CN1766116A - A kind ofly improve farm crop utilize ability to the soil phytate phosphorus method - Google Patents

Abstract

The invention provides and a kind ofly improve farm crop and soil is closed hold the especially method of utilizing ability of phytate phosphorus of attitude phosphorus element, this method comprises: the fusion shown in the SEQ ID NO.1 is had the nucleotide sequence of phytase gene and signal peptide gene is exercisable to be connected to after the promotor, make up plant recombination expression vector; With these plant recombination expression vector transformation receptor farm crop.For security needs, the inventive method also comprises and makes up the plant selectable marker expression vector and with itself and the common transformation receptor farm crop of plant recombination expression vector, and seed selection obtains Expressing Recombinant Phytase and do not contain the genetically modified crops of selection markers gene.The present invention changes phytase gene in the farm crop over to by transgenic technology, efficiently express phytase at crop root, continuous expression phytase in its whole growth process, and to the root external secretion, a large amount of phytate phosphorus that exist in the degraded soil, it is decomposed into the inorganic phosphorous sources that crop can absorb, thereby satisfies the demand of crop phosphorus.

Description

A kind ofly improve farm crop utilize ability to the soil phytate phosphorus method

Technical field

The present invention relates to a kind of plant utilization soil that improves and close the method for holding the plain ability of attitude phosphorus, relate in particular to and a kind ofly utilize transgenic technology to improve farm crop the soil phytate phosphorus to be utilized the method for ability, belong to the genetically engineered field.

Background technology

Phosphorus is one of necessary for plant growth macroelement, in order to satisfy the nutritional needs of plant growth, reaches the high yield purpose, applies a large amount of phosphate fertilizer every year in crop growing season.But studies show that in a large number, after phosphate fertilizer is manured into soil, can be adsorbed to soil particle surface soon or generates the phosphoric acid salt of indissoluble, thereby influence the release of phosphorus to a great extent and the validity of plant with some materials of soil (Fe, Al, Ca etc.).The absorption of phosphorus greatly reduces the phosphoric acid nutrient availability, and therefore, scarce phosphorus is the obstruction factor of plant growth.In China, in nearly 14.9 hundred million mu of arable lands, lacking phosphorus (rapid available phosphorus is below 10ppm) soil has 10.9 hundred million mu approximately, accounts for 74% of total arable land, wherein seriously lacks phosphorus (rapid available phosphorus is below 5ppm) soil and accounts for 40% of total arable land.

For a long time, China rural area is extensive use of chemical fertilizer, and chemical fertilizer can increase soil fertility, but continuous administration then subtracts fertilizer efficiency day, has to strengthen fertilizer amount.And the excessive chemical fertilizer of using then causes soil compaction, and soil fertility weakens, and also influences crops quality.The soil of the torrid zone, subtropical zone contains compounds such as a large amount of ferric oxide and aluminum oxide, and gathering of iron aluminum material has very strong fixed action to the phosphorus in the soil.China's this season phosphate fertilizer utilization efficiency is only about 10%-20%.

At present, China's nitrogen, phosphatization fertilizer consumption have accounted for 30% of whole world consumption.Excessive chemical fertilizer input, the unit chemical fertilizer drops into one of minimum country of grain output to make China become in the world, and fertilizer cost increases above the increases in grain production benefit, and Higher output is not accompanied by a higher income, increased the weight of peasant burden.And, China's organic manure resource is abundant, along with developing rapidly of livestock and poultry breeding industry, China's feces of livestock and poultry year generation is about 17.3 hundred million tons, a large amount of organophosphoruss is discharged in the soil with feces of livestock and poultry, whole nation feces of livestock and poultry annual emissions surpasses national industrial residue and municipal domestic waste quantity discharged sum, surrounding environment is caused severe contamination.

The poor efficiency utilization of phosphatization fertilizer increases the phosphorus amount that accumulates in the soil year by year.Livestock and poultry excretory phosphorus is one of reason of the super nutrition of surface water such as water pollution and lake, makes widespread pollution from the overuse of fertilizers and pesticides in rural area become water system eutrophication, soil acidification and heavy metal contamination greatest factor, threatens ecological safety and Sustainable development.Water body eutrophication problems such as the rivers that cause owing to reasons such as unreasonable fertilising, animal high phosphorus ight soil, soil erosions, lake also increase the weight of day by day, state's control lake eutrophication problem of China 85% is serious, little reservoir down to the main contamination index in waters, bay, all is total phosphorus and total nitrogen to big lake without exception from the inland.

Phosphorus ore is Nonrenewable resources.Phosphorus ore worldwide is on the verge of exhaustion, and whole world phosphate fertilizer resource cheaply expects the year two thousand fifty and will exhaust.China lacks phosphorus big country, and 2,700,000,000 tons of phosphorus ore reserves are only arranged, and only enough keeps and uses about 70 years.China's arable soil is acidity and the calcareous soil to the strong chemical fixation of phosphorus tool more than 70%.Because long-term application phosphate fertilizer has accumulated a bigger potential phosphorus storehouse in the soil, comprise the high machine attitude phosphorus in chemical fixation attitude phosphorus and the animal waste.Efficiently activate, utilize soil phosphorus to can be used as alternate resources.It is the restrictive factor of agriculture production in the world wide that agricultural land soil total phosphorous height and available phosphorus lack.As content of tatal phosphorus in the soil that China's available phosphorus lacks, (press P at 0.04-0.25% ₂O ₅Meter) between, high reaches more than 0.4%.

Phytase (Phytase) extensively exists in plant and microorganism, and it is the general name that catalysis phytic acid (phytinic acid) is hydrolyzed into inositol and phosphoric acid (or phosphoric acid salt) class of enzymes, belongs to orthophosphoric ester monohydrolase.Mainly contain two types, promptly come from the phytinic acid 3-phosphohydrolase (E.C.3.1.3.8) of microorganism and come from the phytinic acid 6-phosphohydrolase (E.C.3.1.3.26) of plant.

The optimal pH difference of the phytase of different sources.Most purified the optimal pH of phytase between 2～6.Optimal pH a wider range of microbial phytase is generally 2.5～6.0.The optimal pH scope of the phytase of plant origin is narrower, generally 4.8～6.0, active significantly decline even inactivation (Hayes JE when pH3.0, R.A., Simpson RJ (2000). " Components of organic phosphorusin soil extracts that are hydrolysed by phytase and acid phosphatase. " Biol.Fertil.Soils (32): 279-286.).

Phytase can decompose the generation inorganic phosphate one by one with six phosphorus of phytinic acid (phytic acid).Can discharge inorganic phosphorus 281.6mg on the complete resolution theory of 1g phytic acid.Most pure phytases are not strong to the specificity of substrate, except that can the hydrolysis phytic acid and phytate, can also other phosphoric acid ester bond of hydrolysis.

Up to the present, have ten surplus a phytase encoding gene obtained separating clone, nearly all phytase gene that is separated to has all been applied for patent.Phytase gene is separating clone from microorganism mainly.The phytase gene of the plant origin of present unique report is that Maugenest equals to clone from the corn seed of sprouting in 1997.Domestic, (B.Yao 1998) such as Yao Bin, Fan Yunliu clone and isolate phytase phyA gene from the Aspergillus niger strain A.niger 963 of phytase generating, long 1506 Nucleotide of its DNA complete sequence, 467 amino acid of encoding.

Under research low-phosphorus stress condition, the variation of the Physiology and biochemistry of root system of plant, find that root exudates kind and quantity and excretory phosphate esterase active increase (Richardson, A.E., P.A.Hadobas, et al. (2001). " Extracellular secretion of Aspergillus phytase from Arabidopsisroots enables plants to obtain phosphorus from phytate. " Plant J 25 (6): 641-9.).Studies show that, under the natural condition, root system of plant can be secreted organic acid and small amounts of phosphoric acid esterase (mainly being phytase), reduces rhizosphere soil pH, impel phytic acid and other organophosphorus in phosphatic dissolving of soil insoluble mineral and the hydrolysis soil, discharge inorganic phosphorus and absorb for plant.But plant absorbs in the soil plant difficulty by this dual mode utilizes the ability of phosphorus very weak.In view of the above, people are just attempting improving plant absorbing by following two approach and utilize and close the ability of holding attitude phosphorus in the soil.

One, improves the activity of phytase in the plant root secretory product.Because the 20-50% of total organic phosphorus content is a phytate phosphorus in the soil, but plant absorbing utilizes the ability of phytate phosphorus very weak.Richardson etc. change the aspergillus niger phytase gene in the Arabidopis thaliana plant, make its at Arabidopis thaliana plant root constitutive expression justacrine outside born of the same parents.The phytase activity of transfer-gen plant root significantly improves, and outside the secretion born of the same parents, makes that the activity of phytase also significantly improves in the root exudates.The transgenic arabidopsis plant is containing Na ₂HPO ₄Identical with growing way on the substratum of phytate phosphorus, but the non-transgenic plant grows on the substratum that with the phytic acid is phosphorus nutrition and obviously is obstructed.This shows that plant root expression justacrine high-activity phytase can improve plant obtains phosphorus from phytic acid ability greatly.

Two, improve plant root secretion organic acid ability.External different research groups attempts changing citrate synthase (the CS citrate synthase) gene of different sources in tobacco and the Arabidopis thaliana (L ó pez-Bucio, et al, 2000 respectively; Koyama, et al, 2000), studies show that express CS and can promote the synthetic of plant citric acid, compared with the control, the root citric acid secretory volume of transgene tobacco and Arabidopis thaliana increases, plant can absorb phosphorus more effectively.

How to utilize in the soil abundant phosphorus source, be one of focal issue of being paid close attention to of pedologist and plant nutrition scholar always.Improve the absorb ability of plant by transgenic technology to the phosphorus element, up to now, it is the level of research object that present research also only rests on model plant tobacco and Arabidopis thaliana, still lacks the method that a kind of effective raising farm crop efficient absorption is utilized the phytate phosphorus ability.Improve farm crop phosphorus in the soil utilized ability and efficient; for improving crop yield; reduce production costs; the aspects such as economic benefit of saving phosphor resource, preserve the ecological environment and even improve agriculture production all have great importance, and improve farm crop and utilize the method for soil phytate phosphorus ability to have great realistic significance so provide a kind of.

Summary of the invention

Technical problem to be solved by this invention is to overcome the deficiencies in the prior art, and a kind of farm crop utilize ability to the soil phytate phosphorus method that improves is provided.

Technical problem to be solved by this invention realizes by following technological approaches:

A kind ofly improve farm crop the soil phytate phosphorus utilized the method for ability, may further comprise the steps:

Fusion shown in the SEQ ID NO.1 had the nucleotide sequence of secretion of phytase gene and guiding gene product and localized signal peptide is exercisable to be connected to after the promotor structure monocotyledons or dicotyledons recombinant expression vector; These plant recombination expression vector transformation receptor farm crop are got final product.

In the aforesaid method, wherein said promotor is the plant tissue specificity promoter, is preferably Ubi promotor or CaMV35S promotor; Described plant recombination expression vector can be by being prepared from afterwards Nucleotide shown in the SEQ ID NO.1 and the exercisable plant tissue specificity promoter that is connected to of signal peptide sequence, as a preferred embodiment of the present invention, described plant recombination expression vector is preferably monocotyledons expression vector pGA1161EAO or dicotyledons expression vector pBINPLUSEAO.

The method of described plant recombination expression vector transformation receptor farm crop can be the conventional method for transformation of this area, for example can be Agrobacterium infestation method, particle bombardment, PEG mediated method, germplasm system mediated method, electric shock perforation method or microinjection, the present invention be preferably Agrobacterium infestation method or particle bombardment; Described acceptor farm crop are preferably rape, corn, soybean or wheat, more preferably rape or corn.

For the ease of screening successfully the crop that transforms simultaneously in order better to meet security requirement, also comprise in the aforesaid method and make up the plant selectable marker expression vector, with plant recombination expression vector and the common transformation receptor crop of plant selectable marker expression vector, seed selection obtains Expressing Recombinant Phytase and does not contain the genetically modified crops of selection markers gene.

The structure of described plant selectable marker expression vector can carry out according to ordinary method, described selectable marker gene can be selected from Bar gene (selected marker of Herbicid resistant), Npt-II gene (neomycin phosphotransferase gene), DHFR gene (dihydrofolate reductase gene), Gent gene (gentamicin resistant gene) etc., is preferably the Bar gene.As the embodiment of an optimum of the present invention, described selectable marker gene expression vector is the selectable marker gene expression vector pBINPLUSBa that is used for the selectable marker gene expression vector PHP17042Bar of monocotyledons conversion or is used for the double leaf Plant Transformation.

More preferably selectable marker gene expression vector PHP17042Bar and monocotyledons expression vector pGA1161EAO are transformed rape with the common maize transformation of particle bombardment or with selectable marker gene expression vector pBINPLUSBar and dicotyledons expression vector pBINPLUSEAO jointly with the Agrobacterium infestation method.

The phytase gene [preferably adopting the patent No. is the phytase gene that derives from Aspergillus sp.98 (aspergillus) among the ZL 97121731.9] that the present invention will derive from microorganism places under the promoters driven, add secretion of guiding gene product and localized signal peptide sequence, the location of controlling gene product (this signal peptide sequence can guide phytase to be secreted into the extracellular), structure includes the plant recombination expression vector of phytase nucleotide sequence, this plant recombination expression vector is transferred in the especially important farm crop of plant, resulting transgenic plants can efficiently express phytase at root, in the whole growth process of plant, continue to produce phytase, and to the root external secretion, with the phytate phosphorus that exists in a large number in the degraded soil, make it be decomposed into the utilizable inorganic phosphorous sources of plant, thereby satisfy the demand of crop phosphorus.

The inventive method can effectively improve crop to soil close hold attitude phosphorus element especially phytate phosphorus utilize ability, thereby significantly reduce demand to mineral phosphate fertilizer in the soil, effectively alleviate the situation of phosphorus source scarcity, but the potential phosphorus storehouse that forms in the decomposition and consumption soil simultaneously alleviates the problem of a series of threat ecological safeties such as the water pollution brought thus and lake, the super nutrition of surface water and sustainable development.

Another one technical problem to be solved by this invention provides a kind of the detection changes the method that the phytase gene farm crop utilize the phytate phosphorus ability.

This technical problem to be solved by this invention realizes by following technological approaches:

A kind of detection changeed the method that the phytase gene farm crop utilize the phytate phosphorus ability, may further comprise the steps:

Inorganic phosphorus in solid or the liquid MS medium is all replaced with the phytate phosphorus of equivalent, with change the phytase gene farm crop the progeny seed surface sterilization, sprout to be placed on MS solid or the liquid nutrient medium and cultivate for some time; Have in the substratum that changes the phytase gene farm crop to growth and to add by FeCl ₃.6H ₂The staining agent that O and sulphosalicylic acid were mixed with; Do not have considerable change as the staining agent color, show that transgenic crop utilizes phytate phosphorus ability height,, show that changeing the phytase gene farm crop utilizes the phytate phosphorus ability low if the staining agent color becomes light red to colourless.

In the aforesaid method, preferred, the staining agent that adds in the solid MS substratum of growth by commentaries on classics phytase gene farm crop is made up of following components in weight percentage: FeCl ₃.6H ₂O 0.03%, sulphosalicylic acid 0.3%, the rest is water; To growth the staining agent that is incorporated as liquid nutrient medium 1/7 volume in the liquid MS medium that changes the phytase gene farm crop is arranged, wherein the following components in weight percentage of this staining agent is formed: FeCl ₃.6H ₂O 0.12%, sulphosalicylic acid 1.2%, the rest is water.

Detection method of the present invention can detect transgenic crop accurately phytate phosphorus is utilized the height of ability, has that the result is accurate, step is simple and direct, high repeatability and other advantages.

Description of drawings

Fig. 1 is the restriction enzyme digestion and electrophoresis figure of phytase gene monocotyledons expression vector PGA1161EAO;

1:1Kb Ladder; The 2:pGA1161EAO plasmid; 3:pGA1161EAO cuts through the BamHI enzyme.

Fig. 2 is the physical schematic of expression vector PHP17042;

Fig. 3 is the restriction enzyme digestion and electrophoresis figure of selectable marker gene expression vector PHP17042Bar;

1:PHP17042Bar cuts through the PstI enzyme; 2:1Kb Ladder.

Fig. 4 is for changeing the PCR result of phytase gene corn genomic dna;

1-15: transgenosis regeneration milpa (wherein 4,5, the 7PCR amplification is negative); The 16:100bp molecular weight standard; 17: positive control; 18: negative control.

Fig. 5 is the Southern-blot result of transgenic corn plant;

The 1:1Kb molecular weight standard; 2: positive control; 13: negative non-transgenic corn contrast 3; 4: the genomic dna of plant 1 is used EcoRV respectively, and the BamHI enzyme is cut; 5,6: the genomic dna of plant 2 is used EcoRV respectively, and the BamHI enzyme is cut; 7,8: the genomic dna of plant 3 is used EcoRV respectively, and the BamHI enzyme is cut; 9,10: the genomic dna of plant 4 is used EcoRV respectively, and the BamHI enzyme is cut; 11,12: the genomic dna of plant 5 is used EcoRV respectively, and the BamHI enzyme is cut.

Fig. 6 is the SDS-PAGE result of transgenic corn plant;

1: protein molecular weight standard; 2,3: the positive control of different extension rates; 4,5,6: strain is C83, C43, C76; 7: negative control (yellow morning four); 8,9,10: strain is C47, C36, C84.

Fig. 7 is the Western-blot result of transgenic corn plant;

1: protein molecular weight standard; 2,3: the positive control of different extension rates; 4,5,6: strain is C83, C43, C76; 7: negative control (yellow morning four); 8,9,10: strain is C47, C36, C84.

Fig. 8 utilizes ability for measuring transgenic corns on the solid medium to phytic acid;

Fig. 9 utilizes ability for measuring transgenic corns on the liquid nutrient medium to phytic acid;

Figure 10 is phytase activity measurement result in the corn root tissue;

1, negative control; 2, incident C83W; 3, incident C83Y.

Figure 11 is the electrophorogram of phytase gene dicotyledons expression vector;

1:pBINPLUSEAO cuts through HindIII and Eco R I enzyme; 2.1Kb Ladder.

Figure 12 is the electrophorogram of Bar Gene Double cotyledon plant expression vector;

1:pBINPLUSBar cuts through HindIII and Eco R I enzyme; 2.1Kb Ladder.

Figure 13 is the pcr amplification phytase gene of transgene rape T1 plant;

M is DNA Marker, and 1-7 is a transgenosis T1 plant DNA cloning fragment.

Figure 14 is the Southern-blot result of transgene rape T2 plant;

1-3 is a transgenosis T1 plant, the positive contrast of CK+, and the negative contrast of CK-, M is a molecular weight standard, Phytase gene 500bp fragment is a probe.

Figure 15 utilizes ability for measuring transgene rape on the solid medium to phytic acid;

Figure 16 utilizes ability for measuring transgene rape on the liquid nutrient medium to phytic acid;

Figure 17 is a phytase activity measurement result in the rape root tissue;

1: negative control; 2: the transgene rape strain is 04p1602; 3: the transgene rape strain is 04p4906.

Further describe preparation method of the present invention and beneficial effect by the following examples, it should be understood that these embodiment only are used for the purpose of illustration, never limit protection scope of the present invention.

Embodiment

Test materials and source

Toolenzyme and modifying enzyme: various restriction enzymes, modifying enzyme, pGEM5Zf plasmid and T-carrier be respectively available from Promega company, New England Biolabs company and Gibco company.

Chemical reagent: yeast extract and Tryptones are available from OXOID company, and a large amount of salt of CHU (N6) are available from Gibco company, and other reagent that tissue culture is used and hormone are available from Sigma company.Other chemical reagent is homemade analytical pure.

Primer is synthetic: synthetic by Beijing AudioCodes bio-engineering corporation and Shanghai Bo Ya Bioisystech Co., Ltd.

Order-checking: finish by Shanghai Bo Ya Bioisystech Co., Ltd.

Illustrate: make the experimental methods of molecular biology specify in following examples, all with reference to " (Sambrook etc. write molecular cloning test handbook, Science Press, version in 1992) listed concrete grammar carries out in the book, perhaps carries out according to test kit and product description.

[embodiment 1]

1, makes up the intermediate carrier that contains the nucleotide sequence shown in the SEQ ID NO.1

1.1 composite signal peptide sequence: fragment 5 ' end in upstream adds the XbaI site, and fragment 5 ' end in downstream adds the SnaBI site, and two fragment sequences are as follows, and restriction enzyme site marks with underscore: the upstream fragment:

5 ' tccccgcgg TctagaCccgggatatcatgggaagaattgctagaggctcaaaaatgagttctctcattgtg ttct3 ' (SEQ ID NO.2), downstream fragment: 5 ' ccggaattc TacgtaAgctgtggtttcggaagccaaattgagtgacacaatactacaagcaaagacacaat ga 3 ' (SEQ ID NO.3), reaction system:

Upstream and downstream fragment (0.5 μ g/ μ l), each 6.0 μ l

10X PCR buffer 5.0μl

dNTP(1.5mM each) 2.8μl

Taq Polymerase(5U/μl) 0.2μl

MgCl ₂(25mM) 5.0μl

H ₂O 24.2μl

Reaction conditions: 94 ℃, 30Sec; 30 ℃, 1Min; 72 ℃, 20Min.

Reaction finishes to get 1 μ l, and the band of electrophoresis detection 150bp size is clear.The fragment that reclaims in the reaction system is connected in the T-carrier.Use XbaI, the SnaBI enzyme is cut this intermediate carrier, and to obtain signal peptide sequence standby.

1.2 amplification phytase gene: upstream primer adds HindIII successively, XbaI, SnaBI site, (5 ' AagcttCtaga TacgtaAtgctggcagtcc 3 ', underscore or italic are restriction enzyme site (SEQ ID NO.4), downstream primer adds HpaI site (5 ' GttaacCtaagcaaaacactccgcccaat 3 ' underscore is a restriction enzyme site, SEQ ID NO.5).Pcr template be plasmid PIC9A2 (B.Yao, C.Y.Z.1998, Science inChina, SeriesC, 41 (3): 330-3360), the pcr amplification condition: 94 ℃, 4Min; 52 ℃, 1Min; 72 ℃, 1Min 30Sec; 34Cycles; 72 ℃, 10Min.The product tailing carries out according to ordinary method, and the product behind the tailing is connected to the T-easy carrier.XbaI, after the SnaBI enzyme was cut this intermediate carrier, signal peptide fragment prepared in the phytase gene of recovery and the step 1.1 was connected, promptly.

2, make up corn conversion plant recombination expression vector

2.1 be used for the phytase gene expression carrier that corn transforms

With HindIII and HpaI respectively enzyme cut intermediate carrier constructed in the digestion above-mentioned steps 1 and expression vector pGA1161 (building process seen Kim S-R, Lee S, Kang H-G, Jeon J-S, Kim K-M, An G, 2003.J Plant Biol 46:211-214.), after the connection, its driving that is subjected to carrier pGA1161 to go up the Ubi promotor is controlled, obtain monocotyledons expression vector pGA1161EAO, this expression vector is cut the evaluation (see figure 1) through enzyme, and the result shows successful being inserted among the expression vector pGA1161 of the nucleotide sequence shown in the SEQ ID NO.1.

2.2 be used for the selection markers expression vector that corn transforms

The Bar gene is upward cut with enzyme from carrier pAHC25 (Christensen AH and Quail HP (1996) TransgenicRes 5:213-218.) and is obtained, pGEM5Zf is after the PstI enzyme is cut, dephosphorylation, be connected with the Bar gene fragment, connect product Transformed E .coli competent cell, extract plasmid, enzyme obtains pGEM5ZfBar after cutting and identifying order-checking; BamHI and EcoRV enzyme are cut pGEM5ZfBar, BamHI and SmaI enzyme are cut PHP17042 and (are made up synoptic diagram and see accompanying drawing 2, contain H2B (Histone B) promotor respectively, 5 end non-translational region and the introns that come from corn Ubi gene, PIN II (Proteinase Inhibitor II) terminator), reclaim the purpose fragment according to a conventional method respectively, two segments are connected according to ordinary method.Connect product Transformed E .coli competent cell, extract plasmid, enzyme obtains selectable marker gene expression vector PHP17042Bar (enzyme is cut qualification result and seen Fig. 3) after cutting evaluation.

3, maize transformation

The corn children fringe of pollinating 9-12 days is peeled off rataria, places on the N6 substratum, and 28 ℃, dark culturing is used for particle gun and transforms after three days.

Callus system: the maize immature embryos of pollinating 9-12 days, place on the N6 substratum and obtain embryo callus subculture system behind the process 6-8 week succeeding transfer culture, culture condition is the same.

Above-mentioned maize immature embryos and embryo callus subculture all can be used as the conversion parent material, culture medium preparation is with reference to " vegetable cell, tissue and organ culture: basic skills " (Plant Cell, Tissue and Organ Culture:fundamental methods/O.L.Gamborg, G.C.Phillips eds., Springer) method in the 16th chapter is carried out in the book.

Corn gene rifle method for transformation carries out with reference to the method in the above-mentioned book.Before transforming maize immature embryos or embryo callus subculture placed the height that contains 120g sucrose to ooze on the substratum after 4-6 hour, be used for micropellet bombardment.Use the PSD/1000 Hellium particle gun of Bio-Rad company, helium pressure is 1000Psi, and vacuum tightness is 28inch Hg.Behind the end of bombardment, the material that is transformed oozes on the substratum at height and kept 1-4 hour, transfers to then and recovers on the substratum that keeps callus to cultivate 3-4 days.

Select to cultivate: the BASTA that keeps adding 3mg/L in the substratum of callus carries out screening and culturing as selective pressure to the material that is transformed, and per two all subcultures once.

Regeneration: after bimestrial selection cultivation, kanamycin-resistant callus tissue is grown on selective medium rapidly, and color is fresh.Kanamycin-resistant callus tissue is forwarded on the regeneration culture medium, after two to three weeks, can obtain sophisticated embryoid.

Embryoid is put on the MS substratum takes root, promptly obtain the maize seedling of regenerating.Phytase expression cassette PCR male plant forwards in the soil, grows in the greenhouse.

4, the Molecular Detection of transgenic corns

4.1 PCR detects

Forward primer: AATTGCTAGAGGCTCAAAAATGA (SEQ ID NO.6)

Reverse primer: CTAAGCAAAACACTCCGCCCAA (SEQ ID NO.7)

Reaction system (20 μ L): regeneration milpa DNA 1 μ L (20-50ng); 10 * damping fluid, 2 μ L; MgCl ₂(2.5mM) 2 μ L; DNTP (2.5mM) 2 μ L; Taq enzyme 0.2 μ L; Primer 10 μ M; Add sterilized water to 20 μ L.Reaction conditions: 94 ℃, 5 minutes; 94 ℃, 45 seconds; 55 ℃, 45 seconds; 72 ℃, 1 minute; 35 circulations; 72 ℃ were extended 5 minutes.

What Fig. 4 showed is transgenic corn plant PCR detected result, and as can be seen from the figure the amplified fragments size is consistent with the full gene size of phytase, is about 1.3Kb.

4.2 Southern-blot detects

Southern-blot is with reference to Sambrook J, wait write " method in the molecular cloning test handbook (Science Press, version in 1992) is carried out.Concrete detection method is as follows:

1) to the positive milpa of PCR detection phytase gene, choose the 0.5-0.8g leaf tissue, extract genomic dna after the liquid nitrogen grinding, extracting method is used in detecting with PCR.

2) DNA that obtains uses isopyknic phenol again after RNase and Proteinase K processing: chloroform (1: 1), and chloroform: primary isoamyl alcohol (24: 1) extracting, with the amount of ultraviolet spectrophotometer mensuration DNA.

3) each sample is got 15 μ g DNA enzymes and is cut and spend the night, 50V, and agarose gel electrophoresis was transferred to nylon membrane after 6 hours.

4) prehybridization was made template with the fragment of phytase gene after 6 hours, through radio isotope P ³²Label probe is hybridized.

5) wash film and finish after, nylon mould X-ray sheet, gained the results are shown in Figure 5.

What Fig. 5 showed is the results of hybridization of corn T2 for plant, probe is the 500bp fragment of phytase gene, as can be seen from the figure the transgenic corn plant genomic dna is hybridized after BamHI singly cuts, two bands that molecular weight is about 6Kb and 8Kb appear, the band that molecular weight is about 4Kb appears in hybridization after EcoRV singly cuts.From the results of hybridization of this results of hybridization and other transformant, phytase gene has been incorporated in the corn gene group, and the copy number of phytase gene in transfer-gen plant is not high, is no more than two.

5, the Western-blot of transgenic corns detects

5.1SDS-PAGE method:

1) takes by weighing 10mg transgenic corn seed grinding, put into the centrifuge tube of screw cap;

2) add the 200ul extraction buffer (60mMTris, pH 6.8; 100mM DTT, 2% (w/v) SDS), the vortex vibration fully suspends powder;

3) 100 ℃ of heating 4min;

4) 14, the centrifugal 10min of 000rpm gets supernatant and carries out SDS-PAGE;

5) electrophoresis carries out according to ordinary method, and resolving gel concentration is 12%;

6) after electrophoresis finishes, with Xylene Brilliant Cyanine G glue is dyeed, and then decolour with destainer.

5.2 Western-blot method:

1) measured the size of glue, by this big or small cutting filter paper and film (nitrocellulose filter), film, glue, filter paper immersion treatment 30min in Transfer Buffer.

2) on the half-dried attitude electroporation of Bio-Rad (lid is-, the end is+) successively (+→-) place four filter paper, film, glue, other 4 filter paper, whenever put one deck, drive bubble away with glass stick, put lid well.Voltage stabilizing 10V-20V, electric current is no more than 1.00,2-3 hour.

3) will change and have about the proteinic membrane marker, and be immersed in the 20ml confining liquid and (be advisable), RT, jog 1 hour or O/N to soak film fully.

4) reclaim confining liquid, add one and resist RT, jog 2h.

5) reclaim one and resist, wash film 4 times, 20-30ml/ time, 4min/ time.

6) add two of alkaline phosphate ester enzyme labelling and resist jog 1h.

7) reclaim two and resist, wash film 3 times, 20-30ml/ time, 4min/ time.

8) 1 * TBS washes film 1 time, and 20-30ml/ time, 3min/ time.

9) add NBT/BCIP colour developing liquid, take out film, massive laundering in the time of suitably.

That Fig. 6 and Fig. 7 show is the result that transgenic corns carries out SDS-PAGE and Western-blot, and as can be seen from the figure phytase gene is to obtain expression in transgenic corns.

6, the phytic acid of the transgenic corn plant of transgenic corn plant utilizes ability to measure

The progeny seed of transgenic corns and rape, through surface sterilization, sprouting is placed on the MS substratum, and substratum is unique phosphorus source with phytic acid, after growth for some time on the substratum, in substratum, add staining agent, promptly can judge the height that utilizes the phytic acid ability of this transgenic corn plant according to the colour-change of staining agent, after phytic acid was decomposed and utilizes in all substratum, the staining agent color did not have considerable change, otherwise color becomes light red to colourless.

6.1 measure transgenic corns on the solid medium phytic acid is utilized ability

Inorganic phosphorus in the plant MS substratum is replaced with the phytate phosphorus of equivalent, and transgenic corn plant is used 0.03%FeCl after growth for some time on this substratum ₃.6H ₂O and 0.3% sulphosalicylic acid solution-treated were observed colour-change after 30 minutes, the results are shown in Figure 8.

Fig. 8 a: the color that joins the staining agent in the solid medium does not have considerable change, illustrates that the transgenic corns that grows on this substratum utilizes phytic acid ability height; Fig. 8 b: staining agent; Fig. 8 c: the staining agent color that joins in the solid medium becomes light red, illustrates that the non-transgenic corn that grows on this substratum utilizes the phytic acid ability low;

6.2 liquid nutrient medium cured articles such as () no agar is gone up and is measured transgenic corns phytic acid is utilized ability

Inorganic phosphorus in the plant regeneration substratum is replaced with the phytate phosphorus of equivalent, prepare 4 times staining agent mother liquor, i.e. 0.12%FeCl ₃.6H ₂O and 1.2% sulphosalicylic acid, plant adds 5 milliliters of above-mentioned staining agent mother liquors after grow for some time on the 35 milliliters of liquid substratum (being longer than 3 days), and soft mixing, leaves standstill the back and observes colour-change, the results are shown in Figure 9.

Fig. 9 a-b: the color that joins the staining agent in the liquid nutrient medium does not have considerable change, illustrates that the transgenic corns that grows on this substratum utilizes phytic acid ability height; Fig. 9 c: staining agent; Fig. 9 d: what do not add staining agent contains the phytate phosphorus liquid nutrient medium; Fig. 9 e-f: the color that joins the staining agent in the liquid nutrient medium becomes light red, illustrates that the non-transgenic corn that grows on this substratum utilizes the phytic acid ability low.

Utilize ability to detect by Molecular Detection and phytic acid, obtain 15 strain systems of transgenic corns of root Expressing Recombinant Phytase.

7, the mensuration of enzymic activity (selecting part transgenic corns strain system to measure) in the transgenic corns root tissue

7.1 phytase activity definition

The phytase of a unit (U) is: at pH5.5, under 37 ℃ the condition, per minute discharges the needed enzyme amount of 1 μ mol inorganic phosphate from substrate POTASSIUM PHYTATE, magnesium (potassium phytate, magnesium).

7.2 reagent

Extract damping fluid (Extraction buffer): the NaAc damping fluid of 0.4M pH5.5; The 50mM sodium phytate; 15%TCA.

Colour developing liquid: (H O.6M ₂SO ₄-2%Vc-0.5% ammonium molybdate).

7.3 measuring method is with reference to Wyss M.et.al. (1999), the phytic acid dipotassium of enzyme liquid and 50mM is mixed in 37 ℃ hatched 60 minutes, wherein the phytic acid dipotassium is dissolved in the NaAc damping fluid of 0.2M pH5.5.Standard curve making: preparation 9mM KH ₂PO ₄Storage liquid is with different dilution KH ₂PO ₄Solution is made typical curve.

7.4 the seed of transgenic corns is ground into ultrafine particulate with Spex 2000 Geno/Grinder, add 1ml in the 100mg powder and extract damping fluid, the room temperature vibration is centrifugal after 1 hour, and getting supernatant is enzyme liquid.

Enzymic activity detects in the seed: as positive control, the wild-type corn carries out enzyme activity determination as negative control with the higher wheat of endogenous phytase activity, and detected result sees Table 1.

Table 1 transgenic corn seed enzymic activity detected result

Sample number	Enzyme is lived and is worth (U/Kg seed)
		C36	1247.8
C43	5110.6
		C47	5732.5
C83	5339.3
		C84	2429.6
C76	539.1
		Negative control	3.3
Positive control	310

Annotate: C36, C43, C47, C83, C84, C76,6 strains systems that change phytase gene corn for the present invention.

What table 1 showed is the seed phytase activity of 6 transgenic corns strain systems, and the highest strain is that C47 can reach the 5732.5U/Kg seed, and minimum strain is the 539.1U/Kg seed.

7.5 result according to the detection of seed enzymic activity, select two strain systems of high C47 of enzymic activity and C83, use Hoagland ' water planting system liquid culture corn, water planting is after two weeks, the individual plant plant moved in the culturing bottle fill 300ml distilled water collected root secretion 48 hours, after using the vivaspin ultra-filtration centrifuge tube of Satoris company to concentrate 40 times the maize root system secretory product of collecting, get 20 μ l gleanings concentrated solutions and carry out phytase activity and measure.

The measurement result of root secretion: carry out water planting and measure the enzymic activity of root secretion, the results are shown in Figure 10, the result shows, transgenic corns root enzymic activity approximately be the non-transgenic contrast 14-44 doubly.

[embodiment 2]

1, makes up the intermediate carrier (with embodiment 1) that contains the nucleotide sequence shown in the SEQ ID NO.1.

2, make up rape conversion plant recombination expression vector

2.1 the structure of phytase gene expression carrier

(pBI525 vector construction process is seen Pang, S.-Z., Nagpala, P., Wang, M., Slightom, J.L.﹠amp to cut pBI525 ' with HindIII and EcoR I enzyme; Gonsalves, D. (1992) Phytopathology, 82,1223-1229., after the present invention uses NcoI digested plasmid pBI525, handle behind the site of pruning from connecting with the Mungbean modifying enzyme, enzyme is cut methods such as connection and is carried out according to a conventional method, plasmid after company confirms NcoI site destroyed, called after pBI525 ' through order-checking) and pBINPLUS (FredA.Van Engelenet al., Transgenic Research 4,288-290), to contain the two 35S promoters of expression cassette element, the fragment of about 900bp of Ω enhanser and NOS terminator is connected into pBINPLUS, resulting carrier is cut the back benefit with the BamHI enzyme earlier put down, again with this carrier of XbaI enzyme cutting.Use XbaI, the MluI enzyme is cut the intermediate carrier that is connected with fusion signal peptide and phytase gene prepared among the embodiment 1, the fragment that obtains is connected the phytase gene dicotyledons expression vector pBINPLUSEAO that promptly obtains by the driving control of CaMV35S promotor with carrier after above-mentioned enzyme is cut, and the enzyme of this expression vector is cut qualification result and is seen Figure 11.

2.2 rape selectable marker gene expression vector establishment

XbaI and EcoR V enzyme are cut pGEM5ZfBar, the BamHI enzyme is cut pBI525 ' (ditto) back and is mended flat, use XbaI enzyme cutting again, reclaim the purpose fragment respectively, connect, use HindIII again, EcoR I enzyme is cut the expression cassette that this intermediate carrier obtains having marker gene, uses HindIII, and EcoR I enzyme is cut binary vector pBINPLUS, expression cassette is inserted pBINPLUS upward promptly obtain pBINPLUSBar after the CaMV35S promotor, the enzyme of this selectable marker gene expression vector is cut qualification result and is seen Figure 12.

3, transform rape

Select full intact Semen Brassicae campestris, with 75% alcohol-pickled 3-5 minute, with 1% DICA sterilization 8-15min, use aseptic water washing again 3 times then, evenly implant solid 1/2MS substratum, 25 ℃, illumination 16 hours/day was cultivated 3-5 days.

Downcut tool handle cotyledon (about 1mm on the stipes), be used for being infected by Agrobacterium as explant.

Infect the cultivation of used Agrobacterium: drew flat board (YEB substratum) activation Agrobacterium in 2-3 days before transforming, conversion washed thalline and made thalline resuspended from flat board with the 1/2MS liquid nutrient medium same day, and Agrobacterium concentration OD is about 0.08 during conversion.

Explant and Agrobacterium are cultivated 5-10min altogether, take out explant and blot with aseptic thieving paper, and (MS+BA0.2mg/L+2 4-D1mg/L) goes up dark the cultivation evenly to implant pre-culture medium.

Change explant over to selection substratum MS+BA4.5mg/L+Ag5mg/L+Cb500mg/L+PPT5-7mg/L after 2-3 days, 25 ℃, illumination 16h/d cultivates.

Change explant over to select to press increase selection substratum MS+BA4.5mg/L+Ag5mg/L+Cb500mg/L+PPT7-10mg/L after 3 weeks, 25 ℃, illumination 16h/d cultivates.

Downcut bud implantation bud hyperplasia substratum from the explant of differentiation, MS+BA2mg/L+NAA0.2mg/L+Ag5mg/L+Cb250mg/L+PPT5-10mg/L, 25 ℃, illumination 16h/d cultivates.

Cutting-out has the bud of vegetative point to implant root media, and MS+NAA0.2mg/L+Cb250mg/L+PPT5-10mg/L25 ℃, illumination 16h/d cultivates.

Phytase expression cassette PCR male rape plant forwards in the soil, grows in the greenhouse.

4, the Molecular Detection of transgene rape

4.1 PCR detects

The PCR detection method detects with corn, and that Figure 13 shows is the result that transgene rape T1 detects for plant PCR.

4.2 Southern-blot detects

Hybridizing method is with embodiment 1.That Figure 14 shows is the result that rape T2 detects for plant Southern-blot, and the rape genomic dna is after the BamHI enzyme is cut, and probe is the 500bp fragment of phytase gene, and transgene rape hybridization back has band to show at the 9Kb place.Negative control amixia signal.Results of hybridization explanation phytase gene has been incorporated in the rape plant.

5, the phytic acid of transgene rape plant utilizes ability to measure

Method the results are shown in Figure 15 and Figure 16 with embodiment 1.Figure 15 a: the color that joins the staining agent in the solid medium does not have considerable change, illustrates that the transgene rape that grows on this substratum utilizes phytic acid ability height; Figure 15 b: the color that joins the staining agent in the solid medium becomes light red, illustrates that the non-transgenic rape that grows on this substratum utilizes the phytic acid ability low; Figure 16 a-b: the color that joins the staining agent in the liquid nutrient medium does not have considerable change, illustrates that the transgene rape that grows on this substratum utilizes phytic acid ability height; Figure 15 c: the color that joins the staining agent in the liquid nutrient medium becomes light red, illustrates that the non-transgenic rape that grows on this substratum utilizes the phytic acid ability low.

Utilize ability to detect by Molecular Detection and phytic acid, obtain 25 strain systems of transgene rape of Expressing Recombinant Phytase.

6, the mensuration of the phytase activity of transgene rape

6.1 the mensuration of the phytase activity of Semen Brassicae campestris

Transgene rape seed powder 100mg is behind 500 μ l ether and sherwood oil (1: 1) degrease, and measuring method is with embodiment 1, and measurement result sees Table 2:

Table 2 transgene rape seed enzymic activity detected result

Sample	Enzyme (u/kg seeds) alive
		In two No. six (non-transgenic contrasts)	90.127
04p1602	830.626
		04p5506	902.694
04p1606	1444.167
		04p4906	1906.618

Annotate: 04p1602 , 04p5506 , 04p1606 , 04p4906  the present invention commentaries on classics phytase gene Semen Brassicae campestris.

6.2 the mensuration of root tissue phytase activity

Measuring method and reagent are with embodiment 1, and selecting the lower strain of seed enzymic activity is that 04p1602 and the highest strain are 04p4906.Measurement result is seen Figure 17, and from Figure 17 as seen, the phytase activity of transgene rape root approximately is 12-45 a times of non-transgenic contrast.

Sequence table .txt

SEQUENCE LISTING

＜110〉Scientia Agricultura Sinica research institute biotechnology research institute

＜120〉a kind ofly improve farm crop utilize ability to the soil phytate phosphorus method

<130>008

<160>7

<170>PatentIn version 3.3

<210>1

<211>1452

<212>DNA

<213>Artificial

<220>

<223>

<400>1

atgggaagaa ttgctagagg ctcaaaaatg agttctctca ttgtgtcttt gcttgtagta 60

ttggtgtcac tcaatttggc ttccgaaacc acagcttacg taatgctggc agtccccgcc 120

tcgagaaatc agtccacttg cgatacggtc gatcaggggt atcaatgctt ctcggagact 180

tcgcatcttt ggggccaata cgcgccgttc ttttctctgg caaacaaatc ggccatctcc 240

cctgatgttc ccgccggatg ccaagtcact ttcgctcagg ttctctcccg ccatggagcg 300

cggtatccga ccgactccaa gggcaagaaa tactccgctc tcatcgagga gatccagcag 360

aacgcgacta ccttcaagga gaaatatgcc ttcctgaaga catacaacta cagcctgggc 420

gcggatgacc tgactccctt tggagagcag gagctggtca actccggcgt caagttctac 480

cagcgatacg agtcgctcac aagaaacatt gtcccgttca tccgatcctc aggctccagc 540

cgcgtgattg cctctggcaa taaattcatc gagggctacc agagcactaa gctgaaggat 600

cctcgtgctc agcccggcca atcgtcgccc aagatcgacg tggtcatttc agaggccagc 660

acatccaaca acactctcga tccgggcacc tgcaccgttt tcgaagatag cgaattggcc 720

gatgacatcg aagccaattt caccgccacg ttcgtccctt ccattcgtca acgtctggag 780

aacgacttgt ctggcgtgac tctcacggac acagaagtga cctacctcat ggacatgtgc 840

tccttcgaca ccatctccac cagcaccgtc gacaccaagc tgtccccctt ctgtgacctg 900

ttcacccatg aagaatggat caactacgac tacctccagt ccctgaacaa atactacggc 960

catggcgcag gtaacccgct cggcccgacc cagggcgtcg gctacgctaa cgagctcatc 1020

gcccgtctca cccactcgcc tgtccacgat gacaccagct ccaaccacac attggactcc 1080

aacccggcta ctttcccgct caactccact ctctatgcgg acttttcgca tgataacggc 1140

atcatctcta tcctctttgc tttgggtctg tacaacggca ccaagccgct gtcctccacg 1200

accgcggaga atatcaccca gaccgatggg ttctcatctg cctggacggt tcctttcgcg 1260

tcgcgcatgt acgtcgagat gatgcaatgc cagtctgagc aggagccttt ggtccgtgtc 1320

ttggttaatg atcgcgttgt tccgctgcat ggctgtccgg ttgatgcttt ggggagatgt 1380

acgcgggata gcttcgtgaa gggtttgagc tttgccagat ctggcggtga ttgggcggag 1440

tgttttgctt ag 1452

<210>2

<211>75

<212>DNA

<213>Artificial

<220>

<223>

<400>2

tccccgcggt ctagacccgg gatatcatgg gaagaattgc tagaggctca aaaatgagtt 60

ctctcattgt gttct 75

<210>3

<211>73

<212>DNA

<213>Artificial

<220>

<223>

<400>3

ccggaattct acgtaagctg tggtttcgga agccaaattg agtgacacaa tactacaagc 60

aaagacacaa tga 73

<210>4

<211>30

<212>DNA

<213>Artificial

<220>

<223>

<400>4

aagcttctag atacgtaatg ctggcagtcc 30

<210>5

<211>29

<212>DNA

<213>Artificial

<220>

<223>

<400>5

gttaacctaa gcaaaacact ccgcccaat 29

<210>6

<211>23

<212>DNA

<213>Artificial

<220>

<223>

<400>6

aattgctaga ggctcaaaaa tga 23

<210>7

<211>22

<212>DNA

<213>Artificial

<220>

<223>

<400>7

ctaagcaaaa cactccgccc aa 22

Claims (10)

1. one kind is improved farm crop utilize ability to the soil phytate phosphorus method, may further comprise the steps: the fusion shown in the SEQID NO.1 is had the nucleotide sequence of phytase gene and signal peptide gene is exercisable to be connected to after the promotor, make up unifacial leaf or dicotyledons recombinant expression vector; These plant recombination expression vector transformation receptor farm crop are got final product.

2. according to the method for claim 1, it is characterized in that described promotor is Ubi promotor or CaMV35S promotor.

3. according to the method for claim 1, it is characterized in that described plant recombination expression vector is monocotyledons expression vector pGA1161EAO or dicotyledons expression vector pBINPLUSEAO.

4. according to the method for claim 1, the method that it is characterized in that plant recombination expression vector transformation receptor farm crop is Agrobacterium infestation method or particle bombardment.

5. according to the method for claim 1, it is characterized in that described acceptor farm crop are corn or rape.

6. according to the method for claim 1, it is characterized in that also comprising structure plant selectable marker expression vector, with constructed plant selectable marker expression vector and the common transformation receptor farm crop of plant recombination expression vector, seed selection obtains Expressing Recombinant Phytase and does not contain the genetically modified crops of selection markers gene.

7. according to the method for claim 6, it is characterized in that described plant selectable marker expression vector is the selectable marker gene expression vector pBINPLUSBar that is used for the selectable marker gene expression vector PHP17042Bar of monocotyledons conversion or is used for the double leaf Plant Transformation.

8. according to the method for claim 6, it is characterized in that selectable marker gene expression vector PHP17042Bar and monocotyledons expression vector pGA1161EAO are transformed rape with the common maize transformation of particle bombardment or with selectable marker gene expression vector pBINPLUSBar and dicotyledons expression vector pBINPLUSEAO jointly with the Agrobacterium infestation method.

9. a test right requires commentaries on classics phytase gene farm crop in 1 to utilize the method for phytate phosphorus ability, may further comprise the steps:

Inorganic phosphorus in solid or the liquid MS medium is all replaced with the phytate phosphorus of equivalent; Progeny seed surface sterilization, the sprouting of changeing the phytase gene farm crop are placed on above-mentioned MS solid or the liquid nutrient medium and cultivate for some time; Have in the solid that changes the phytase gene farm crop or the liquid MS medium to growth and to add by FeCl ₃.6H ₂The staining agent that O and sulphosalicylic acid are formed; Do not have considerable change as the staining agent color, show that transgenic crop utilizes phytate phosphorus ability height,, show that transgenic crop utilizes the phytate phosphorus ability low if the staining agent color becomes light red to colourless.

10. according to the method for claim 9, it is characterized in that: the staining agent that adds in the solid MS substratum of growth by commentaries on classics phytase gene farm crop is made up of following components in weight percentage: FeCl ₃.6H ₂O0.03%, sulphosalicylic acid 0.3%, the rest is water; To growth the staining agent that is incorporated as liquid nutrient medium 1/7 volume in the liquid MS medium that changes the phytase gene farm crop is arranged, wherein this staining agent is made up of following components in weight percentage: FeCl ₃.6H ₂O 0.12%, sulphosalicylic acid 1.2%, the rest is water.

Images