SEQ ID NO.:11.SEQID NO.:11 is the primer sequence that is found to be the basis with specific conserved regions, this specific conserved regions be at present all known sequences that derive from japanese encephalitis virus serogroups member conserved regions, can detect according to the present invention.In other embodiments, described second kind of primer comprises sequence shown in SEQ IDNO.:15 or the SEQ ID NO:74.SEQ ID NO.:15 and SEQ ID NO:74 are can be used to according to the present invention the to increase specific primer sequences of japanese encephalitis virus serogroups member nucleic acid.In certain embodiments, described first and second kinds of primers can be applied in the method that detects Japanese encephalitis serogroups member nucleic acid together.

In certain embodiments, described method is included in the following amplification of the existence condition japanese encephalitis virus serogroups member's of specific detectable label nucleic acid probe nucleic acid, and this detectable label probe comprises fluorescence part and quencher part.In certain embodiments, the template dependent form nucleic acid polymerase with 5 '-3 ' nuclease makes described detectable label probe fracture, thereby the fluorescence part is partly separated with quencher.In certain embodiments, can detect the fracture and and then the existence of definite japanese encephalitis virus serogroups member nucleic acid of described probe by the emission of monitoring fluorescence.

In certain embodiments, nucleic acid that can be by making Japanese encephalitis serogroups member and covalency are connected primer of the present invention or the probe hybridization on the solid support, to detect this nucleic acid.In certain embodiments, can be by making above-mentioned nucleic acid and detectable label primer or probe hybridization, to detect this nucleic acid.In other embodiments, but can be by the test section be mixed in the above-mentioned nucleic acid, with this nucleic acid of direct detection.

In other embodiments, can utilize the covalently bound nucleic acid that the millimicro detection of particles Japanese encephalitis serogroups member of 2 or a plurality of primer of the present invention or probe is arranged.In other embodiments, can detect Japanese encephalitis serogroups member's nucleic acid by the rolling circle amplification test that utilizes primer of the present invention and/or probe to carry out.In other embodiments, then can detect Japanese encephalitis serogroups member's nucleic acid by the strand displacement amplification test that utilizes two kinds of primers of the present invention to carry out.In other embodiments, can detect Japanese encephalitis serogroups member's nucleic acid by the transcriptive intermediate amplification test that utilizes primer of the present invention and/or probe to carry out.In another embodiment, can detect Japanese encephalitis serogroups member's nucleic acid by the amplification based on nucleotide sequence (NASBA) test that utilizes primer of the present invention and/or probe to carry out.In another embodiment, then can detect Japanese encephalitis serogroups member's nucleic acid by the diagnosis PCR that utilizes primer of the present invention and/or probe to carry out.

In certain embodiments, first kind and second kind of primer of the present invention and probe can be applied in the method that detects Japanese encephalitis serogroups member together.In certain embodiments, can utilize the probe in detecting Japanese encephalitis serogroups member's of the present invention who comprises molecular beacon nucleic acid.In other embodiments, can test the nucleic acid that detects Japanese encephalitis serogroups member by the amplification that utilizes primer of the present invention and/or probe to carry out based on nucleotide sequence.In other embodiments, then can be by utilizing two kinds of primer amplification Japanese encephalitis serogroups members' of the present invention nucleic acid, and then with this nucleic acid of detectable label probe in detecting of the present invention, to detect this nucleic acid.In certain embodiments, can detect Japanese encephalitis serogroups member's nucleic acid by the Dot blot test that utilizes primer of the present invention and/or probe to carry out.In other embodiments, can detect Japanese encephalitis serogroups member's nucleic acid by the reverse Dot blot test that utilizes primer of the present invention and/or probe to carry out.In other embodiments, then can utilize nucleic acid such as the multivalence probe in detecting Japanese encephalitis serogroups member of dendron shaped polymer.

Except aforesaid method, the nucleic acid primer and the probe that are used to detect Japanese encephalitis serogroups member nucleic acid have been the present invention further provides.In certain aspects, the invention provides the nucleic acid primer that is used to detect japanese encephalitis virus serogroups member.In certain embodiments, described primer comprise can with the nucleic acid of nucleic acid hybridization shown in the SEQ ID NO.:1.In certain embodiments, described nucleic acid primer comprises at least 16 continuous nucleotides in the sequence shown in the SEQ ID NO.:2.In other embodiments, described nucleic acid primer comprises sequence shown in the SEQ ID NO.:3.In other embodiments, described nucleic acid primer then comprises sequence shown in the SEQ ID NO.:8.

In certain embodiments, described nucleic acid primer comprises the N of No. 23 positions of sequence shown in the SEQ ID NO.:8 ⁶-alkyl-Desoxyadenosine.In a kind of particular, described nucleic acid primer comprises the N of No. 23 positions of sequence shown in the SEQ ID NO.:8 ⁶-methyl-Desoxyadenosine.In certain embodiments, described nucleic acid primer comprises the N of sequence 24 position shown in the SEQ ID NO.:8 ⁶-alkyl-Desoxyadenosine.In a kind of particular, described nucleic acid primer comprises the N of sequence 24 position shown in the SEQ IDNO.:8 ⁶-the tertiary butyl-benzyl-Desoxyadenosine.In certain embodiments, described nucleic acid primer comprises the N of sequence 23 shown in the SEQ ID NO.:8 and No. 24 positions ⁶-alkyl-Desoxyadenosine.In another kind of particular, described nucleic acid primer comprises the N of No. 23 positions of sequence shown in the SEQ IDNO.:8 ⁶The N of sequence 24 position shown in-methyl-Desoxyadenosine and the SEQ ID NO.:8 ⁶-the tertiary butyl-benzyl-Desoxyadenosine.

In certain embodiments, the invention provides the nucleic acid primer that is used to detect japanese encephalitis virus serogroups member.In certain embodiments, described primer comprise can with the nucleic acid of nucleic acid hybridization shown in the SEQ ID NO.:9.In other embodiments, described nucleic acid primer comprises at least 16 continuous nucleotides in the sequence shown in the SEQ IDNO.:10.In other embodiments, described nucleic acid primer comprises sequence shown in the SEQ ID NO.:11.In other embodiments, described nucleic acid primer then comprises sequence shown in SEQ ID NO.:15 or the SEQ ID NO.:74.In certain embodiments, described nucleic acid primer comprises shown in SEQ ID NO.:15 or the SEQ ID NO.:74 N of No. 24 positions in the sequence ⁶-alkyl-Desoxyadenosine.In a kind of particular, described nucleic acid primer comprises shown in SEQ ID NO.:15 or the SEQ ID NO.:74 N of No. 24 positions in the sequence ⁶-the tertiary butyl-benzyl-Desoxyadenosine.

In aspect other, the invention provides the nucleic acid probe that is used to detect flavivirus nucleic acid.The flavivirus nucleic acid of available this probe in detecting comprises, for example, and japanese encephalitis virus serogroups member, dengue fever virus, yellow fever virus, Meng Taina mouse ear bat leukoencephalitis virus and Modoc virus.In certain embodiments, described probe comprise can with the nucleic acid of nucleic acid shown in the SEQ ID NO.:16 or its complementary sequence hybridization.In certain embodiments, described nucleic acid probe comprises the continuous nucleotide of 2O at least in sequence shown in the SEQ IDNO.:17 or its complementary sequence.In other embodiments, described nucleic acid probe comprises sequence or its complementary sequence shown in the SEQ ID NO.:18.In other embodiments, described nucleic acid probe then comprises sequence or its complementary sequence shown in the SEQ ID NO.:28.

In certain embodiments, the invention provides the nucleic acid probe that comprises fluorescence part and quencher part.In certain embodiments, when described probe was complete, described fluorescence part was partially absorbed by quencher with the photon that quencher relative positioning partly can make this fluorescence partly launch.Enzyme with 5 ' nuclease can make its fluorescence part partly separate with quencher to the fracture of this probe, thereby the photon that fluorescence is partly launched can be detected.

In aspect other, the invention provides the test kit of the nucleic acid that is used to detect japanese encephalitis virus serogroups member.In certain embodiments, described test kit comprises oligonucleotide of the present invention.In further embodiment, described test kit comprises the combination of one or more primers of the present invention and probe.For example, in one embodiment, described test kit comprise can with first kind of nucleic acid primer of nucleic acid hybridization shown in the SEQID NO.:1; Can with second kind of nucleic acid primer of nucleic acid hybridization shown in the SEQ ID NO.:9; And can with the nucleic acid probe of nucleic acid shown in the SEQ ID NO.:16 or its complementary sequence hybridization.

In certain embodiments, first of test kit of the present invention kind of nucleic acid primer comprises at least 16 continuous nucleotides in the sequence shown in the SEQ IDNO.:2.In other embodiments, described first kind of nucleic acid primer comprises sequence shown in the SEQ ID NO.:3.In other embodiments, described first kind of nucleic acid primer comprises sequence shown in the SEQ ID NO.:8.In certain embodiments, described first kind of nucleic acid primer comprises the N of No. 23 positions of sequence shown in the SEQ ID NO.:8 ⁶-alkyl-Desoxyadenosine.In a kind of particular, described first kind of nucleic acid primer comprises the N of No. 23 positions of sequence shown in the SEQ ID NO.:8 ⁶-methyl-Desoxyadenosine.In certain embodiments, described first kind of nucleic acid primer comprises the N of sequence 24 position shown in the SEQ ID NO.:8 ⁶-alkyl-Desoxyadenosine.In a kind of particular, described first kind of nucleic acid primer comprises the N of sequence 24 position shown in the SEQ ID NO.:8 ⁶-the tertiary butyl-benzyl-Desoxyadenosine.In certain embodiments, described first kind of nucleic acid primer comprises the N of sequence 23 shown in the SEQ ID NO.:8 and No. 24 positions ⁶-alkyl-Desoxyadenosine.In another kind of particular, described first kind of nucleic acid primer comprises the N of No. 23 positions of sequence shown in the SEQ ID NO.:8 ⁶The N of sequence 24 position shown in-methyl-Desoxyadenosine and the SEQ ID NO.:8 ⁶-the tertiary butyl-benzyl-Desoxyadenosine.

In certain embodiments, second of test kit of the present invention kind of nucleic acid primer comprises at least 16 continuous nucleotides in the sequence shown in the SEQ IDNO.:10.In other embodiments, described second kind of nucleic acid primer comprises sequence shown in the SEQ ID NO.:11.In other embodiments, described second kind of nucleic acid primer comprises sequence shown in the SEQ ID NO.:15.In certain embodiments, described second kind of nucleic acid primer comprises the N of sequence 24 position shown in the SEQ ID NO.:15 ⁶-alkyl-Desoxyadenosine.In a kind of particular, described second kind of nucleic acid primer comprises the N of sequence 24 position shown in the SEQ ID NO.:15 ⁶-the tertiary butyl-benzyl-Desoxyadenosine.

In certain embodiments, the nucleic acid probe of test kit of the present invention comprises at least 20 continuous nucleotides in sequence shown in the SEQ ID NO.:17 or its complementary sequence.In other embodiments, described nucleic acid probe comprises sequence or its complementary sequence shown in the SEQ ID NO.:18.In other embodiments, described nucleic acid probe then comprises sequence or its complementary sequence shown in the SEQ ID NO.:28.

In certain embodiments, test kit of the present invention comprises the oligonucleotide that can be used as the nucleic acid probe application, but wherein this nucleic acid probe is connected with one or more test sections.In certain embodiments, but described one or more test section is the fluorescence part.In certain embodiments, the plain family of the optional autofluorescence of described fluorescence part dyestuff, many halogen fluorescein family dyestuff, chlordene fluorescein family dyestuff, tonka bean camphor family dyestuff, rhodamine family dyestuff, Hua Jing family dyestuff, piperazine family dyestuff, thiazine family dyestuff, squaraine family dyestuff, chelating lanthanon family's dyestuff and BODIPY  family dyestuff.In a kind of preferred embodiment, described fluorescence partly is the 6-Fluoresceincarboxylic acid.

In certain embodiments, test kit of the present invention comprises the oligonucleotide that can be used as the nucleic acid probe application, and wherein this nucleic acid probe is connected with at least one quencher part.In certain embodiments, the plain family of the optional autofluorescence of described quencher dyestuff, many halogen fluorescein family dyestuff, chlordene fluorescein family dyestuff, tonka bean camphor family dyestuff, rhodamine family dyestuff, Hua Jing family dyestuff, piperazine family dyestuff, thiazine family dyestuff, squaraine family dyestuff, chelating lanthanon family dyestuff, BODIPY  family's dyestuff and non-fluorescence quencher part.In certain embodiments, described non-fluorescence quencher part can be BHQ ^TM-family dyestuff, Iowa Black ^TMOr Dabcyl.In a kind of preferred embodiment, described quencher partly is Cy5 ^TMIn other embodiments, but described probe comprises at least one test section, for example fluorescence part and at least one quencher part.

In certain embodiments, test kit of the present invention comprises heat-stable DNA polymerase.In certain embodiments, described heat-stable DNA polymerase has the reverse transcription activity.In certain embodiments, test kit of the present invention also comprises and detects the relevant specification sheets of japanese encephalitis virus serogroups family member's nucleic acid according to the inventive method.

The present invention also provides isolating polynucleotide, comprises SEQ ID NO:29, SEQ IDNO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQID NO:39 or SEQ ID NO:40.

The present invention also provides the carrier that contains specific polynucleotide, and these polynucleotide comprise SEQ IDNO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQID NO:38, SEQ ID NO:39 or SEQ ID NO:40.

The present invention also provides the oligonucleotide that contains particular sequence, this sequence contains at least 10 adjacent nucleotides, can with SEQ ID NO:29 or its complementary sequence, SEQ ID NO:30 or its complementary sequence, SEQ ID NO:31 or its complementary sequence, SEQ ID NO:32 or its complementary sequence, SEQ ID NO:33 or its complementary sequence, SEQ ID NO:34 or its complementary sequence, SEQID NO:35 or its complementary sequence, SEQ ID NO:36 or its complementary sequence, SEQ ID NO:37 or its complementary sequence, SEQ ID NO:38 or its complementary sequence, SEQ ID NO:39 or its complementary sequence, SEQ ID NO:40 or its complementary sequence hybridization.In certain embodiments, described oligonucleotide and SEQ ID NO:68 hybridization, or with the complementary sequence hybridization of SEQ ID NO:69.In certain embodiments, described oligonucleotide comprises the sequence that is selected from SEQ ID NO:64, SEQ IDNO:65, SEQ ID NO:66 and SEQ ID NO:67.In certain embodiments, described oligonucleotide is selected from SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66 and SEQ ID NO:67.In certain embodiments, described oligonucleotide has and is less than 100 Nucleotide.

The present invention also provides the reaction mixture that contains specific oligonucleotides, this oligonucleotide comprise can with SEQ ID NO:29 or its complementary sequence, SEQ ID NO:30 or its complementary sequence, SEQID NO:31 or its complementary sequence, SEQ ID NO:32 or its complementary sequence, SEQ ID NO:33 or its complementary sequence, SEQ ID NO:34 or its complementary sequence, SEQ ID NO:35 or its complementary sequence, SEQ ID NO:36 or its complementary sequence, SEQ ID NO:37 or its complementary sequence, SEQ ID NO:38 or its complementary sequence, SEQ ID NO:39 or its complementary sequence, the nucleotide sequence of SEQ ID NO:40 or its complementary sequence hybridization.

In certain embodiments, described oligonucleotide and SEQ ID NO:68 hybridization, or with the complementary sequence hybridization of SEQ ID NO:69.In certain embodiments, described oligonucleotide comprises the sequence that is selected from SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66 and SEQ ID NO:67.In certain embodiments, described oligonucleotide is selected from SEQ ID NO:64, SEQ IDNO:65, SEQ ID NO:66 and SEQ ID NO:67.

In certain embodiments, described reaction mixture comprises the oligonucleotide that is selected from SEQ ID NO:64 and SEQID NO:65; With the oligonucleotide that is selected from SEQ ID NO:66 and SEQ ID NO:67.In certain embodiments, described oligonucleotide has and is less than 100 Nucleotide.In certain embodiments, described reaction mixture further comprise can with the detectable label oligonucleotide of SEQ ID NO:16 or its complementary sequence hybridization.

In certain embodiments, described reaction mixture comprises archaeal dna polymerase.

In certain embodiments, described detectable label oligonucleotide comprises at least 20 continuous nucleotides in sequence shown in the SEQ ID NO.:17 or its complementary sequence.In certain embodiments, described detectable label oligonucleotide comprises sequence or its complementary sequence shown in the SEQ ID NO.:28.In certain embodiments, described detectable label oligonucleotide comprises the fluorescence part.In certain embodiments, described detectable label oligonucleotide further comprises the quencher part.

The present invention also provides the method that detects Saint Louis' encephalitis virus.In certain embodiments, described method comprises under given conditions, with at least a comprise can with SEQ ID NO:29 or its complementary sequence, SEQ ID NO:30 or its complementary sequence, SEQ ID NO:31 or its complementary sequence, SEQ ID NO:32 or its complementary sequence, SEQ ID NO:33 or its complementary sequence, SEQ ID NO:34 or its complementary sequence, SEQ ID NO:35 or its complementary sequence, SEQ ID NO:36 or its complementary sequence, SEQ ID NO:37 or its complementary sequence, SEQ ID NO:38 or its complementary sequence, the nucleic acid of the oligonucleotide of the nucleotide sequence of SEQ ID NO:39 or its complementary sequence or SEQ ID NO:40 or its complementary sequence hybridization amplification Saint Louis' encephalitis virus, described specified conditions promptly allow from this oligonucleotide begin to increase at least a portion of above-mentioned nucleotide sequence; And the detection amplification of nucleic acid, to detect Saint Louis' encephalitis virus.

In certain embodiments, described oligonucleotide comprises the sequence that is selected from SEQ ID NO:64, SEQ IDNO:65, SEQ ID NO:66 and SEQ ID NO:67.In certain embodiments, described oligonucleotide is selected from SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66 and SEQ ID NO:67.In certain embodiments, described oligonucleotide and SEQ ID NO:68 hybridization, or with the complementary sequence hybridization of SEQ ID NO:69.In certain embodiments, described oligonucleotide has and is less than 100 Nucleotide.

In certain embodiments, the nucleic acid of Saint Louis' encephalitis virus is with being selected from the primer of SEQ IDNO:64 and SEQ ID NO:65, and the primer amplification that is selected from SEQ ID NO:66 and SEQ ID NO:67.

In certain embodiments, described detection step comprises and makes and can hybridize with the amplification of nucleic acid of Saint Louis' encephalitis virus nucleic acid with the detectable label oligonucleotide of SEQ ID NO:16 hybridization; And detect the hybridization of this probe and amplification of nucleic acid.

In certain embodiments, the detectable label oligonucleotide comprises at least 20 continuous nucleotides in sequence shown in the SEQ ID NO.:17 or its complementary sequence.In certain embodiments, the detectable label oligonucleotide comprises sequence or its complementary sequence shown in the SEQ ID NO.:28.In certain embodiments, the detectable label oligonucleotide comprises the fluorescence part.In certain embodiments, the detectable label oligonucleotide further comprises the quencher part.

In certain embodiments, the amount of amplification of nucleic acid is at the amplification period detecting, thus the just quantitative virus in the sample.

In certain embodiments, amplification step is under given conditions, carry out in the amplification reaction mixture that comprises the template dependent form nucleic acid polymerase with 5 '-3 ' exonuclease activity, described specified conditions promptly allow the condition of the described detectable label oligonucleotide of this template dependent form nucleic acid polymerization enzymatic breaking; This method further comprises the fracture that detects described detectable label nucleic acid oligonucleotides.

The present invention also provides the test kit that is used to detect Saint Louis' encephalitis virus.In certain embodiments, described test kit comprises the oligonucleotide that contains specific nucleotide sequence, this specific nucleotide sequence can with SEQ ID NO:29 or its complementary sequence, SEQ ID NO:30 or its complementary sequence, SEQ ID NO:31 or its complementary sequence, SEQ ID NO:32 or its complementary sequence, SEQ ID NO:33 or its complementary sequence, SEQ ID NO:34 or its complementary sequence, SEQ ID NO:35 or its complementary sequence, SEQ ID NO:36 or its complementary sequence, SEQ ID NO:37 or its complementary sequence, SEQ ID NO:38 or its complementary sequence, SEQ ID NO:39 or its complementary sequence, or SEQ ID NO:40 or its complementary sequence hybridization.

In certain embodiments, described oligonucleotide and SEQ ID NO:68 hybridization, or with the complementary sequence hybridization of SEQID NO:69.In certain embodiments, described oligonucleotide comprises the sequence that is selected from SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66 and SEQ ID NO:67.In certain embodiments, described oligonucleotide is selected from SEQ ID NO:64, SEQ IDNO:65, SEQ ID NO:66 and SEQ ID NO:67.

In certain embodiments, described test kit comprises the oligonucleotide that is selected from SEQ ID NO:64 and SEQ IDNO:65, and the oligonucleotide that is selected from SEQ ID NO:66 and SEQ ID NO:67.In certain embodiments, described oligonucleotide has and is less than 100 Nucleotide.In certain embodiments, described test kit further comprise can with the detectable label oligonucleotide of sequence shown in the SEQ ID NO:16 or its complementary sequence hybridization.

The present invention also provides the oligonucleotide that contains the sequence that is selected from SEQ ID NO:56, SEQ ID NO:57, SEQ IDNO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ IDNO:62 and SEQ ID NO:63.In certain embodiments, described oligonucleotide is selected from SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62 and SEQ ID NO:63.

The present invention also provides the reaction mixture that contains specific oligonucleotides, and this oligonucleotide comprises the sequence that is selected from SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62 and SEQ ID NO:63.In certain embodiments, described oligonucleotide is selected from SEQ ID NO:56, SEQID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQID NO:61, SEQ ID NO:62 and SEQ ID NO:63.

In certain embodiments, described reaction mixture further comprise can with the detectable label oligonucleotide of SEQ ID NO:25 or its complementary sequence hybridization.In certain embodiments, described reaction mixture further comprises the detectable label oligonucleotide with FGGTCTAGAIGGTTAGAGGAGACCCTCCAG sequence, and wherein F is that CY5, I are that FAM, P are that PO4, U are that proyl dU, E are 5-methyl-dC.In certain embodiments, described reaction mixture further comprise can with the detectable label oligonucleotide of SEQ ID NO:16 or its complementary sequence hybridization.

In certain embodiments, described reaction mixture comprises archaeal dna polymerase.In certain embodiments, described reaction mixture comprises at least a upstream primer and at least a downstream primer.

The present invention also provides the method that detects yellow fever virus.In certain embodiments, described method comprises under given conditions, with the nucleic acid of at least a oligonucleotide amplification yellow fever virus that contains the sequence that is selected from SEQ ID NO:56, SEQ IDNO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ IDNO:61, SEQ ID NO:62 and SEQ ID NO:63, described specified conditions promptly allow from this oligonucleotide begin to increase at least a portion of above-mentioned nucleotide sequence; And the detection amplification of nucleic acid, to detect yellow fever virus.

In certain embodiments, described oligonucleotide is selected from SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:6O, SEQ ID NO:61, SEQ ID NO:62 and SEQ ID NO:63.In certain embodiments, detecting step comprises and makes and can hybridize with the amplification of nucleic acid of yellow fever virus nucleic acid with the detectable label oligonucleotide of sequence shown in the SEQ ID NO:25 or its complementary sequence hybridization; And detect the hybridization of this detectable label oligonucleotide and amplification of nucleic acid.

In certain embodiments, described detectable label oligonucleotide comprises FGGTCTAGAIGGTTAG AGGAGACCCTCCAG, and wherein F is that CY5, I are that FAM, P are that PO4, U are that proyl dU, E are 5-methyl-dC.In certain embodiments, detecting step comprises and makes and can hybridize with the amplification of nucleic acid of yellow fever virus nucleic acid with the detectable label oligonucleotide of SEQ ID NO:16 or its complementary sequence hybridization; And detect the hybridization of this detectable label oligonucleotide and amplification of nucleic acid.

In certain embodiments, described oligonucleotide has and is less than 100 Nucleotide.In certain embodiments, the amount of amplification of nucleic acid is at the amplification period detecting, thus the just quantitative virus in the sample.

In certain embodiments, amplification step is under given conditions, carry out in the amplification reaction mixture that comprises the template dependent form nucleic acid polymerase with 5 '-3 ' exonuclease activity, described specified conditions promptly allow the above-mentioned detectable label oligonucleotide of this template dependent form nucleic acid polymerization enzymatic breaking; This method further comprises the fracture that detects this detectable label oligonucleotide.

The present invention also provides the test kit that is used to detect yellow fever virus.This test kit comprises the oligonucleotide that contains the sequence that is selected from SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62 and SEQ ID NO:63.In certain embodiments, this oligonucleotide is selected from SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62 and SEQ ID NO:63.

In certain embodiments, described test kit further comprise can with the detectable label oligonucleotide of SEQ ID NO:16 or its complementary sequence hybridization.In certain embodiments, described test kit further comprise can with the detectable label oligonucleotide of SEQ ID NO:25 or its complementary sequence hybridization.In certain embodiments, described test kit further comprises the detectable label oligonucleotide with FGGTCTAGAIGGTTAGAGGAGACCCTCCAG, and wherein F is that CY5, I are that FAM, P are that PO4, U are that proyl dU, E are 5-methyl-dC.

The present invention also provides the oligonucleotide that contains the sequence that is selected from SEQ ID NO:41, SEQ ID NO:42, SEQ IDNO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ IDNO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55.In certain embodiments, described oligonucleotide is selected from SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQID NO:54 and SEQ ID NO:55.

The present invention also provides the reaction mixture that comprises specific oligonucleotides, and this oligonucleotide contains the sequence that is selected from SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQID NO:53, SEQ ID NO:54 and SEQ ID NO:55.In certain embodiments, described oligonucleotide is selected from SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55.

In certain embodiments, described reaction mixture further comprise can with the detectable label oligonucleotide of SEQ ID NO:16 or its complementary sequence hybridization.In certain embodiments, described reaction mixture comprises archaeal dna polymerase.In certain embodiments, described reaction mixture comprises at least a upstream primer and at least a downstream primer.

The present invention also provides the method that detects dengue fever virus.In certain embodiments, described method comprises under given conditions, be selected from SEQ ID NO:41 with at least a containing, SEQ IDNO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ IDNO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, the nucleic acid of the oligonucleotide of the sequence of SEQ ID NO:54 and SEQID NO:55 amplification dengue fever virus, described specified conditions promptly allow from this oligonucleotide begin to increase at least a portion of above-mentioned nucleotide sequence; And the detection amplification of nucleic acid, to detect dengue fever virus.

In certain embodiments, described method further comprise make can with the detectable label oligonucleotide of SEQ ID NO:16 hybridization and the dengue fever virus nucleic acid hybridization of amplification; And detect the hybridization of this oligonucleotide and amplification of nucleic acid.In certain embodiments, described oligonucleotide is selected from SEQID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ IDNO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55.

In certain embodiments, described nucleic acid increases with at least a upstream primer and at least a downstream primer.In certain embodiments, described detectable label oligonucleotide comprises at least 20 continuous nucleotides in sequence shown in the SEQID NO.:17 or its complementary sequence.In certain embodiments, described detectable label oligonucleotide comprises sequence or its complementary sequence shown in the SEQ ID NO.:18.In certain embodiments, described detectable label oligonucleotide comprises the fluorescence part.In certain embodiments, described detectable label oligonucleotide further comprises the quencher part.

In certain embodiments, described oligonucleotide has and is less than 100 Nucleotide.In certain embodiments, the amount of amplification of nucleic acid is at the amplification period detecting, thus the just quantitative virus in the sample.In certain embodiments, amplification step is under given conditions, carry out in the amplification reaction mixture that comprises the template dependent form nucleic acid polymerase with 5 '-3 ' exonuclease activity, described specified conditions promptly allow the above-mentioned detectable label oligonucleotide of this template dependent form nucleic acid polymerization enzymatic breaking; This method further comprises the fracture that detects this detectable label nucleic acid oligonucleotides.

The present invention also provides the test kit that is used to detect dengue fever virus.In certain embodiments, described test kit comprises the oligonucleotide that contains the sequence that is selected from SEQ ID NO:41, SEQ ID NO:42, SEQID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ IDNO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55.In certain embodiments, described oligonucleotide is selected from SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQID NO:54 and SEQ ID NO:55.

In certain embodiments, described test kit further comprise can with the detectable label oligonucleotide of sequence shown in the SEQ ID NO:16 or its complementary sequence hybridization.In certain embodiments, described reaction mixture comprises archaeal dna polymerase.

In certain embodiments, quantitatively step utilizes inside or external control nucleic acid to carry out.Referring to by the complete United States Patent(USP) Nos. that is incorporated herein by reference 5,476,774 and 5,219,727.

The accompanying drawing summary

Figure 1 shows that a conserved sequence region in the flavivirus genome 3 ' non-translational region, be confirmed as SEQ ID NO.:1, can utilize the compositions and methods of the invention to detect, and can combine with primer of the present invention.SEQ ID NO.:2 represents the complementary sequence of SEQ ID NO.:1.

Figure 2 shows that a conserved sequence region in the flavivirus genome 3 ' non-translational region, be confirmed as SEQ ID NO.:9, can utilize the compositions and methods of the invention to detect, and can combine with primer of the present invention.SEQ ID NO.:10 represents the complementary sequence of SEQ ID NO.:9.

Figure 3 shows that a conserved sequence region in the flavivirus genome 3 ' non-translational region, be confirmed as SEQ ID NO.:16, can utilize the compositions and methods of the invention to detect, and can combine with probe of the present invention.SEQ ID NO.:17 represents the complementary sequence of SEQ ID NO.:16.In SEQ ID NO:16, N is disappearance, A or C.In SEQ ID NO:17, N is disappearance, T or G.

Figure 4 shows that the contrast of the nucleotide sequence of oligonucleotide of the present invention and japanese encephalitis virus serogroups member's nucleotide sequence.

Figure 5 shows that the contrast of nucleotide sequence of the nucleotide sequence of oligonucleotide of the present invention and non-japanese encephalitis virus serogroups member's detected flavivirus.

Figure 6 shows that the graph of a relation of normalization method fluorescence and amplification cycles number, shown and utilized the detected result of oligonucleotide of the present invention the extraction WNV RNA of serial dilution.

Figure 7 shows that 3 ' non-translational region sequence in the genome of many SLEV isolates, available the compositions and methods of the invention detect, and can combine with primer of the present invention.The sequence of listed isolate is as follows: BFS1750 (SEQ ID NO:29), 1750-Std (SEQ ID NO:30), TD6-4G (SEQ ID NO:31), CoaV750 (SEQ ID NO:32), L695121.05 (SEQID NO:33), TNM771K (SEQ ID NO:34), MSI-7 (SEQ ID NO:35), Kern217 (SEQ ID NO:36), CoaV608 (SEQ ID NO:37), TBH-28 (SEQ ID NO:38), VR1265 (SEQ ID NO:39) and CoaV353 (SEQ ID NO:40).

Detailed Description Of The Invention

1. abbreviation

In the content in the whole text of this specification, the abbreviation that is used to refer to contain the nucleic acid of specific nucleotide sequence is conventional single-letter abbreviation. Therefore, in the time of in being included in nucleic acid, the abbreviation of naturally occurring coding nucleotide is as follows: adenine (A), guanine (G), cytimidine (C), thymidine (T) and uracil (U). Equally, as without indicating in addition, be represented as the nucleotide sequence of one group of single-letter abbreviation with 5 '-〉 3 ' direction indication.

2. definition

" amplified reaction " refers to that any copy that causes template nucleic acid sequence increases or makes the reaction that shows the signal that there is this template and strengthen (for example reaction of chemical, enzymatic or other type). Amplified reaction for example comprises, and polymerase chain reaction (PCR) and ligase chain reaction (LCR) (referring to United States Patent (USP) 4,683,195 and 4,683,202; PCR Protocols:A Guide to Methods and Applications (Innis et al., eds, 1990)), strand displacement amplification (SDA) (Walker, et al.Nucleic Acids Res.20 (7): 1691-6 (1992); 1-6 (1993)), amplification (Phyffer, et al., the J.Clin.Microbiol.34:834-841 (1996) of transcriptive intermediate Walker PCR Methods Appl 3 (1):; Vuorinen, et al., J.Clin.Microbiol.33:1856-1859 (1995)), take amplification (the NASBA) (Compton of nucleotide sequence as the basis, Nature 350 (6313): 91-2 (1991)), rolling circle amplification (RCA) (Lisby, Mol.Biotechnol. 12 (1): 75-99 (1999)); Hatch et al., Genet.Anal.15 (2): 35-40 (1999)), branched DNA signal amplification (bDNA) (Iqbal et al., 315-320 (1999)) and Q-β replicase (Lizardi et al., Bio/Technology 6:1197 (1988)) Mol.Cell Probes 13 (4):.

" sample " used herein refers to any material that contains or contained nucleic acid by supposition. This sample can be natural or synthetic source, and can obtain by any method known to those skilled in the art. This sample can be from one or more individual tissue or fluid samples that obtain that separate, include but not limited to, for example skin, blood plasma, serum, whole blood, spinal fluid, sperm, seminal fluid, lymph liquid, synovia, urine, tear, haemocyte, organ, tumour, BAL fluid, also can be the cell in vitro sample of cultivating component (include but not limited to by cell in cell culture medium, grow and the conditioned medium, recombinant cell and the cell that obtain form). Nucleic acid can obtain from biological sample by any means known in the art.

Term used herein " nucleic acid ", " polynucleotides " and " oligonucleotides " guide thing, probe, oligomer fragment to be checked, oligomer tester and unlabelled sealing oligomer, be often referred to the line style polymer of polydeoxyribonucleotide (containing DRI), polyribonucleotide (containing D-ribose), and purine or pyrimidine bases, or the purine of modifying or other any N-glucosides of pyrimidine bases.

Nucleic acid, polynucleotides or oligonucleotides can contain phosphodiester bond or the key through modifying, comprise, but be not limited to tricresyl phosphate ester bond, phosphoramidic acid ester bond, siloxane bond, carbonic acid ester bond, carboxymethyl ester bond, acetamide ester bond, amino-formate bond, thioether bond, bridging phosphoramidic acid ester bond, bridging methylene phosphoric acid ester bond, phosphorothioate bond, methyl acid phosphate ester bond, phosphordithiic acid ester bond, bridging phosphorothioate bond or sulfone key, and the combination of these keys.

Nucleic acid, polynucleotides or oligonucleotides can comprise 5 in base (adenine, guanine, thymidine, cytimidine and uracil) and/or other base except these 5 bases of biologically existing. These bases may serve many purposes, and for example, make hybrid stability or unstable; Promote or the degraded of inhibition probe; But the tie point that perhaps serves as connection test section or quencher part. For example, polynucleotides of the present invention can contain base portion one or more modifications, non-standard or that derive, include but not limited to N⁶-methyl-adenine, N⁶-the tert-butyl group-benzyl-adenine, imidazoles, substituted imidazole, 5 FU 5 fluorouracil, 5-bromouracil, the 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, the 4-acetylcytosine, 5-(carboxyl hydroxymethyl) uracil, 5-carboxymethyl aminomethyl-2-thiouridine, 5-carboxymethyl aminomethyl uracil, dihydrouracil, β-D-galactosylqueosine, inosine, the N6-isopentenyl gland purine, the 1-methyl guanine, M1I, the 2-dimethylguanine, the 2-methyl adenine, the 2-methyl guanine, the 3-methylcystein, 5-methylcytosine, the N6-methyl adenine, the 7-methyl guanine, 5-methyl aminomethyl uracil, 5-methoxyl group aminomethyl-2-thiouracil, β-D mannosylqueosine, 5 '-the methoxyl group carboxymethyl uracil, the 5-methoxyuracil, 2-methyl mercapto-N6-isopentenyl gland purine, uracil-5-glycolic (v), wybutoxosine, pseudouracil, queosine, the 2-thiocytosine, 5-methyl-2-thiouracil, the 2-thiouracil, the 4-thiouracil, methyl uracil, uracil-5-glycolic methyl ester, 3-(3-amino-3-N-2-carboxylic propyl group) uracil, (acp3) w, 2,6-diaminopurine and 5-propinyl pyrimidine. Other example of that modify, the non-standard or base portion of deriving can be referring to by the complete United States Patent(USP) Nos. that is incorporated herein by reference 6,001,611,5,955,589,5,844,106,5,789,562,5,750,343,5,728,525 and 5,679,785.

In addition, nucleic acid, polynucleotides or oligonucleotides can comprise one or more sugar moieties through modifying, and include but not limited to arabinose, 2-fluoro arabinose, xylulose and hexose.

The present invention does not wish to be subject to the source of nucleic acid, polynucleotides or oligonucleotides. Nucleic acid, polynucleotides or oligonucleotides can derive from human or inhuman mammal, or other any organism, perhaps derive from any recombinant, external synthetic or synthetic by chemical method. Nucleic acid, nucleotides, polynucleotides or oligonucleotides can be DNA, RNA, cDNA, DNA-RNA, lock nucleic acid (LNA), peptide nucleic acid (PNA), heterozygote or their any mixture, and may exist with two strands, strand or partially double stranded form. Nucleic acid can also be by the complete United States Patent (USP) that is incorporated herein by reference 5,696,248 described derivative nucleic acids. Nucleic acid of the present invention comprises purifying or not nucleic acid and the fragment thereof of purified form, comprise such as microorganism, such as gene, chromosome, the plasmid of bacterium, yeast, virus, viroid, mould, fungi and plant, animal, mankind's etc. biologic material, genome.

The length of term nucleic acid, polynucleotides and oligonucleotides is without specific difference, and these terms all are used interchangeably. These terms comprise two strands and single stranded DNA, and two strands and single stranded RNA.

Term used herein " residue " refer to above nucleotides or the base in the nucleic acid that defines. Without restriction, residue can be any nucleotides well known by persons skilled in the art, comprises above-mentioned all nucleotides that generate by biological method and the nucleotides that generates by the abiology method.

Term " primer " refers to and can serve as the oligonucleotides of the synthetic starting point of polynucleotides along the template nucleic acid chain under given conditions that described specified conditions namely allow primer extension product synthetic and described template strand complementation. This primer can obtain from the recombinant source, and form is the restricted fragment of purifying, perhaps gets by the synthetic method preparation. Primer extends condition and typically is included under the suitable temperature, in suitable buffer solution (" buffer solution " can comprise it itself being co-factor or the substituent that affects pH, ionic strength etc.), contain four kinds of different deoxyribonucleoside triphosphates and the reagent with polymerization activity, such as archaeal dna polymerase or reverse transcriptase. This primer is most effective strand in amplification preferably. Primer of the present invention may contain, 5-500 nucleotides for example, in certain embodiments, will contain at least 10,20,30,25,30,40,50,75 or 100 nucleotides and/or contain and be less than 500,300,200,100,90,80,70,60,50,40,30,25 or 20 nucleotides.

Term " hybridization " refers to the combination in local strand zone with the local strand zone of another single-chain nucleic acid with complementary series or double-strandednucleic acid of single-chain nucleic acid or double-strandednucleic acid. Known to those skilled in the art, two nucleic acid chains do not need complete complementary just can hybridize each other. According to hybridization conditions, nucleic acid can with its complementary sequence hybridization, even exist the situation of less, some perhaps many mispairing, disappearance or interpolations also can hybridize in two chains or the chain wherein. In certain embodiments, as hereinafter defined, primer of the present invention and probe can be optionally and the nucleic acid hybridization of at least part of complementation. In certain embodiments, under primer of the present invention and the probe stringent condition that can define hereinafter with the sequence hybridization of at least part of complementation.

Term used herein " strictly " or " stringent condition " refer to the hybridization conditions of LIS and high-temperature as known in the art; Referring to being introduced into this paper as a reference, the 2nd edition molecular cloning publishing in 1989 such as people such as Maniatis: laboratory manual; J.Wiley ﹠ Sons publ., the Current Protocols in Molecular Biology that the people such as Ausubel that New York 1988 publishes edits and Tijssen 1993 biochemistry and the technology aspect the molecular biology-with the hybridization of nucleic acid probe in " Hybridization principle is summarized and the nucleic acid testing program ". Usually, selected stringent condition hangs down about 5-30 ℃ than particular sequence in ionic strength and the pyrolysis chain temperature (Tm) under the pH condition of definition. Alternatively, selected stringent condition is than ionic strength and pyrolysis chain temperature (Tm) pH condition under the low about 5-15C of particular sequence in definition. Tm refer to the probe of target complementation in, temperature (under ionic strength, pH and the nucleic acid concentration condition of definition) when the hybridization of 50% probe and target sequence being arranged and being in poised state is (when target sequence is excessive when existing, under the Tm condition, 50% probe is occupied, and is in poised state). For example, stringent hybridization condition can be as follows, wherein arrive under the condition of about pH8.3 at about pH7.0, salinity is less than about 1.0M sodium (or other salt) ion, typically be about 0.01 to about 1M Na ion concentration, and for short probe (for example having 10-50 nucleotides), temperature is at least about 25C, for long probe (for example having the nucleotides more than 50), temperature is at least about 55 ℃. Stringent condition also can be changed by the hybridization destabilizing agent that adds such as formamide.

Term used herein " selectively " or " selective conditions " refer to be applicable to the hybridization conditions of primer of the present invention and/or probe, the amplification that can realize the nucleic acid of the detected flavivirus in the specific sample is carried out, detection and/or quantitatively, it not is to derive from other nucleic acid that can detect flavivirus that described specific sample may contain, or derives from other nucleic acid of extraneous areas in the flavivirus genome. It is as described below to detect flavivirus.

" complementary series " of nucleotide sequence used herein refers to be in the oligonucleotides of antiparallel bonding state, namely when itself and described nucleotide sequence compare, 5 ' end of a sequence can with 3 ' terminal pairing of another sequence. The complementary series of nucleotide sequence need not accurately to match with each nucleotides of this sequence; Stable duplex may contain base mismatch to or do not match base. The technical staff in nucleic acid field can rule of thumb consider many variablees, comprise the base composition of length, this oligonucleotides of described oligonucleotides for example and sequence, ionic strength, base mismatch on the impact of incidence, determine the stability of duplex.

The stability of nucleic acid duplex is determined by the mensuration of melting temperature or " Tm ". Specific nucleic acid duplex Tm under given conditions is the temperature that the potential base-pair of half dissociates.

Term used herein " probe " refers to form with a zone of nucleic acid the oligonucleotides of duplex structure, and the reason of formation duplex structure is that at least one sequence of this probe and the sequence in the above-mentioned zone have complementarity. Preferred probe does not comprise the sequence with the primer sequence complementation. As described below, this probe can be mark or unlabelled. 3 ' end of this probe can " be added cap ", mixes in the primer extension product to stop this probe. " adding cap " can be by utilizing the incomplementarity base or by being achieved in the 3 ' hydroxyl that will add such as the chemical part of biotin or phosphate group last nucleotides, difference according to selected portion, add cap and may have double duty, namely also serve as mark, can be used for subsequent detection or catch the nucleic acid that links to each other with this mark. Adding cap also can be by removing above-mentioned 3 ' hydroxyl or by utilizing the nucleotides without 3 ' hydroxyl, being achieved such as dideoxy nucleotide.

Term used herein " but test section " refers to can be used to provide to detect (randomly quantifiable) signal, with any atom or the molecule that can link to each other with nucleic acid or protein. But the test section may provide by detectable signals of method such as fluorescence, radioactivity, colorimetric method, gravimetry, X-ray diffraction or absorption process, magnetic, enzymatic activities. Comprise that but those are for detection of the test section of oligonucleotide fragment size but be applicable to suitable test section of the present invention.

Term used herein " fluorescence part " refers under given conditions radiative chemical part, and this condition namely is applicable to the condition of this specific part. Typically, specific fluorescence part can be launched the light of specific wavelength after the light that absorbs shorter wavelength. The light wavelength of partly being launched by specific fluorescent is the feature of this part. Therefore, can be after utilizing the optical excitation specific fluorescent part of shorter wavelength, by detecting the light of suitable wavelength, to detect this fluorescence part. The example that can be applicable to the fluorescence part of the inventive method and composition includes, but are not limited to fluorescein family dyestuff, many halogen fluorescein family dyestuff, chlordene fluorescein family dyestuff, cumarin family dyestuff, rhodamine family dyestuff, Hua Jing family dyestuff, piperazine family dyestuff, thiazine family dyestuff, squaraine family dyestuff, chelating lanthanide series family's dyestuff and BODIPY  family dyestuff.

Term used herein " quencher part " refers to absorb under given conditions the chemical part of fluorescence part institute emitted energy, described specified conditions are namely worked as this quencher part fully near the fluorescence part, for example when this quencher links to each other with same polynucleotides with the fluorescence part. This phenomenon is commonly called FRET (" FRET ") in this area. The quencher part can be launched the energy that partially absorbs from fluorescence again, form the peculiar signal of this quencher part, so quencher also can be " fluorescence part ". Alternatively, the quencher part may will be scattered and disappeared from the energy that fluorescence partially absorbs when heating.

" 5 '-3 ' nuclease " defined herein or " 5 ' nuclease " refer to the enzymatic activity of can sequential mode oligonucleotides 5 ' terminal nucleotides being removed. This 5 ' nuclease can be 5 '-3 ' exonuclease activity or 5 '-3 ' endonuclease enzymatic activity. For example, what many template specificity nucleic acid polymerases showed is usually 5 '-3 ' exonuclease activity relevant with some archaeal dna polymerase, (be that e. coli dna polymerase I has this activity, the Klenow fragment of e. coli dna polymerase I is then without this activity). 5 '-3 ' exonuclease activity also can be from 5 ' terminal beginning cracking of the substrate nucleic acid phosphodiester bond (nucleotides) more than. Although be not intended to be subject to any specific theory of operation, for causing probe to discharge this one side of oligonucleotide fragment of cracking, 5 '-3 ' exonuclease activity relevant with archaeal dna polymerase is considered to still depend on that the specific nucleotide of described probe forms. For example, between the two nucleotides of described oligonucleotides and template nucleic acid, especially the coupling or the mispairing number that appear at described oligonucleotides 5 ' end can affect this 5 '-3 ' exonuclease activity, as for example, by complete Holland et al. incorporated herein by reference, 1991, Proc.Natl.Acad.Sci.USA 88:7276-80 is described.

Term used herein " contrast 5 ' nuclease reaction " refers to as described below based on known quantity, for example 5 ' the nuclease reaction carried out of the detected flavivirus nucleic acid of known copy number. Fluorescence volume by this reaction emission can compare with the reaction of carrying out based on the sample that contains unknown quantity japanese encephalitis virus sero-group nucleic acid, to assess the amount of this nucleic acid that exists in this sample.

Term used herein " adjacent " refers to that described primer is with respect to the location of described probe on the identical or complementary strand of template nucleic acid. Described primer and probe may be by more than about 150 nucleotides, more than about 125 nucleotides, more than about 100 nucleotides, more than about 80 nucleotides, more than about 60 nucleotides, more than about 50 nucleotides, more than about 40 nucleotides, more than about 30 nucleotides, separate to about 10 nucleotides to about 20 nucleotides, about 1 more than about 20 nucleotides, about 1, perhaps may be directly adjacent one another are. If need to adopt the method that does not rely on polymerization to detect flavivirus nucleic acid, then described probe and probe are preferably separated to about 10 nucleotides by about 1. In depending on the method for polymerization, for example, in pcr amplification as herein described and the detection method, probe may with sequence to be amplified optional position, be the detected nucleic acid hybridization in primer downstream, can determine the position of polymerase thereby primer is extended, and then this probe that ruptured.

Term " thermally-stabilised nucleic acid polymerase " refers to compare with for example nucleotide polymerase in Escherichia coli source, but the enzyme of the polymerization of and catalysis ribonucleoside triphosphote relatively stable to heat. Usually, this kind of enzyme is to obtain the thermophilic organism from being thought by those skilled in the art. This enzyme can begin to synthesize in 3 ' end of the primer that is annealed to the primer binding sequence usually, and will continue 5 ' terminal synthetic new chain to template. If this polymerase has 5 '-3 ' nuclease, it can be hydrolyzed the probe that interleaves that has been annealed to template, to discharge mark and unlabelled probe fragment, until polymerization termination or all probe fragments and nucleic acid to be checked dissociate. United States Patent (USP) 4,889,818 have described the representative thermophilic enzyme that separates from thermus aquaticus (Taq), Saiki et al., 1988, Science 239:487-91 has described the method that is applied to conventional PCR. Another kind of representational thermophilic enzyme comprises the hot bacterial classification Z05 archaeal dna polymerase of dwelling. Referring to for example United States Patent (USP) 5,674,738.

The Taq archaeal dna polymerase have synthetic dependent form strand displacement 5 '-3 ' exonuclease activity of DNA (referring to Gelfand at Stockton Press, " round pcr principle and the application aspect DNA cloning thereof " " the Taq DNA polymerase " in the 2nd chapter that N.Y. (1989) publishes and Erlich edits. Therefore, when probe not when template DNA is combined, non-degradable this probe of Taq archaeal dna polymerase.

" reaction of 5 ' nuclease " of term nucleic acid primer or probe refer to when utilizing the nucleic acid polymerase with 5 '-3 ' nuclease to extend primer just as hereinbefore defined and hereinafter will describe in detail, with the degraded of the probe of described nucleic acid hybridization. This reaction is based on by the complete United States Patent (USP) that is incorporated herein by reference 6,214,979,5,804,375,5,487,972 and 5,210,015 described method.

For determining " the complementary percentage " or " homogeneity percentage " of two nucleotide sequences, these two sequences are compared, to obtain result's (for example, breach can be imported in first nucleotide sequence, be used for carrying out the suitableeest contrast with second nucleotide sequence) of optimum ratio. Then compare the locational nucleotides of corresponding nucleotide. When a position in first sequence by with second sequence in the nucleotides of nucleotides complementation on the relevant position when occupying, these two molecules are complementary in this position. Equally, when a position in first sequence by with second sequence in identical nucleotides on the relevant position when occupying, then these two molecules are consistent in this position. The complementary percentage of these two sequences (or homogeneity percentage) be total position number of being compared except the common complimentary positions of these two sequences (or consistent position) number after the result's that obtains function (be total position number * 100% of % complementarity=complementary lap position number/shorter nucleotides; With total position number of % homogeneity=consistent lap position number/shorter nucleotides * 100%).

Also can utilize mathematical algorithm to realize to the percentile mensuration of homogeneity between two sequences. The preferred limiting examples that is used to the mathematical algorithm of two sequences of comparison is that Karlin and Altschul are in 1990, the disclosed algorithm of Proc.Natl.Acad.Sci.U.S.A.87:2264-2268, and Karlin and Altschul are in the disclosed modified algorithm of 1993, Proc.Natl.Acad. Sci.U.S.A.90:5873-5877. This algorithm is merged to advance Altschul et al., in the disclosed NBLAST program of 1990, J.Mol.Biol.215:403.

Indicate in addition such as nothing, practice of the present invention will be applied to conventional molecular biology, microbiological technique and the recombinant DNA technology that belongs to the art technology category. These technology have obtained complete explaination in the literature. Referring to for example Cold Spring Harbor Laboratory Press, Cold Spring Harbor, the third edition Molecular Cloning:A Laboratory Manual that the people such as Sambrook that publish of New York calendar year 2001 edit; Oligonucleotide Synthesis (M.J.Gait edited in 1984); Nucleic Acid Hybridization (nucleic acid hybridization) ((B.D.Hames ﹠ S.J.Higgins edited in 1984); A Practical Guide to Molecular Cloning (B. Perbal edited in 1984); And a series of Methods in Enzymology (Academic Press, Inc.).

3. for detection of nucleic acid primer and the probe of the nucleic acid of encephalitis B sero-group member and some other flavivirus

The invention provides and can be used as oligonucleotides that whether nucleic acid that primer and probe be used to detect japanese encephalitis virus sero-group member and some other Flavivirus member exist and their application process. These primers and probe hereinafter have been described in detail in detail. Although should be pointed out that the primer that this paper discusses may be by the specific virus type of pointing out to be particularly useful for to increase (such as west nile virus, SLEV, dengue fever virus, flavivirus etc.), these primers also can be used for other virus of amplification.

Can the oligonucleotides that be applied to the inventive method be designed, it is comprised by the flavivirus of different strains or nucleotide sequence or its complementary series guarded by other member of two or more members of japanese encephalitis virus sero-group or Flavivirus. The oligonucleotides that comprises by different strains or sero-group member or belong to the sequence that the member guards for example may be used as, and primer or probe are used to detect different strains or member, detect different strains or the necessary primer of member or number of probes thereby reduce. Conserved sequence can comprise, for example between two or more members or other member of Flavivirus of two or more bacterial strains or japanese encephalitis virus sero-group, fully (namely 100%) or basically consistent at least 5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,30,40,50 or more adjacent nucleotide. Basically consistent sequence for example comprises those, is comprising the sequence that has 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homogeneity between two or more bacterial strains of above-mentioned adjacent nucleotide

3.1. nucleic acid primer

Primer based on SEQ ID NO:1

In one aspect, the invention provides the nucleic acid primer that can be used in the method that detects japanese encephalitis virus sero-group member. The first nucleic acid primer that in certain embodiments, can be used to detect japanese encephalitis virus sero-group member comprise can with the nucleic acid of nucleic acid shown in the SEQ ID NO.:1 or its complementary sequence hybridization. SEQ ID NO.:1 has as shown in Figure 1 shown a conserved sequence region in the flavivirus genome 3 ' non-translational region, can utilize the compositions and methods of the invention to detect. SEQ ID NO.:2 has shown the complementary series of SEQ ID NO.:1.

In above-mentioned embodiment of the present invention, described the first nucleic acid primer has can make it form with the nucleotides of nucleic acid hybridization shown in the SEQ ID NO.:1 under given conditions, i.e. chemical constitution. In some cases, each nucleotides with the primer of nucleic acid hybridization will form the base pairing complementary series with the nucleotides of this nucleic acid. For example, comprise can with nucleic acid shown in the SEQ ID NO.:1 in the primer of standard nucleotides of C residue hybridization should have in this relevant position the G residue. Therefore, determine the nucleotide sequence of primer with the hybridization of nucleic acid shown in the SEQ ID NO.:1, and and then determined the accurate chemical constitution of this primer. In addition, to the definition of oligonucleotides and primer, described the first nucleic acid primer also can comprise non-standard nucleotides according to above. Base-pair can is combined and form to some so non-standard nucleotides also with other standard or non-standard nucleotides. For example, non-standard nucleotides inosine can match with uracil, cytimidine and adenine. Suppose that the correlation between hybridization and the chemical constitution is known, those skilled in the art can easily identify the standard feature of primer of the present invention. Hereinafter specifically described typical embodiments.

In certain embodiments, the first nucleic acid primer with nucleic acid hybridization shown in the SEQ ID NO.:1 may be as little to about 6 nucleotides. In other embodiments, described the first nucleic acid primer can grow to about 80 nucleotides. In certain embodiments, described the first nucleic acid primer has about 10, about 12, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 35 or about 40 nucleotides. In certain embodiments, described the first nucleic acid primer has and is less than 100,80,70,60,50,40,30,25,21 or 20 nucleotides.

Can select length and the composition of primer, so that sufficient thermodynamic stability to be provided, and then guarantee this primer and the hybridization of flavivirus nucleic acid under suitable reaction conditions, this reaction condition depends on detection method to be performed. For example, having primer modification, non-standard or derivatized nucleotide may be longer or short than the primer with conventional nucleotides, but still have similar thermokinetics hybridization characteristic. The example of this non-standard bases can be referring to by the complete United States Patent (USP) that is incorporated herein by reference 6,320,005,6,174,998,6,001,611 and 5,990,303. Another example is, is rich in the similar primer of A/T sequence and length and compares with having, and having the primer that is rich in the G/C sequence may be annealed to target sequence under higher temperature conditions. Therefore, in certain embodiments, described the first nucleic acid primer comprises modification defined above, non-standard or the base of deriving.

In certain embodiments, described the first nucleic acid primer comprises about at least 16 continuous nucleotides in the sequence shown in the SEQ ID NO.:2. SEQ ID NO.:2 as shown in Figure 1 is the complementary series of SEQ ID NO.:1. In other embodiments, described the first nucleic acid primer comprises about at least 18 continuous nucleotides in the sequence shown in the SEQ ID NO.:2. In other embodiments, described the first nucleic acid primer comprises about at least 20 continuous nucleotides in the sequence shown in the SEQ ID NO.:2. In other embodiments, described the first nucleic acid primer then comprises about at least 22 continuous nucleotides in the sequence shown in the SEQ ID NO.:2. In other embodiments, described the first nucleic acid primer comprises about at least 24 continuous nucleotides in the sequence shown in the SEQ ID NO.:2.

In certain embodiments, the invention provides the nucleic acid primer that can be used to detect japanese encephalitis virus sero-group member. By reference nucleic acid sequence, can structurally define these primers, as shown in table 1.

Table 1
Table 1		SEQ ID NO.:3 japanese encephalitis virus sero-group primer 1	GN ²AAN ⁵CCN ⁸N ⁹N ¹⁰CN ¹²N ¹³AN ¹⁵CN ¹⁷N ¹⁸N ¹⁹N ²⁰TCGGN ²⁵N ²⁶N wherein²Be T or A; N⁵Be G or C; N⁸Be T or disappearance; The N of No. 9 positions is C or G; N¹⁰Be T or C; N¹²Be A or G; N¹³Be G or A; N¹⁵Be A or C; N¹⁷Be C or T; N¹⁸Be G or C; N¹⁹Be T or C; N²⁰Be C or T; N²⁵Be A or G; And N²⁶Be A or T.
SEQ ID NO.:4 west nile virus primer 1	GTAAGCCN ⁸CN ¹⁰CAGAACCGN ¹⁹N ²⁰TCGGAA is N wherein⁸Be disappearance or T; N¹⁰Be T or C; N¹⁹Be T or C; And N²⁰Be C or T.
SEQ ID NO.:4 west nile virus primer 1		SEQ ID NO.:5 japanese encephalitis virus primer 1	GAAAN ⁵CCN ⁸CTCN ¹²N ¹³AAC N ¹⁷GTN ²⁰TCGGAA is N wherein⁵Be G or C; N⁸Be disappearance; N¹²Be A or G; N¹³Be G or A; N¹⁷Be C or T; And N²⁰Be C or T.
SEQ ID NO.:6 Murray river valley encephalitis viruses primer 1	GAAAGCCTCCCAGAN ¹⁵CCGTN ²⁰TCGGAA is N wherein¹⁵Be A or C; And N²⁰Be C or T.	SEQ ID NO.:5 japanese encephalitis virus primer 1
		SEQ ID NO.:7 Koutango virus primer 1	GTAAGCCCTCAGAACCGTCTCGGAA
SEQ ID NO.:8 example primer 1	GTAAGCCCTCAGAACCGTCTCGGAA	SEQ ID NO.:7 Koutango virus primer 1	GTAAGCCCTCAGAACCGTCTCGGAA
SEQ ID NO.:8 example primer 1	GTAAGCCCTCAGAACCGTCTCGGAA	SEQ ID NO.:11 japanese encephalitis virus sero-group primer 2	N ¹CCN ⁴AN ⁶TN ⁸TN ¹⁰N ¹¹N ¹²N ¹³CCAGGTN ²⁰TCAA is N wherein¹Be T or C; N⁴Be C or T; N⁶Be G or C; N⁸Be C or A; N¹⁰Be A or T; N¹¹Be disappearance or T; N¹²Be T or C; N¹³Be C or T; And N²⁰Be G or A.
SEQ ID NO.:12 west nile virus primer 2	N ¹CCTAGTCTATCCCAGGTN ¹⁹TCAA is N wherein¹Be T or C and N¹⁹Be G or A.

Table 1
Table 1		SEQ ID NO.:13 japanese encephalitis virus primer 2	CCCN ⁴AN ⁶TN ⁸TATN ¹²N ¹³CCAGGTGTCAA is N wherein⁴Be C or T; N⁶Be G or C; N⁸Be C or A; N¹²Be T or C; And N¹³Be C or T.
SEQ ID NO.:14 Murray river valley encephalitis viruses primer 2	TCCTAGTCTTTTCCCAGGTGTCAA	SEQ ID NO.:13 japanese encephalitis virus primer 2
	TCCTAGTCTTTTCCCAGGTGTCAA	SEQ ID NO.:15 example primer 2	TCCTACTCTATCCCAGCTGTCAA
SEQ ID NO.:74 example primer 2	TCTCCTAGTCTATCCCAGGTGTCAA	SEQ ID NO.:15 example primer 2	TCCTACTCTATCCCAGCTGTCAA

In certain embodiments, described the first nucleic acid primer comprises the arbitrary sequence shown in the SEQ ID NOS.:3-8. In certain embodiments of the invention, in order to improve primer specificity, described primer can its 3 ' terminal or near comprise one or more alkylation nucleotides. For example, in certain embodiments, described the first nucleic acid primer comprises sequence shown in the SEQ ID NO.:8, and wherein No. 23 position residues are N⁶-alkyl-desoxyadenossine. In a kind of particular, described the first nucleic acid primer comprises sequence shown in the SEQ ID NO.:8, and wherein No. 23 position residues are N⁶-methyl-desoxyadenossine. In certain embodiments, described the first nucleic acid comprises sequence shown in the SEQ ID NO.:8, and wherein No. 24 position residues are N⁶-alkyl-desoxyadenossine. In a kind of particular, described the first nucleic acid comprises sequence shown in the SEQ ID NO.:8, and wherein No. 24 position residues are N⁶-the tert-butyl group-benzyl-desoxyadenossine. In certain embodiments, described the first nucleic acid primer comprises sequence shown in the SEQ ID NO.:8, and wherein No. 23 position residues are N⁶-alkyl-desoxyadenossine, No. 24 position residues are N⁶-alkyl-desoxyadenossine. In another kind of particular, described the first nucleic acid primer comprises sequence shown in the SEQ ID NO.:8, and No. 23 position residues are N⁶-methyl-desoxyadenossine, No. 24 position residues then are N⁶-the tert-butyl group-benzyl-desoxyadenossine. The United States Patent (USP) 6,001 that above is incorporated herein by reference, 611 have described N⁶-alkyl-desoxyadenossine, and the homogeneity of the moieties that can use with this non-standard nucleotides. For example, in certain embodiments, described moieties comprises C₁To about C₁₀Have side chain or unbranched alkyl. In other embodiments, described moieties comprises C₁To about C₂₀Have side chain or unbranched alkyl.

In one aspect of the method, the invention provides the second nucleic acid primer for detection of japanese encephalitis virus sero-group member, comprise can with the nucleic acid of nucleic acid shown in the SEQ ID NO.:9 or its complementary sequence hybridization. SEQ ID NO.:9 has as shown in Figure 2 shown a conserved sequence region in the flavivirus genome 3 ' non-translational region, can utilize the compositions and methods of the invention to detect. Fig. 2 has also shown the complementary series of SEQ ID NO.:9, i.e. SEQ ID NO.:10.

In above-mentioned embodiment of the present invention, described the second nucleic acid primer has the nucleotides that can make nucleic acid hybridization shown in itself and the SEQ ID NO.:9 and forms, i.e. chemical constitution. For example, comprise can with nucleic acid shown in the SEQ ID NO.:9 in the primer of standard nucleotides of C residue hybridization should have in the relevant position G residue. Therefore, determine the nucleotide sequence of primer with the hybridization of nucleic acid shown in the SEQ ID NO.:9, and and then determined the accurate chemical constitution of this primer. In addition, to the definition of oligonucleotides and primer, described the second nucleic acid primer also can comprise non-standard nucleotides according to above. Base-pair can is combined and form to some so non-standard nucleotides also with other standard or non-standard nucleotides. For example, non-standard nucleotides inosine can match with uracil, cytimidine and adenine. Suppose that the correlation between hybridization and the chemical constitution is known, those skilled in the art can easily identify the standard feature of primer of the present invention. Hereinafter specifically described typical embodiments.

In certain embodiments, the second nucleic acid primer with nucleic acid hybridization shown in the SEQ ID NO.:9 may be as little to about 6 nucleotides. In other embodiments, described the second nucleic acid primer can grow to about 80 nucleotides. In certain embodiments, described the second nucleic acid primer has about 10, about 12, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 35 or about 40 nucleotides.

Can select length and the composition of the second primer, so that sufficient thermodynamic stability to be provided, and then guarantee this primer and the hybridization of flavivirus nucleic acid under suitable reaction conditions, this reaction condition depends on detection method to be performed. For example, having primer modification, non-standard or derivatized nucleotide may be longer or short than the primer with conventional nucleotides, but still have similar thermokinetics hybridization characteristic. The example of this non-standard bases can be referring to by the complete United States Patent (USP) that is incorporated herein by reference 6,320,005,6,174,998,6,001,611 and 5,990,303. Another example is, is rich in the similar primer of A/T sequence and length and compares with having, and having the primer that is rich in the G/C sequence may be annealed to target sequence under higher temperature conditions. Therefore, in certain embodiments, described the second nucleic acid primer comprises modification defined above, non-standard or the base of deriving.

In certain embodiments, described the second nucleic acid primer comprises at least 16 continuous nucleotides in the sequence shown in the SEQ ID NO.:10. SEQ ID NO.:10 as shown in Figure 2 represents the complementary series of SEQ ID NO.:9. In other embodiments, described the second nucleic acid primer comprises about at least 18 continuous nucleotides in the sequence shown in the SEQ ID NO.:10. In other embodiments, described the second nucleic acid primer comprises about at least 20 continuous nucleotides in the sequence shown in the SEQ ID NO.:10. In other embodiments, described the second nucleic acid primer then comprises about at least 22 continuous nucleotides in the sequence shown in the SEQ ID NO.:10. In other embodiments, described the second nucleic acid primer comprises about at least 24 continuous nucleotides in the sequence shown in the SEQ ID NO.:10.

In certain embodiments, described the second nucleic acid primer comprises sequence shown in the SEQ ID NO.:11. In other embodiments, described the second nucleic acid primer comprises sequence shown in the SEQ ID NO.:12. In other embodiments, described the second nucleic acid primer comprises sequence shown in the SEQ ID NO.:13. In other embodiments, described the second nucleic acid primer comprises sequence shown in the SEQ ID NO.:14. In other embodiments, described the second nucleic acid primer comprises sequence shown in SEQ ID NO.:15 or the SEQ ID NO:74. In certain embodiments, described the second nucleic acid primer comprises nucleotides non-standard or that derive. In other embodiments, described the second nucleic acid primer can have one or more alkylation nucleotides at its 3 ' end. In certain embodiments, described the second nucleic acid primer comprises sequence shown in SEQ ID NO.:15 or the SEQ ID NO:74, and wherein No. 24 position residues are N⁶-alkyl-desoxyadenossine. In certain embodiments, described moieties comprises C₁To about C₁₀Have side chain or unbranched alkyl. In other embodiments, described moieties comprises C₁To about C₂₀Have side chain or unbranched alkyl. In a kind of particular, described the second nucleic acid primer comprises sequence shown in SEQ ID NO.:15 or the SEQ ID NO:74, and wherein No. 24 position residues are N⁶-the tert-butyl group-benzyl-desoxyadenossine.

Nucleic acid primer of the present invention also can comprise nucleotide sequence not complementary with japanese encephalitis virus sero-group member and/or that do not hybridize. These appended sequence can be that those skilled in the art select, for example, and with auxiliary detection japanese encephalitis virus sero-group member. Hereinafter 4.2 and 4.3 save the detailed method that detects the nucleic acid that comprises japanese encephalitis virus sero-group member nucleic acid of having described. These methods have been described and can be present in the additional nucleotide sequence in the nucleic acid primer of the present invention and utilize these appended sequence to detect japanese encephalitis virus sero-group member's method.

Without restriction, can prepare above-mentioned nucleic acid primer by any suitable method well known by persons skilled in the art. The method of the oligonucleotides of preparation particular sequence is well known in the art, for example comprises, to clone and restriction and the directly chemical synthesis of proper sequence. Chemical synthesis process for example can comprise, Narang et al., phosphotriester method, Brown et al. that 1979, Methods in Enzymology 68:90 describes, 1979, di-phosphate ester method, Beaucage et al. that Methods in Enzymology 68:109 describes, the disclosed diethylamino phosphate of 1981, Tetrahedron Letters 22:1859 method, and United States Patent (USP) 4,458,066 disclosed solid support methods. In addition, the impact enzyme behavior relevant with the oligonucleotides that is synthesized can be used for ideally on the change of above-mentioned synthetic method. For example, will mix the cracking that may be used in the oligonucleotides stop at specific site through the phosphodiester bond (for example thiophosphate, methyl phosphorodithioate, phosphoramidate or boranophosphate) of modifying or the key that is different from phosphorous acid derivative. In addition, when described oligonucleotides with also as the nucleic acid hybridization of the template of synthetic novel nucleic acids chain the time, along with the hydrolysis of this oligonucleotides, the application of 2 '-amido modified sugar will be facilitated the carrying out of displacement.

The dengue fever virus primer

Other primers of the present invention and dengue fever virus 3 ' UTR hybridization. The typical primer that is used for amplification and/or detection dengue fever virus nucleic acid comprises the primer shown in the table 2 (5 ' → 3 ').

Table 2

Sequence annotation SEQ ID NO:

The GAGCCCCGTCCAAGGACGTAAAAAGAA dengue fever virus has 41

Upstream primer.

The GAGCCCCGTCCAAGGACGTAAAAAGAJ dengue fever virus has 42

Upstream primer.

The GAGCCCCGTCCAAGGACGTAAAAAGEJ dengue fever virus has 43

Upstream primer.

GAGCCCCGTCCAAGGACGTAAAATGAA I type dengue fever virus 44

Upstream primer.

GAGCCCCGTCCAAGGACGTAAAATGAJ I type dengue fever virus 45

Upstream primer.

GAGCCCCGTCCAAGGACGTAAAATGEJ I type dengue fever virus 46

Upstream primer.

GAGCCCCGTCCAAGGACGTTAAAAGAA II﹠amp; The III type is stepped on leather 47

The fever virus upstream primer

GAGCCCCGTCCAAGGACGTTAAAAGAJ II﹠amp; The III type is stepped on leather 48

The fever virus upstream primer

GAGCCCCGTCCAAGGACGTTAAAAGEJ II﹠amp; The III type is stepped on leather 49

The fever virus upstream primer

ATTGAAGTCAGGCCACTTGTGCCA IV type dengue fever virus 50

Upstream primer

ATTGAAGTCAGGCCACTTGTGCCJ IV type dengue fever virus 51

Upstream primer

ATTGAAGTCAGGCCACTTGTGCUJ IV type dengue fever virus 52

Upstream primer

GATCTCTGGTCTTTCCCAGCGTCAA dengue fever virus downstream 53

Primer

GATCTCTGGTCTTTCCCAGCGTCAJ dengue fever virus downstream 54

Primer

GATCTCTGGTCTTTCCCAGCGTCEJ dengue fever virus downstream 55

Primer

The definition of primer suffix: J=t-butyl-benzyl-dA, E=methyl-dA; U=ethyl-dC

In certain embodiments, applied in any combination a kind of " upstream " primer and " downstream " primer amplification dengue fever virus nucleic acid.In certain embodiments, applied in any combination detect one or more dengue fever virus nucleic acid more than a kind of upstream primer and at least a downstream primer.The multiple upstream primer of application can be realized amplification and/or the detection to different dengue fever virus nucleic acid variants in single amplified reaction.For example, in certain embodiments, first kind of upstream primer (being selected from SEQ IDNO:41, SEQ ID NO:42 and SEQ ID NO:43) and second kind of upstream primer (being selected from SEQ ID NO:50, SEQ ID NO:51 and SEQ ID NO:52) are with dengue fever virus downstream primer (for example being selected from the primer that comprises sequence shown in SEQ ID NO:53, SEQ ID NO:54 and the SEQ ID NO:55) applied in any combination.These embodiments for example help, and detect in 1,2, the 3 or 4 type dengue fever viruss any one.

The yellow fever virus primer

Other primers of the present invention and yellow fever virus 3 ' UTR hybridization.The typical primer that is used to increase and/or detects yellow fever virus nucleic acid comprises the primer shown in the following table 3 (5 ' → 3 ').

Table 3

Sequence note SEQ ID NO:

On the AACCGGGATAAAAACTACGGGTGGAGAA yellow fever virus 56

The trip primer

On the AACCGGGATAAAAACTACGGGTGGAGAJ yellow fever virus 57

The trip primer

On the AACCGGGATAAAAACTACGGGTGGAGEJ yellow fever virus 58

The trip primer

On the ATAAAAACTACGGGTGGAGAACCGGA yellow fever virus 59

The trip primer

On the ATAAAAACTACGGGTGGAGAACCGGJ yellow fever virus 60

The trip primer

Under the ACTCCGGTCTTTCCCTGGCGTCAA yellow fever virus 61

The trip primer

Under the ACTCCGGTCTTTCCCTGGCGTCAJ yellow fever virus 62

The trip primer

Under the ACTCCGGTCTTTCCCTGGCGTCEJ yellow fever virus 63

The trip primer

Suffix is referring to table 2.

In certain embodiments, applied in any combination a kind of " upstream " primer and " downstream " primer amplification yellow fever virus nucleic acid.In certain embodiments, applied in any combination detect one or more yellow fever virus nucleic acid more than a kind of upstream primer and at least a downstream primer.In single amplified reaction, may be applied to multiple upstream primer.For example, in certain embodiments, first kind of upstream primer (for example, be selected from SEQ ID NO:56, SEQ ID NO:57 and SEQ IDNO:58) and second kind of upstream primer is (for example, be selected from SEQ ID NO:59, SEQ ID NO:60 and SEQ ID NO:521) be with yellow fever virus downstream primer (for example, being selected from the primer that comprises sequence shown in SEQ IDNO:62 and the SEQ ID NO:63) applied in any combination.

Primer based on sequence shown in Figure 7

Other primers of the present invention can be under given conditions with arbitrary sequence shown in Figure 7 (for example, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40) or their complementary sequence hybridization, described specified conditions promptly allow to cause the condition of amplified reaction.In some cases, these primers are used to increase and/or detect the nucleic acid that SLEV originates.

With above-mentioned can be the same with the primer of sequence hybridization shown in the SEQ ID NO:1, to the definition of oligonucleotide and primer, can also can comprise non-standard Nucleotide according to above with the primer of arbitrary sequence hybridization shown in Figure 7.

Can be to selecting with the length and the composition of the primer of arbitrary sequence shown in Figure 7 hybridization, so that sufficient thermodynamic stability to be provided, and then guarantee this primer and the hybridization of flavivirus nucleic acid under suitable reaction conditions, this reaction conditions depends on detection method to be performed.For example, having primer modification, non-standard or derivatized nucleotide may be longer or short than the primer with conventional Nucleotide, but still have similar thermokinetics hybridization characteristic.Therefore, in certain embodiments, described second kind of nucleic acid primer comprises modification defined above, non-standard or the base of deriving.Can comprise with the primer of arbitrary sequence shown in Figure 7 hybridization in arbitrary sequence shown in Figure 7 or their complementary sequence at least for example, 4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,30,40,50 or more heterogeneous adjacent Nucleotide.

What one skilled in the art should appreciate that is, can utilize sequences Design primer shown in SEQ ID NO:29, SEQ IDNO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQID NO:39, the SEQ ID NO:40 right, with 3 ' UTR district amplification expected sequence from SLEV.In certain embodiments, allowing to cause under the condition of amplified reaction, first kind of primer of the present invention and TTGACACCTGGAAA GACAGGAGA (SEQ ID NO:68) hybridization, second kind of primer then with the complementary sequence hybridization of CAAAGCCCCTCATTC CGACTCGGG (SEQ ID NO:69).

Be used to detect and/or the typical primer of the SLEV that increases comprises the primer shown in the table 4.

Table 4

Sequence note SEQ ID NO:

On the CAAAGCCCCTCATTCCGACTCGGGA Saint Louis' encephalitis virus 64

The trip primer

On the CAAAGCCCCTCATTCCGACTCGGGJ Saint Louis' encephalitis virus 65

The trip primer

Under the TCTCCTGTCTTTCCAGGTGTCAA Saint Louis' encephalitis virus 66

The trip primer

Under the TCTCCTGTCTTTCCAGGTGTCAJ Saint Louis' encephalitis virus 67

The trip primer

Suffix is referring to table 2.

3.2. nucleic acid probe

In one aspect of the method, the invention provides the probe that is used to detect some flavivirus nucleic acid.The flavivirus nucleic acid that can utilize probe in detecting of the present invention is as described in 3.3 and 3.4 joints hereinafter.Do not add restriction, this probe can be any nucleic acid probe whether flavivirus nucleic acid exists that detects well known by persons skilled in the art that is used to identify.This probe typically comprise can with the nucleotide sequence of a area hybridization in the flavivirus nucleic acid to be checked.

The nucleotide sequence of described probe can have random length, and this length is enough to the nucleic acid of specificity in conjunction with flavivirus to be checked.In certain embodiments, described probe has about at least 6 Nucleotide.In certain embodiments, described probe has and is less than about 140 Nucleotide.In certain embodiments, the length of described probe can be about 18 to about 25, about 25 to about 35 or about 35 to about 45 Nucleotide.Can select the length and the composition of this probe, so that sufficient thermodynamic stability to be provided, and then guarantee this probe and the hybridization of flavivirus nucleic acid under suitable reaction conditions, this reaction conditions then depends on detection method to be performed.For example, having probe modification, non-standard or derivatized nucleotide may be longer or short than the probe with conventional Nucleotide, but still have similar thermokinetics hybridization characteristic.The example of this non-standard bases can be referring to by the complete United States Patent (USP) that is incorporated herein by reference 6,320,005,6,174,998,6,001,611 and 5,990,303.Another example is, is rich in the similar probe of A/T sequence and length and compares with having, and having the probe that is rich in the G/C sequence may be annealed to target sequence under comparatively high temps.

In the nucleotide sequence of described probe, typically can detect in the nucleic acid regional consistent or complementary by described probe hybridization with this with the part that can detect nucleic acid hybridization.But, this part of probe is with can detect can be less than 100% by the sequence identity in the zone of this probe hybridization or complementarity in the viral nucleic acid.In certain embodiments of the invention, can have about 99%, about 98%, about 97%, about 96%, about 95%, about 90%, about 85% or about 80% complementarity or identity with can detecting in the viral nucleic acid with the nucleotide sequence of the part that can detect viral nucleic acid hybridization in the described probe by the zone of this probe hybridization.

In certain embodiments, the invention provides the probe that is used to detect japanese encephalitis virus serogroups member, this probe comprise can with the nucleic acid of nucleic acid hybridization shown in the SEQ ID NO.:16.SEQ ID NO.:16 has as shown in Figure 3 shown a conserved sequence region in the flavivirus genome 3 ' non-translational region, can utilize the compositions and methods of the invention to detect.Fig. 3 has also shown SEQ ID NO.:17, the complementary sequence of expression SEQ ID NO.:16.

In these embodiments of the present invention, described probe has can make it form with the Nucleotide of nucleic acid hybridization shown in the SEQ ID NO.:16 under given conditions, i.e. chemical structure.For example, comprise that standard nucleotides also can must have the G residue in the corresponding position with the probe that the C residue in the nucleic acid shown in the SEQ ID NO.:16 is hybridized.Therefore, determined the nucleotide sequence of described probe, and and then determined its chemical structure accurately with the hybridization of nucleic acid shown in the SEQ ID NO.:16.In addition, to the definition of oligonucleotide and primer, described probe also can comprise non-standard Nucleotide according to above.Some so non-standard Nucleotide also can combine and form base pair with other standard or non-standard Nucleotide.For example, non-standard Nucleotide inosine can match with uridylic, cytosine(Cyt) and VITAMIN B4.Suppose that the dependency between hybridization and the chemical structure is known, those skilled in the art can easily discern the standard feature of probe of the present invention.Some typical embodiments have hereinafter been specifically described.

In certain embodiments, can have about 10 with the probe of sequence hybridization shown in the SEQ ID NO.:16, about 12, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 32, about 34, about 36, about 38, about 40, about 42, about 44, about 46, about 48, about 50, about 55, about 60, about 65, about 70, about 75 or about 80 Nucleotide.In certain embodiments, described probe comprises modification defined above, non-standard or the base of deriving.

In certain embodiments, described probe comprises about at least 20 continuous nucleotides in the sequence shown in the SEQ ID NO.:17.In other embodiments, described probe comprises about at least 22 continuous nucleotides in the sequence shown in the SEQ IDNO.:17.In other embodiments, described probe comprises about at least 24 continuous nucleotides in the sequence shown in the SEQ ID NO.:17.In other embodiments, described probe comprises about at least 28 continuous nucleotides in the sequence shown in the SEQ ID NO.:17.In other embodiments, described probe comprises about at least 30 continuous nucleotides in the sequence shown in the SEQ ID NO.:17.In other embodiments, described probe comprises about at least 32 continuous nucleotides in the sequence shown in the SEQ ID NO.:17.In other embodiments, described probe comprises about at least 36 continuous nucleotides in the sequence shown in the SEQ ID NO.:17.In other embodiments, described probe then comprises about at least 38 continuous nucleotides in the sequence shown in the SEQ ID NO.:17.In other embodiments, described probe comprises about at least 40 continuous nucleotides in the sequence shown in the SEQ ID NO.:17.

In certain embodiments, the invention provides the specific nucleic acid probe that can be used to detect japanese encephalitis virus serogroups member and some other flavivirus.As shown in table 5, by reference nucleic acid sequence, can structurally define these probes.

Table 5
Table 5		SEQ ID NO.:18 is used to detect the probe of flavivirus	GGN ³CTAGN ⁸GGTTAGAGGAGACCCN ²⁴N ²⁵N ²⁶N ²⁷N ²⁸N wherein ³Be A or T; N ⁸Be A or T; N ²⁴Be C or T; N ²⁵Be G, C, T, A or disappearance; N ²⁶Be C, T, G or disappearance; N ²⁷Be G, C, A, T or disappearance; And N ²⁸Be G, C, A, T or disappearance.
SEQ ID NO.:19 is used to detect japanese encephalitis virus serogroups member's probe	GGACTAGN ⁸GGTTAGAGGAGACCCCN ²⁵N ²⁶N ²⁷N ²⁸N wherein ⁸Be A or T; N ²⁵Be G or A; N ²⁶Be C or T; N ²⁷Be G or T; And N ²⁸Be G or T.	SEQ ID NO.:18 is used to detect the probe of flavivirus
		SEQ ID NO.:20 is used to detect the probe of west nile virus	GGACTAGN ⁸GGTTAGAGGAGACCCCN ²⁵CGN ²⁸N wherein ⁸Be A or T; N ²⁵Be G or A; And N ²⁸Be G or T.
SEQ ID NO.:21 is used to detect the probe of japanese encephalitis virus	GGACTAGAGGTTAGAGGAGACCCCGN ²⁶GG is N wherein ²⁶Be C or T.

Table 5
Table 5		SEQ ID NO.:22 is used to detect the probe of Murray river valley encephalitis	GGACTAGAGGTTAGAGGAGACCCCACTC
SEQ ID NO.:23 is used to detect the probe of Kunjin virus	AATAN ⁵GTGGATTACATGAN ¹⁹TTCAN ²⁴TGAAG is N wherein ⁵Be T or C; N ¹⁹Be G or C; And N ²⁴Be T or C.		GGACTAGAGGTTAGAGGAGACCCCACTC
SEQ ID NO.:23 is used to detect the probe of Kunjin virus		SEQ ID NO.:24 is used to detect the probe of dengue fever virus	GGACTAGAGGTTAGAGGAGACCCCN ²⁵N ²⁶N ²⁷N ²⁸N wherein ²⁵Be C or T; N ²⁶Be C or G; N ²⁷Be C or G; And N ²⁸Be G, C or A.
SEQ ID NO.:25 is used to detect the probe of yellow fever virus	GGTCTAGAGGTTAGAGGAGACCCTCCAG
	GGTCTAGAGGTTAGAGGAGACCCTCCAG	SEQ ID NO.:26 is used to detect the probe of Meng Taina mouse ear bat leukoencephalitis virus	GGACTAGAGGTTAGAGGAGACCCCTTCC
SEQ ID NO.:27 is used to detect the probe of Modoc virus	GGACTAGAGGTTAGAGGAGACCCCCGGC		GGACTAGAGGTTAGAGGAGACCCCTTCC
SEQ ID NO.:27 is used to detect the probe of Modoc virus	GGACTAGAGGTTAGAGGAGACCCCCGGC	SEQ ID NO.:28 example probe 1	GGACTAGAGGTTAGAGGAGACCCCGCGG
SEQ ID NO.:70 flavivirus antisense probe	GGGTCTCCTCTAACCTCTAGTCCTTCCCCC	SEQ ID NO.:28 example probe 1	GGACTAGAGGTTAGAGGAGACCCCGCGG

In certain embodiments of the invention, described probe comprises any one sequence in the sequence or its complementary sequence shown in SEQ ID NOS.:18-28 or 70.

Nucleic acid probe of the present invention also can comprise be not derive from japanese encephalitis virus serogroups member or available the disclosure probe in detecting other flavivirus and/or not with their other nucleotide sequence of nucleic acid hybridization.Those skilled in the art can select these additional nucleotide sequences, makes described probe have the functional of expection.For example, described nucleic acid probe can comprise and can make the improved appended sequence of detection method.Can comprise that additional nucleotide sequence maybe can be adjusted the probe example that is used for probe of the present invention, method and test kit by other method can be referring to by the complete United States Patent (USP) that is incorporated herein by reference 6,323,337,6,248,526,6,150,097,6,117,635,6,090,552,5,866,336 and 5,723,591.In addition, 4.2 and 4.3 joints hereinafter detailed described to detect comprise that japanese encephalitis virus serogroups member or other can detect the method for nucleic acid of the nucleic acid of flavivirus.Some method in these methods has also adopted the additional nucleotide sequence that can be present in the nucleic acid primer of the present invention; Hereinafter describe these additional nucleotide sequences and utilized these appended sequence to detect japanese encephalitis virus serogroups member's method.

Do not add restriction, nucleic acid probe of the present invention can be by any means preparation well known by persons skilled in the art.Particularly, the method that is used to prepare nucleic acid primer of the present invention also can be used to prepare nucleic acid probe of the present invention.

Except above-mentioned probe nucleotide sequence, described probe also can comprise additional nucleotide sequence or the other parts that do not suppress the inventive method.In easy embodiment of the present invention, described probe can include additional nucleotide sequence or the other parts that help implement the inventive method.For example, 3 ' end of described probe can be added cap, with the unwanted nucleic acid polymerization effect that stops this probe to cause.Equally, can there be specific part in the described probe, so that the hybrid stability of this probe or probe fragment and described nucleotide sequence or instability.Probe of the present invention also can comprise modification defined above, non-standard or derivatized nucleotide.

In certain embodiments of the invention, but described probe can comprise the test section.Do not add restriction, but but should the test section can be test section arbitrarily well known by persons skilled in the art.In addition, do not add restriction, should the test section but can detect by any means well known by persons skilled in the art.For example, but can pass through that spectrum, photochemistry, biological chemistry, immunochemistry or chemical process detect should test section.

But multiplely be used to detect the test section of probe of the present invention and make them and the method for described probe bridge joint is known in the art, include but not limited to enzyme (for example alkaline phosphatase and horseradish peroxidase) and enzyme substrates, radioactive segment, fluorescence part, chromophoric group, chemiluminescent labeling, such as Origin ^TM(Igen) electrochemiluminescence mark, thus the part of specific binding partner or the mark of the enhancing interact with each other of other any possibility, change or attenuated signal had.Certainly, when temperature improves, should utilize heat-stable DNA polymerase to carry out the reaction of 5 ' nuclease, but described test section should or not become and can not detect by the degraded of the temperature of this rising.

In certain embodiments, but described test section can be the fluorescence part.Do not add restriction, this fluorescence part can be any fluorescence part well known by persons skilled in the art.Usually preferably have the fluorescence part of wide Stokes shift, thereby can use the photofluorometer that is better than single colorimeter, and improve detection efficiency with wave filter.In certain embodiments, plain dyestuff (the Integrated DNA Technologies of family of the optional autofluorescence of described fluorescence part, Inc., Coralville, IA), many halogen fluorescein family dyestuff, chlordene fluorescein family dyestuff, dyestuff (the Molecular Probes of tonka bean camphor family, Inc., Eugene, Or), rhodamine family dyestuff (Integrated DNA Technologies, Inc.), Hua Jing family dyestuff, piperazine family dyestuff, thiazine family dyestuff, squaraine family dyestuff, chelating lanthanon family's dyestuff and BODIPY  family dyestuff (Molecular Probes, Inc.).In a kind of preferred embodiment, described fluorescence partly is 6-Fluoresceincarboxylic acid (FAM ^TM) (IntegratedDNA Technologies, Inc.).Other fluorescence part example that can be applicable to probe of the present invention, method and test kit can be referring to by the complete United States Patent (USP) that is incorporated herein by reference 6,406,297,6,221,604,5,994,063,5,808,044,5,880,287,5,556,959 and 5,135,717.

In other embodiments, but but described test section can be different test sections with the fluorescence part.In the middle of radioactive segment, preferred ³²The compound of P-mark.Do not add restriction, any means well known by persons skilled in the art all can be used to ³²P imports in the probe.For example, can probe mark be had by utilizing kinases to carry out 5 ' mark or inserting nick translation at random ³²P.But the test section that itself is enzyme typically can be detected by their activity.For example, can be by measuring this enzyme of fluoroscopic examination that suitable substrate compounds effect is produced by alkaline phosphatase.But, can combine during with the integral part of specific binding partner, detect the existence of described probe by the specificity of detection molecules with the integral part of this specific binding partner as the test section.For example, antigen can be connected with described probe, then can adopt this antigen is had specific this antigenic existence of monoclonal antibody detection, and then determine the existence of described probe.But other specific binding partner that can be used as the test section comprises vitamin H and avidin or streptavidin, IgG and A albumen, and many other receptor-ligands well known in the art are right.But other test section example of non-fluorescence part can be referring to by the complete United States Patent (USP) that is incorporated herein by reference 5,525,465,5,464,746,5,424,414 and 4,948,882.

But above to the description of test section and do not mean that multiple mark is divided for different sorts, because same tag may play a role with some kinds of different modes.For example, ¹²⁵I can serve as radioactive segment or the sub-reagent of cipher telegram.Horseradish peroxidase can serve as the antigen of enzyme or monoclonal antibody.In addition, but can be with multiple test section applied in any combination, with the performance predictive role.For example, available biotinylated probe, and with being marked with ¹²⁵The avidin of I or the antibiotin monoclonal antibody that is marked with horseradish peroxidase detect the existence of this probe.Other conversion and possibility should be that those of ordinary skills are understandable, and are considered to belong to the equivalent of category of the present invention.

But but but above-mentioned test section is connected with probe or the bonded method depend on certainly adopted test section type and should the position of test section on probe.

Can but described test section directly or indirectly be linked to each other with probe by multiple technologies.But according to the accurate type of adopted test section, but should test section can be positioned at probe 5 ' or 3 ' terminal, be positioned at probe nucleotide sequence inside, or link to each other with composition with the spacerarm of different sizes, be beneficial to the interaction of signal.The phosphoramidite reagent that utilization obtains by the commercial channel; can be by means of having the oligonucleotide of functional group's (for example sulfydryl or primary amine) at arbitrary end through the preparation of the phosphoramidite of due care, but and the method for describing among the PCR Protocols:A Guide to Methods and Applications that edits by people such as Innis that can adopt that Academic Press for example publishes make it be connected with the test section.

United States Patent (USP) 4,914,210 have described the method that imports the oligonucleotide functionalized reagent, one or more sulfydryls, amino or hydroxylic moiety can be imported in the described sequence oligonucleotide probe, typically import 5 ' end in this sequence.By utilize polynucleotide kinase and [γ- ³²P] ATP, 5 ' phosphate group can be imported as radio isotope, so that reporter group to be provided.By making the N-hydroxy-succinamide ester reaction of the amino thymidine residue that imports between synthesis phase or alkylamino joint and vitamin H, vitamin H can be added 5 ' end.But make other method that the test section that comprises fluorescence part links to each other with probe can be referring to by the complete United States Patent (USP) that is incorporated herein by reference 5,118,802.

Also might be by application examples such as polynucleotide terminal enzyme (DNA), to add such as, cordycepin for example ³⁵The desired part of S-dATP and biotinylation dUTP, thus but the test section is connected 3 ' end of described probe.

But oligonucleotide derivative also is the test section that can be used in probe of the present invention, method and the test kit.For example, ethene-dA and ethene-A all are known fluorescence adenine nucleotides that are impregnated in the oligonucleotide probe.Equally, ethene-dC is that another kind can be applicable to probe synthetic analogue.The probe that comprises this nucleotide derivative can be had the polysaccharase degraded of 5 '-3 ' nuclease by for example, discharges the mononucleotide that fluorescence far is better than complete probe.

In certain embodiments of the invention, but probe can be labeled the test section more than.In some such embodiment, each test section all can link to each other with the different bases of described probe individually.In other embodiments, but can link to each other with the identical base of described probe more than one test section.

In certain embodiments, but described test section can with 5 ' terminal linking to each other of probe.In other embodiments, but described test section can on the residue position in distance probe 5 ' terminal 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30, about 35 or about 40 the residue scopes, link to each other with probe.In certain embodiments, but the test section can with 3 ' terminal linking to each other of probe.In other embodiments, but described test section can on the residue position in distance probe 3 ' terminal 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30, about 35 or about 40 the residue scopes, link to each other with probe.But should can link to each other with the arbitrary portion of probe residue the test section.For example, but the test section can link to each other with sugar, phosphoric acid or the base portion of probe nucleotide.In other embodiments, but described test section can be connected between two residues of probe.

In certain embodiments of the invention, described probe can comprise fluorescence part and quencher part.In these embodiments, the fluorescence part can be any fluorescence part well known by persons skilled in the art as mentioned above.In addition, do not add restriction, the quencher part can be any quencher part well known by persons skilled in the art.In certain embodiments, the plain family of the optional autofluorescence of quencher part dyestuff, many halogen fluorescein family dyestuff, chlordene fluorescein family dyestuff, tonka bean camphor family dyestuff, rhodamine family dyestuff, Hua Jing family dyestuff, piperazine family dyestuff, thiazine family dyestuff, squaraine family dyestuff, chelating lanthanon family's dyestuff and BODIPY  family's dyestuff and non-fluorescence quencher part.In certain embodiments, non-fluorescence quencher part can be BHQ ^TMFamily's dyestuff (comprising WO 01/86001 described quencher), IowaBlack ^TMOr Dabcyl (Integrated DNA Technologies, Inc.).Other specificity quencher part example includes but not limited to, for example TAMRA (N, N, N ', N '-tetramethyl--6-carboxyl rhodamine) (Molecular Probes, Inc.), DABCYL (4-(4 '-dimethylamino phenylazo) phenylformic acid), Iowa Black ^TM(Integrated DNATechnologies, Inc.), Cy3 ^TM(Integrated DNA Technologies, Inc.) or Cy5 ^TM(Integrated DNA Technologies, Inc.).In a kind of preferred embodiment, quencher partly is Cy5 ^TMOther quencher part example that can be applicable to probe of the present invention, method and test kit can be referring to by the complete United States Patent (USP) that is incorporated herein by reference 6,399,392,6,348,596,6,080,068 and 5,707,813.

In certain embodiments, the quencher part can (link to each other with 5 of probe ' end.In other embodiments, the quencher part can be connected on the residue at probe 5 ' terminal 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30, about 35 or about 40 residue places.In certain embodiments, the quencher part can link to each other with 3 of probe ' end.In other embodiments, the quencher part can link to each other with probe at the residue place in distance probe 3 ' terminal 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30, about 35 or about 40 the residue scopes.In a kind of preferred embodiment, fluorescence partly is connected 5 ' end of probe, and quencher part then is connected on the residue in probe 5 ' terminal about 9 residue scopes.The quencher part can link to each other with the arbitrary portion of probe residue.For example, the quencher part can link to each other with sugar, phosphoric acid salt or the base portion of probe nucleotide.In other embodiments, the quencher part can be connected between two residues of probe.

Though do not want to be subject to any specific theory or mechanism of action, when probe was complete, the photon that fluorescence is partly launched still was considered to and can be partially absorbed and quencher by quencher.This quencher partly then discharges photon energy with the form or the hot form of different wave length photon.Therefore, the quencher part also can be the fluorescence part.As mentioned above, this phenomenon is called as FRET (fluorescence resonance energy transfer) (" FRET ").The cracking of probe between fluorescence part and quencher part causes the minimizing of quencher part to the quencher of fluorescence part institute emitting fluorescence.

Usually, the energy between fluorescence part and the quencher part shifts the distance that depends between this fluorescence part and the quencher part and the specific right critical transfer distance of fluorescence part-quencher part.This critical transfer distance is feature and the constant with the known fluorescence part of known quencher portion paired.In addition, when the right critical transfer distance of fluorescence part-quencher part near between this fluorescence part and the quencher part apart from the time, just can determine fluorescence part and quencher spatial relation partly more delicately.Correspondingly, skilled practitioners can be selected fluorescence part and quencher part, and having specific critical transfer distance, fluorescence is partly close with quencher separation distance partly on this distance and the probe.The specific right critical transfer distance of fluorescence part-quencher part is well known in the art, can be referring to for example, by the complete Wu that is incorporated herein by reference and Brand 1994, the paper among the Anal.Biochem.218:1-13.

For specific fluorescent part-quencher part to other standard for example comprise the quantum yield of fluorescence part emitted fluorescence; The wavelength of fluorescence part emitted fluorescence; The optical extinction coefficient of quencher part; The wavelength of quencher part emitted fluorescence, if any; And the quantum yield of quencher part emitted fluorescence, if any.In addition,, can preferably partly select, one of them part emitted fluorescence and another part emitted fluorescence be distinguished being easy to this quencher part and fluorescence if quencher part also is the fluorescence part.With select specific fluorescent part-quencher partly to relevant further guidance can referring to by the complete Klostermeier that is incorporated herein by reference and Millar 2002, the summary paper among the Biopolymers61:159-179.

Can be applicable to the fluorescence part of this aspect of the present invention and the typical combination of quencher part and include, but not limited to fluorescence part rhodamine 590 and quencher partial crystallization purple.A kind of preferably combination of fluorescence and quencher part is fluorescence part 6-Fluoresceincarboxylic acid and quencher portion C y5 ^TMOther fluorescence part-quencher part that can be applied in probe of the present invention, method and the test kit can be referring to by the complete United States Patent (USP) that is incorporated herein by reference 6,245,514 to example.

Can be used as fluorescence and quencher certain applications and comprise fluorescein, 6-Fluoresceincarboxylic acid, 2 ' 7 '-dimethoxy-4 ' ' 5 '-two chloro-6-Fluoresceincarboxylic acids, rhodamine, 6-carboxyl rhodamine, 6-carboxyl-X-rhodamine and 5-(2 '-amino-ethyl) amino naphthalenes-1-sulfonic acid (EDANS) in the branch sub-instance of FRET.Or, fluorescence part donor acceptor partly determines actually exciting with emmission spectrum and with its paired fluorescence according to it.For example, FAM ^TMBe to be that the light of 488nm excites the most effectively, and emmission spectrum is the light of 500-650nm, and maximum emission wavelength is 525nm by wavelength.Correspondingly, FAM ^TMBe to be fit to the fluorescence part used with the TAMRA that is 514nm as quencher part and maximum excitation wavelength.

In certain embodiments, adopted following probe variant: FGGACTAGAIGGTTAGAGGAGACCCCGCGGP (variant of sequence shown in the SEQ ID NO:28); FGGAEUAGAIGGUUAGAGGAGAEEEEGEGGP (variant of sequence shown in the SEQ ID NO:28); FGGGTCTCCITCTAACCTCTAGTCCTTCCCCCP (variant of sequence shown in the SEQ ID NO:70); FGGGUEUEEIUEUAACCTCTAGTCCTTCCCCCP (variant of sequence shown in the SEQ IDNO:70) and FGGTCTAGAIGGTTAGAGGAGACCCTCCAGP (variant of sequence shown in the SEQ ID NO:25).In all these probes, F=CY5, I=FAM, P=PO4, U=proyl dU, E=5-methyl-dC).

Detectable japanese encephalitis virus serogroups member's nucleic acid

Primer of the present invention, probe, method and test kit are used to detect some member of Flavivirus.Particularly, these primers, probe, method and test kit are used to detect the member of japanese encephalitis virus serogroups.For example, the japanese encephalitis virus serogroups member that can detect according to the present invention includes, but are not limited to japanese encephalitis virus, west nile virus, Murray river valley encephalitis, SLEV and Kunjin virus.In some cases, the complete sequence of at least one bacterial strain of above-mentioned some virus is determined.By just finding these sequences, Figure 4 shows that the contrast of japanese encephalitis virus serogroups member's nucleotide sequence and oligonucleotide of the present invention with reference to GenBank numbering shown in Figure 4.The genomic nucleotide sequence of each flavivirus according to numbering identification shown in Figure 4 is incorporated herein by reference by complete.

Other japanese encephalitis virus serogroups member, for example the genomic complete nucleotide sequence of Cacipacore virus, Saint Louis' encephalitis virus, Usutu virus and Youende virus is determined as yet.But primer of the present invention and probe still be considered to can with all japanese encephalitis virus serogroups members in have high conservative degree sequence hybridization.In addition, those skilled in the art after having determined above-mentioned virus genomic nucleotide sequence, just can easily identify can with the primer and the probe of the nucleic acid hybridization that is derived from the member that do not check order as yet.

In certain embodiments, can detect japanese encephalitis virus serogroups member's nucleic acid.In other embodiments, can detect the nucleic acid of japanese encephalitis virus.In other embodiments, can detect the nucleic acid of west nile virus.In other embodiments, then can detect the nucleic acid of Kunjin virus.In other embodiments, can detect the nucleic acid of Murray river valley encephalitis.In other embodiments, can detect the nucleic acid of SLEV.In other embodiments, then can detect the nucleic acid of japanese encephalitis virus, west nile virus, SLEV or Murray river valley encephalitis.

Nucleic acid to be checked can be to derive from any nucleic acid that detects flavivirus described herein.This nucleic acid typically is single stranded RNA, because flavivirus to be checked has normal chain single stranded RNA genome.But, nucleic acid to be checked also can be on sequence with the corresponding DNA of rna gene group that can detect flavivirus.This DNA can be by for example, prepared as the method for retrovirus RNA as described in 4.1 joints hereinafter.

Do not add restriction, in the sample in any source well known by persons skilled in the art, all can detect whether there is the nucleic acid that can detect flavivirus.For example, can in biological sample defined above, detect described viral nucleic acid.At any natural origin, comprise such as in fish, Amphibians, Reptilia, bird or mammiferous vertebrates and the sample such as the invertebratess of insect, crustacean, arthropods etc. source, all can detect the existence of described viral nucleic acid.In addition, sample to be checked can derive from abiotic material, such as water or pedotheque or swipe sample, such as the sample that is obtained by the surface check.

In certain embodiments of the invention, can be according to the method known to those skilled in the art nucleic acid to be checked that increases.This amplification can be carried out before detecting according to methods described herein, perhaps carried out simultaneously with detection as herein described.The method of amplification of nucleic acid is as described below, and can be referring to for example by the complete Saiki et al. that is incorporated herein by reference, 1988, Science 239:487-91.

3.4. other can detect the nucleic acid of flavivirus

Probe of the present invention, method and test kit also can be used to detect and derive from other flavivirus, include but not limited to the nucleic acid of dengue fever virus, Meng Taina mouse ear bat leukoencephalitis virus, Modoc virus and yellow fever virus.The same with japanese encephalitis virus serogroups member, the nucleotide sequence of at least one bacterial strain of above-mentioned some virus is determined.By just finding these sequences with reference to numbering shown in Figure 5, Figure 5 shows that the contrast of sequence shown in above-mentioned nucleotide sequence that detects flavivirus and the SEQ ID NO:16.The genomic nucleotide sequence of each flavivirus according to GenBank numbering shown in Figure 5 identification all is incorporated herein by reference by complete.

As described herein, primer SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55 all are used for amplification and/or detect dengue fever virus, primer SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62 and SEQ ID NO:63 are used for amplification and/or detect yellow fever virus.

3.5. detect the polynary amplified reaction of different virus variant or different virus

Primer of the present invention and probe can be in reaction applied in any combination, to detect more than a kind of viral nucleic acid.For example, in some cases, multiple upstream and/or multiple downstream primer can be combined in a kind of reaction mixture, be used to detect the different virus variant (for example by single primer or primer to can't detect or only can faint detected viral variants).In certain embodiments, multiple upstream and/or multiple downstream primer can be combined in a kind of reaction mixture, to be used to detect the virus more than a kind of.In these embodiments, comprised in the reaction mixture that each virus to be checked is all had specific primer, thereby each viral nucleic acid in the sample that can increase.For example, detect the difference of virus, can comprise the arbitrary combination of the primer of be used to increase west nile virus, SLEV, dengue fever virus and yellow fever virus according to need.Adopting single reaction to detect multiple virus is useful in following situation, and for example when the screening blood products or in other situation, i.e. the pollution of any virus all needs when detected.

Probe of the present invention can be used in the above-mentioned reaction.The result of Huo Deing can adopt the single probe that can detect the viral nucleic acid product that may exist arbitrarily as required.Alternatively, can adopt can with the different probe of each viral nucleic acid product specific hybrid that may exist.In these situations, use different detectable labels together with each probe and help to distinguish the viral nucleic acid product.

In certain embodiments, can adopt polynary PCR and utilize above-mentioned composition to detect multiple viral nucleic acid.Polynary PCR can increase in same reaction and/or detect multiple polynucleotide passage.Referring to for example, PCR PRIMER, A LABORATORY MANUAL (Dieffenbach, ed.1995) Cold Spring Harbor Press, pages 157-171.

In certain embodiments, adopted the primer that can be used for detecting west nile virus and SLEV.In certain embodiments, adopted the primer that can be used for detecting west nile virus, SLEV and dengue fever virus.In certain embodiments, adopted the primer that can be used for detecting west nile virus, SLEV and yellow fever virus.In certain embodiments, then adopted the primer that can be used for detecting west nile virus, SLEV, yellow jack and dengue fever virus.In some cases, multicomponent reaction further comprises at least a probe as herein described.

4. the nucleic acid to Japanese encephalitis serogroups member and some other flavivirus detects and/or quantitative methods

In certain aspects, the invention provides the method for utilizing nucleic acid primer and some flavivirus nucleic acid of probe in detecting.In aspect other, the invention provides the method for utilizing the nucleic acid of some flavivirus in nucleic acid primer and the probe quantitative sample.Do not add restriction, the known any means of nucleic acid primer and probe in detecting nucleic acid of utilizing of those skilled in the art all can be used to detect the above-mentioned nucleic acid that detects flavivirus.In certain embodiments, described method is utilized primer and probe in detecting japanese encephalitis virus serogroups member's nucleic acid.In other embodiments, described method is utilized two kinds of primers and a kind of probe in detecting japanese encephalitis virus serogroups member's nucleic acid.In other embodiments, described method is then utilized some flavivirus of probe in detecting, and is as described below.

4.1. with the reaction of 5 ' nuclease serves as that the basis is detected and/or the quantitatively test of Japanese encephalitis serogroups member nucleic acid

Of the present invention aspect some in, described method comprises the nucleic acid with primer and probe in detecting japanese encephalitis virus serogroups member.These methods generally include to make with the primer of japanese encephalitis virus serogroups member's nucleic acid hybridization and contact with the enzyme with 5 ' nuclease.This enzyme with 5 ' nuclease then makes the probe fracture with japanese encephalitis virus serogroups member's nucleic acid hybridization in the reaction of 5 ' nuclease.But available this probe of test section mark that is used for the detection probes fracture.This method is based on by the complete United States Patent (USP) that is incorporated herein by reference 6,214,979,5,804,375,5,487,972 and 5,210,015 described method.

Do not add restriction, in the reaction of 5 ' nuclease, described nucleic acid, primer and probe can contact with any enzyme with 5 '-3 ' nuclease known in the art.Optimum condition can make this probe of polysaccharase cracking and make described nucleic acid discharge a plurality of fragments of probe.Preferred enzyme with 5 ' nuclease comprises template dependent form nucleic acid polymerase.Known natural and this polysaccharase recombinant forms for example comprises, and e. coli dna polymerase I (Fermentas, Inc., Hanover, MD), bacillus stearothermophilus archaeal dna polymerase and Thermococcus littoralis archaeal dna polymerase.

In preferred embodiments, the enzyme with 5 ' nuclease is to have thermostability and thermoactive nucleic acid polymerase.This heat-stabilised poly synthase includes but not limited to derive from multiple Eubacterium, the polysaccharase of the natural and recombinant forms of the heat of promptly dwelling, dwell thermobacillus and high warm sleeve Pseudomonas.For example, can be applicable to the hot bacterial classification polysaccharase of dwelling of the inventive method comprises by the complete United States Patent (USP) that is incorporated herein by reference 5,405,774,5,352,600,5,079,352,4,889,818,5,466,591,5,618,711,5,674,738 and 5,795,762 described thermus aquaticus (Taq) archaeal dna polymerases, thermus thermophilus (Tth) archaeal dna polymerase, dwell hot bacterial classification Z05 (Z05) archaeal dna polymerase and the hot bacterial classification sps17 (sps17) of dwelling.The thermobacillus of dwelling that can be applicable to the inventive method belongs to polysaccharase and comprises for example Thermotoga maritima archaeal dna polymerase and Thermatoganeapolitana archaeal dna polymerase, and a high warm sleeve Pseudomonas polysaccharase example that may be utilized is a Thermosipho africanus archaeal dna polymerase.The sequence of Thermotoga maritima and Thermosipho africanus archaeal dna polymerase is disclosed by the complete International Patent Application PCT/US91/07035 that is incorporated herein by reference and publication WO 92/06200.By complete 97/09451 sequence that discloses Thermatoganeapolitana of international monopoly publication WO that is incorporated herein by reference.

5 ' nuclease reaction comprises that the enzyme that makes nucleic acid to be checked and primer, probe and have 5 '-3 ' nuclease contacts under given conditions, this condition be described primer and probe can with the condition of this nucleic acid hybridization.Each component of 5 ' nuclease reaction can any order contact with nucleic acid to be checked, for example, nucleic acid to be checked can at first contact with primer, then contact with enzyme with 5 ' nuclease with probe, perhaps alternatively, nucleic acid to be checked at first contacts with the enzyme with 5 ' nuclease, then contacts with primer with probe.In certain embodiments, can in the reaction of 5 ' nuclease, add more than a kind of primer or probe.In some preferred embodiment, the nucleic acid in 5 ' the nuclease reaction can with primer to contacting.Primer can be the arbitrary primer that can cause synthesis reaction of DNA.When only adopting a kind of primer, this primer should with the nucleic acid upstream hybridization of described probe, promptly 3 ' of this primer end should point to 5 ' end of probe.3 ' end of described primer can be hybridized with the consecutive position of probe 5 ' end, and perhaps 3 ' end of this primer can be hybridized with the more upstream position of probe 5 ' end.Employing is during more than a kind of primer, as mentioned above, at least a primer should with the nucleic acid hybridization to be checked of probe upstream.

Some embodiment of 5 ' nuclease reaction of the present invention is based on some 5 ' nuclease reactions well known by persons skilled in the art.The example of these reactions is obtained in the complete United States Patent (USP) that is incorporated herein by reference 5,210,015 describing in detail for example.

In brief, in the reaction of 5 ' nuclease, target nucleic acid contacts with probe with primer under given conditions, and this condition is the condition of primer and probe and the hybridization of described nucleic acid chains.This nucleic acid, primer and probe also with the enzyme with 5 '-3 ' nuclease, for example nucleic acid polymerase contact.Probe with nucleic acid downstream hybridization of the nucleic acid polymerase cleavable of 5 '-3 ' nuclease and described primer.3 of this primer ' end provides the substrate that extends new nucleic acid based on the template nucleic acid of nucleic acid polymerase.When this polymerase extension new nucleic acid, run into the 5 ' terminal and begin the fragment of this probe of cracking of probe.

Can design described primer and probe, make they under approximating state with target nucleic acid hybridization, described nucleic acid polymerase and combining of primer 3 ' end then make the 5 ' end that it can contact probe.In the method, must not carry out nucleic acid and extend bringing described nucleic acid polymerase into specific position, and realize cracking.This process is called as term and " does not rely on the cracking of polymerization ".

Alternatively, if described primer and probe are annealed to the zone of farther distance in the described nucleic acid, then nucleic acid extends and must run into probe 5 ' terminal generation before at described nucleic acid polymerase.When polymerization continued, polysaccharase began crack fragment gradually from probe 5 ' end.The remainder that this cracking lasts till probe is unstable till specific degrees, this degree be its can with the dissociated degree of template molecule.This process is called as " relying on the cracking of polymerization ".

The advantage of cracked that does not rely on polymerization is need not amplification of nucleic acid.When lacking primer extension, the chain of nucleic acid is strand basically.If described primer and probe are adjacent to combine with described nucleic acid, just can circulate sequentially oligonucleotide annealing and fragment cracking take place.Therefore, can make the probe fracture of capacity,, and then can under the situation that lacks polymerization, realize detecting with the acquisition detectable signal.

In above-mentioned arbitrary method, the sample that is provided includes described nucleic acid.If this nucleic acid is double-stranded, should for example make the chain of this nucleic acid separated from one another at first by sex change.Do not add restriction, any appropriate denaturation method well known by persons skilled in the art comprises that physics, chemistry or enzymatic means all can be used to the described nucleic acid chains of dissociating.The preferred physical method of chain of being used to dissociate is that heating nucleic acid is until its (＞99%) sex change fully.Typical thermally denature is included in about 80 ℃ and arrives about 105 ℃ temperature range internal heating about 10 seconds to about 10 minutes.Optional method with respect to sex change is, nucleic acid can single stranded form be present in the sample, such as for example, and single stranded RNA or dna virus.

Should be pointed out that the virus that available primer of the present invention, probe, method and test kit detect is the strand positive chain RNA virus.Correspondingly, when detecting the viral genome of not amplification, need not to make the sex change of natural viral genome.But, following some embodiment according to the present invention is DNA if the natural viral genome is reversed record, then must make the viral nucleic acid sex change of amplification before with primer of the present invention and probe in detecting.

If nucleic acid to be checked is RNA, this RNA can be used as the RNA template and is used to the reaction of above-mentioned 5 ' nuclease, perhaps can be used as template and is reversed record and is cDNA, or participate in this two processes simultaneously.In certain embodiments, utilizing the inventive method can detect described RNA, is cDNA and need not its reverse transcription.The above-mentioned cleavage method that does not rely on polymerization is particularly useful for this embodiment.In other embodiments, described RNA can at first be reversed record for cDNA under probe shortage condition, then just can detect the cDNA product according to the inventive method.In other embodiments, described RNA can be reversed record under the probe existence condition, generates the cDNA that can be amplified subsequently and/or detect simultaneously, by the fracture of assessment probe as described herein, just can determine the existence of described RNA.

When described RNA is reversed record under probe shortage condition, can this RNA reverse transcription be advanced among the cDNA by any means well known by persons skilled in the art.Then just can detect the product of this reverse transcription according to methods described herein as detecting nucleic acid arbitrarily.

Under the probe existence condition during the described RNA of reverse transcription, has 5 '-3 ' nuclease and RNA carries out this RNA of DNA chain synthetic archaeal dna polymerase reverse transcription for template but can utilize.The same with all known archaeal dna polymerase composite reactivies, this synthetic participation that needs primer is such as those primers as herein described.The preferred archaeal dna polymerase that can RNA be template has thermostability, thereby can carry out a plurality of round-robin sex change and DNA is synthetic under the condition of not destroying this polysaccharase.In addition, the archaeal dna polymerase that is used to reverse transcription also can preferably utilize the dna profiling synthetic DNA.For example, by the complete United States Patent (USP) that is incorporated herein by reference 6,468,775 (Carboxydothermus hydrogenformans archaeal dna polymerase), 5,968,799 (Thermosipho africanus archaeal dna polymerases), 5,736,373 (Bacilluspallidus archaeal dna polymerases), 5,674, in 738 (hot bacterial classification Z05 archaeal dna polymerases of dwelling) and 5,407,800 (thermus aquaticus and the thermus thermophilus archaeal dna polymerases) this polysaccharase has been described.In addition, by the complete United States Patent (USP) that is incorporated herein by reference 5,693,517,5,561,058,5,405,774,5,352,600,5,310,652 and 5,079,352 have described and have utilized the method and composition with the active heat-stable DNA polymerase reverse transcription of reverse transcription RNA.

No matter be RNA or DNA, the nucleic acid chains of sex change all then contacts with probe with primer under the specific cross condition, and this hybridization conditions can make described primer and probe combine with described nucleic acid chains.In certain embodiments, can adopt two kinds of described nucleic acid of primer amplification.In these embodiments, can select described two kinds of primers, make them specific along the relative position of described nucleic acid, can be by the synthetic extension products of a kind of primer wherein, this extension products is with after its template (complementary sequence) is separated, just the template that can serve as another kind of primer extension is to obtain to determine the amplified production of length.The length of this product depends on two kinds of sequence lengths between the primer, and the length of these two kinds of primers self.

Because complementary strand is typically long than probe or primer, this chain has more point of contact, and is obtaining more can the discovery each other and the bonded chance in the known time section arbitrarily.The probe of too high molar weight and primer help to make balance to shift to primer and probe annealing, rather than template annealing.

Described primer is answered sufficiently long, just can cause the synthetic of extension products under polymerization agents useful for same existence condition.The exact length of this primer and composition can be depending on many factors, comprise the degree of approach and the primer in temperature, primer source and composition, probe annealing site and the primer annealing site of annealing reaction: the concentration and probe concentration ratio.For example, according to the complicacy of described sequence, Oligonucleolide primers typically has about 15-30 Nucleotide, but also may have still less or more Nucleotide.Described primer must be fully complementary, just optionally is annealed to their corresponding chain and forms stable duplex.

Can select each primer, so that chain " basically " complementation of itself and described nucleic acid.This primer need not to reflect the accurate sequence of template, but must be fully complementary, just can be under proper reaction conditions corresponding chain selective cross with it.Incomplementarity base or longer sequence can be disperseed to advance perhaps to be positioned at the end of primer in the primer, make this primer keep also forming stable duplex with it with the abundant complementarity of its template strand.The incomplementarity nucleotide sequence of primer may comprise restriction enzyme sites.All incomplementarity nucleotide sequences all preferably are not positioned at 3 ' end of primer.

Described probe preferably polysaccharase and described nucleic acid and primer combines and based on the template that can detect nucleic acid after primer extension new nucleic acid chain just with nucleic acid hybridization to be checked.Polysaccharase is possible in conjunction with primer and nucleic acid to be checked with detecting nucleic acid at probe before contacting; But, this arrangement can cause probe fracture to reduce, unless just carry out a plurality of round-robin primer extensions can, the situation in preferably reacting as will be explained hereinafter based on the 5 ' nuclease of PCR.Correspondingly, probe preferably before polysaccharase begins primer extension with nucleic acid hybridization to be checked.

Multiple technologies well known by persons skilled in the art all can be used to improve the possibility of following situation, be that probe is before the primer extension polymerization arrives this duplex zone, or polysaccharase in the process that does not rely on polymerization with before upstream oligonucleotide links to each other, and can detect nucleic acid hybridization.For example, the short primer molecule needs colder temperature usually, just can form fully stable heterozygosis complex body with described nucleic acid.Therefore, can must be longer than primer with probe design, make probe preferably be annealed to described nucleic acid under the temperature required high temperature than primer annealing.

Also can form and utilize primer and probe with differing thermal stabilities according to the Nucleotide of primer and probe.For example, can select to have the probe that therefore higher G/C content also have the thermostability higher than primer.Alternatively or additionally, one or more modifications, non-standard or derived dna base can be mixed in primer or the probe, it is compared with primer that only has conventional DNA base or probe, have higher or lower thermostability.The example of this modification, the non-standard or base of deriving can be referring to by the complete United States Patent (USP) that is incorporated herein by reference 6,320,005,6,174,998,6,001,611 and 5,990,303.

In addition, also can change temperature of reaction, to utilize the differing thermal stabilities of probe and primer.For example, after sex change under the above-mentioned high temperature, can not allow incubation reaction under the primer bonded medium temperature, further reduce temperature then and make primer annealing and then extension allowing the probe combination.

For primer concentration, the concentration and probe concentration of too high molar weight also can be preferably used for impelling probe to realize combination before primer.This concentration and probe concentration is typically than being generally 0.5-5 * 10 ^-7The high approximately 2-20 of the corresponding primer concentration of M doubly.

The template dependent form of described Oligonucleolide primers extend be by archaeal dna polymerase in the reaction medium that comprises suitable salt, metallic cation and pH buffer system, and at four kinds of deoxyribonucleoside triphosphate (dATP of capacity, dGTP, dCTP and dTTP) or analogue, for example catalytic under the dUTP existence condition.But suitable polymerizing agent is the enzyme that known catalysis primer and template dependent form DNA synthesize and have 5 '-3 ' nuclease.This kind of enzyme for example comprises, e. coli dna polymerase I, thermus thermophilus archaeal dna polymerase, bacillus stearothermophilus archaeal dna polymerase, Thermococcus littoralis archaeal dna polymerase, thermus aquaticus's archaeal dna polymerase and Z05 archaeal dna polymerase.In addition, it is known in the art utilizing these archaeal dna polymerases to carry out DNA synthetic reaction conditions.In order to be applicable to the inventive method, polymerizing agent should have effectively cracking oligonucleotide and the segmental 5 ' nuclease of release mark, with direct or indirect generation detectable signal.

The duplex molecule that this synthetic product is made up of template strand and primer extension chain.The probe fragment that this synthetic by product is made up of single, double and oligonucleotide fragment mixture.In preferred embodiments, can carry out sex change, probe and primer annealing, primer extension and the probe cracking of recirculation, amplification region and the index determined by primer with exponential accumulation generate labeled fragment.This repeated thermal cycles is commonly called polymerase chain reaction (PCR) in this area.Can circulate fully with the probe of fracture capacity, to distinguish positive reaction and negative reaction, the former is the reaction of carrying out under the nucleic acid existence condition to be checked, and the latter then is the reaction of carrying out under the non-existent condition of nucleic acid to be checked.

In some preferred embodiment, the PCR reaction is to carry out with the form of the automation process of utilizing thermophilic enzyme.In this process, reaction mixture has passed through the circulation that comprises denaturing step, probe and primer annealing step and synthesis step, thereby is able to the extension of primer dependent form template cracking and displacement take place simultaneously.Can use through particular design and can utilize the thermal cycler of thermophilic enzyme, such as ABI 3700 (Applied Biosystems, Inc., Foster City, CA).In some such embodiment of the present invention, the nucleic acid to be checked that can increase under the condition that lacks the detectable label probe then detects this amplified production in separating reaction.Alternatively, the nucleic acid to be checked that can increase under the probe existence condition is to realize amplification and to detect in single reaction.

Heat-stabilised poly synthase preferably in this automation process is by they accept high temperature (about 95 ℃) at PCR cycle period chien shih because make the optimal way of double-stranded extension products sex change.For example, United States Patent (USP) 4,889,818 disclose the representative thermophilic enzyme that separates from the thermus aquaticus.Other representative heat-stabilised poly synthase for example comprises, extract self-heating stable bacterial yellow dwell hot bacterium, redness dwell hot bacterium, thermus thermophilus, bacillus stearothermophilus (optimum temperuture is lower than listed other bacterium slightly), Thermus lacteus, Thermus rubens, Thermotoga maritima, Thermococcus littoralis, red-hot methane thermophile bacteria and fierce fireball bacterium (Stratagene, La Jolla, polysaccharase CA).As mentioned above, above-mentioned some heat-stabilised poly synthase can be by RNA template synthetic DNA.Divide the period of the day from 11 p.m. to 1 a.m when detecting RNA, should adopt and promptly to have the active archaeal dna polymerase of reverse transcription by RNA template synthetic DNA according to the inventive method.

In aspect other, the inventive method also can be used to the nucleic acid of japanese encephalitis virus serogroups member in the quantitative sample.In these methods, carried out above-mentioned 5 ' nuclease reaction, and determined the fluorescence volume that is produced.Do not add restriction, can determine fluorescence volume by any means well known by persons skilled in the art.In certain embodiments, can utilize photofluorometer to determine the emitted fluorescence amount.This fluorescence volume can compare with control reaction emitted fluorescence amount.Control reaction preferably adopts identical reagent and carries out simultaneously with the reaction that sample carried out that employing has the japanese encephalitis virus serogroups member nucleic acid of known quantity.Alternatively, can compare with the typical curve of marking and drawing according to the relation of fluorescence and viral nucleic acid concentration by fluorescence part emitted fluorescence amount.Representational typical curve as shown in Figure 6.The further guidance relevant with quantitative japanese encephalitis virus serogroups member nucleic acid can be referring to published U.S. Patent application publication 2002/0058262 and European patent 1 138 780,1 138 783 and 1 138 784.

4.2. utilize other method of one or more primers and a kind of probe in detecting Japanese encephalitis serogroups member nucleic acid

Except above-mentioned 5 ' nuclease reaction, the present invention further provides other and can be used to detect the method for japanese encephalitis virus serogroups member nucleic acid, as described below.

In certain embodiments, any means of utilizing two kinds of nucleic acid primers and a kind of nucleic acid probe to detect nucleic acid well known by persons skilled in the art all can be used to detect japanese encephalitis virus serogroups member's nucleic acid.Do not add restriction, 3.1 and 3.2 described nucleic acid primers of joint and probe all can be used in the above-mentioned any means well known by persons skilled in the art.The typical amplified reaction that can be used to detect described viral nucleic acid comprises, for example polymerase chain reaction (PCR) and ligase chain reaction (LCR) (referring to United States Patent (USP) 4,683,195 and 4,683,202; PCR Protocols:A Guide to Methods and Applications (Innis et al., eds, 1990)), strand displacement amplification (SDA) (Walker, et al.Nucleic Acids Res.20 (7): 1691-6 (1992); 1-6 (1993)), amplification (Phyffer, et al., the J.Clin.Microbiol.34:834-841 (1996) of transcriptive intermediate Walker PCR Methods Appl 3 (1):; Vuorinen, et al., J.Clin.Microbiol.33:1856-1859 (1995)), based on amplification (the NASBA) (Compton of nucleotide sequence, 91-2 (1991)), rolling circle amplification (RCA) (Lisby, Mol.Biotechnol.12 (1): 75-99 (1999)) Nature 350 (6313):; Hatch et al., Genet.Anal.15 (2): 35-40 (1999)), branched DNA signal amplification (bDNA) is (referring to for example Iqbalet al., 315-320 (1999)) and Q-β replicative enzyme (Lizardi et al., Bio/Technology 6:1197 (1988)) Mol.Cell Probes 13 (4):.

An example of these methods is existence of amplification Japanese encephalitis serogroups member's nucleic acid and this nucleic acid of probe in detecting that utilization itself is molecular beacon.This probe comprises can hybridize the target recognition sequence that has on the position of complementary sequence in both sides and can form hair clip.Described molecular beacon has fluorescence part and quencher part at the end relatively of probe.This molecular beacon makes the fluorescence part partly separate with quencher with the hybridization of Japanese encephalitis serogroups member nucleic acid, thereby can detect this fluorescence part, and shows the existence of Japanese encephalitis serogroups member nucleic acid thus.Any probe of the present invention 5 ' and 3 ' terminal add some thought by those skilled in the art can form the residue of hairpin structure after, all can be used in these methods.With select and utilize the relevant further guidance of molecular beacon can referring to by the complete Tyagi that is incorporated herein by reference and Kramer 1996, the paper among the Nat.Biotechnol.14:303-308.

In another example, can adopt two kinds of primers of the present invention and a kind of probe and by nucleic acid based on the augmentation detection Japanese encephalitis serogroups member of nucleotide sequence.Amplification (NASBA) based on nucleotide sequence is the strong amplification technique that can be used to detect Japanese encephalitis serogroups member nucleic acid.In the NASBA method, adopted three kinds of enzymes, comprise reversed transcriptive enzyme, T7 RNA polymerase and RNase H.Final amplified production is the polarity single stranded RNA opposite with nucleic acid to be checked.By utilization and magnetic particle bonded target-specific capturing probe, and in conjunction with the detection probes of using the ruthenium mark and equipment (the NucliSens Reader that can measure electrochemiluminescence (ECL); BioM é rieux), just can detect this cloning RNA product.Alternatively, as mentioned above, can be by in amplified reaction, comprising above-mentioned molecular beacon probe, to detect RNA specifically in real time by the NASBA amplification.The further guidance relevant with utilizing primer of the present invention and probe can referring to by the complete Compton that is incorporated herein by reference 1991, people such as Nature 350:91-92 and Kievits are 1991, the paper among the J.Virol.Methods 35:273-86.

Other example of this method comprises 5 ' the nuclease reaction of above describing in detail.Another example of this method comprises the nucleic acid with two kinds of primer amplification Japanese encephalitis serogroups members of the present invention, then with this amplification of nucleic acid of probe in detecting of the present invention.In this method, can be utilized by those skilled in the art or adjust other examples that are used to detect japanese encephalitis virus serogroups member nucleic acid can be referring to by the complete United States Patent (USP) that is incorporated herein by reference 6,403,339,6,329,152,5,952,202 and 5,387,510.

In other embodiments, any means of utilizing nucleic acid primer and nucleic acid probe to detect nucleic acid well known by persons skilled in the art all can be used to detect japanese encephalitis virus serogroups member's nucleic acid.Do not add restriction, can in above-mentioned any means well known by persons skilled in the art, use 3.1 and 3.2 described nucleic acid primer of joint and probes.Those skilled in the art will appreciate that primer of the present invention also can be used as probe in above-mentioned some method, probe of the present invention then can be used as primer.

For example, japanese encephalitis virus serogroups member's nucleic acid can with the primer hybridization of the present invention that is combined on the solid support.Detectable label probe of the present invention can be then and nucleic acid hybridization to be checked, points out the existence of this nucleic acid thus.Alternatively, this probe can be bonded on the described solid support and be used to catch above-mentioned nucleic acid, then can make primer have detectable label and with described nucleic acid hybridization, point out the existence of this nucleic acid thus.Adopt the method with solid phase bonded probe to be disclosed in US 5,232,829 and EP 420 260 in.

Utilize another example of the method for nucleic acid primer and probe in detecting japanese encephalitis virus serogroups member nucleic acid to comprise and utilize the millimicro particle.In this method, can with two kinds of oligonucleotide of the different zones of nucleic acid to be checked hybridization, be covalently bound millimicro particle such as primer of the present invention or probe.This millimicro particle contacts with japanese encephalitis virus serogroups member's nucleic acid under hybridization conditions.If this nucleic acid exists, then this nucleic acid will combine with the oligonucleotide that described millimicro particle is connected, the macromolecule complex body that generation can be detected.Do not add restriction, can detect this complex body by any means well known by persons skilled in the art.In certain embodiments, be that precipitation by this complex body detects it.With utilize the millimicro particle can be referring to Taton et al. together with the relevant further guidance of the method for primer of the present invention and probe, 2000, Science289 (5485): 1757-60 and United States Patent(USP) Nos. 6,506,564,6,495,324,6,417,340,6,399,303 and 6,361,944.

In another example, can adopt rolling circle amplification (" RCA ") as a part that detects japanese encephalitis virus serogroups member nucleic acid method.In some embodiment of RCA method, be the polymerase extension DNA amplification ring by complementary primer.Arbitrary primer of the present invention or probe all can be used in this method.The method of cyclized DNA is well known in the art, for example comprises, under the condition that helps intramolecularly to connect the end of dna molecular is linked together.Do not add restriction, then can detect the concatermer product of single stranded product by any nucleic acid detection method well known by persons skilled in the art.For example, can utilize this concatermer product of detectable label probe in detecting of the present invention.This paper has described other method example that detects the nucleic acid of known array in detail.In other RCA embodiments, can adopt and second kind of primer of described concatermer product complementary.But this primer index amplification is present in the sequence in the cyclic DNA template.Also can utilize this amplified production of detectable label probe in detecting of the present invention by for example.The further guidance relevant with probe in detecting japanese encephalitis virus serogroups member nucleic acid with utilize primer of the present invention in the RCA method can be referring to by the complete United States Patent (USP) that is incorporated herein by reference 6,344,329,6,350,580,6,221,603,6,210,884,5,648,245 and 5,714,320, and international monopoly publication WO95/35390.

Another example of this method is the above-mentioned 5 ' nuclease reaction that does not rely on polymerization.By the complete United States Patent (USP) that is incorporated herein by reference 6,316,200,6,268,128,6,180,338,5,716,784 and 5,573,906 have described other examples that utilize primer and probe and can be utilized or adjust the method that is used to detect japanese encephalitis virus serogroups member by those skilled in the art.

In certain embodiments, but can adopt any test method of utilizing two kinds of nucleic acid primer amplification of nucleic acid and detecting this nucleic acid well known by persons skilled in the art to detect japanese encephalitis virus serogroups member's nucleic acid.Do not add restriction, can in all this methods well known by persons skilled in the art, adopt the described nucleic acid primer of 3.1 joints.In addition, those skilled in the art will appreciate that probe of the present invention also can be used as primer in above-mentioned some method.

In an example of this method, can detect japanese encephalitis virus serogroups member's nucleic acid by following method, promptly adopt at least a this nucleic acid of primer amplification that has comprised specific hairpin structure, described hairpin structure comprises fluorescence part and quencher part at 5 ' end of molecule.This primer is mixed amplified production, described fluorescence part is partly separated with quencher, thereby detected this fluorescence part.Detecting of this fluorescence part illustrates the nucleic acid that has japanese encephalitis virus serogroups member.Those skilled in the art is convenient to recognize primer of the present invention or the purposes of probe in this method by mixing additional residue to form essential hairpin structure in described primer or probe.With design with select the further guidance relevant of this primer can be referring to by the complete Nazerenko et al. that is incorporated herein by reference with probe, 1997, Nucleic AcidsRes.25:2516-2521 and Thelwell et al., 2000, Nucleic Acids Res.28:3752-3761.

In another example of this method, can adopt strand displacement amplification (" SDA ") to detect japanese encephalitis virus serogroups member's nucleic acid.In this method, the japanese encephalitis virus serogroups nucleic acid of amplification is detected by mixing specific strand primer, and this strand primer comprises fluorescence part, quencher part and with the separated transformation restriction site of these two parts.Those skilled in the art can easily recognize how arbitrary primer of the present invention or probe are modified, so that it is applicable to SDA.

In being applied to first kind of amplified reaction of SDA, primer is for example to be used to Japanese encephalitis serogroups member's the nucleic acid that increases under the sulfo-dCTP existence condition, thereby this primer has been mixed in the amplified production.Then, can adopt restriction endonuclease, in this primer, form the restriction site otch.This restriction endonuclease can not cut two chains of amplified production, because mixed sulfo-dCTP in the amplified production.Finally, can be used to cause new polyreaction, thereby 3 ' part of this chain is replaced into the otch in template strand source by primer 3 ' end that otch forms.Displacement to this chain makes the fluorescence part partly separate with quencher, thereby has stoped the quencher to this fluorescence part institute emitting fluorescence.Thus just can be by measuring the existence and/or the fluorescence volume of fluorescence, detection and/or quantitative Japanese encephalitis serogroups member's nucleic acid.With primer and probe are selected and are modified so that it is applicable to that the relevant further guidance of SDA can be referring to by the complete Little et al. that is incorporated herein by reference, 1999, Clin.Chem.45-777-784 and United States Patent (USP) 6,528,254 and 6,528,632.

In another example, can utilize amplification (" TMA ") the detection Japanese encephalitis serogroups member's of transcriptive intermediate nucleic acid.TMA utilizes the increase rna transcription amplification system of nucleic acid to be checked of RNA polymerase and reversed transcriptive enzyme.In the method, adopted the primer that has the promotor that is used for RNA polymerase among the present invention, to cause the reverse transcription of japanese encephalitis virus serogroups member RNA.The active then degradation of rna template of the RNAse of reversed transcriptive enzyme discharges the cDNA chain.Second chain is synthetic by second kind of primer initiation of the present invention, and catalytic by reversed transcriptive enzyme.RNA polymerase then is identified in the second chain synthetic promotor and begins a plurality of round-robin rna transcriptions of catalysis from this second chain.Then just can detect this RNA product, or it is taken turns the template of amplification as another.

Then can detect the RNA product of TMA by any means well known by persons skilled in the art.In certain embodiments, can adopt this RNA product of probe in detecting of the present invention.In other embodiments, can adopt and be marked with acridine-ester mark (Gen-Probe, Inc., SanDiego, this RNA product of probe in detecting of the present invention CA).Can never remove this mark on the hybridization probe by chemical process, and not disturb the mark on the hybridization probe.Therefore, in this embodiment, can determine the existence of japanese encephalitis virus serogroups member nucleic acid by detecting the existence of this acridine-ester mark.The further guidance relevant with probe with use primer of the present invention in based on the method for TMA can be referring to by the complete Arnoldet al. that is incorporated herein by reference, 1989, Clin.Chem.35:1588-1594, Miller et al., 1994, J.Clin.Microbiol.32-393-397, and United States Patent (USP) 6,335,166 and 6,294,338.

In another example, can utilize diagnosis PCR to detect japanese encephalitis virus serogroups member's nucleic acid.In this method, the existence of nucleic acid to be checked is that the template dependent form amplification by the success that the PCR product is carried out is illustrated.Usually, can determine the identity of this PCR product by the size of PCR product; Treat the PCR product that the successful amplification that checks acid will obtain known dimensions usually.Determine that the method such as the nucleic acid size of PCR product is well known in the art, for example also comprise gel and capillary electrophoresis etc.

The successful amplification that detects the PCR product shows thus also that other method that has Japanese encephalitis serogroups member comprises and utilizes non-specific dna binding dye.For example, can in amplified reaction, comprise SYBR  green (Molecular Probes, Inc., Eugene, OR), with detect and quantitative PCR during any double-stranded DNA of generating.The example of this method can be referring to by the complete United States Patent (USP) that is incorporated herein by reference 6,323,337 and 5,863,753.

At last, by the complete United States Patent (USP) that is incorporated herein by reference 6,528,632,6,475,729,6,361,944,6,329,152,6,270,967,6,258,546,6,063,603,6,057,099,6,040,166,5,914,230,5,843,650,5,747,255,5,747,251,5,731,146,5,712,386,5,635,347,5,554,517,5,409,818,5,384,242,4,965,188,4,868,104,4,800,159 and 4,683,195 have described and can have been utilized by those skilled in the art or adjust, to utilize other method of primer of the present invention and probe in detecting japanese encephalitis virus serogroups member.

In other embodiments, can adopt utilization well known by persons skilled in the art can with any test method of single nucleic acid primer or this nucleic acid of probe in detecting of nucleic acid hybridization, to detect japanese encephalitis virus serogroups member's nucleic acid.Do not add restriction, can in above-mentioned any means well known by persons skilled in the art, use nucleic acid primer and probe that 3.1 and 3.2 joints are described.In addition, those skilled in the art will appreciate that primer of the present invention also can be used as probe in above-mentioned some method, probe of the present invention then can be used as primer.

For example, by utilizing primer starting primer extension reaction, can detect japanese encephalitis virus serogroups member's nucleic acid.There is japanese encephalitis virus serogroups member's nucleic acid in nucleic acid polymerase to the successful extension explanation of this primer.Can illustrate that the primer extension product that has japanese encephalitis virus serogroups member detects by any means well known by persons skilled in the art.For example, this primer extension reaction can mix ³²P-mark or fluorescently-labeled Nucleotide.

Described can content application as described herein or adjusted other single primer of the method that is used to detect japanese encephalitis virus serogroups member or probe in detecting method example by those skilled in the art can be referring to by the complete United States Patent (USP) that is incorporated herein by reference 6,440,707,6,379,888,6,368,803,6,365,724,6,361,944,6,352,827,6,326,145,6,312,906,6,268,128,6,261,784,6,177,249,6,140,055,6,130,047,6,124,090,6,121,001,6,110,677,6,054,279,6,022,686,5,981,176,5,958,700,5,945,283,5,935,791,5,919,630,5,888,739,5,888,723,5,882,867,5,876,924,5,866,336,5,856,092,5,853,990,5,846,726,5,814,447,5,808,036,5,800,989,5,795,718,5,792,614,5,710,028,5,683,875,5,683,872,5,679,510,5,641,633,5,597,696,5,595,890,5,571,673,5,547,861,5,525,462,5,514,546,5,491,063,5,437,977,5,294,534,5,118,605,5,102,784,4,994,373,4,851,331,4,767,700 and 4,683,194.

Above some U.S. Patent Publication of reference can utilize one or both primers, or utilize the method for one or both primers and a kind of probe.Foregoing does not mean that these methods is categorised.For example utilized, the method that two kinds of primers that provided in the United States Patent (USP) that is described to provide the method for utilizing single primer to detect nucleic acid detect nucleic acid also is introduced into this paper as a reference, and can use with primer of the present invention, probe and test kit.

4.3. utilize the method for the nucleic acid of probe in detecting Japanese encephalitis serogroups member and some other flavivirus

Except the test method of above-mentioned detection japanese encephalitis virus serogroups member nucleic acid, the present invention further provides the method that detects the nucleic acid of japanese encephalitis virus serogroups member and some other flavivirus.Above 3.4 joints have been described the flavivirus that can detect according to these methods.

In certain embodiments, any means of utilizing nucleic acid probe to detect nucleic acid well known by persons skilled in the art all can be used to detect the nucleic acid of japanese encephalitis virus serogroups member and some other flavivirus.Above 3.2 joints have been described the nucleic acid probe of the nucleic acid that can be used to detect japanese encephalitis virus serogroups member and some other flavivirus.

In certain embodiments, can adopt probe of the present invention and by determining that whether this probe combines with the virus sequence that exists in the sample, to determine whether to exist in this sample the virus sequence of the nucleic acid of japanese encephalitis virus serogroups member and some other flavivirus.For example, can adopt the Dot blot form to realize this detection.In the Dot blot form, unlabelled amplification sample combines with solid support such as film, then under suitable hybridization conditions with this film of label probe incubation, remove the not probe of hybridization by washing, and the monitoring filter is to detect bonding probes.When adopting a plurality of sample of single probe analysis, this Dot blot form is quite useful.By film is immersed in the probe solution, also hybridize simultaneously at the discrete location place that a plurality of samples are fixed on individual film.

When adopting a large amount of different probes, quite useful optional method is " oppositely " Dot blot form, and extension increasing sequence wherein has mark, and described probe then combines with solid support.If test method of the present invention is to be employed as the part in the one group of method that will carry out simultaneously at sample, then this form is useful.In this form, unmarked probe combines with film under suitable stringent hybridization condition and is exposed to the sample of mark.Then by under suitable stringent condition, washing, removing the not sample of mark of hybridization, and the monitoring filter, to detect binding sequence.

In microtiter plate, can carry out forward and oppositely Dot blot test easily; Referring to the U.S. Patent application of being submitted to by complete 3 days Mays in 1991 that are incorporated herein by reference 695,072, the CIP of the U.S. Patent application 414,542 that on September 29th, 1 submitted to, and the United States Patent (USP) 5,232,829 that has been awarded right.Described probe can link to each other with bovine serum albumin (BSA), for example, and by the adhesion microtiter plate, thereby with this probe stationary.

Provide detect film bind nucleic acid method and by the complete United States Patent (USP) that is incorporated herein by reference 6,383,756 in, the another kind of method example that utilizes the nucleic acid of probe in detecting japanese encephalitis virus serogroups member of the present invention and some other flavivirus has been described.

In another example, can adopt the nucleic acid that detects japanese encephalitis virus serogroups member based on the method for branched DNA.In these methods, dendron shaped polymer monomer is made of two DNA chains, and the centre portions of these two chains is shared a sequence complementary region.When these two chain annealing formed above-mentioned monomer, the structure that obtains had and the terminal double-stranded center that links to each other of four strands.By described monomeric strand end is hybridized each other, can obtain the dendron shaped polymer by the monomer assembling, still keep many vacant strand ends simultaneously.These vacant strand ends can have the sequence of arbitrary primer of the present invention or probe.Do not add restriction, but available test section arbitrarily well known by persons skilled in the art, but ground mark dendron shaped polymer can be detected in the relevant any test section of probe as indicated above and of the present invention.

Then, can be used as probe to the dendron shaped polymer in following " Dot blot " test for example.In addition, can be used as probe to the dendron shaped polymer in any means well known by persons skilled in the art, wherein this probe is directly detected.In the time can determining to have described probe, just can directly detect this probe, and need not any subsequent reactions or modification, such as Dot blot or DNA hybridization.With select and utilize can be used as probe in detecting Japanese encephalitis serogroups member or other can detect the relevant further guidance of the dendron shaped polymer s of nucleic acid of flavivirus can be referring to by the complete United States Patent (USP) that is incorporated herein by reference 6,261,779 and Nilsen et al., 1997, J.Theoretical Biology 187:273-284, Capaldi et al., 2000, Nucleic.Acids Res., 28 (7): 21e, Wang et al., 1998, J.Am.Chem.Soc.120:8281-8282 and Wang et al., 1998, Electroanalysis10 (8): 553-556.

Those skilled in the art will appreciate that probe of the present invention can with specific arbitrary primer applied in any combination, this primer optionally with the viral hybridization of available probe in detecting of the present invention.Correspondingly, applied in any combination probe of the present invention and optionally detect the method that can detect flavivirus with the arbitrary primer that can detect flavivirus hybridization should be also in category of the present invention.

Above the described any means of utilizing single primer or probe and can being used to detect japanese encephalitis virus serogroups member nucleic acid of 4.2 joints all can be used to detect above with probe of the present invention

3.4 save described other flavivirus.

5. test kit

In one aspect of the method, the invention provides the test kit of the nucleic acid that can be used to detect japanese encephalitis virus serogroups member and/or some other flavivirus.Above 3.3 joints have been described the japanese encephalitis virus serogroups member that available test kit of the present invention detects, and then 3.4 joints are described as mentioned for the nucleic acid of other flavivirus that available test kit of the present invention detects.

In certain embodiments, described test kit comprises probe of the present invention.In certain embodiments, described test kit comprises primer of the present invention.In certain embodiments, described test kit comprises the combination that is made of one or more primers of the present invention and probe.

For example, in one embodiment, described test kit comprise can with first kind of nucleic acid primer of nucleic acid hybridization shown in the SEQ ID NO.:1 and can with second kind of nucleic acid primer of nucleic acid hybridization shown in the SEQ ID NO.:9.In other embodiments, described test kit comprises the primer (for example at least a upstream and/or a kind of downstream primer) that contains specific polynucleotide, these polynucleotide can with SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQID NO:37, SEQ ID NO:3g, SEQ ID NO:39, SEQ ID NO:40 or their complementary sequence hybridization.Typical primer can be selected from, for example SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66 and SEQ ID NO:67.

In certain embodiments, described test kit comprises at least a upstream and/or a kind of downstream primer that is selected from SEQ ID NO:41, SEQ IDNO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ IDNO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54 or SEQID NO:55.

In other embodiments, described test kit comprises at least a upstream and/or a kind of downstream primer that is selected from SEQ ID NO:56, SEQ IDNO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ IDNO:61, SEQ ID NO:62 or SEQ ID NO:63.

In above-mentioned some embodiment, described test kit also comprise as described herein can with the nucleic acid probe of nucleic acid shown in the SEQ IDNO.:16 or its complementary sequence hybridization.

In certain embodiments, described test kit comprises two nucleic acid primers and nucleic acid probe that is used to detect japanese encephalitis virus serogroups member nucleic acid.Above 3.1 joints have described the nucleic acid primer that can be used as test kit integral part of the present invention in detail, and then 3.2 joints are described as mentioned for the nucleic acid probe that can be used as test kit integral part of the present invention.As mentioned above, the described probe of mark randomly.In certain embodiments, described test kit comprises heat-stable DNA polymerase.In certain embodiments, described heat-stable DNA polymerase has the reverse transcription activity.In certain embodiments, described test kit comprises with detection can detect the relevant specification sheets of flavivirus nucleic acid according to the inventive method.In other embodiments, described test kit comprises and detects the relevant specification sheets of japanese encephalitis virus serogroups member.In other embodiments, described test kit then comprises one or more containers that hold its integral part.

In certain embodiments, described test kit can contain the composition that comprises primer of the present invention.This test kit also can contain the composition that comprises probe of the present invention.This test kit can further contain the composition that comprises heat-stable DNA polymerase.The described composition of primer of the present invention or probe or heat-stable DNA polymerase that comprises can further comprise other reagent.For example, said composition can comprise suitable preservatives, the suitable buffer reagent that can regulate its pH that can stop its degraded, can change the suitable diluents of its viscosity etc.

Described test kit can comprise that also above-mentioned other is used to carry out the reagent of 5 ' nuclease reaction.In addition, described test kit can comprise the probe that is used for detection of broken and the reagent that has japanese encephalitis virus serogroups member nucleic acid is described.The test kit that can be used to detect the nucleic acid of determining sequence has been described by the complete United States Patent (USP) that is incorporated herein by reference 6,514,736,6,197,563,6,040166 and 5,641,864.Those skilled in the art can easily utilize primer of the present invention and probe that the disclosure of above-mentioned United States Patent (USP) is changed, to design other test kit that still belongs to category of the present invention.

In a word, what the present invention is directed to is the method that is used to detect japanese encephalitis virus serogroups member nucleic acid, comprising:

A) make sample under given conditions and can with the detectable label nucleic acid probe of nucleic acid shown in the SEQ ID NO.:16 or its complementary sequence hybridization, can with the primer of nucleic acid shown in the SEQ ID NO.:1 or its complementary sequence hybridization, and the template dependent form nucleic acid polymerase contact with 5 '-3 ' exonuclease activity, described specified conditions can make the condition of the described detectable label nucleic acid probe of template dependent form nucleic acid polymerization enzymatic breaking; And

B) fracture of the above-mentioned detectable label nucleic acid probe of detection, wherein there is Japanese encephalitis serogroups member's nucleic acid in the fracture of this detectable label probe explanation.

In preferred embodiments, described detectable label probe comprises at least 20 continuous nucleotides in arbitrary sequence shown in SEQ ID NO.:17, SEQID NO.:18 and the SEQ ID NO.:28 or its complementary sequence.Preferred detectable label probe comprises the fluorescence part.Preferred fluorescence partly is selected from fluorescein family dyestuff, many halogen fluorescein family dyestuff, chlordene fluorescein family dyestuff, tonka bean camphor family dyestuff, rhodamine family dyestuff, Hua Jing family dyestuff, piperazine family dyestuff, thiazine family dyestuff, squaraine family dyestuff, chelating lanthanon family's dyestuff and BODIPY  family dyestuff.A kind of fluorescence very preferably partly is the 6-Fluoresceincarboxylic acid.

For the preferred embodiment of TaqMan  test, described detectable label probe further comprises the quencher part.Preferred quencher partly is selected from fluorescein family dyestuff, many halogen fluorescein family dyestuff, chlordene fluorescein family dyestuff, tonka bean camphor family dyestuff, rhodamine family dyestuff, Hua Jing family dyestuff, piperazine family dyestuff, thiazine family dyestuff, squaraine family dyestuff, chelating lanthanon family dyestuff, BODIPY  family's dyestuff and non-fluorescence quencher part.Most preferred quencher partly is Cy5 ^TMPreferred non-fluorescence quencher partly is selected from BHQ ^TM-family dyestuff, Iowa Black ^TMOr Dabcyl.Most preferred non-fluorescence quencher partly is selected from BHQ ^TM-1, BHQ ^TM-2 and BHQ ^TM-3, in TaqMan  test, the template dependent form nucleic acid polymerase with 5 ＇-3 ' nuclease partly separates described fluorescence part with quencher the fracture of detectable label probe.Preferably can be by the fracture of the laser induced described probe of fluoroscopic examination.More preferably, when described probe is complete, the fluorescence part is partially absorbed by quencher with respect to the photon that quencher location partly can make fluorescence partly launch, and the enzyme with 5 '-3 ' nuclease partly separates described fluorescence part with quencher the fracture of this probe, thereby is detected the photon that fluorescence is partly launched.

In one approach, be utilize comprised can with first kind of primer amplification japanese encephalitis virus serogroups member's of the nucleic acid of nucleic acid hybridization shown in the SEQ ID NO.:1 nucleic acid.More preferably be to utilize the first kind of described nucleic acid of primer amplification that has comprised at least 16 continuous nucleotides in the sequence shown in the SEQ ID NO.:2.Most preferred first kind of primer comprises sequence shown in SEQ ID NO.:3 or the SEQ ID NO.:8.

When adopting the residue of process modification, preferably, No. 23 position residues of sequence shown in the SEQ ID NO.:8 are N ⁶-alkyl-Desoxyadenosine, perhaps sequence No. 23 position residues are N shown in the SEQ ID NO.:8 ⁶-methyl-Desoxyadenosine, perhaps sequence No. 24 position residues are N shown in the SEQ ID NO.:8 ⁶-alkyl-Desoxyadenosine, most preferably N ⁶-the tertiary butyl-benzyl-Desoxyadenosine.More preferably sequence No. 23 position residues are N shown in the SEQ ID NO.:8 ⁶-methyl-Desoxyadenosine, No. 24 position residues of sequence shown in the SEQ ID NO.:8 are N ⁶-the tertiary butyl-benzyl-Desoxyadenosine.

Preferred second kind of primer comprise can with the nucleic acid of nucleic acid hybridization shown in the SEQ ID NO.:9, more preferably be to comprise at least 16 continuous nucleotides in the sequence shown in the SEQ ID NO.:10, most preferably be to comprise sequence shown in SEQ ID NO.:11 or 15.When adopting through the residue modified, preferred second kind of primer comprises shown in the SEQ ID NO.:15 N of No. 24 positions in the sequence ⁶-alkyl Desoxyadenosine, most preferably N ⁶-tertiary butyl benzyl-Desoxyadenosine.

Oligonucleotide according to the present invention is primer and the probe that is used to aforesaid method.According to their location and sequence, can be with primer as probe, perhaps vice versa.Preferred oligonucleotide comprises at least 16 continuous nucleotides in arbitrary sequence shown in the SEQ ID NOs:2,9 and 17 or its complementary sequence.Other preferred oligonucleotide comprise at least 16 continuous nucleotides in arbitrary sequence shown in

SEQ ID NOs

3,4,5,6,7,8,11,12,13,14,15,18,19,20,21,22,23,24,25,26,27 and 28 or its complementary sequence.

The preferred reagent box comprises above-mentioned preferred oligonucleotide.Preferred test kit comprises

A) can with first kind of nucleic acid primer of nucleic acid shown in the SEQ ID NO.:1 or its complementary sequence hybridization

B) can with second kind of nucleic acid primer of nucleic acid shown in the SEQ ID NO.:9 or its complementary sequence hybridization; With

C) can with the nucleic acid probe of nucleic acid shown in the SEQ ID NO.:16 or its complementary sequence hybridization.Most preferred test kit comprises above-mentioned optional or preferably be labeled preferred primer and probe with modified.In addition, this test kit also comprises heat-stable DNA polymerase.This heat-stable DNA polymerase can have the reverse transcription activity.This have that the active heat-stable DNA polymerase of reverse transcription preferably is selected from Carboxydothermus hydrogenformans archaeal dna polymerase, Thermosipho africanus archaeal dna polymerase, Bacillus pallidus archaeal dna polymerase, dwell hot bacterial classification Z05 archaeal dna polymerase, thermus aquaticus's archaeal dna polymerase, thermus thermophilus archaeal dna polymerase and the hot bacterial classification sps17 archaeal dna polymerase of dwelling.

This test kit also can comprise and detect the relevant specification sheets of japanese encephalitis virus serogroups member's nucleic acid.

Another theme of the present invention is the composition that is used to detect japanese encephalitis virus serogroups member, said composition comprise can with the nucleic acid primer and the buffer reagent of nucleic acid shown in the SEQ ID NO.:1 or its complementary sequence hybridization.Preferred primer and probe are as mentioned above.

Another theme of the present invention is the method that is used for the nucleic acid of the japanese encephalitis virus serogroups member of test sample or dengue fever virus, yellow fever virus, Modoc virus or Meng Taina mouse ear bat leukoencephalitis virus, comprising:

A) make sample and can contact with the nucleic acid probe of sequence hybridization shown in the SEQ ID NO.:16; And

B) detect the hybridization of the nucleic acid of this nucleic acid probe and japanese encephalitis virus serogroups member or dengue fever virus, yellow fever virus, Modoc virus or Meng Taina mouse ear bat leukoencephalitis virus, with existing of the nucleic acid that detects japanese encephalitis virus serogroups member or dengue fever virus, yellow fever virus, Modoc virus or Meng Taina mouse ear bat leukoencephalitis virus.

Another theme of the present invention is the method that is used for the japanese encephalitis virus serogroups member nucleic acid of test sample, comprising:

A) can and have the nucleic acid of amplification japanese encephalitis virus serogroups member under the existence condition of template dependent form archaeal dna polymerase of 5 '-3 ' exonuclease activity with the nucleic acid probe of sequence hybridization shown in the SEQ ID NO.:16; And

B) detect the fracture of this probe, to detect existing of japanese encephalitis virus serogroups member's nucleic acid.

Another theme of the present invention is the method that is used to detect japanese encephalitis virus serogroups member nucleic acid, comprises

A) make sample and can contact with the nucleic acid primer or the probe of the hybridization of arbitrary sequence shown in the SEQ ID NOs.1,9,16 or 29, wherein this nucleic acid primer or probe are covalently bound with solid support under the condition of the nucleic acid that allows japanese encephalitis virus serogroups member and its hybridization;

B) make and can contact with the above-mentioned solid phase support with the detectable label primer or the probe of the hybridization of arbitrary sequence shown in the SEQ ID NOs.:1,9,16 or 29, this detectable label primer or probe are not above-mentioned and covalently bound same primers as or the probe of solid support; And

C) by detecting the hybridization of this detectable label primer or probe and japanese encephalitis virus serogroups member nucleic acid, to detect japanese encephalitis virus serogroups member nucleic acid.

Another theme of the present invention is the method that is used for the japanese encephalitis virus serogroups member nucleic acid of quantitative sample, comprising:

A) make the sample that whether has a japanese encephalitis virus serogroups member to be detected and can contact with template dependent form nucleic acid polymerase with the fluorescent mark nucleic acid probe of nucleic acid shown in the SEQID NO.:16 or its complementary sequence hybridization with 5 ＇-3 ' exonuclease activity;

B) detect the fragment amount that template dependent form nucleic acid polymerization enzymatic breaking that this fluorescent mark nucleic acid probe had 5 '-3 ' exonuclease activity is generated, wherein the Japanese encephalitis serogroups member's who exists in the amount of this fluorescence labeling probe fracture and the sample nucleic acid amount is proportional; And

C), determine the amount of this fluorescence labeling probe fracture by comparing by above-mentioned fluorescence labeling probe emitted fluorescence amount with by the institute of the fluorescence labeling probe in control reaction emitted fluorescence amount.

Another theme of the present invention is the method that is used to detect japanese encephalitis virus serogroups member nucleic acid, comprising:

A) amplification japanese encephalitis virus serogroups member's nucleic acid;

B) make and to hybridize with the detectable label probe of sequence hybridization shown in the SEQ ID NO.:16 and Japanese encephalitis serogroups member's amplification of nucleic acid; And

C) detect this detectable label probe, to detect Japanese encephalitis serogroups member nucleic acid.

Another theme of the present invention is the separation polynucleotide that comprise sequence shown in SEQ ID NO:29, SEQ ID NO:30, SEQ IDNO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or the SEQID NO:40.

Another theme of the present invention is the carrier with specific polynucleotide, and these polynucleotide comprise sequence shown in SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or the SEQ ID NO:40.

A further theme of the present invention is the oligonucleotide that comprises particular sequence, this particular sequence is made of at least 10 adjacent nucleotides, can with SEQ ID NO:29 or its complementary sequence, SEQ ID NO:30 or its complementary sequence, SEQ ID NO:31 or its complementary sequence, SEQ ID NO:32 or its complementary sequence, SEQ ID NO:33 or its complementary sequence, SEQ ID NO:34 or its complementary sequence, SEQ ID NO:35 or its complementary sequence, SEQ ID NO:36 or its complementary sequence, SEQ ID NO:37 or its complementary sequence, SEQ ID NO:38 or its complementary sequence, SEQ ID NO:39 or its complementary sequence, SEQ ID NO:40 or its complementary sequence hybridization.Preferred oligonucleotide has and is less than 100 Nucleotide.Preferred oligonucleotide can with sequence hybridization shown in the SEQ ID NO:68, or with the complementary sequence hybridization of SEQ ID NO:69 or/and comprise the sequence that is selected from SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66 and SEQ ID NO:67.Also want preferred oligonucleotide to be selected from SEQ ID NO:64, SEQ ID NO:65, SEQ IDNO:66 and SEQ ID NO:67.Most preferred oligonucleotide is to be selected from SEQ ID NO:64 and SEQ ID NO:65 or to be selected from SEQ ID NO:66 and the oligonucleotide of SEQ ID NO:67.

Another theme of the present invention is the reaction mixture that comprises above-mentioned any oligonucleotide.Preferred reaction mixture further comprise can with the detectable label oligonucleotide of sequence shown in the SEQ ID NO:16 or its complementary sequence hybridization, more preferably comprise any label probe mentioned above, be preferably used for TaqMan  test.Most preferred reaction mixture comprises archaeal dna polymerase.

Another theme of the present invention is the method that detects Saint Louis' encephalitis virus, comprising:

Under given conditions, with at least a nucleic acid that comprises the oligonucleotide amplification Saint Louis' encephalitis virus of specific nucleotide sequence, described specific nucleotide sequence can with SEQ ID NO:29 or its complementary sequence, SEQ ID NO:30 or its complementary sequence, SEQ ID NO:31 or its complementary sequence, SEQ ID NO:32 or its complementary sequence, SEQ ID NO:33 or its complementary sequence, SEQID NO:34 or its complementary sequence, SEQ ID NO:35 or its complementary sequence, SEQ ID NO:36 or its complementary sequence, SEQ ID NO:37 or its complementary sequence, SEQ ID NO:38 or its complementary sequence, SEQ ID NO:39 or its complementary sequence or SEQ ID NO:40 or its complementary sequence hybridization, described specified conditions promptly allow from described oligonucleotide begin the to increase condition of at least a portion of above-mentioned nucleotide sequence; And

Detect amplification of nucleic acid, to detect Saint Louis' encephalitis virus.Preferred oligonucleotide comprises the sequence that is selected from SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66 and SEQ ID NO:67, more preferably is selected from SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66 and SEQ ID NO:67.Most preferred oligonucleotide can with sequence hybridization shown in the SEQ ID NO:68, or with the complementary sequence hybridization of SEQ ID NO:69.Preferred oligonucleotide has and is less than 100 Nucleotide.What preferred method adopted is the primer that is selected from SEQ ID NO:64 and SEQ ID NO:65; With the primer that is selected from SEQ ID NO:66 and SEQ ID NO:67.

Described method preferably includes the detection step, comprises making and can hybridizing with the detectable label oligonucleotide of sequence hybridization shown in the SEQ ID NO:16 and the amplification of nucleic acid of Saint Louis' encephalitis virus nucleic acid; And detect the hybridization of this probe and amplification of nucleic acid.Preferred probes is as indicated above.The amount of amplification of nucleic acid is preferably at the amplification period detecting.TaqMan  method most preferably.

Another theme of the present invention is the test kit that comprises the above-mentioned oligonucleotide relevant with described method.

Another theme of the present invention is the oligonucleotide that comprises the sequence that is selected from SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62 and SEQ ID NO:63.Preferred oligonucleotide is selected from SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62 and SEQ ID NO:63.

Another theme is the reaction mixture that comprises above-mentioned oligonucleotide, preferred reaction mixture further comprise can with the detectable label oligonucleotide of sequence shown in the SEQ ID NO:25 or its complementary sequence hybridization.Preferred detectable label oligonucleotide can with sequence or its complementary sequence hybridization shown in the SEQ ID NO:16.Most preferred detectable label oligonucleotide comprises sequence FGGTCTAGAIGGTTAGAGGAGACCCTCCAG, and wherein F is CY5; I is FAM; P is PO4; U is proyl dU; With E be 5-methyl-dC.Preferred reaction mixture comprises at least a upstream primer and at least a downstream primer.

Another theme of the present invention is the method that detects yellow fever virus, comprise under given conditions with at least a nucleic acid that comprises the oligonucleotide amplification yellow fever virus of particular sequence, described particular sequence is selected from SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ IDNO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62 and SEQ IDNO:63, and described specified conditions promptly allow from described oligonucleotide begin the to increase condition of at least a portion of above-mentioned nucleotide sequence; And the detection amplification of nucleic acid, to detect yellow fever virus.Preferred oligonucleotide is selected from SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62 and SEQ ID NO:63.Preferred detection step comprises to be made and can hybridize with the detectable label oligonucleotide of sequence shown in the SEQ ID NO:25 or its complementary sequence hybridization and the amplification of nucleic acid of yellow fever virus nucleic acid; And detect the hybridization of this detectable label oligonucleotide and amplification of nucleic acid.Preferred detectable label oligonucleotide comprises F-5 '-GGTCTAGAIGGTTAGAGGAGACCCTCCAG-3 '-P, and wherein F is CY5; I is that FAM and P are PO4; Perhaps can with sequence or its complementary sequence hybridization shown in the SEQ ID NO:16.Preferred detectable label oligonucleotide comprises at least 20 continuous nucleotides in sequence shown in the SEQ IDNO.:17 or its complementary sequence, comprise sequence shown in the SEQ IDNO.:18 or its complementary sequence, comprise sequence or its complementary sequence shown in the SEQ ID NO.:28.For preferred TaqMan  test, preferred detectable label oligonucleotide comprises fluorescence part and quencher part.The amount of amplification of nucleic acid is preferably at the amplification period detecting, thus the just quantitative virus in the sample.

The test kit that is used to detect yellow fever virus comprises the above-mentioned oligonucleotide that is applicable to described method.

Another theme of the present invention is the oligonucleotide that comprises particular sequence, and described particular sequence is selected from SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQID NO:53, SEQ ID NO:54 and SEQ ID NO:55.Preferred oligonucleotide is selected from SEQID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ IDNO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54 and SEQID NO:55.

Another theme of the present invention is the reaction mixture that comprises this oligonucleotide.Preferred oligonucleotide comprises detectable label.

Another theme of the present invention is the method that detects dengue fever virus, comprise under given conditions with at least a nucleic acid that comprises the oligonucleotide amplification dengue fever virus of particular sequence, described particular sequence is selected from SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ IDNO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ IDNO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55, described specified conditions promptly allow from this oligonucleotide begin to increase condition of at least a portion of above-mentioned nucleotide sequence; And the detection amplification of nucleic acid, to detect dengue fever virus.This method preferably further comprise make can with the detectable label oligonucleotide of sequence hybridization shown in the SEQID NO:16 and the dengue fever virus nucleic acid hybridization of amplification; And detect the hybridization of this oligonucleotide and amplification of nucleic acid.Preferred detectable label oligonucleotide comprises sequence or its complementary sequence shown in the SEQ ID NO:24.Preferred oligonucleotide is selected from SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQID NO:53, SEQ ID NO:54 and SEQ ID NO:55.Described nucleic acid increases with at least a upstream primer and at least a downstream primer.Preferred detectable label oligonucleotide comprises at least 20 continuous nucleotides in sequence shown in the SEQ ID NO.:17 or its complementary sequence, comprise sequence or its complementary sequence shown in the SEQ ID NO.:18, perhaps comprise sequence or its complementary sequence shown in the SEQ ID NO.:28.Above-mentioned preferred feature is applicable to TaqMan  and quantitative test.Another theme of the present invention is the test kit that is used to detect dengue fever virus, and this test kit comprises the above-mentioned oligonucleotide that is applicable to described method.

Embodiment

Embodiment 1: the amplification of west nile virus RNA and detection

The lysate of virus infected cell culture supernatants obtains the Dr.R.Lanciotti from CDC.Nucleic acid is to utilize the miniature test kit of QIAamp viral RNA (QiagenInc., Valencia, CA) reagent in and got by above-mentioned lysate purifying according to manufacturer's specification sheets.10-times of serial dilutions (10 of preparation purification of nucleic acid ^-2-10 ^-7).Utilize TaqMan  reagent and method to carry out the reaction test of 5 ' nuclease, and by containing 1 μ M primer (comprising SEQ ID NO:8 and SEQ ID NO:15), 55mM Tricine (pH7.7, Sigma, cat T-5816), 450 μ M dNTPs (comprise dATP, dCTP, dGTP and dUTP, Pharmacia), 2.7mM manganous acetate (Fluka, cat 63537), 135mM potassium acetate (Fluka, cat 60035), 7% (v/v) DMSO (Sigma, cat D8418), 6% (V/V) glycerine (USB, cat 16347), the uridylic of 5 units-N-glycosylase (RocheDiagnostics), Z05 archaeal dna polymerase of 40 units (Roche Diagnostics) and 0.15 μ M probe (SEQ ID NO:28, be marked with FAM and CY5) 100 μ l reaction mixtures in carry out RT-PCR, with the above-mentioned diluent of each 50 microlitre of amplification.Reverse transcription/PCR is at COBAS TaqMan ^TMEquipment (Roche Diagnostics, Pleasanton, CA) utilize following thermal circulation parameters to carry out in: 50 ℃ following 4 minutes → 59 ℃ following 30 minutes → 2 circulations, each circulation comprises 95 ℃ of following 15 seconds, 58 ℃ following 50 seconds → 60 circulations, each circulation comprise 91 ℃ of following 15 seconds, 58 ℃ following 50 seconds → 40 ℃ following 2 minutes.An example of amplification as shown in Figure 6.

This paper has described multiple embodiments of the present invention.Described content and example are intended to illustrate the present invention, but not it is construed as limiting.Certainly, it will be understood by those skilled in the art that and under the prerequisite that does not depart from the present invention's spirit or following accessory claim category, to change multiple embodiments of the present invention.

Each reference that this paper quoted all is incorporated herein by reference by complete.

Sequence table

<110>Roche Diagnostics GmbH

F.Hoffmann-La Roche AG

＜120〉be used to detect the composition and the method for some flavivirus that comprises japanese encephalitis virus serogroups member

<130>21640-WO

<150>US 60/459,491

<151>2003-03-31

＜150〉US 60/ does not specify as yet

<151>2004-03-12

＜150〉US 60/ does not specify as yet

<151>2004-03-22

<160>74

<170>PatentIn version 3.2

<210>1

<211>35

<212>DNA

＜213〉artificial

<220>

＜223〉the conserved sequence district in the flavivirus genome 3 ' non-translational region

<220>

＜221〉comprehensive characteristics

<222>(8)..(8)

<220>

＜221〉comprehensive characteristics

<222>(8)..(8)

＜223〉n is a, c, g or t

<400>1

gtaagccnct cagaaccgtc tcggaaggag gaccc 35

<210>2

<211>35

<212>DNA

＜213〉artificial

<220>

＜223〉complementary sequence of SEQ ID NO:1, first kind of primer

<220>

＜221〉comprehensive characteristics

<222>(28)..(28)

＜223〉n=g, a, c or t

<400>2

gggtcctcct tccgagacgg ttctgagngg cttac 35

<210>3

<211>26

<212>DNA

＜213〉artificial

<220>

＜223〉japanese encephalitis virus serogroups primer 1

<220>

＜221〉comprehensive characteristics

<222>(8)..(8)

＜223〉n=t or disappearance

<400>3

gwaasccnsy crramcysyy tcggrw 26

<210>4

<211>26

<212>DNA

＜213〉artificial

<220>

＜223〉the west nile virus primer 1

<220>

＜221〉comprehensive characteristics

<222>(8)..(8)

＜223〉n=t or disappearance

<400>4

gtaagccncy cagaaccgyy tcggaa 26

<210>5

<211>26

<212>DNA

＜213〉artificial

<220>

＜223〉the japanese encephalitis virus primer 1

<220>

＜221〉comprehensive characteristics

<222>(8)..(8)

＜223〉n=disappearance

<400>5

gaaasccnct crraacygty tcggaa 26

<210>6

<211>26

<212>DNA

＜213〉artificial

<220>

＜223〉Murray river valley encephalitis primer 1

<400>6

gaaagcctcc cagamccgty tcggaa 26

<210>7

<211>25

<212>DNA

＜213〉artificial

<220>

＜223〉Koutango virus primer 1

<400>7

gtaagccctc agaaccgtct cggaa 25

<210>8

<211>25

<212>DNA

＜213〉artificial

<220>

＜223〉the example primer 1

<400>8

gtaagccctc agaaccgtct cggaa 25

<210>9

<211>52

<212>DNA

＜213〉artificial

<220>

＜221〉comprehensive characteristics

<222>(29)..(29)

＜223〉n=g, a, c or t

<400>9

caacaaaaca gcatattgac acctgggant agactaggag atcttctgct ct 52

<210>10

<211>52

<212>DNA

＜213〉artificial

<220>

＜223〉complementary sequence of SEQ ID NO:9, second kind of primer

<220>

＜221〉comprehensive characteristics

<222>(24)..(24)

＜223〉n=g, a, c or t

<400>10

agagcagaag atctcctagt ctantcccag gtgtcaatat gctgttttgt tg 52

<210>11

<211>24

<212>DNA

＜213〉artificial

<220>

＜223〉japanese encephalitis virus serogroups primer 2

<220>

＜221〉comprehensive characteristics

<222>(11)..(11)

＜223〉n=t or disappearance

<400>11

yccyastmtw nyyccaggtr tcaa 24

<210>12

<211>23

<212>DNA

＜213〉artificial

<220>

＜223〉west nile virus primer 2

<400>12

ycctagtcta tcccaggtrt caa 23

<210>13

<211>24

<212>DNA

＜213〉artificial

<220>

＜223〉japanese encephalitis virus primer 2

<400>13

cccyastmta tyyccaggtg tcaa 24

<210>14

<211>24

<212>DNA

＜213〉artificial

<220>

＜223〉Murray river valley encephalitis primer 2

<400>14

tcctagtctt ttcccaggtg tcaa 24

<210>15

<211>23

<212>DNA

＜213〉artificial

<220>

＜223〉example primer 2

<400>15

tcctagtcta tcccaggtgt caa 23

<210>16

<211>37

<212>DNA

＜213〉artificial

<220>

＜221〉comprehensive characteristics

<222>(1)..(37)

＜223〉n=g, a, c or t

<400>16

ggcganaagg actagaggtt agaggagacc nccgcgg 37

<210>17

<211>37

<212>DNA

＜213〉artificial

<220>

＜223〉complementary sequence of SEQ ID NO:16, nucleic acid probe

<220>

＜221〉comprehensive characteristics

<222>(1)..(37)

＜223〉n=g, a, c or t

<400>17

ccgcggnggt ctcctctaac ctctagtcct tntcgcc 37

<210>18

<211>28

<212>DNA

＜213〉artificial

<220>

＜223〉be used to detect the probe of flavivirus

<220>

＜221〉comprehensive characteristics

<222>(25)..(25)

＜223〉n=g, c, t, a or disappearance

<220>

＜221〉comprehensive characteristics

<222>(26)..(26)

＜223〉n=c, t, g or disappearance

<220>

＜221〉comprehensive characteristics

<222>(27)..(28)

＜223〉n is a, c, g, t or disappearance

<400>18

ggwctagwgg ttagaggaga cccynnnn 28

<210>19

<211>28

<212>DNA

＜213〉artificial

<220>

＜223〉be used to detect japanese encephalitis virus serogroups member's probe

<400>19

ggactagwgg ttagaggaga ccccrykk 28

<210>20

<211>28

<212>DNA

＜213〉artificial

<220>

＜223〉be used to detect the probe of west nile virus

<400>20

ggactagwgg ttagaggaga ccccrcgk 28

<210>21

<211>28

<212>DNA

＜213〉artificial

<220>

＜223〉be used to detect the probe of japanese encephalitis virus

<400>21

ggactagagg ttagaggaga ccccgygg 28

<210>22

<211>28

<212>DNA

＜213〉artificial

<220>

＜223〉be used to detect the probe of Murray river valley encephalitis

<400>22

ggactagagg ttagaggaga ccccactc 28

<210>23

<211>29

<212>DNA

＜213〉artificial

<220>

＜223〉be used to detect the probe of Kunjin virus

<400>23

aataygtgga ttacatgast tcaytgaag 29

<210>24

<211>28

<212>DNA

＜213〉artificial

<220>

＜223〉be used to detect the probe of dengue fever virus

<400>24

ggactagagg ttagaggaga ccccyssv 28

<210>25

<211>28

<212>DNA

＜213〉artificial

<220>

＜223〉be used to detect the probe of yellow fever virus

<400>25

ggtctagagg ttagaggaga ccctccag 28

<210>26

<211>28

<212>DNA

＜213〉artificial

<220>

＜223〉be used to detect the probe of Meng Taina mouse ear bat leukoencephalitis virus

<400>26

ggactagagg ttagaggaga ccccttcc 28

<210>27

<211>28

<212>DNA

＜213〉artificial

<220>

＜223〉be used to detect the probe of Modoc virus

<400>27

ggactagagg ttgagggaga cccccggc 28

<210>28

<211>28

<212>DNA

＜213〉artificial

<220>

＜223〉the example probe 1

<400>28

ggactagagg ttagaggaga ccccgagg 28

<210>29

<211>418

<212>DNA

＜213〉artificial

<220>

＜223〉the genomic 3 ' non-translational region of Saint Louis' encephalitis virus (SLEV) isolate BFS1750

<400>29

ttgccaccgg atgtcaggta aacggtgctg tctgtaacct ggccccaggt gactgggtta 60

tcaaagccaa tctggccgag tgcaaagccc ctcattccga ctcgggaggg tccctagcac 120

gtaggctgga gaggacgcaa aagtcagacc agaaatgcca cctgaaagca tgctaaaggt 180

gctgtctgta catgccccag gaggactggg ttaacaaagc ttaacagccc cagcggccca 240

aaccatggag tgcgtgacca tggcgtaagg actagaggtt agaggagacc ccgctgcaac 300

ttggcaaggc ccaaacccgc tcgaagctgt agagacgggg gaaggactag aggttagagg 360

agaccccttg ccgttaacgc aaacaacagc atattgacac ctggaaagac aggagatc 418

<210>30

<211>342

<212>DNA

＜213〉artificial

<220>

＜223〉the genomic 3 ' non-translational region of Saint Louis' encephalitis virus (SLEV) isolate 1750-Std

<400>30

ttgccaccgg atgtcaggta aacggtgctg tctgtaacct ggccccaggt gactgggtta 60

tcaaagccaa tctggccgag tgcaaagccc ctcattccga ctcgggaggg tccctagcac 120

gtaggctgga gaggacgcaa aagtcagacc agaaatgcca cctgaaagca tgctaaaggt 180

gctgtctgta catgccccag gaggactggg ttaacaaagc ttaacagccc cagcggccca 240

aaccatggag tgcgtgacca tggcgtaagg actagaggtt agaggagacc ccgcgcaact 300

tggcaaggcc caaacccgct cgaagctgta gagacggggg aa 342

<210>31

<211>418

<212>DNA

＜213〉artificial

<220>

＜223〉the genomic 3 ' non-translational region of Saint Louis' encephalitis virus (SLEV) isolate TD6-4G

<400>31

ttgccaccgg atgtcaggta aacggtgctg cctgtaacct ggccccaggt gactgggtta 60

tcaaagccaa tctggccgag tgcaaagccc ctcattccga ctcgggaggg tccctggcac 120

gtaggctgga gaggacgcaa aagtcagacc agaaatgcca cctgaaagca tgctaaaggt 180

gctgtctgta catgccccag gaggactggg ttaacaaagc ttaacagccc cagcggccca 240

aaccatggag tgcgtgacca tggcgtaagg actagaggtt agaggagacc ccgctgcaac 300

tcggcaaggc ccaaacccgc tcgaagctgt agagatgggg gaaggactag aggttagagg 360

agaccccttg ccgttaacgc aaacaacagc atattgacac ctggaaagac aggagatc 418

<210>32

<211>342

<212>DNA

＜213〉artificial

<220>

＜223〉the genomic 3 ' non-translational region of Saint Louis' encephalitis virus (SLEV) isolate CoaV750

<400>32

ttgccaccgg atgtcaggta aacggtgctg cctgtaacct ggccccaggt gactgggtta 60

ccaaagccaa tctggctgag tgcaaagccc ctcgttccga ttcgggaggg tccctggcac 120

gtaggctgga gaggacgcaa aagtcagacc agaaatgcca cctgaaagca tgctaaaggt 180

gctgtctgta catgccccag gaggactggg ttaacaaagc ttaacagccc cagcggccca 240

aaccatggag tgcgtgacca tggcgtaagg actagaggtt agaggagacc ccgcgcaact 300

tggcaaggcc aaaacccgct cgaagctgta gagatggggg aa 342

<210>33

<211>418

<212>DNA

＜213〉artificial

<220>

＜223〉the genomic 3 ' non-translational region of Saint Louis' encephalitis virus (SLEV) isolate L695121.05

<400>33

ttgccaccgg atgtcaggta aacggtgctg tctgtaacct ggccccaggt gactgggtta 60

tcaaagccaa tccggctggg tgcaaagccc ctcattccga ctcgggaggg tccctggcat 120

gtaggctgga gaggacgcac aagtcagacc agaaatgcca cctgaaagca tgctaaaggt 180

gctgtctgta catgccccag gaggactggg ttaacaaagc ttaacagccc cagcggccca 240

aaccatggag tgcgtgacca tggcgtaagg actagaggtt agaggagacc ccgctgtaac 300

ttggcaaggc ccaaacccgc tcgaagctgt agagacgggg gaaggactag aggttagagg 360

agaccccttg ccgttaacgc aaacaacagc atattgacac ctggaaagac aggagatc 418

<210>34

<211>418

<212>DNA

＜213〉artificial

<220>

＜223〉the genomic 3 ' non-translational region of Saint Louis' encephalitis virus (SLEV) isolate TNM771K

<220>

＜221〉comprehensive characteristics

<222>(384)..(384)

＜223〉n=g, a, c or t

<400>34

ttgccaccgg atgtcaggta aacggtgctg tctgtaacct ggccccaggt gactgggtca 60

tcaaagccaa tctggctggg tgcaaagccc ctcattccga ctcgggaggg tccctggcac 120

gtaggctgga gaggacgcac aagtcagacc agaaatgcca cctgaaagca tgctaaaggt 180

gctgtctgta catgccccag gaggactggg ttaacaaagc ttaacagccc cagcggccca 240

aaccatggag agcgtgacca tggcgtaagg actagaggtt agaggagacc ccgctgtaac 300

ttggcaaggc ccaaacccgc tcgaagctgt agagacgggg gaaggactag aggttagagg 360

agaccccttg ccgttaacgc aaanaacagc atattgacac ctggaaagac aggagatc 418

<210>35

<211>418

<212>DNA

＜213〉artificial

<220>

＜223〉the genomic 3 ' non-translational region of Saint Louis' encephalitis virus (SLEV) isolate MSI-7

<400>35

ttgccaccgg atgtcaggta aacggtgctg tctgtaacct ggccccaggc gactgggtta 60

tcaaagccaa tccggctggg tgcaaagccc ctcattccga ctcgggaggg tccctggcac 120

gtaggctgga gaggacgcac aagtcagacc agaaatgcca cctgaaagca tgctaaaggt 180

gctgtctgta catgccccag gaggactggg ttaacaaagc ttaacagccc cagcggccca 240

aaccatggag tgcgtgacca tggcgtaagg actagaggtt agaggagacc ccgctgtaac 300

ttggcaaggc ccaaacccgc tcaaagctgt agagacgggg gaaggactag aggttagagg 360

agaccccttg ccgttaacgc aaacaacagc atattgacac ctggaaagac aggagatc 418

<210>36

<211>405

<212>DNA

＜213〉artificial

<220>

＜223〉the genomic 3 ' non-translational region of Saint Louis' encephalitis virus (SLEV) isolate Kern217

<400>36

ccggatgtca ggtaaacggt gctgtctgta acctggcccc aggtcactgg gttatcaaag 60

ccaacccggc tgggtgcaaa gcccctcatt ccgactcggg agggtccctg gcacgtaggc 120

tggagaggac gcacaagtca gaccagaaat gccacctgaa agcatgctaa aggtgctgtc 180

tgtacatgcc ccaggaggac tgggttaaca aagcttaaca gccccagcgg cccaaaccat 240

ggagtgcgtg accatggcgt aaggactaga ggttagagga gaccccgctg taacttggca 300

aggcccaaac ccgctcaaag ctgtagagac gggggaagga ctagaggtta gaggagaccc 360

cttgccgtta acgcaaacaa cagcatattg acacctggaa agaca 405

<210>37

<211>375

<212>DNA

＜213〉artificial

<220>

＜223〉the genomic 3 ' non-translational region of Saint Louis' encephalitis virus (SLEV) isolate CoaV608

<400>37

cccaggcgac tgggttatca aagccaatcc ggctgggtgc aaagcccctc attccgactc 60

gggagggtcc ctggcacgta ggctggagag gacgcacaag tcagaccaga aatgccacct 120

gaaagcatgc taaaggtgct gtctgtacat gccccaggag gactgggtta acaaagctta 180

acagccccag cggcccaaac catggagtgc gtgaccatgg cgtaaggact agaggttaga 240

ggagaccccg ctgtaacttg gcaaggccca aacccgctca aagctgtaga gacgggggaa 300

ggactagagg ttagaggaga ccccttgccg ttaacgcaaa caacagcata ttgacacctg 360

gaaagacagg agatc 375

<210>38

<211>411

<212>DNA

＜213〉artificial

<220>

＜223〉the genomic 3 ' non-translational region of Saint Louis' encephalitis virus (SLEV) isolate TBH-28

<400>38

ttgccaccgg atgtcaggta aacggtgctg tctgtaacct ggccccaggt gactgggtta 60

tcaaagccaa cccggctggg tgcaaagccc ctcattccga ctcgggaggg tccctggcac 120

gtaggccgga gaggacgcac aagtcagacc agaaatgcca cctgaaagca tgctaaaggt 180

gctgtctgta catgccccag gaggactggg ttaacaaagc ttaacagccc cagcggccca 240

aaccatggag tgcgtgacca tggcgtaagg actagaggtt agaggagacc ccgctgtaat 300

ttggcaaggc ccaaacccgc tcgaagctgt agagacgggg gaaggactag aggttagagg 360

agaccccttg ccgttaacgc aaacaacagc atattgacac ctggaaagac a 411

<210>39

<211>402

<212>DNA

＜213〉artificial

<220>

＜223〉the genomic 3 ' non-translational region of Saint Louis' encephalitis virus (SLEV) isolate VR1265

<400>39

ccggaagtca ggtaaacggt gctgtctgta acctggcccc aggtgactgg gttatcaaag 60

ccaatctggc tgggtgcaaa gcccctcatt ccgactcggg agggtccctg gcacgtaggc 120

tggagcggac gcacaagtca gaccagaaat gccacctgaa agcatgctaa aggtgctgtc 180

tgtacatgcc ccaggaggac tgggttaaca aagcttaaca gccccagcgg cccaaaccat 240

ggagtgcgtg accatggcgt aaggactaga ggttagagga gaccccgctg taacttggca 300

aggcccaaac ccgctcgaag ctgtagagac gggggaagga ctagaggtta gaggagaccc 360

cttgccgtca acgcaaacaa cagcatattg acacctggaa ag 402

<210>40

<211>374

<212>DNA

＜213〉artificial

<220>

＜223〉the genomic 3 ' non-translational region of Saint Louis' encephalitis virus (SLEV) isolate CoaV353

<400>40

cccaggtgac tgggttatca aagccaatct agctgagtgc aaagcccctc attccgactc 60

gggagggtcc ctggcacgta ggctggagag gacgcaaaag tcagaccaga aatgccacct 120

gaaagcatgc taaaggtgct gtctgtacat gccccaggag gactgggtta acaaagctta 180

acagccccag cggcccaaac catggagtgc gtgaccatgg cgtaaggact agaggttaga 240

ggagaccccg ctgcaacttg gcaaggccca aacccgctcg aagctgtaga gacgggggaa 300

ggactagagg ttagaggaga ccccttgccg ttaacgcaaa caacagcata ttgacacctg 360

gaaagacagg agat 374

<210>41

<211>27

<212>DNA

＜213〉artificial

<220>

＜223〉the total upstream primer of dengue fever virus

<400>41

gagccccgtc caaggacgta aaaagaa 27

<210>42

<211>27

<212>DNA

＜213〉artificial

<220>

＜223〉the total upstream primer of dengue fever virus

<220>

＜221〉comprehensive characteristics

<222>(27)..(27)

＜223〉the n=tertiary butyl-benzyl-dA

<400>42

gagccccgtc caaggacgta aaaagan 27

<210>43

<211>27

<212>DNA

＜213〉artificial

<220>

＜223〉the total upstream primer of dengue fever virus

<220>

＜221〉comprehensive characteristics

<222>(26)..(26)

＜223〉n=methyl-dA

<220>

＜221〉comprehensive characteristics

<222>(27)..(27)

＜223〉the n=tertiary butyl-benzyl-dA

<400>43

gagccccgtc caaggacgta aaaagnn 27

<210>44

<211>27

<212>DNA

＜213〉artificial

<220>

＜223〉I type dengue fever virus upstream primer

<400>44

gagccccgtc caaggacgta aaatgaa 27

<210>45

<211>27

<212>DNA

＜213〉artificial

<220>

＜223〉I type dengue fever virus upstream primer

<220>

＜221〉comprehensive characteristics

<222>(27)..(27)

＜223〉the n=tertiary butyl-benzyl-dA

<400>45

gagccccgtc caaggacgta aaatgan 27

<210>46

<211>27

<212>DNA

＜213〉artificial

<220>

＜223〉I type dengue fever virus upstream primer

<220>

＜221〉comprehensive characteristics

<222>(26)..(26)

＜223〉N=methyl-dA

<220>

＜221〉comprehensive characteristics

<222>(27)..(27)

＜223〉the n=tertiary butyl-benzyl-dA

<400>46

gagccccgtc caaggacgta aaatgnn 27

<210>47

<211>27

<212>DNA

＜213〉artificial

<220>

＜223〉II and III type dengue fever virus upstream primer

<400>47

gagccccgtc caaggacgtt aaaagaa 27

<210>48

<211>27

<212>DNA

＜213〉artificial

<220>

＜223〉II and III type dengue fever virus upstream primer

<220>

＜221〉comprehensive characteristics

<222>(27)..(27)

＜223〉the n=tertiary butyl-benzyl-dA

<400>48

gagccccgtc caaggacgtt aaaagan 27

<210>49

<211>27

<212>DNA

＜213〉artificial

<220>

＜223〉II and III type dengue fever virus upstream primer

<220>

＜221〉comprehensive characteristics

<222>(26)..(26)

＜223〉n=methyl-dA

<220>

＜221〉comprehensive characteristics

<222>(27)..(27)

＜223〉the n=tertiary butyl-benzyl-dA

<400>49

gagccccgtc caaggacgtt aaaagnn 27

<210>50

<211>24

<212>DNA

＜213〉artificial

<220>

＜223〉IV type dengue fever virus upstream primer

<400>50

attgaagtca ggccacttgt gcca 24

<210>51

<211>24

<212>DNA

＜213〉artificial

<220>

＜223〉IV type dengue fever virus upstream primer

<220>

＜221〉comprehensive characteristics

<222>(24)..(24)

＜223〉the n=tertiary butyl-benzyl-dA

<400>51

attgaagtca ggccacttgt gccn 24

<210>52

<211>24

<212>DNA

＜213〉artificial

<220>

＜223〉IV type dengue fever virus upstream primer

<220>

＜221〉comprehensive characteristics

<222>(23)..(23)

＜223〉n=ethyl-dC

<220>

＜221〉comprehensive characteristics

<222>(24)..(24)

＜223〉the n=tertiary butyl-benzyl-dA

<400>52

attgaagtca ggccacttgt gcnn 24

<210>53

<211>25

<212>DNA

＜213〉artificial

<220>

＜223〉dengue fever virus downstream primer

<400>53

gatctctggt ctttcccagc gtcaa 25

<210>54

<211>25

<212>DNA

＜213〉artificial

<220>

＜223〉dengue fever virus downstream primer

<220>

＜221〉comprehensive characteristics

<222>(25)..(25)

＜223〉the n=tertiary butyl-benzyl-dA

<400>54

gatctctggt ctttcccagc gtcan 25

<210>55

<211>25

<212>DNA

＜213〉artificial

<220>

＜223〉dengue fever virus downstream primer

<220>

＜221〉comprehensive characteristics

<222>(24)..(24)

＜223〉n=methyl-dA

<220>

＜221〉comprehensive characteristics

<222>(25)..(25)

＜223〉the n=tertiary butyl-benzyl-dA

<400>55

gatctctggt ctttcccagc gtcnn 25

<210>56

<211>28

<212>DNA

＜213〉artificial

<220>

＜223〉yellow fever virus upstream primer

<400>56

aaccgggata aaaactacgg gtggagaa 28

<210>57

<211>28

<212>DNA

＜213〉artificial

<220>

＜223〉yellow fever virus upstream primer

<220>

＜221〉comprehensive characteristics

<222>(28)..(28)

＜223〉the n=tertiary butyl-benzyl-dA

<400>57

aaccgggata aaaactacgg gtggagan 28

<210>58

<211>28

<212>DNA

＜213〉artificial

<220>

＜223〉yellow fever virus upstream primer

<220>

＜221〉comprehensive characteristics

<222>(27)..(27)

＜223〉n=methyl-dA

<220>

＜221〉comprehensive characteristics

<222>(28)..(28)

＜223〉the n=tertiary butyl-benzyl-dA

<400>58

aaccgggata aaaactacgg gtggagnn 28

<210>59

<211>26

<212>DNA

＜213〉artificial

<220>

＜223〉yellow fever virus upstream primer

<400>59

ataaaaacta cgggtggaga accgga 26

<210>60

<211>26

<212>DNA

＜213〉artificial

<220>

＜223〉yellow fever virus upstream primer

<220>

＜221〉comprehensive characteristics

<222>(26)..(26)

＜223〉the n=tertiary butyl-benzyl-dA

<400>60

ataaaaacta cgggtggaga accggn 26

<210>61

<211>24

<212>DNA

＜213〉artificial

<220>

＜223〉yellow fever virus downstream primer

<400>61

actccggtct ttccctggcg tcaa 24

<210>62

<211>24

<212>DNA

＜213〉artificial

<220>

＜223〉yellow fever virus downstream primer

<220>

＜221〉comprehensive characteristics

<222>(24)..(24)

＜223〉the n=tertiary butyl-benzyl-dA

<400>62

actccggtct ttccctggcg tcan 24

<210>63

<211>24

<212>DNA

＜213〉artificial

<220>

＜223〉yellow fever virus downstream primer

<220>

＜221〉comprehensive characteristics

<222>(23)..(23)

＜223〉n=methyl-dA

<220>

＜221〉comprehensive characteristics

<222>(24)..(24)

＜223〉the n=tertiary butyl-benzyl-dA

<400>63

actccggtct ttccctggcg tcnn 24

<210>64

<211>25

<212>DNA

＜213〉artificial

<220>

＜223〉Saint Louis' encephalitis virus upstream primer

<400>64

caaagcccct cattccgact cggga 25

<210>65

<211>25

<212>DNA

＜213〉artificial

<220>

＜223〉Saint Louis' encephalitis virus upstream primer

<220>

＜221〉comprehensive characteristics

<222>(25)..(25)

＜223〉the n=tertiary butyl-benzyl-dA

<400>65

caaagcccct cattccgact cgggn 25

<210>66

<211>23

<212>DNA

＜213〉artificial

<220>

＜223〉Saint Louis' encephalitis virus upstream primer

<400>66

tctcctgtct ttccaggtgt caa 23

<210>67

<211>23

<212>DNA

＜213〉artificial

<220>

＜223〉Saint Louis' encephalitis virus upstream primer

<220>

＜221〉comprehensive characteristics

<222>(23)..(23)

＜223〉the n=tertiary butyl-benzyl-dA

<400>67

tctcctgtct ttccaggtgt can 23

<210>68

<211>23

<212>DNA

＜213〉artificial

<220>

＜223〉first kind of primer complementary sequence of Saint Louis' encephalitis virus (SLEV)

<400>68

ttgacacctg gaaagacagg aga 23

<210>69

<211>24

<212>DNA

＜213〉artificial

<220>

＜223〉second kind of primer of Saint Louis' encephalitis virus (SLEV)

<400>69

caaagcccct cattccgact cggg 24

<210>70

<211>30

<212>DNA

＜213〉artificial

<220>

＜223〉flavivirus antisense probe

<400>70

gggtctcctc taacctctag tccttccccc 30

<210>71

<211>100

<212>DNA

＜213〉artificial

<220>

＜223〉the conserved sequence district in the flavivirus genome 3 ' non-translational region, AF196835

<220>

＜221〉comprehensive characteristics

<222>(1)..(100)

＜223〉n=g, a, c or t

<400>71

caaccccagg aggactgggt gaacaaagcc gcgaagtgan tccatgtaag ccnctcagaa 60

ccgtctcgga aggaggaccc cacatgttgt aacttcaaag 100

<210>72

<211>183

<212>DNA

＜213〉artificial

<220>

＜221〉comprehensive characteristics

<222>(1)..(183)

＜223〉n=g, a, c or t

<400>72

gaagctgtag gtcaggngga aggactagag gttagtggag accccgtgcc acaaaacacc 60

acaacaaaac agcatattga cacctgggan tagactagga gatcttctgc tctngcacaa 120

cnncagccac acggcacagt gcgccgacaa tggtggctgg tggtgcgnna gaacacagga 180

tct 183

<210>73

<211>120

<212>DNA

＜213〉artificial

<220>

＜221〉comprehensive characteristics

<222>(1)..(120)

＜223〉n=g, a, c or t

<400>73

acgcggccct agccnccgng tannnnatgg tgnnnttaac ncagggcgan aaggactaga 60

ggttagagga gaccnccgcg gttnntnnnn nnaaagtgca nncggcccag ccnntgactn 120

<210>74

<211>25

<212>DNA

＜213〉artificial

<220>

＜223〉example primer 2

<400>74

tctcctagtc tatcccaggt gtcaa 25

Claims

1. be used to detect japanese encephalitis virus serogroups member's oligonucleotide, comprise can with the nucleic acid of nucleic acid shown in the SEQ IDNO.:1 or its complementary sequence hybridization.

2. the oligonucleotide of claim 1, wherein this oligonucleotide comprises at least 16 continuous nucleotides in sequence shown in the SEQ ID NO.:2 or its complementary sequence.

3. the oligonucleotide of claim 2, wherein this oligonucleotide comprises sequence or its complementary sequence shown in the SEQ ID NO.:8.

4. the oligonucleotide of claim 3, wherein sequence No. 23 position residues are N shown in the SEQ ID NO.:8 ⁶-methyl-Desoxyadenosine, No. 24 position residues of sequence shown in the SEQ ID NO.:8 are N ⁶-the tertiary butyl-benzyl-Desoxyadenosine.

5. be used to detect japanese encephalitis virus serogroups member's oligonucleotide, comprise can with the nucleic acid of nucleic acid shown in the SEQ IDNO.:9 or its complementary sequence hybridization.

6. the oligonucleotide of claim 5, wherein this oligonucleotide comprises at least 16 continuous nucleotides in sequence shown in the SEQ ID NO.:10 or its complementary sequence.

7. the oligonucleotide of claim 6, wherein this oligonucleotide comprises sequence or their complementary sequence shown in SEQ ID NO.:15 or the SEQ ID NO:74.

8. the oligonucleotide of claim 7, wherein No. 24 position residues of sequence are N shown in SEQ ID NO.:15 or the SEQ ID NO:74 ⁶-alkyl-Desoxyadenosine.

9. the oligonucleotide of claim 8, wherein No. 24 position residues of sequence are N shown in SEQ ID NO.:15 or the SEQ ID NO:74 ⁶-the tertiary butyl-benzyl-Desoxyadenosine.

10. be used to detect the oligonucleotide of japanese encephalitis virus serogroups member or dengue fever virus, yellow fever virus, Meng Taina mouse ear bat leukoencephalitis virus or Modoc virus, comprise can with the nucleic acid of nucleic acid shown in the SEQ ID NO.:16 or its complementary sequence hybridization.

11. the oligonucleotide of claim 10, wherein this oligonucleotide comprises at least 20 continuous nucleotides in sequence shown in the SEQ ID NO.:17 or its complementary sequence.

12. comprise the oligonucleotide of at least 16 continuous nucleotides in arbitrary sequence shown in SEQ ID NOs 2,9 and 17 or its complementary sequence.

13. comprise the oligonucleotide of at least 16 continuous nucleotides in arbitrary sequence shown in SEQ ID NOs 8,15,25 and 74 or its complementary sequence.

14. comprise the oligonucleotide of the sequence that is selected from SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 and SEQ ID NO:40.

15. comprise the oligonucleotide of the sequence that constitutes by at least 10 adjacent nucleotides, this sequence can with SEQ ID NO:29 or its complementary sequence, SEQ ID NO:30 or its complementary sequence, SEQ IDNO:31 or its complementary sequence, SEQ ID NO:32 or its complementary sequence, SEQ ID NO:33 or its complementary sequence, SEQ ID NO:34 or its complementary sequence, SEQ ID NO:35 or its complementary sequence, SEQ ID NO:36 or its complementary sequence, SEQ ID NO:37 or its complementary sequence, SEQ ID NO:38 or its complementary sequence, SEQ ID NO:39 or its complementary sequence, SEQ ID NO:40 or its complementary sequence hybridization.

16. comprise the oligonucleotide of the sequence that is selected from SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQID NO:52, SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55.

17. comprise the oligonucleotide of the sequence that is selected from SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62 and SEQ ID NO:63.

18. the oligonucleotide of claim 15, sequence hybridization shown in this oligonucleotide and the SEQ ID NO:68 wherein, or with the complementary sequence hybridization of SEQ ID NO:69.

19. the oligonucleotide of claim 18, wherein this oligonucleotide comprises the sequence that is selected from SEQ IDNO:64, SEQ ID NO:65, SEQ ID NO:66 and SEQ ID NO:67.

20. the oligonucleotide of claim 19, wherein this oligonucleotide is selected from SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66 and SEQ ID NO:67.

21. comprise the reaction mixture of the oligonucleotide of any claim among the claim 1-20.

22. the reaction mixture of claim 21, wherein this reaction mixture comprises archaeal dna polymerase.

23. any one reaction mixture in claim 21 and 22 further comprises detectable label oligonucleotide any among the claim 10-13.

24. comprise the carrier of polynucleotide, these polynucleotide comprise the sequence that is selected from SEQ ID NO:29, SEQID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQID NO:39 and SEQ ID NO:40.

25. be used to detect the test kit of japanese encephalitis virus serogroups member nucleic acid, comprise:

A) any one first kind of nucleic acid primer among the claim 1-4;

B) any one second kind of nucleic acid primer among the claim 5-9; With

C) any one nucleic acid probe among the claim 10-13.

The test kit of flavivirus nucleic acid contains at least one container 26. be used to increase

-claim 14 or 15 oligonucleotide and

-be used for the reagent of amplification of nucleic acid.

27. be used to detect the test kit of flavivirus nucleic acid, at least one container, contain

-claim 14 or 15 oligonucleotide and

-be used to detect the reagent of the heterozygote that forms by oligonucleotide and described nucleic acid.

28. be used to detect the test kit of Saint Louis' encephalitis virus, comprise the oligonucleotide of claim 15-18.

29. be used to detect the test kit of yellow fever virus, comprise the oligonucleotide of claim 15-18.

30. be used to detect the test kit of dengue fever virus, comprise the oligonucleotide of claim 15-18.

31. any one test kit among the claim 27-30 further comprises archaeal dna polymerase.

32. be used to detect japanese encephalitis virus serogroups member's composition, comprise primer any among claim 1-9 or the 15-20 and buffer reagent.

33. be used to detect japanese encephalitis virus serogroups member's composition, comprise nucleic acid probe any among the claim 10-11 and buffer reagent.

34. be used to detect the method for japanese encephalitis virus serogroups member nucleic acid, comprise:

A) sample is contacted under the condition that allows template dependent form nucleic acid polymerization enzymatic breaking detectable label nucleic acid probe

Any one nucleic acid probe among the-claim 10-13, this probe be by detectable label,

Among-claim the 1-9 any one primer and

-have a template dependent form nucleic acid polymerase of 5 '-3 ' exonuclease activity; And

B) detect the fracture of this detectable label nucleic acid probe, wherein there is Japanese encephalitis serogroups member's nucleic acid in the fracture of this detectable label probe explanation.

35. the method for claim 34, detectable label probe wherein comprises the fluorescence part.

36. the method for claim 35, detectable label probe wherein further comprises the quencher part.

37. the method for claim 34, wherein japanese encephalitis virus serogroups member's nucleic acid is to utilize at least aly to be increased according to primer any in claim 1-9 or 12.

The method of flavivirus nucleic acid 38. be used to increase, wherein at least a is that nucleic acid with this flavivirus is that template is extended according to oligonucleotide any among the claim 1-20.

39. be used for the method for the nucleic acid of test sample japanese encephalitis virus serogroups member or dengue fever virus, yellow fever virus, Modoc virus or Meng Taina mouse ear bat leukoencephalitis virus, comprise:

A) nucleic acid probe any among sample and the claim 1-20 is contacted; And

40. be used for the method for test sample japanese encephalitis virus serogroups member nucleic acid, comprise:

A) any one nucleic acid probe and have the nucleic acid of amplification japanese encephalitis virus serogroups member under the existence condition of template dependent form archaeal dna polymerase of 5 '-3 ' exonuclease activity in claim 1-11; And

B) detect the fracture of this probe, with existing of the nucleic acid that detects japanese encephalitis virus serogroups member.

41. be used to detect the method for japanese encephalitis virus serogroups member nucleic acid, comprise:

A) sample is contacted under the condition of the nucleic acid that allows japanese encephalitis virus serogroups member and nucleic acid primer or probe hybridization with any one nucleic acid primer or probe among the claim 1-13, wherein this nucleic acid primer or probe are covalently bound on solid support;

B) detectable label primer any among the claim 1-13 or probe are contacted with the above-mentioned solid phase support, this detectable label primer or probe are not above-mentioned and covalently bound same primers as or the probe of this solid support; And

C) by detecting the hybridization of above-mentioned detectable label primer or probe and japanese encephalitis virus serogroups member nucleic acid, to detect japanese encephalitis virus serogroups member's nucleic acid.

42. be used for the method for quantitative sample japanese encephalitis virus serogroups member nucleic acid, comprise:

A) any one fluorescent mark nucleic acid probe contacts with the template dependent form nucleic acid polymerase with 5 '-3 ' exonuclease activity among the sample that makes japanese encephalitis virus serogroups member to be detected and the claim 10-13;

B) detection is by the amount of the above-mentioned fluorescent mark nucleic acid probe of template dependent form nucleic acid polymerization enzymatic breaking with 5 '-3 ' exonuclease activity, and wherein the amount of the Japanese encephalitis serogroups member nucleic acid that exists in the amount of this fluorescence labeling probe fracture and the sample is proportional; And

C), determine the amount of this fluorescence labeling probe fracture by comparing by this fluorescence labeling probe emitted fluorescence amount with by the institute of the fluorescence labeling probe in control reaction emitted fluorescence amount.

43. be used to detect the method for japanese encephalitis virus serogroups member nucleic acid, comprise:

A) amplification japanese encephalitis virus serogroups member's nucleic acid;

B) detectable label probe any among the claim 10-13 and japanese encephalitis virus serogroups member's amplification of nucleic acid is hybridized; And

C) detect above-mentioned detectable label probe, with existing of the nucleic acid that detects japanese encephalitis virus serogroups member.

44. detect the method for Saint Louis' encephalitis virus, comprising:

A) with at least a nucleic acid according to oligonucleotide amplification Saint Louis' encephalitis virus any among the claim 15-18; And

B) detect this amplification of nucleic acid, to detect Saint Louis' encephalitis virus;

45. detect the method for yellow fever virus, comprising:

A) with at least a nucleic acid according to oligonucleotide amplification yellow fever virus any among the claim 15-18; And

B) detect this amplification of nucleic acid, to detect yellow fever virus.

46. detect the method for dengue fever virus, comprising:

A) with at least a nucleic acid according to oligonucleotide amplification dengue fever virus any among the claim 15-18; And

B) detect this amplification of nucleic acid, to detect dengue fever virus.

47. any one method among the claim 44-46, detection wherein is to utilize probe any among the claim 10-11 to carry out.