CN1772901A

CN1772901A - Antifreeze gene from wild rice and its coded protein and application

Info

Publication number: CN1772901A
Application number: CN 200510068051
Authority: CN
Inventors: 种康; 戴晓燕; 徐云远; 陈大洲; 肖叶青; 许智宏
Original assignee: Institute of Botany of CAS
Current assignee: Institute of Botany of CAS
Priority date: 2005-05-09
Filing date: 2005-05-09
Publication date: 2006-05-17
Anticipated expiration: 2025-05-09
Also published as: CN100436583C

Abstract

The present invention discloses wild rice antifreeze gene and its coded protein and application. The gene has one of the following nucleotide sequences: 1. DNA sequence of SEQ ID No. 1 in the sequence list; and 2. the nucleotide sequence capable of hybridizing in high strict condition with the DNA sequence limited by SEQ ID No. 1 in the sequence list. The gene coded protein has one of the following amino acid residue sequence: 1. SEQ ID No. 2 in the sequence list; and 2. the amino acid residue sequence of SEQ ID No. 2 through substitution, deletion and/or addition of 1-10 amino acid residues and coding protein with function of regulating plant antifreeze property. The antifreeze gene of the present invention will play an important part in breeding plant, especially rice, with enhanced antifreeze property.

Description

Anti-freeze gene and proteins encoded and application from wild-rice

Technical field

The present invention relates in the plant to coerce relevant gene and proteins encoded and application, particularly in the wild-rice and freeze proof relevant gene and proteins encoded and its application in the plant of cultivation frost resistance raising with anti-.

Background technology

The growth of plant is subjected to the influence of multiple abiotic factor in the environment, and wherein freeze injury and cold coercing are one of principal elements that influences crop yield.The expression that studies show that a large amount of adverse circumstance response genes be plant obtain resistance necessary (Gong et al., PNAS, 99:11507-11512).What research was more clearly at present is this approach of DREBl/CBF with freeze proof relevant approach, transcription factor DREB l/CBF in this approach (Dehydration-responsiveelement binding protein/C-repeat binding factor) family passes through and the cis-acting elements combination, thereby activate expression (the Liu et al. of downstream gene, Plant Cell, 10:1391-1406).But up to now, the research of relevant DREBl/CBF approach signal transduction yet there are no report, heterotrimer G-protein linked receptor (GProtein-Coupled Receptor) is a bigger family in animal, participate in a lot of processes in the vital movement, the homology of the different members of family on protein level is very low, mainly be divided into six class (Kolakowski by function at present, Receptors Channels, 2:1-7), but albumen has a common characteristic on space structure, promptly all contain 7 and stride film district (Anthony, Genome Biology, 2:3013.1-3013.10), the research of heterotrimer G-protein linked receptor concentrates in the animal mostly, and relevant for the report of GPCR effect in the plant seldom, only from the chip hybridization result, people infer that heterotrimer G-protein linked receptor may have important Role in Plant Signal Transduction in degeneration-resistant process.

China Jiangxi Province Dongxiang common wild-rice (O.rufipogon) is the wild-rice kind that is distributed in the world northernmost, contain abundant disease-resistant worm gene and cold-resistant gene, have good resistance to cold, drought tolerance, anti-lean property and disease resistance etc., and protein content is higher, but utility value is huge.Therefore make full use of a series of desirable genes of Dongxiang Wild Rice, in plant breeding research, have great value.In addition, the finishing of Arabidopis thaliana and rice genome examining order is the research that utilizes these model plants the to carry out gene function condition of providing convenience.

Summary of the invention

The purpose of this invention is to provide anti-freeze gene and proteins encoded thereof in the wild-rice.

Anti-freeze gene provided by the present invention, name is called OrMYB5, derives from common wild-rice (O.rufipogon), and it can have one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 1 dna sequence dna;

2) under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 1 .DNA sequence hybridization that limits.

The rigorous condition of described height be 0.1 * SSPE (or 0.1 * SSC), in the solution of 0.1%SDS, hybridization and wash film under 65 ℃ of conditions.

SEQ ID № in the sequence table: 1 by 1764 based compositions, and its encoding sequence is that coding has SEQ ID № in the sequence table: the protein of 2 amino acid residue sequence from 5 ' end 1-1764 bit base.

The albumen (OrMYB5) that anti-freeze gene of the present invention is coded is the protein with one of following amino acid residue sequences:

1) the SEQ ID № in the sequence table: 2;

2) with SEQ ID № in the sequence table: 2 amino acid residue sequence is through replacement, disappearance or the interpolation of one to ten amino-acid residue and the protein with regulation and control plant frost resistance.

SEQ ID № in the sequence table: 2 are made up of 587 amino-acid residues.

Contain expression carrier of the present invention, transgenic cell line and host bacterium and all belong to protection scope of the present invention.

Arbitrary segmental primer is to also within protection scope of the present invention among the amplification OrMYB5.

Utilize plant expression vector, anti-freeze gene of the present invention is imported vegetable cell, can obtain tolerance to low temperature enhanced transgenic cell line and transfer-gen plant.

Described plant expression vector comprises the double base agrobacterium vector and can be used for the carrier etc. of plant micropellet bombardment.Described plant expression vector also can comprise 3 ' end untranslated zone of foreign gene, promptly comprise the polyadenylic acid signal and any other participation mRNA processing or the dna fragmentation of genetic expression.The bootable polyadenylic acid of described polyadenylic acid signal joins 3 ' end of mRNA precursor, and the non-translational region of inducing (Ti) plasmid gene (as kermes synthetic enzyme Nos gene), plant gene (as soybean storage protein gene) 3 ' end to transcribe as the Agrobacterium crown-gall nodule all has similar functions.

When using OrMYB5 to make up plant expression vector, before its transcription initiation Nucleotide, can add any enhancement type promotor or inducible promoter, as cauliflower mosaic virus (CAMV) 35S promoter, root specific expression promoter etc., they can use separately or be used in combination with other plant promoter; In addition, when using gene constructed plant expression vector of the present invention, also can use enhanser, comprise translational enhancer or transcriptional enhancer, these enhanser zones can be ATG initiator codon or neighboring region initiator codon etc., but must be identical with the reading frame of encoding sequence, to guarantee the correct translation of whole sequence.The source of described translation control signal and initiator codon is widely, can be natural, also can be synthetic.Translation initiation region can be from transcription initiation zone or structure gene.

For the ease of transgenic plant cells or plant being identified and screening, can process used plant expression vector, can produce the enzyme of colour-change or the gene of luminophor (gus gene, luciferase genes etc.) as adding the coding that in plant, to express, have the antibiotic marker thing (gentamicin marker, kantlex marker etc.) of resistance or anti-chemical reagent marker gene (as anti-weedkiller gene) etc.From the security consideration of transgenic plant, can not add any selected marker, directly with adverse circumstance screening transformed plant.

Carry OrMYB5 of the present invention plant expression vector can Ti-plasmids, Ri plasmid, plant viral vector, directly DNA conversion, microinjection, electricity be led, conventional biological method transformed plant cells or tissue such as agriculture bacillus mediated by using, and the plant transformed cell or tissue is cultivated into plant.By the plant transformed host both can be monocotyledonss such as paddy rice, corn, wheat, also can be dicotyledonss such as Arabidopis thaliana, tobacco.

The anti-freeze gene OrMYB5 that the present invention screens from Dongxiang Wild Rice by chip technology provides theoretical basis for the Antifreezing Mechanism of research Dongxiang Wild Rice and the breeding work of paddy rice, will play an important role in cultivating frost resistance enhanced plant (particularly paddy rice).

The present invention will be further described below in conjunction with specific embodiment.

Description of drawings

Fig. 1 is the agarose gel electrophoresis detected result of the OrMYB5 cDNA that increases with the RT-PCR method from the total RNA of rice seedling

Fig. 2 is the physical map of OrMYB5 plant expression vector pSN::OrMYB5

Fig. 3 is for changeing the PCR qualification result of the positive seedling of OrMYB5 Arabidopis thaliana

Fig. 4 is for changeing the RT-PCR qualification result of OrMYB5 Arabidopis thaliana

Fig. 5 is for changeing the phenotype of OrMYB5 Arabidopis thaliana after low temperature stress is handled

Embodiment

Method therefor is ordinary method if no special instructions among the following embodiment.

The clone of embodiment 1, OrMYB5

The rice cDNA chip is hybridized, from freeze proof candidate gene, select one after low temperature induction expressing quantity improve 2.6 times gene (OrMYB5) and carry out functional verification, obtain open reading frame (ORF) sequence of this gene complete from (http://www.ncbi.nlm.nih.gov) and (http://www.tigr.org) two websites of NCBI and according to this sequences Design primer according to known est sequence: 5 ' to hold primer be CGC GGATCCATGGGGGCCATGGCGATGGTGG (band underscore part base is a restriction enzyme BamH I recognition site); 3 ' end primer is CGG GGTACCTTAGGTTACATCCAAATTGG (band underscore part base is a restriction enzyme Kpn I recognition site).Is template with Dongxiang Wild Rice (O.rufipogon) seedling through 2-3 ℃ of total RNA that handled 72 hours, under the right guiding of above-mentioned primer, and the cDNA sequence of RT-PCR amplification OrMYB5, concrete grammar may further comprise the steps:

1, the extraction of total RNA: the Dongxiang Wild Rice seedling in two weeks of growth on not containing the 1/2MS substratum of hormone is placed in the low temperature incubator 2-3 ℃ of processing 72 hours, extract the total RNA of seedling with Trizol method (agents useful for same is available from Invitrogen company), concrete grammar is: collect the rice material 100mg through above-mentioned subzero treatment, place liquid nitrogen to grind immediately, add 1mL Trizol reagent, fully behind the mixing, room temperature was placed 5 minutes; Add the 0.2mL chloroform, violent jolting 15 seconds, room temperature incubation 3 minutes; 4 ℃, centrifugal 15 minutes of 12000g; Supernatant liquor is transferred in the new 1.5mL centrifuge tube, added 0.5mL isopropanol precipitating RNA; At last with RNA precipitation with being dissolved in after 1mL 75% washing with alcohol in right amount in the DEPC treated water ,-70 ℃ of preservations are standby.

2, the first chain cDNA's is synthetic: use Superscript ^TMII RT test kit (Invitrogen) is also operated by the test kit specification sheets: get the total RNA of paddy rice that 1-5 μ g step 1 the obtains PCR pipe of RNase of having put into deactivation, add Oligo (dT) _12-18(500mg/mL) 1 μ L and dNTP Mix (10mM each) 1 μ L is supplemented to 12 μ L with the distilled water after the DEPC processing, heats 5 minutes down at 65 ℃ behind the mixing, places on ice 1 minute then rapidly.Of short durationly add 5 * the first chain reverse transcription damping fluids, 4 μ L, 0.1M DTT 2 μ L and RNaseOut again after centrifugal ^TM(40unit/ μ L) 1 μ L, gently behind the mixing, 42 ℃ of incubations 2 minutes add Superscript then ^TMII ThermoScript II (200unit/ μ L) 1 μ L, mixing, 42 ℃ of incubations 50 minutes, 70 ℃ of heating made enzyme deactivation in 15 minutes, obtained the first chain cDNA.

3, OrMYB5 cDNA's is synthetic: the reverse transcription product of getting the acquisition of 1 μ L step 2 is a template, under the guiding of 5 ' end primer and 3 ' end primer, with the cDNA of the synthetic OrMYB5 of the method for PCR, the PCR reaction system is: LA Taq (TaKaRa company) 0.5 μ L, 2 * GC damping fluid I (TaKaRa company), 25 μ L, dNTP 1 μ L, 5 ' end primer (10 μ M/L), 1 μ L, 3 ' end primer (10 μ M/L), 1 μ L, template 1 μ L, add distilled water postreaction system to 50 μ L.The PCR reaction conditions is: earlier 94 ℃ 4 minutes; Again 94 ℃ 45 seconds, 62 ℃ 45 seconds, 72 ℃ 2 minutes, totally 35 circulations; Last 72 ℃ 10 minutes.

After reaction finishes, the PCR product is carried out 0.8% agarose gel electrophoresis detect, detected result is (swimming lane 1 negative contrast as shown in Figure 1, swimming lane 2 is the RT-PCR product of OrMYB5, swimming lane 3 is DL15000DNA Marker), obtain the band that molecular weight is about 1.7kb, conform to expected results.Reclaim test kit (sky, Beijing is a Time Inc.) with sepharose and reclaim this fragment, should reclaim fragment then and be connected with carrier pGEM-T Easy (Promega company), linked system is: T ₄Dna ligase (3u/ μ L), 2 * ligase enzyme damping fluid, 5 μ L, pGEM-TEasy (50ng/ μ L) 0.5 μ L and recovery PCR product 3.5 μ L, 4 ℃ were reacted 12-24 hour.Method (Proc Natl Acad Sci with reference to Cohen etc., 69:2110), to connect product transformed into escherichia coli DH5 α competent cell, according to the carboxylic Bian penicillin resistance label screening positive colony on the pGEM-T Easy carrier, obtain containing the segmental recombinant plasmid of recovery, called after pTOsMYB.With T7 on this plasmid vector and SP6 promoter sequence is that primer carries out nucleotide sequencing to it, sequencing result shows that OrMYB5 has SEQ ID № in the sequence table: 1 nucleotide sequence, by 1764 based compositions, its open reading frame (ORF) is from 5 ' end 1-1764 bit base, coding has SEQ ID № in the sequence table: the protein of 2 amino acid residue sequence, 587 amino acid of encoding.

Embodiment 2, OrMYB5 overexpression carry the structure of pSN::OrMYB5

1, the acquisition of corn ubiquitin promoter (UbiPro)

1) extraction of corn gene group DNA: the about 0.2g corn seedling of clip places liquid nitrogen to grind; Add the extraction damping fluid (containing 0.1M Tris-HCl pH8.0,50mM EDTA, 0.5M NaCl, 1%SDS and 1% beta-mercaptoethanol) of the new preparation of 800 μ L then, thermal agitation makes its whole suspensions; 65 ℃ of water-baths 30 minutes were put upside down mixing once in per 5 minutes; Add the 5M potassium acetate of 250 μ L precoolings then, put upside down mixing immediately, ice bath 5 minutes; Add equal amounts of phenolic/chloroform, extracting once, centrifugal 5 minutes of 12000rpm; Collect supernatant, add the isopropanol precipitating DNA of 0.6 times of volume, room temperature was placed 40 minutes; Centrifugal 15 minutes of 4 ℃ of 12000rpm abandon supernatant; Precipitation is respectively washed once with 70%, 100% ethanol; After the drying, be dissolved in the ddH that 20 μ L contain 100 μ g/mL RNase ₂Among the O, obtain corn gene group DNA.

2) pcr amplification corn ubiquitin promoter (UbiPro): the corn gene group DNA solution of getting the acquisition of 2 μ L step 1) is as template, at the 5 ' primer (GG that has Hind III recognition site AAGCTTCTGCAGTGCAGCGTGACCCGG) and have 3 ' primer (CG of BamHI recognition site GGATCCAAGTAACACCAAACAACAGGG) carry out pcr amplification under the guiding, the PCR reaction conditions is: earlier 94 ℃ 3 minutes; Again 94 ℃ 45 seconds, 62 ℃ 45 seconds, 72 ℃ 2 minutes, totally 35 circulations, last 72 ℃ 10 minutes.After reaction finishes, the PCR product is carried out 0.8% agarose gel electrophoresis to be detected, show and obtain the amplified fragments that length is about 2kb, conform to expected results, reclaim this purpose fragment, with reclaiming behind restriction enzyme Hind III and the BamH I double digestion, obtain having the corn ubiquitin promoter (UbiPro) of sticky end, standby.

2, with restriction enzyme Sac I and EcoR I Noster poly A terminator sequence is downcut from plasmid vector pBI221 (Clontech company), be connected in the corresponding site of carrier pUC19 (TaKaRa company), obtain recombinant vectors, called after pUC19-Noster.Use restriction enzyme HindIII and BamHI double digestion pUC19-Noster again, after agarose gel electrophoresis detects, reclaim the big fragment of linearizing carrier, and will reclaim the corn ubiquitin promoter (UbiPro) that has sticky end that fragment and step 1 obtain and link to each other, obtain recombinant vectors, called after pUN19.

3, partially digested and HindIII complete degestion is purchased the recombinant vectors pUN19 that builds from step 2 and is downcut the fragment that the length that comprises UbiPro and Noster is about 2.3kb with restriction enzyme EcoR I, this fragment cloning is gone into plasmid vector pCAMBIA1301 (Center for the Application of Molecular Biology toInternational Agriclture, www.cambia.org) the EcoR I of multiple clone site and HindIII site, obtain recombinant vectors, called after pUN1301.

4, with restriction enzyme HindIII and BamHI plasmid vector pBI221 is carried out double digestion, after detecting, reclaims agarose gel electrophoresis the 35S promoter fragment that length is about 0.8kb, it is connected with plasmid vector pUN1301 through the same enzyme double digestion, obtain containing the segmental recombinant vectors of 35S promoter, called after pSN1301.

5, recombinant plasmid vector pTOsMYB and pSN1301 are carried out double digestion with restriction enzyme KpnI and BamHI respectively, the enzyme system of cutting is: plasmid 10 μ L, 10 * enzyme cutting buffering liquid, 5.0 μ L, KpnI 1 μ L, BamHI 0.8 μ L add ddH ₂O postreaction system to 50 μ L, 37 ℃ of enzymes were cut 12-24 hour.With agarose gel electrophoresis enzyme is cut product and separate, reclaim the OrMYB5 fragment of 1764bp and the big fragment of carrier pSN1301 of 12376bp, be dissolved in 20 μ L ddH respectively ₂Among the O.By following reaction system both are connected again: T ₄The OrMYB5 10 μ L of dna ligase 2 μ L, 10 * ligase enzyme damping fluid, 2 μ L, recovery, the pSN1301 6 μ L of recovery, 16 ℃ connect 16 hours.To connect product transformed into escherichia coli DH5 α competent cell, the resistant panel screening through containing kantlex obtains positive strain, and with this recombinant plasmid called after pSN::OrMYB5, its physical map as shown in Figure 2.Adopt CaMV 35S strong promoter to start goal gene OrMYB5 overexpression in plant in this plasmid, the preparation method of transgenic plant is stated embodiment as follows.

The acquisition and the evaluation thereof of embodiment 3, OrMYB5 overexpression Arabidopis thaliana

One, transforms the acquisition of the Arabidopis thaliana that OrMYB5 overexpression plasmid pSN::OrMYB5 is arranged

The Agrobacterium that contains expression vector is soaked seed that plants transformed is tied and uses T by the plant that this seed grows up to ₀Representative, T ₁T is shown in representative ₀The seed that produces for selfing reaches by the plant that it grew up to T ₂T is shown in representative ₁The seed that produces for selfing and by plant that it grew up to.

1, OrMYB5 overexpression plasmid pSN::OrMYB5 arabidopsis thaliana transformation

Operate with EasyJecT Plus electric exciter (Britain EquiBio company) and with reference to specification sheets, plasmid pSN::OrMYB5 is transformed Agrobacterium C58 with electrization, the resistant panel screening through containing kantlex obtains the positive colony of Agrobacterium; Refer again to the method (Clough SJ and Bent AF, 1998 Plant J16:735-43) of Clough etc., under the mediation of above-mentioned positive colony Agrobacterium, with the pSN::OrMYB5 arabidopsis thaliana transformation.

2, the antibiotic screening of the positive seedling of transgenic arabidopsis

The seed of the transgenic arabidopsis that the step 1 of results is obtained was with 0.2% TritonX-100 immersion 10 minutes; Use 10% clorox surface sterilization again, 12 minutes; Aqua sterilisa washing five times, per 2 minutes are once; Water is layered on seed on the MS flat board that contains the 25mg/L Totomycin, with masking foil parcel, places 2 days under 4 ℃, dark condition, takes out back dark cultivation 3-4 days in 22 ℃ culturing room; After 3-4 days, the positive for just being sieved to that growing way is the highest transforms seedling, takes out under the lucifuge condition, cultivates under the light 3 days again, the transgenic positive seedling is moved to cultivate in the flowerpot then, obtains T1 for transgenic line.

Two, the evaluation of transgenic arabidopsis

GUS staining fluid: 100mmol/L phosphoric acid salt pH 7.0,0.1%Triton X-100,10mmol/L EDTA, the 0.5mmol/L Tripotassium iron hexacyanide, X-Gluc 1mg/mL.

Edwards extracts damping fluid: 200mM Tris-Cl pH7.5,250mM NaCl, 25mM EDTA, 0.5%SDS.

1, the GUS dyeing of the positive seedling of Arabidopis thaliana is identified

The positive seedling leaves of the Arabidopis thaliana tip 2-3mm material of getting step 1 screening in 3 weeks of growth carries out GUS dyeing.37 ℃ incubation 12-24 hour, again with 75% alcohol decolouring, blade is blue positive plant.

2, the PCR of transfer-gen plant identifies

1) extraction of genomic dna

Get a slice and put into 1.5mL Eppendorf pipe, add liquid nitrogen, grind pestle with tissue and ground for 10 seconds, grind with the blade of the Arabidopis thaliana positive plant of the method evaluation of step 1; Add 400 μ L Edwards and extract damping fluid, grind gently (organizing on the flush away pestle); Vibrated for 5 seconds, centrifugal 1 minute, the supernatant liquor that shifts 300 μ L added 300 μ L Virahols in new pipe, mixed, and placed 2 minutes in room temperature; Centrifugal, abandon supernatant, air-dry precipitation is dissolved in the 100 μ L water, obtains the genomic dna of transgenic line.

2) PCR of transfer-gen plant identifies

The genomic dna that obtains with step 1) is a template, primer 1 (5 ' end primer: ATGGGGGCCATGGCGATGGTGG) and primer 2 (3 ' holds primer: under guiding TTAGGTTACATCCAAATTGG), method with PCR identifies that to transfer-gen plant the PCR reaction system is: each 1 μ L of genomic dna solution 1 μ L, LA taq 0.5 μ L, 2 * GC damping fluid, 25 μ L, dNTP 1 μ L, primer 1 (10 μ M/L) and primer 2 (10 μ M/L), add distilled water postreaction system to 50 μ L.The PCR reaction conditions is: earlier 94 ℃ 5 minutes; Again 94 ℃ 30 seconds, 60 ℃ 30 seconds, 72 ℃ 90 seconds, totally 28 circulations; Last 72 ℃ 10 minutes.After reaction finishes, the PCR product is carried out 0.8% agarose gel electrophoresis to be detected, (swimming lane 1 is DL2000DNA Marker to the result as shown in Figure 3, swimming lane 2 is the wild-type plant, swimming lane 3-8 is different transgenic lines), expand the transgenic positive seedling that the 1.7kb band, conform to expected results, wild-type does not then amplify this band, shows that goal gene successfully changes in the Arabidopis thaliana.

3, the RT-PCR of transfer-gen plant identifies

The total RNA that extracts the wild-type plant respectively and be flowering period with detected three the transgenic positive strains of aforesaid method respectively gets the total RNA of 2 μ g and carries out reverse transcription, synthetic its cDNA, and RNA extracts and reverse transcription method carries out with reference to the step among the embodiment 1.With this reverse transcription product is template, at OrMYB5 special primer (5 ' primer: ATGGGGGCCATGGCGATGGTGG, 3 ' primer: under guiding TTAGGTTACATCCAAATTGG), (with Actin is reference to carry out the RT-PCR detection, 5 ' primer: CCCTCTTTGAATTGCCTC, 3 ' primer: CAGGAGCAATACGGAGCT), PCR reaction system and embodiment 1 with, the PCR reaction conditions is: earlier 94 ℃ 5 minutes; Again 94 ℃ 30 seconds, 60 ℃ 30 seconds, 72 ℃ 90 seconds, totally 28 circulations; Last 72 ℃ 10 minutes.After reaction finishes, the PCR product is carried out 0.8% agarose gel electrophoresis to be detected, (swimming lane L5, L11 are three different transgenic lines with L14 to the result as shown in Figure 4, swimming lane WT is the wild-type plant), all transgenic lines all expand and the fragment of OrMYB5 clearly, wild-type does not then have, and shows that OrMYB5 successfully changes in the Arabidopis thaliana.

The phenotype of the OrMYB5 transgenic arabidopsis after embodiment 4, low temperature stress are handled

OrMYB5 transgenic positive Arabidopis thaliana seedling is carried out low temperature stress handle the frost resistance of observing it.Concrete grammar is: the potted plant OrMYB5 transgenic arabidopsis seedling in 3 weeks of will growing is earlier 4 ℃ of following cold one weeks of instructionization, be divided into three groups then respectively-8 ℃ of following subzero treatment 3 hours, 6 hours and 9 hours, seedling is placed 22 ℃ of recoveries to cultivate again and observed its phenotypic characteristic in 3 days, the result is (WT: 9 hours wild-type plant of-8 ℃ of following subzero treatment as shown in Figure 5; L5: at 3 hours transfer-gen plant L5 of-8 ℃ of following subzero treatment; L11: at 6 hours transfer-gen plant L11 of-8 ℃ of following subzero treatment; L14: at 9 hours transfer-gen plant L14 of-8 ℃ of following subzero treatment), show that the OrMYB5 transgenic arabidopsis has tangible low temperature stress resistance.

Sequence table

<160>2

<210>1

<211>1764

<212>DNA

＜213〉common wild-rice (O.rufipogon)

<400>1

atgggggcca?tggcgatggt?ggagcaggag?gggtgcgtcg?agaaccggca?gcccctggcg 60

gcgtcgagct?cgtcagtttc?cgacggaagc?agctatggcg?gcggcagcgg?cgggctcgcg 120

cagatgtcgc?cgccggtgtc?tggctcggcg?aattccatct?ccggtcttag?gcggacaagc 180

gggccaataa?ggagagcaaa?gggtggctgg?acaccagagg?aggacgagac?attgaggaag 240

gcagttgagg?cttataaggg?tagaaactgg?aagaaaatag?ccgaatgttt?tccatacaga 300

acagaggtac?aatgcttgca?tcgatggcaa?aaggttctta?atcctgaact?tatcaaaggt 360

ccttggactc?aagaggaaga?tgatcaaatt?attgatcttg?taaagaagta?tggaccaaca 420

aaatggtctg?tcatagctaa?ggcattacct?ggccgtatag?ggaagcaatg?tcgagagagg 480

tggcacaatc?atctaaatcc?agaaataagg?aaagatgctt?ggactactga?ggaggaacag 540

gcactcataa?atgctcatcg?gatttatggg?aataaatggg?cagagatagc?aaaagttctt 600

cctggaagga?ctgataattc?tataaagaat?cattggaata?gttctctcag?aaagaagcaa 660

ggtatgtaca?ataccagcaa?taatatggta?gttccgaaac?tgcttgttca?tgataagttc 720

aaggataaac?caaagctgat?ggctatggag?ggtcatcttg?atttgaacaa?ggcacccatt 780

atcaattcaa?aagaccaacc?tggaacagct?catcggtcta?attgctcagg?gtttctatct 840

cgttcctcat?tgccaactgc?tcagccactt?acttcccgtg?aggcatctgt?agttgatggt 900

tccgctgtca?ctttagtggc?gcaagctctg?gaaagtgatt?ctgtccgtgg?taagggcttg 960

gaaattgatt?ctgttcatga?gaaaggtctt?gaggttaact?cggcacctga?tcataccggg 1020

aactcttgga?ccattcaact?agaagctgca?ccatccaaag?gtgaagcaga?attatctttg 1080

aagaatgagg?cacgctctct?tggtccactt?tgttaccaga?tccctaacat?ggaagatgta 1140

gtccctgtga?gttcctcact?cttttctgac?catcttactg?ggaaccatac?atctgaacat 1200

tgtggggatg?atatattgtc?acctgctggc?tgcactactc?cccctccaac?aaagggaaaa 1260

ttaacaagcc?agcttagtgt?tgattcaatt?ttgaagagtg?ctgctaacag?ttttccaggt 1320

actccttcaa?tattaaaaag?aagaaaacgg?gataaatcaa?cacctgtttc?agctagtgag 1380

gtgaagatca?gtggatcaaa?tactgataga?ttttacactc?ccatggggat?ggaacctgct 1440

acagctacac?cagagtcatt?caaaactaca?tcttttttgt?cattgggttc?tcttgatggt 1500

tctgtaaaga?gctttgatgt?ttcaccacaa?taccgggcaa?ggtcaaaaag?aatggctctc 1560

acgaaaacag?ttgagaaaca?gctggatttt?tcatcagatg?gattagatac?ttgtggttct 1620

gagattctga?actcttcctg?caataattcc?caaagcacac?tttctattac?cgaagcccca 1680

aaactgaaag?aaaaggaaca?tgctgttcaa?ttggaaaatt?taaccaagaa?ctttgcgcat 1740

acaaccaatt?tggatgtaac?ctaa 1764

<210>2

<211>587

<212>PRT

＜213〉common wild-rice (O.rufipogon)

<400>2

Met?Gly?Ala?Met?Ala?Met?Val?Glu?Gln?Glu?Gly?Cys?Val?Glu?Asn?Arg

1 5 10 15

Gln?Pro?Leu?Ala?Ala?Ser?Ser?Ser?Ser?Val?Ser?Asp?Gly?Ser?Ser?Tyr

20 25 30

Gly?Gly?Gly?Ser?Gly?Gly?Leu?Ala?Gln?Met?Ser?Pro?Pro?Val?Ser?Gly

35 40 45

Ser?Ala?Asn?Ser?Ile?Ser?Gly?Leu?Arg?Arg?Thr?Ser?Gly?Pro?Ile?Arg

50 55 60

Arg?Ala?Lys?Gly?Gly?Trp?Thr?Pro?Glu?Glu?Asp?Glu?Thr?Leu?Arg?Lys

65 70 75 80

Ala?Val?Glu?Ala?Tyr?Lys?Gly?Arg?Asn?Trp?Lys?Lys?1le?Ala?Glu?Cys

85 90 95

Phe?Pro?Tyr?Arg?Thr?Glu?Val?Gln?Cys?Leu?His?Arg?Trp?Gln?Lys?Val

100 105 110

Leu?Asn?Pro?Glu?Leu?Ile?Lys?Gly?Pro?Trp?Thr?Gln?Glu?Glu?Asp?Asp

115 120 125

Gln?Ile?Ile?Asp?Leu?Val?Lys?Lys?Tyr?Gly?Pro?Thr?Lys?Trp?Ser?Val

130 135 140

Ile?Ala?Lys?Ala?Leu?Pro?Gly?Arg?Ile?Gly?Lys?Gln?Cys?Arg?Glu?Arg

145 150 155 160

Trp?His?Asn?His?Leu?Asn?Pro?Glu?Ile?Arg?Lys?Asp?Ala?Trp?Thr?Thr

165 170 175

Glu?Glu?Glu?Gln?Ala?Leu?Ile?Asn?Ala?His?Arg?Ile?Tyr?Gly?Asn?Lys

180 185 190

Trp?Ala?Glu?Ile?Ala?Lys?Val?Leu?Pro?Gly?Arg?Thr?Asp?Asn?Ser?Ile

195 200 205

Lys?Asn?His?Trp?Asn?Ser?Ser?Leu?Arg?Lys?Lys?Gln?Gly?Met?Tyr?Asn

210 215 220

Thr?Ser?Asn?Asn?Met?Val?Val?Pro?Lys?Leu?Leu?Val?His?Asp?Lys?Phe

225 230 235 240

Lys?Asp?Lys?Pro?Lys?Leu?Met?Ala?Met?Glu?Gly?His?Leu?Asp?Leu?Asn

245 250 255

Lys?Ala?Pro?Ile?Ile?Asn?Ser?Lys?Asp?Gln?Pro?Gly?Thr?Ala?His?Arg

260 265 270

Ser?Asn?Cys?Ser?Gly?Phe?Leu?Ser?Arg?Ser?Ser?Leu?Pro?Thr?Ala?Gln

275 280 285

Pro?Leu?Thr?Ser?Arg?Glu?Ala?Ser?Val?Val?Asp?Gly?Ser?Ala?Val?Thr

290 295 300

Leu?Val?Ala?Gln?Ala?Leu?Glu?Ser?Asp?Ser?Val?Arg?Gly?Lys?Gly?Leu

305 310 315 320

Glu?Ile?Asp?Ser?Val?His?Glu?Lys?Gly?Leu?Glu?Val?Asn?Ser?Ala?Pro

325 330 335

Asp?His?Thr?Gly?Asn?Ser?Trp?Thr?Ile?Gln?Leu?Glu?Ala?Ala?Pro?Ser

340 345 350

Lys?Gly?Glu?Ala?Glu?Leu?Ser?Leu?Lys?Asn?Glu?Ala?Arg?Ser?Leu?Gly

355 360 365

Pro?Leu?Cys?Tyr?Gln?Ile?Pro?Asn?Met?Glu?Asp?Val?Val?Pro?Val?Ser

370 375 380

Ser?Ser?Leu?Phe?Ser?Asp?His?Leu?Thr?Gly?Asn?His?Thr?Ser?Glu?His

385 390 395 400

Cys?Gly?Asp?Asp?Ile?Leu?Ser?Pro?Ala?Gly?Cys?Thr?Thr?Pro?Pro?Pro

405 410 415

Thr?Lys?Gly?Lys?Leu?Thr?Ser?Gln?Leu?Ser?Val?Asp?Ser?Ile?Leu?Lys

420 425 430

Ser?Ala?Ala?Asn?Ser?Phe?Pro?Gly?Thr?Pro?Ser?Ile?Leu?Lys?Arg?Arg

435 440 445

Lys?Arg?Asp?Lys?Ser?Thr?Pro?Val?Ser?Ala?Ser?Glu?Val?Lys?Ile?Ser

450 455 460

Gly?Ser?Asn?Thr?Asp?Arg?Phe?Tyr?Thr?Pro?Met?Gly?Met?Glu?Pro?Ala

465 470 475 480

Thr?Ala?Thr?Pro?Glu?Ser?Phe?Lys?Thr?Thr?Ser?Phe?Leu?Ser?Leu?Gly

485 490 495

Ser?Leu?Asp?Gly?Ser?Val?Lys?Ser?Phe?Asp?Val?Ser?Pro?Gln?Tyr?Arg

500 505 510

Ala?Arg?Ser?Lys?Arg?Met?Ala?Leu?Thr?Lys?Thr?Val?Glu?Lys?Gln?Leu

515 520 525

Asp?Phe?Ser?Ser?Asp?Gly?Leu?Asp?Thr?Cys?Gly?Ser?Glu?Ile?Leu?Asn

530 535 540

Ser?Ser?Cys?Asn?Asn?Ser?Gln?Ser?Thr?Leu?Ser?Ile?Thr?Glu?Ala?Pro

545 550 555 560

Lys?Leu?Lys?Glu?Lys?Glu?His?Ala?Val?Gln?Leu?Glu?Asn?Leu?Thr?Lys

565 570 575

Asn?Phe?Ala?His?Thr?Thr?Asn?Leu?Asp?Val?Thr

580 585

Claims

1, wild-rice anti-freeze gene has one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 1 dna sequence dna;

2) under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 1 dna sequence dna hybridization that limits.

2, anti-freeze gene according to claim 1 is characterized in that: described anti-freeze gene has SEQ ID № in the sequence table: 1 dna sequence dna.

3, the proteins encoded of the described anti-freeze gene of claim 1 is characterized in that: be one of following amino acid residue sequences:

1) the SEQ ID № in the sequence table: 2;

4, albumen according to claim 3 is characterized in that: described albumen has the SEQ ID № in the sequence table: 2 amino acid residue sequences.

5, the expression vector that contains the described anti-freeze gene of claim 1.

6, the transgenic cell line that contains the described anti-freeze gene of claim 1.

7, the host bacterium that contains the described anti-freeze gene of claim 1.

8, a kind of method of cultivating freeze proof plant is to utilize plant expression vector that the described anti-freeze gene of claim 1 is imported vegetable cell, obtains transgenic cell line and transfer-gen plant to the tolerance to low temperature enhanced.

9, method according to claim 8 is characterized in that: described is paddy rice by the plant transformed host.