CN1782083A

CN1782083A - Novel thrombase-like gene and its use

Info

Publication number: CN1782083A
Application number: CN 200510036960
Authority: CN
Inventors: 徐安龙; 刘钰山; 王磊; 任宇锋; 赖春娥; 陈尚武
Original assignee: Sun Yat Sen University
Current assignee: Sun Yat Sen University
Priority date: 2005-09-02
Filing date: 2005-09-02
Publication date: 2006-06-07
Anticipated expiration: 2025-09-02
Also published as: CN100351381C

Abstract

The present invention discloses a new kind of thrombin-like enzyme gene and its application. By means of RT-PCR process, thrombin-like enzyme gene tle, which has DNA sequence as shown in <400>1 sequence in the sequence list, is screened out from total RNA of Agkistrodon acutus venom gland. The gene coded proten thrombin-like enzyme (TLE) has amino acid sequence as shown in <400>2 sequence in the sequence list. The recombinant thrombin-like enzyme has both blood coagulation and hemostasis acitivity, and may be used in preparing medicine for treating vanous thrombosis, cerebral thrombosis and other vascular embolus diseases.

Description

A kind of new thrombase-like gene and application thereof

Technical field

The present invention relates to a kind of new Thrombin-like enzyme Thrombin-like enzyme (TLE) and this proteic gene tle of coding, and the application of this albumen in vessel embolism medicines such as preparation treatment phlebothrombosis, cerebral thrombosis.。

Background technology

Agkistrodon acutus (Deinagkistrodon acutus, Gunther, 1888), belong to Viperidae (Viperidae), Crotalinae (Crotalinae), point kiss Pallas pit viper belongs to (Agkistrodon) unique kind, also cries Agkistrodon, Hundred-pace pit viper, Ji snake etc., and folklore goes on foot and will die as walking after being bitten by it less than 100.Be the distinctive snake kind of China, mainly be distributed in the vast mountain area on ground such as Fujian, each province, China south, Zhejiang, Hunan, Hubei, Jiangxi, Anhui, Guangdong, Guangxi and Taiwan.

People very early agkistrodon acutus as a kind of valuable medicinal, with dried the stimulating the circulation of the blood and cause the muscles and joints to relax of snake that it is made, spasmolysis is attacked effects such as poison.Have long and big pipe tooth, mainly contain the circulation of blood poison.The venom injection rate is big when hurting sb.'s feelings, and is with drastic toxicity, wound severe pain, and whole body can play bleeding blister.Because agkistrodon acutus is the peculiar snake kind of China, so the various research work of relevant agkistrodon acutus also mainly concentrate on China's (containing Taiwan Province).Research to sTLE also is so, from document, is Japanese scholar's research report though sub-fraction is arranged, and most of research report to sTLE all concentrates on China's Mainland and Taiwan.

The research of domestic relevant agkistrodon acutus snake venom, many earliest antidotes that bite with exploration snake venom toxicity and searching treatment are purpose.Research to the agkistrodon acutus Thrombin-like enzyme starts from the end of the seventies, and has progressively developed and have anti-freezing, go effect such as fibre and thrombolysis, is used for the treatment of sick fiber eliminating enzyme (and various predecessor) such as ischemic cerebrovascular, coronary heart disease and stenocardia.Even to this day, fiber eliminating enzyme still as outstanding domestic drug widespread use safely and efficiently clinically.Domestic short research of coagulating component is after the eighties in last century to relevant agkistrodon acutus Thrombin-like enzyme, and most research all inadequately comprehensively and deeply.Usefulness DEAE-Sephadex A-50 such as Liu Guangfen produce the agkistrodon acutus snake venom to Fujian and have carried out preliminary column chromatography analysis and activation analysis.Usefulness diethylaminoethylcellulose column chromatographies such as Zhang Hongji are divided into 15 components with the agkistrodon acutus snake venom, and enzyme activity, blood coagulation activity, fibrinolytic, hemorrhage poison and the toxicity etc. of each component are measured, find that the agkistrodon acutus snake venom contains the component of tool arginine ester enzymic activity, fibrinolytic and blood coagulation activity.Teng Guoqiang etc. separate the agkistrodon acutus snake venom of Wannan mountainous area with DEAE-Mierocrystalline cellulose DA22 column chromatography, get 15 protein peaks, and measured respectively each component relevant enzyme active and with shortly coagulate, the relation of anti-freezing, fibrinolytic, haemolysis, physiologically active such as hemorrhage, and think that short Blood clotting is to directly act on Fibrinogen, and with the arginine ester enzymic activity; The author has studied wherein some the enzyme activities of Thrombin-like enzyme class simultaneously, finds that it can act on Fibrinogen to specificity and make the clotting of plasma, does not need the participation of other thrombin, also is not subjected to the inhibition of heparin.Wang Qingchuan etc. ^[58]The mixture of three kinds of isozymes of having studied the agkistrodon acutus Thrombin-like enzyme is found that its aggegation to the platelet suspension of people, dog or rabbit is inhibited, and is dosage correlation the influence of platelet aggregation function.Zhu Longxiang etc. have studied with ELASA microdetermination agkistrodon acutus Thrombin-like enzyme, and have carried out the research of the pharmacokinetics of these product as detection technique with this method.Zhou Sufang etc. ^[58]Studied the setting time of external whole plasm of agkistrodon acutus Thrombin-like enzyme inductive and adsorbed plasma, different physico chemical factors are to the setting time (thrombintime of the external whole plasm of agkistrodon acutus Thrombin-like enzyme and thrombin induction, TT), KPTT (KPTT) and prothrombin time (prothrombjn time, influence PT).Liu Guangfen etc. have also carried out the long term toxicity of agkistrodon acutus Thrombin-like enzyme and the research of the pharmacological effect behind the successive administration.Though more than research provides a lot of useful data for we are familiar with sTLE, but these researchs rest on each component of separating is carried out on the mensuration and general research of enzyme activity more, lack further investigation its structure and characteristic; And employed isolation technique is also comparatively simple, can not obtain the pure product of one-component, or does not provide the purifying process and the characteristic of sample; In addition, only we can't judge that also these components are the component of anti-bolt anticoagulation on earth on pharmacology from these researchs, still short component of coagulating anastalsis.

Chinese Academy of Sciences's Dalian physical chemistry the usefulness ion-exchange such as Qian Yawen and the gel filtration method of Y.ZHANG etc. and Chinese University of Science and Technology from the agkistrodon acutus snake venom, obtain seven protein peaks that contain blood coagulation activity, with capillary electrophoresis these seven peaks are carried out further fine separation then, use the auxiliary laser desorption mass spectrometry of matrix (laser desorption/ionization massmonitoring again, LDIM) detect the molecular weight of each component, draw the molecular weight of the major protein at seven peaks.The prompting of above-mentioned result of study, the molecular weight of the agkistrodon acutus Thrombin-like enzyme in the certain molecular weight scope are included in above-mentioned each peak of listing in main and the less important proteic molecular weight.

Open your equality and produce the agkistrodon acutus snake venom, isolated a Thrombin-like enzyme that molecular weight is 15.1KD, and its physics and chemistry and zymologic property are studied from the Hunan; This component can make human plasma solidify rapidly, and can strengthen the effect of zymoplasm, thrombin time is shortened, so have hemostatic effect.From beginning in 1988, Xiao Changhua etc. delivered a series of articles, and what we can be comparatively detailed from these articles recognizes the short research train of thought of coagulating component of agkistrodon acutus Thrombin-like enzyme.Xiao Changhua etc. have carried out isolation and purification with DEAE-sephadex A-50 post, DEAE-cellulose DE52 post, QAE-sephadex A-25 post, SephadexG-25 post four one-step chromatographies to the agkistrodon acutus snake venom respectively, obtained four and had the active electrophoretically pure single albumen of arginine esterase, illustrating has four kind thrombin component in the agkistrodon acutus snake venom.He Lifen etc. ^[43]Further studied the interior hemostatic effect of body of said components, adopt the hemorrhage hemostasis experiment of rabbit carotid artery and domesticated dog medium-sized artery damage ejection, rabbit liver parenchyma organ hemostasis experiment and domesticated dog dialysis hind leg hemostasis experiment, drawing it has anastalsis to rabbit and the experimental wound hemorrhage of domesticated dog.But regrettably above-mentioned experiment is that 30KD and 19.5KD two components are mixed in proportion the back as sample and usefulness, and the research respectively of its one-component is not reported.

The various researchs about snake venom thrombin-like enzyme abroad are extremely extensively and go deep into.Domestic present widely used imported medicine DF-521 and reptilase are exactly the representative of snake venom thrombin-like enzyme in anti-bolt and two application facet of hemostasis, and relevant basis and clinical study are also very deep.But for the correlative study of agkistrodon acutus Thrombin-like enzyme, particularly coagulate and hematostatic research about short, external and domestic the same extremely thin a little less than.Main overseas investigator is Taiwan and Japanese scholar.As far back as nineteen fifty-seven, Taiwan's scholars Ouyang just finds that Taiwan is produced in the agkistrodon acutus and contains the Thrombin-like enzyme composition, and the activity that confirms this Thrombin-like enzyme has procoagulant activity under the high dosage and an anticoagulating active under the low dosage external.Cheng.H etc. have inquired into the separating effect of different separation methods to the agkistrodon acutus Thrombin-like enzyme, some the enzyme activities of different chromatographic peaks have been measured, and studied the blood coagulation enhancing effect of agkistrodon acutus Thrombin-like enzyme and the relation between the enzymic activity, and confirm that the Thrombin-like enzyme activity is exactly the esterase effect of occurring in nature.Ouyang.C etc. have isolated the Thrombin-like enzyme that a kind of molecular weight is 24.1K in the agkistrodon acutus snake venom, and its physico-chemical property carried out preliminary research, find that it has fibrinoclase activity, fine former lytic enzyme activity and casein lytic activity, and it is confirm that its fibrinolytic is specificly to act on fibrinogenic α (A) chain, and inoperative to β (B) chain and γ chain.Equally, the former justice of a specified duration of China fir etc. are also produced the agkistrodon acutus snake venom from Taiwan and are isolated the Thrombin-like enzyme that a kind of molecular weight is 52K, this short component carbohydrate containing of coagulating, and the hydrolyzable arginine ester, as TAEE or TAME, but the indigestion casein.Should shortly coagulate with the arginine ester enzymic activity and can be suppressed by DFP and antiserum(antisera), but not by Trypsin inhibitor SBTI (STI), EDTA, halfcystine, heparin or pCMBA (PCMB) etc. suppress.

But about the agkistrodon acutus Thrombin-like enzyme there is no bibliographical information as the production and the service condition of hemostatic drug.

Contain a large amount of blood toxicities and enzyme resource in the agkistrodon acutus, but, traditional biochemical extracting method production cost height, product purity are low, add the shortage of the snake resource that going from bad to worse of global ecological environment brought, and have restricted the research and utilization of various enzyme components in the snake venom to a great extent.

The invention of agkistrodon acutus Thrombin-like enzyme Thrombin-like enzyme, be to find in the novelty of these species of agkistrodon acutus, it provides a good drug candidates, is very useful for preventing and treating vessel embolism such as human phlebothrombosis and cerebral thrombosis.

Summary of the invention

The object of the present invention is to provide a kind of new Thrombin-like enzyme Thrombin-like enzyme and this proteic gene tle of coding.

Another object of the present invention is to provide this proteic production method.

The 3rd purpose of the present invention is to provide the application of this albumen in vessel embolism medicines such as preparation treatment phlebothrombosis, cerebral thrombosis.

The present invention separates the thrombase-like gene tle that obtains with the method for RT-PCR from the total RNA of agkistrodon acutus poison gland, its dna sequence dna as in the sequence table＜400〉1 sequences shown in.

The albumen Thrombin-like enzyme of genes encoding of the present invention, its aminoacid sequence as in the sequence table＜400〉2 sequences shown in.Molecular weight is 26kD.

This albumen can be by recombination yeast with the excretory formal representation.

This albumen acts on the fibrinogenic A α chain specifically, has blood coagulation activity.

The selected agkistrodon acutus of the present invention picks up from Fujian Province's Wuyishan Nature Reserve.

The structure in agkistrodon acutus poison gland cDNA library: at first with the agkistrodon acutus broken end, anatomical isolation goes out fresh poison gland tissue fast, extracts total RNA.Reverse transcription is a synthetic double chain cDNA behind the chain cDNA, and double-stranded cDNA is connected back Transformed E .coli with the pcDNA3.0 carrier, and preserves each recombinant clone.

The present invention measures by above reorganization library clone being carried out extensive stochastic sequence, therefrom obtained the clone of a coding Thrombin-like enzyme, called after Thrombin-like enzyme (be called for short TLE), (its dna sequence dna as in the sequence table＜400〉1 sequences shown in).New 236 amino acid whose mature peptides of genes encoding (its aminoacid sequence as in the sequence table＜400〉2 sequences shown in), molecular weight is 26kDa, has typical Thrombin-like enzyme characteristics.Through bioinformatic analysis, a kind of new Thrombin-like enzyme of this genes encoding.It contain with conservative serine stretch protein enzyme catalysis three connect structures (H57, D102, S195), and near also high conservative of the sequence three amino acid of catalysis triplet.

The present invention is by a pair of primer of design, and the new gene tle of coding Thrombin-like enzyme is come out from pcDNA3.0 carrier amplification with PCR method, is cloned on the methanol yeast expression vector pPICZ α A, is built into expression plasmid and it is transformed pichia spp GS115.This expression vector is with P _AOX1Be promotor, adopt the form of secreting, expressing that recombinant protein is secreted in the fermentation supernatant.By to incubation time, induction time, the groping and optimize of conditions such as methanol concentration, the Recombinant Protein Expression amount can reach 1mg/L.

The present invention also gropes and has optimized the purification condition of recombination classes zymoplasm, and the fermentation supernatant can obtain purity at the ripe recombination classes zymoplasm Thermbin-like enzyme (TLE) more than 95% through Q sepharose FF anionresin column purification.

The recombination classes zymoplasm Thermbin-enzyme like biologically active that the present invention obtains.What this recombination classes zymoplasm was special acts on the fibrinogenic Aa chain, has blood coagulation activity.

By the expression plasmid pPICZ α A of Thermbin-like enzyme mature polypeptide coding sequence that contains of the present invention through XhoI/Not I double digestion, can obtain the fragment about 780bp, be agkistrodon acutus poison gland Thrombin-like enzyme Thermbin-likeenzyme mature polypeptide coding sequence.

The clone method of expression plasmid of the present invention:, press CaCl with reference to Sambrook (Sambrook, et al.1989, Molecular cloingCold Spring Harbor Labroratory Press.USA) method ₂Method transforms plasmid in E.coli.DH5 α bacterial strain, with the LB substratum transform bacteria that contains penbritin (100 μ g/mL), alkaline process extracts plasmid.

Description of drawings

Fig. 1 is the comparison result of agkistrodon acutus poison gland Thrombin-like enzyme Thermbin-like enzyme of the present invention and other several homology Thrombin-like enzymes.The amino acid that dash (-) representative is identical, the amino acid of plus sige (+) representative disappearance.Tle1 is an agkistrodon acutus poison gland Thrombin-like enzyme; Halys is from Gloydius halys (gi:AF015727.1); Trimeresurus is from Trimeresurus gramineus (gi:2114123); Acutase has another name called Acuthrombin, from Deinagkistrodonacutus (gi:8567982); Agkistrodon and Dav-KN and Dav-PA are from Deinagkistrodon acutus[]; Ussuriensis and ussuriensis2 are from Gloydius ussuriensis (gi:2407644); Macrovipera is from Macrovipera lebetina (gi:6562943); Protobothrops is from Protobothrops mucrosquamatus (gi602601);

Fig. 2 is the total RNA electrophoresis result of agkistrodon acutus poison gland.

Fig. 3 is an agkistrodon acutus poison gland Thrombin-like enzyme tle Gene RT-PCR electrophoresis result.1:1kb DNA marker; 2:PCR purpose band.

Fig. 4 is the expression plasmid pPICZoA-tlePCR evaluation figure that contains gene tle.1：1kb?DNA?marker；2：Nativecontrol。3、4：Positive?transformants。

Fig. 5 is the recombinant expression plasmid pPICZoA-tle design of graphics that contains gene tle.

Fig. 6 dyes figure as a result for the expression and purification SDS-PAGE silver of delivering of Thrombin-like enzyme.1-5 is the fermentation supernatant of different periods: 5 for inducing back 12hr, and 1 is 24hr, and 2 is 36hr, and 3 is 36hr, and 4 is 72hr, and 6 is to express contrast (72hr) behind the empty carrier transformed yeast bacterium.8 is the result behind the Benzamidine purifying.

Fig. 7 lives for fibrinogen plate assay detects enzyme.Formed muddy spot behind the A:TLE Benzamidine purifying.B: the active spot that forms after the TLE behind the purifying dilutes 10 times.C: the active spot that forms after the TLE behind the purifying dilutes 50 times.

Fig. 8 is the research of Thrombin-like enzyme to substrate specificity.1, negative control does not add enzyme reaction solution; 2-13 is respectively in TLE effect 0.5min, 1min, 10min, 60min, 2hr, 4hr, 6hr, 8hr, 10hr, 12hr, 14hr, 16hr stopped reaction; 14, behind homemade fiber eliminating enzyme effect 2min; 15 be reptilase effect 2min after.

Embodiment

Following examples will help those of ordinary skill in the art further to understand the present invention, but not limit the present invention in any form.

Embodiment 1: the extraction of the total RNA of agkistrodon acutus poison gland and RT-PCR amplification

The extraction of total RNA and cDNA are synthetic: adopt a step hot phenol method to extract the total RNA of agkistrodon acutus poison gland, protein is removed in extracting.Obtaining total rna concentration is 3.9 μ g/ μ l, its A ₂₆₀/ A ₂₈₀=1.9, detect as seen 18s and 28s two bands clearly through 1% agarose electrophoresis, (see figure 2) shows that total RNA integrity is good.Get the total RNA of 1ug with SMART IIIolignuclotide (5 '-AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCGGG-3 ') and CDSIII/3 ' PCR primer (5 '-ATTCTAGAGGCCGAGGCGGCCGACATG-d (T) ₃₀N _-1N-3 ') each 1ul carries out synthetic first chain of reverse transcription, obtains 10 μ l cDNA, the first chain product.2 μ l, the first chain product is with 5 ' PCR primer (5 '-AAGCAGTGGTATCAACGCAGAGT-3 '), CDS III/3 ' PCR primer (5 '-ATTCTAGAGGCCGAGGCGGCCGACATGd (T) ₃₀N _-1N-3 ') carries out the amplification of second chain.With carrying out Sfi I cutting behind second chain protease K digestion and the purifying, connect into same Sfi I enzyme and cut on the pcDNA3.0 carrier library of handling.The EST that random sequencing obtains thrombase-like gene finds that through software analysis this EST is a total length.

Embodiment 2: the sequential analysis of agkistrodon acutus poison gland thrombase-like gene

Blast homology analysis revealed, the stejnobin sequence of a kind of serine protease of the nucleotide sequence of the new gene of this agkistrodon acutus poison gland Thrombin-like enzyme and a kind of India green bamboo snake (Trimeresurus gramineus) and Chinese green bamboo snake (Trimeresurus stejnegeri) has 87% homology, and (Bathrops jararaca) has 86% homology with America spearhead Pallas pit viper.The coded aminoacid sequence of stejnobin of the protein sequence of TLE and Chinese Trimeresurus stejnegeri (Trimeresurus stejnegeri) has the highest homology (72%), what is interesting is, this TLE gene with originally be that the homology of reporting thrombase-like gene from agkistrodon acutus is not the highest, in 13 thrombase-like genes of the agkistrodon acutus of having reported, it and Acutobin precursor (Acuthrombin/Acutase) have the highest homology (68%).This TLE aminoacid sequence has the typical feature with the Thrombin-like enzyme of other snake venom, contains the conservative catalysis triplet of serine protease: His67, Asp112, Ser206.By sequence relatively, prove that TLE is a kind of new thrombase-like gene, tle gene ORF total length is 780bp, translates into 260 amino acid with zymogen forms, and wherein signal peptide has 18 amino acid, pre-peptide region has 6 amino acid, and mature peptide contains 236 amino acid.Its mature peptide molecular weight (not containing glycosyl) is 26kD.It contains 12 halfcystines, forms 6 pairs of disulfide linkage.

Embodiment 3: the structure of agkistrodon acutus Thrombin-like enzyme yeast secreted expression plasmid

According to the synthetic a pair of primer of two terminal sequences of tle gene, upstream primer contains Xho I cleavage site, and downstream primer contains the NotI cleavage site.

Upstream primer (B1):

-CCG CTCGAGAAAAGAGAGGCTGAAGCTGTCATTGGAGGTAATGAATGTAAC-

Xho?I?3’end?ofα-Factor?signal?sequence Mature?TLE

Downstream primer (B2):

-TGC TCTAGATAACTTCTTCAAAAGTTTTCACGG

With the pcDNA3.0 plasmid that contains the tle gene is template, and B1, B2 are the primer PCR amplification, obtains the single band of specific amplified, and the product size is (Fig. 3) about 122bp.PCR is about 800bp, and amplified production to pichia yeast expression vector pPICZ α A, obtains recombinant expression vector pPICZ α A-tle (its building process as shown in Figure 5) through Xho I/NotI enzyme cutting clone.Expression vector identifies that through PCR (see figure 4) is correct.Foreign gene among the expression vector pPICZ α A-tle is identified correct through order-checking.

Embodiment 4: the expression of agkistrodon acutus recombination classes zymoplasm

PPICZ α A-tle electric shock is transformed Pichi strain Gs115, obtain recombination yeast gene engineering fungus.This restructuring yeast strains is after methanol induction is expressed, and its fermented supernatant fluid is with Tricine/Tris SDS-PAGE electrophoretic analysis.The result shows that thalline has tangible specifically expressing product band after inducing, and its molecular weight (28kD) is bigger slightly than the theoretical value (26kD) of prediction, and supposition is glycosylated result (Fig. 6) in the yeast expression process.。

Process is groped conditions such as medium pH value, methanol induction concentration, induction time, has determined medium pH 5.5,3 days expression condition of induction time.

Embodiment 5: the purifying of agkistrodon acutus recombination classes zymoplasm

The fermented supernatant fluid that contains agkistrodon acutus recombination classes zymoplasm of embodiment 5 gained, change level pad (20mM Tris-HCl into through Sephadex G-25 post, 150mM NaCl pH8.0) after, go up the Benzamidine pillar that same damping fluid balance is crossed, reduce to 0 with this damping fluid flushing pillar to passing the peak again, use 500mM NaAc, 500mMNaCl (pH3.0) is wash-out directly, collect elution peak, use Tris-Hcl (pH8.0) neutralization of 500mM to be eluted to neutral pH immediately.Elution peak is TLE (Fig. 6) after SDS-PAGE detects.

Embodiment 6: recombinant expressed Thrombin-like enzyme is active to be detected

Adopt fibrinogen plate assay [Stocker K] to improve: 50mg agarose is dissolved in the 5ml physiological saline, be heated to 90 ℃ and make dissolving, be cooled to 45 ℃, add 5ml and be preheating to 45 ℃ 0.4% bovine fibrinogen (Nat'l Pharmaceutical ﹠ Biological Products Control Institute's system), mixing, a kind of rhyme scheme in Chinese operas serving as the prelude to a complete score for voices fast.After the cooling, punch on flat board, every hole adds 10 μ l testing samples, is just putting in 37 ℃ of moist environments and is spending the night, and observation has or not muddy spot to occur.The results are shown in Figure 7, recombinant expressed Thrombin-like enzyme has muddy spot to occur.

Embodiment 7: the low thing specific detection of recombination classes zymoplasm

Adopt the SDS-PAGE method: bovine fibrinogen is dissolved in the Tris-HCl solution of aseptic 0.02mol/L pH8.0 or the physiological saline (20mg/ml), getting 200 μ l transfers in the glass test tube, add isopyknic enzyme liquid, 37 ℃ of temperature are bathed, in different period termination reactions, sampling is handled and is carried out SDS-PAGE.The results are shown in Figure 8, recombinant expressed Thrombin-like enzyme is the same with fiber eliminating enzyme and reptilase, all is specific acting on the fibrinogenic A α chain.

Sequence table

＜110〉Zhongshan University

＜120〉a kind of new thrombase-like gene and application thereof

<160>2

<210>1

<211>711

<212>DNA

＜213〉agkistrodon acutus (Hippocampus kuda Bleeker)

<220>

<221>mat?peptide

<222>(1)…(711)

<400>1

1 GTC?ATT?GGA?GGT?AAT?GAA?TGT?AAC?ATA?AAT?GAA?CAT?CGT?TTC?CTT?GTA?GCC?TTG?TAT?GAC 61

1 V I G G N E C N I N E H R F L V A L Y D 20

61 AAT?TTG?ACT?GGG?ACT?TTG?GAC?TGC?GGT?GGG?ACT?TTG?ATC?AAT?CAG?GAA?TGG?GTG?CTC?AGC?121

21 N L T G T L D C G G T L I N Q E W V L S 40

121?GCT?GCA?CAC?TGC?GAC?AGG?ACA?AGT?GTG?GTC?ATA?TAC?CTT?GGT?ATG?CAT?AAC?AAA?AGT?GTA?181

41 A A H C D R T S V V I Y L G M H N K S V 60

181?AAC?AAT?GAC?GAT?CAG?CAG?AGA?AGA?TCC?CCA?AAG?GAG?AAG?TAC?TTT?TTT?AAC?TGT?AGC?AAT?241

61 N N D D Q Q R R S P K E K Y F F N C S N 80

241?AGC?TTT?ACC?CAA?CTG?GAA?AAG?GAC?ATC?ATG?TTG?ATC?AGG?CTG?GAC?AGT?CCT?GTT?AAC?AAC?301

81 S F T Q L E K D l M L I R L D S P V N N 100

301?AGT?ACA?CAC?ATC?GCG?CCT?CTC?AGC?TTG?CCT?TCC?AGC?CCT?CCC?AGT?ATG?GAC?TCA?GTT?TGC?361

101?S T H I A P L S L P S S P P S M D S V C 120

361?CGT?GTT?ATG?GGA?TGG?GGC?GCA?ATC?ACA?TCT?CCT?AAA?GAG?ACT?TTT?CCC?GAG?GTC?CCT?CGT?421

121?R V M G W G A I T S P K E T F P E V P R 140

421?TGT?GCT?AAC?ATT?AAC?CTG?TTC?GAT?TAT?ACG?GTG?TGT?CGT?GGA?GCT?TTC?TCA?AGG?TTG?CCA?481

141?C A N I N L F D Y T V C R G A F S R L P 160

482?GAG?ACA?AGA?AGA?ATA?TTG?TGT?GCA?GGT?GTC?ATG?GAA?GGA?GGC?ATA?GAT?ACA?TGT?AAT?CAT?541

161?E T R R I L C A G V M E G G I D T C N H 180

542?GAC?TCT?GGG?GGA?CCT?CTC?ATC?TGT?GAT?GGA?CAA?TTC?CAG?GGC?ATT?GTA?TCT?TGG?GGA?CCC?601

181?D S G G P L I C D G Q F Q G I V S W G P 200

602?TAT?CCT?TGT?GCC?CAA?CCA?CGT?AAG?CCT?GCC?CTT?TAC?ACC?AAT?GTC?TTC?AAT?TAT?AAT?GGT?661

201?Y P C A Q P R K P A L Y T N V F N Y N G 220

662?TGG?ATC?CGG?AGC?ATT?ATT?GCC?GGA?AAT?ATC?GAT?GCG?GCT?TGC?CCC?CCG?TGA 709/711

221?W I R S I I A G N I D A A C P P * 236

<210>2

<211>236

<212>PRT

＜213〉agkistrodon acutus (Hippocampus kuda Bleeker)

<220>

<221>mat?peptide

<222>(1)…(236)

<400>2

1 V I G G N E C N I N E H R F L V A L Y D 20

21?N L T G T L D C G G T L I N Q E W V L S 40

41?A A H C D R T S V V I Y L G M H N K S V 60

61?N N D D Q Q R R S P K E K Y F F N C S N 80

81?S F T Q L E K D I M L I R L D S P V N N 100

101?S T H I A P L S L P S S P P S M D S V C 120

121?R V M G W G A I T S P K E T F P E V P R 140

141?C A N I N L F D Y T V C R G A F S R L P 160

161?E T R R I L C A G V M E G G I D T C N H 180

181?D S G G P L I C D G Q F Q G I V S W G P 200

201?Y P C A Q P R K P A L Y T N V F N Y N G 220

221?W I R S I I A G N I D A A C P P * 236

Claims

1. with the method for RT-PCR, separate the thrombase-like gene tle that obtains from the total RNA of agkistrodon acutus, its dna sequence dna is as sequence table＜400〉shown in 1 sequence.

2. the albumen of the described genes encoding of claim 1, its aminoacid sequence is as＜400〉shown in 2 sequences; This molecular weight of albumen is 28kD.

3. the described albumen of claim 2, preparation by the following method:

(1) the described gene tle of claim 1 is cloned on the methanol yeast expression vector pPICZ α A, obtains recombinant expression vector pPICZ α A-tle

(2) pPICZ α A-tle electric shock is transformed Pichi strain GS115, obtain recombination yeast gene engineering fungus;

(3) at the substratum of pH5.5, be 1% methyl alcohol with concentration, above-mentioned recombination yeast gene engineering fungus was carried out abduction delivering 6 days;

(4) fermented supernatant fluid obtains the recombination classes zymoplasm TLE of purifying through Q Sepharose FF anionresin column purification.

4. the described albumen of claim 2 is used for the treatment of the application in the vessel embolism medicines such as phlebothrombosis, cerebral thrombosis in preparation.