CN1735408A - Receptor function controlling agent - Google Patents

Receptor function controlling agent Download PDF

Info

Publication number
CN1735408A
CN1735408A CN 200380108260 CN200380108260A CN1735408A CN 1735408 A CN1735408 A CN 1735408A CN 200380108260 CN200380108260 CN 200380108260 CN 200380108260 A CN200380108260 A CN 200380108260A CN 1735408 A CN1735408 A CN 1735408A
Authority
CN
China
Prior art keywords
substituent
ring
alkyl
expression
group
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 200380108260
Other languages
Chinese (zh)
Inventor
深津考司
佐佐木忍
日沼州司
伊藤康明
铃木伸宏
原田征隆
安间常雄
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Takeda Pharmaceutical Co Ltd
Original Assignee
Takeda Chemical Industries Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Takeda Chemical Industries Ltd filed Critical Takeda Chemical Industries Ltd
Publication of CN1735408A publication Critical patent/CN1735408A/en
Pending legal-status Critical Current

Links

Images

Landscapes

  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

A GPR40 receptor function controlling agent which contains a compound having an aromatic ring and a group capable of releasing a cation and is useful as a insulin secretion promoting agent or a preventive/remedy for diabetes, etc.

Description

Receptor function controlling agent
Technical field
The present invention relates to comprise the GPR40 receptor function controlling agent of the carboxylic acid or derivatives thereof that contains aromatic rings and new compound with GPR40 receptor function controlling regulating action.
Background technology
Be derived from human body GPR40 aminoacid sequence and with its coded DNA, on the books (WO2000/22129 number and Biochem Biophys Res Commun.1997, Oct 20; 239 (2)).
It is known that the carboxylic acid or derivatives thereof that contains aromatic rings has various physiologically actives.
Alkane acid derivative is known (spy opens 2002-265457 number).
Have insulin secretion facilitation and blood sugar lowering effect and in the prevention of diabetes etc., treatment useful De isoxazole derivatives be known (spy opens 2002-212171 number).
Have blood sugar lowering effect and blood fat reducing effect and in the prevention of diabetes etc., treatment useful nitrogenous five member ring heterocyclic compound be known (spy opens 2001-226350 number).
Have blood sugar lowering effect and blood fat reducing effect and in the prevention of diabetes etc., treatment useful Alkoximino alkane acid derivative be known (spy opens 2001-199971 number).
Have blood sugar lowering effect and blood fat reducing effect and in the prevention of diabetes etc., treatment useful oximido alkane acid derivative be known (spy opens 2000-198772 number).
Have vitamin A (retinoid) associated receptor function regulating action and useful 1 in the prevention of diabetic complication etc., treatment, the 3-Zole derivatives is known (spy opens 2000-80086 number).
Have blood sugar lowering effect and blood fat reducing effect and in the prevention of diabetes etc., treatment useful oximido alkane acid derivative be known (spy opens 2000-34266 number).
Have insulin secretion facilitation and blood sugar lowering effect and in the prevention of diabetes etc., treatment You Yong De oxazole derivant be known (spy opens flat 09-323983 number).
Benzofuran derivatives with blood sugar lowering and blood fat is known (spy opens flat 08-311065 number).
Fatty acid is incorporated into the existing report of GPR40 (WO02/057783).
So far, for the low molecule agonist of non-peptide or the antagonist of GPR40 receptor, still unknown.Therefore, earnestly wish to develop excellent GPR40 receptor function controlling agent.
Summary of the invention
The object of the present invention is to provide a kind of as useful GPR40 receptor function controlling agent of prevention, the curative of medicine that promotes insulin secretion and diabetes etc. and new compound with GPR40 receptor function controlling regulating action.
People such as the inventor, various further investigations have been carried out repeatedly, found that: the carboxylic acid or derivatives thereof that contains aromatic rings, based on its special chemical constitution, the GPR40 receptor with unexpected excellence is excited active, even also have excellent character in stability etc. aspect the rerum natura of medicine, prevention, curative as related morbid state of mammiferous GPR40 receptor or illness, become safe and useful medicine,, finished the present invention based on these discoveries.
That is, the invention provides:
(1) comprises the GPR40 receptor function controlling agent that contains aromatic rings and can emit the chemical compound of cationic base;
(2) as (1) described regulator, wherein: comprise the carboxylic acid or derivatives thereof that contains aromatic rings;
(3) as (1) described regulator, wherein: comprise the carboxylic acid or derivatives thereof that contains 2 above aromatic rings;
(4) as (1) described regulator, wherein: contain useful formula (I ')
(in the formula, the ring P represent to have substituent aromatic rings, the ring Q represent except
Figure A20038010826000112
Can also have substituent aromatic rings, X and Y in addition and represent base at interval respectively,
Expression can be emitted cationic base) expression compound or its salt or its prodrug;
(5) as (2) described regulator, wherein: contain useful
Figure A20038010826000114
(in the formula, ring P represents to have substituent aromatic rings, ring Q represent except can also have the-Y-COOH substituent aromatic rings, X and Y represent respectively base at interval ,-Y-COOH represents to be replaced in the optional position on the ring Q) compound or its salt or its prodrug represented;
(6) as (1) described regulator, wherein: can emit cationic base, be that (1) can emit cationic quinary heterocyclic radical, (2) carboxyl, (3) sulfonic group, (4) and can use C 1-4C can be used in the mono-substituted sulfamoyl of alkyl, (5) phosphonate group, (6) 1-4The mono-substituted carbamoyl of alkyl, (7) C 2-7Alkyl sulphonyl thiocarbamoyl or (8) trifluoro acute pyogenic infection of nails sulfonic acid amides base (NHSO 2CF 3);
(7) as (1) described regulator, wherein: can emit cationic base is:
Figure A20038010826000122
Or
Figure A20038010826000123
(8) as (1) described regulator, wherein: be insulin secretion regulator, Hypoylycemic agents or pancreatic beta cell protective agent;
(9) as (1) described regulator, wherein: the prevention, the therapeutic agent that are diabetes, anti-sugared dysfunction, ketoacidosis, acidosis, diabetic neuropathy, diabetic nephritis, diabetic retinopathy, hyperlipidemia, sexual dysfunction, dermatosis, arthritis, bone minimizing disease, arteriosclerosis, thrombotic disease, dyspepsia, mnemonic learning obstacle, obesity, hypoglycemia, hypertension, edema, insulin resistance syndrome, unstable diabetes, lipoatrophy, insulin allergy disease, insulinoma, fatty toxicity, hyperinsulinemia or cancer;
(10) use formula
Figure A20038010826000124
The compound or its salt of (in the formula, ring A represents to have substituent phenyl ring, ring R represents to have substituent phenylene, Xa represent that it is that 0 to 4 carbochain, Ra represent hydrogen atom or substituent group that interval base, p and q beyond the alkylidene represents to have substituent carbon number respectively) expression;
(11) prodrug of above-mentioned (10) described compound or its salt;
(12) above-mentioned (10) described chemical compound, wherein: partial structural formula
Figure A20038010826000125
Be
Figure A20038010826000131
Or
Figure A20038010826000132
The substituent group that ring A can have is (1) halogen atom, (2) C 1-6Alkyl, (3) C 1-6Halogen atom, C can be used in alkoxyl, (4) 1-6Alkyl or C 1-6The C that alkoxyl replaces 6-14Aryl, (5) C 6-14Aryloxy group or (6) C 7-16Aralkoxy,
The substituent group that ring R can have is halogen atom or C1-6 alkyl,
Ra is a hydrogen atom,
The interval base of representing with Xa is an oxygen atom;
(13) use formula
(in the formula, the ring S 1Expression has the substituent phenyl ring that has phenyl ring, ring R represents to have substituent phenylene, Ra represents hydrogen atom or substituent group) expression compound or its salt (here, except (i) 2-ethyoxyl-4-[[2-[(5-methyl-2-phenyl-4-oxazolyl) methoxyl group] phenyl] methoxyl group] benzenpropanoic acid, (ii) 2-ethyoxyl-4-[[3-[(5-methyl-2-phenyl-4-oxazolyl) methoxyl group] phenyl] methoxyl group] benzenpropanoic acid, (iii) 2-ethyoxyl-4-[[4-[(5-methyl-2-phenyl-4-oxazolyl) methoxyl group] phenyl] methoxyl group] benzenpropanoic acid, (iv) 4-[[4-[(5-methyl-2-phenyl-4-oxazolyl) methoxyl group] phenyl] methoxyl group] benzenpropanoic acid);
(14) prodrug of above-mentioned (13) described compound or its salt;
(15) above-mentioned (13) described chemical compound, wherein: the substituent group with phenyl ring is to use formula: R 11-E 2-(R 11Expression can have substituent phenyl, indanyl or naphthyl, E respectively 2Expression key or basic at interval) substituent group of expression, and use E 2The interval base of expression is-(CH 2) m 1-W 1-(CH 2) m 2-(m 1And m 2Represent 0 to 3 integer, W respectively 1Expression-O-,-N (R 2)-,-S-,-CO-or-CO-N (R 3)-, R 2And R 3Represent hydrogen atom or C respectively 1-6Alkyl);
(16) chemical compound of above-mentioned (13) record is used formula
Figure A20038010826000141
(in the formula, R 11aExpression has 1 to 2 substituent phenyl; Ea represents key, oxygen atom or can substituted methylene; Ring S 1aExpression can further have substituent phenyl ring, and described substituent group is selected from can substituted C 1-6Alkyl, can substituted C 1-6Alkoxyl and halogen atom; R 16And R 17Can be identical or different, expression hydrogen atom, halogen atom, C 1-6Alkyl or C 1-6Alkoxyl) represents;
(17) above-mentioned (16) described chemical compound, wherein: R 11aBe to have that be selected from can substituted C 1-6Alkyl, can substituted C 1-62 substituent phenyl in alkoxyl and the halogen atom; Ea is key, oxygen atom or methylene; R 16And R 17Identical or different, be hydrogen atom or halogen atom;
(18) above-mentioned (17) described chemical compound, wherein: Ea is a key;
(19) above-mentioned (17) described chemical compound, wherein: R 16Be hydrogen atom and R 17It is fluorine atom;
(20) above-mentioned (16) described chemical compound, wherein: partial structural formula
Be
(21) above-mentioned (20) described chemical compound, wherein: R 11aBe to have that be selected from can substituted C 1-6Alkyl, can substituted C 1-62 substituent phenyl in alkoxyl and the halogen atom; Ea is a key; Ring S 1aBe not have further substituent phenyl ring;
(22) above-mentioned (13) described chemical compound, wherein: the substituent group with phenyl ring is to use formula: R 11-E 2-(R 11Expression can have substituent phenyl, indanyl or naphthyl, E respectively 2Expression key or basic at interval) substituent group of expression, ring S 1Can reuse C 1-6Alkyl replaces, R 11Can with E 2With ring S 1The common ring that forms;
(23) above-mentioned (22) described chemical compound, wherein:
R 11Be can have respectively the halogen atom of being selected from, nitro, carboxyl, can be by halogenated C 1-6Alkyl, hydroxyl-C 1-6Alkyl, carboxyl-C 1-6Alkyl-carbonylamino-C 1-6Alkyl, can be by halogenated C 1-6Alkoxyl, C 6-14Aryl, C 6-14Aryloxy group and C 7-16Substituent phenyl or indanyl in the aralkoxy,
E 2Be key ,-O-,-CH 2-O-,-CO-,-CONH-,-N (CH 3) CH 2-,-S-CH 2-or-C=C-,
Ring S 1Can reuse C 1-6Alkyl replaces,
R 11With E 2With ring S 1The common ring that forms is
Figure A20038010826000151
The substituent group that ring R can have is C 1-6Alkyl, Ra are hydrogen atoms;
(24) use formula
(in the formula, the ring M represent to have substituent phenyl ring, the ring N represent to have substituent five-ring heterocycles, the ring E represent to have substituent phenylene, Ra represents hydrogen atom or substituent group) expression compound or its salt (here, except 4-(1H-benzotriazole-1-ylmethoxy) benzenpropanoic acid and 4-(1H-indol-3-yl methoxyl group) benzenpropanoic acid);
(25) prodrug of above-mentioned (24) described compound or its salt;
(26) above-mentioned (24) described chemical compound, wherein: partial structural formula
Figure A20038010826000153
Be can have respectively the halogen atom of being selected from, can substituted C 1-6Alkyl, can substituted C 1-6Alkoxyl, C 1-6Alkoxyl-carboxyl and can substituted C 7-16Substituent in the aralkoxy
Figure A20038010826000154
Or
Figure A20038010826000155
(27) above-mentioned (24) described chemical compound, wherein: partial structural formula
Figure A20038010826000156
Be to have the halogen atom of being selected from and can substituted C respectively 1-6Substituent in the alkyl
Figure A20038010826000157
Or
Ring E is that phenylene, the Ra that nothing replaces is hydrogen atom;
(28) use formula
Figure A20038010826000161
(in the formula, ring S 2Expression can have substituent phenyl ring, ring R represents to have substituent phenylene, E 1Expression key or basic at interval, R 13Expression can have substituent thiazolyl, Ra represents hydrogen atom or substituent group) expression compound or its salt;
(29) prodrug of above-mentioned (28) described compound or its salt;
(30) above-mentioned (28) described chemical compound, wherein: ring S 2Be that phenyl ring, ring R do not have phenylene, the R that replaces 13Be to have the C of being selected from 6-14Aryl and C 1-6Substituent thiazolyl in the alkyl, E 1Be-N (R 14)-(CH 2) m 2-or-S-(CH 2) m 2-(R 14Expression hydrogen atom or C 1-6Alkyl, m 2The integer of expression 0 to 3), Ra is a hydrogen atom;
(31) above-mentioned (28) described chemical compound, wherein: R 13Be to have substituent 2-thiazolyl;
(32) above-mentioned (28) described chemical compound is used formula
Figure A20038010826000162
(in the formula, E 1aExpression-N (R 14)-CH 2-,-CH (R 22)-O-or-CH (R 22) CH 2-(R 14And R 22Expression hydrogen atom or C 1-6Alkyl), R 18And R 19Identical or different, expression hydrogen atom, halogen atom, C 1-6Alkyl or C 1-6Alkoxyl, R 20And R 21Identical or different, the expression hydrogen atom, can substituted C 6-14Aryl or can substituted C 1-6Alkyl or R 20And R 21In conjunction with and form ring) represent;
(33) above-mentioned (32) described chemical compound, wherein: E 1aBe-N (R 14)-CH 2-(R 14Expression hydrogen atom or C 1-6Alkyl), R 18And R 19Identical or different, be hydrogen atom or halogen atom;
(34) contain the medicine of above-mentioned (10), (13), (24) or (28) described compound or its salt or its prodrug;
(35) a kind of GPR40 receptor function controlling control method is characterized in that: the aromatic rings that contains of effective dose is thrown to mammal with the chemical compound that can emit cationic base;
(36) contain aromatic rings and the application of the chemical compound that can emit cationic base in making the GPR40 receptor function controlling agent;
(37) screening technique of a kind of ligand at GPR40, agonist or antagonist is characterized in that: use GPR40 or its partial peptide or its salt and contain aromatic rings and the chemical compound that can emit cationic base;
(38) the screening with medicament box of a kind of ligand at GPR40, agonist or antagonist is characterized in that: comprise GPR40 or its partial peptide or its salt and contain aromatic rings and the chemical compound that can emit cationic base.
The present invention also provides
(39) above-mentioned (2) described regulator, wherein: contain useful formula
Figure A20038010826000171
(in the formula, ring P represents to have substituent aromatic rings, ring R represents to have substituent phenylene, X 1The expression key maybe can have substituent C 1-6Alkylidene, W 5The expression key ,-O-,-N (R 6)-,-CO-N (R 7)-or-S-, R 6And R 7Represent hydrogen atom or C respectively 1-6Alkyl, Y 1Expression can have substituent C 1-6Alkylidene) Biao Shi compound or its salt or its prodrug;
(40) above-mentioned (2) described regulator, wherein: contain useful formula
Figure A20038010826000172
Compound or its salt or its prodrug that (in the formula, ring S represents to have substituent phenyl ring, ring R represents to have substituent phenylene, Z represents the chain that formed by 4 keys) represented;
(41) above-mentioned (2) described regulator, wherein: contain useful formula
Figure A20038010826000173
(in the formula, ring A represents to have substituent phenyl ring, ring P 1Expression can have substituent ring, ring Q 1Expression except can also have the-Y-COOH substituent aromatic rings, X and Y represent respectively at interval base ,-Y-COOH is replaced in ring Q 1On the optional position) expression compound or its salt or its prodrug;
(42) above-mentioned (41) described regulator, wherein: contain useful formula
(in the formula, ring P 2Expression can have substituent ring, other each mark is represented and above-mentioned (30) identical meaning) expression compound or its salt or its prodrug;
(43) above-mentioned (41) described regulator, wherein: contain useful formula
Figure A20038010826000181
(in the formula, ring A represents to have substituent phenyl ring, ring B represents to have substituent 5 to 7 yuan ring, ring C represent except can also have the-Y-COOH base substituent phenyl ring, X and Y represent respectively base at interval ,-Y-COOH is replaced in the optional position on the ring C) compound or its salt or its prodrug represented;
(44) above-mentioned (4), (5) or (39) described regulator, wherein: ring P can have substituent phenyl ring maybe can have the substituent heteroaromatic that does not have alkalescence;
(45) above-mentioned (4), (5) or (39) described regulator, wherein: ring P can have substituent phenyl ring;
(46) above-mentioned (4), (5) or (39) described regulator, wherein: ring P can have substituent phenyl ring on a position;
(47) above-mentioned (4), (5) or (39) described regulator, wherein: the substituent group of ring P is the substituent group with aromatic rings;
(48) above-mentioned (47) described regulator, wherein: the substituent group with aromatic rings is to use formula R 1-E-(R 1Expression can have substituent fragrant cyclic group, E and represent key or base at interval) substituent group of expression;
(49) above-mentioned (48) described regulator, wherein :-E-be key ,-O-,-CH 2-O-,-CO-,-CONH-,-N (R 2)-CH 2-(R 2Expression hydrogen atom or C 1-6Alkyl) ,-S-CH 2-or-CH=CH-;
(50) above-mentioned (48) described regulator, wherein :-E-be key ,-O-or-CH 2-O-;
(51) above-mentioned (48) described regulator, wherein: R 1Be (i) can have the halogen atom of being selected from, nitro, carboxyl, can be by halogenated C 1-6Alkyl, hydroxyl-C 1-6Alkyl, carboxyl-C 1-6Alkyl-carbonylamino-C 1-6Alkyl, can be by halogenated C 1-6Alkoxyl, C 6-14Aryl, C 6-14Aryloxy group and C 7-16Substituent phenyl in the aralkoxy or (ii) can have is selected from can be by halogenated C 1-6Alkyl, C 6-14Aryl and C 6-14Aryl-C 2-6Substituent in the alkenyl also contains 1 to 4 heteroatomic 5 to 14 yuan heterocycle that is selected from nitrogen-atoms, oxygen atom and the sulphur atom except carbon atom, E is a key or with-(CH 2) m 1-W 1-(CH 2) m 2-(m 1And m 2Represent 0 to 3 integer, W respectively 1Expression-O-,-N (R 2)-,-CO-or-CO-N (R 3)-, R 2And R 3Represent hydrogen atom or C respectively 1-6Alkyl) Biao Shi interval base;
(52) above-mentioned (5) described regulator, wherein: ring Q can have substituent phenyl ring;
(53) above-mentioned (4), (5), (41), (42) and (43) described regulator, wherein, the interval base of representing with X is:
(i)-X 1-W 2-X 2-(X 1And X 2Represent that respectively key maybe can have substituent C 1-6Alkylidene, W 2Expression-O-,-N (R 4)-,-CO-N (R 5)-or-S-, R 4And R 5Represent hydrogen atom or C respectively 1-6Alkyl), or
(ii)-W 3-X 3-W 4-(X 3Expression can have substituent C 1-6Alkylidene, W 3And W 4Respectively expression-O-,-N (R 4)-,-CO-N (R 5)-or-S-, R 4And R 5Represent hydrogen atom or C respectively 1-6Alkyl);
(54) above-mentioned (4), (5), (41), (42) and (43) described regulator, wherein: the interval base of representing with X is-X 1-O-X 2-(X 1And X 2Represent that respectively key maybe can have substituent C 1-6Alkylidene);
(55) above-mentioned (4), (5), (41), (42) and (43) described regulator, wherein: the interval base of representing with X is-X 1-O-(X 1The expression key maybe can have substituent C 1-6Alkylidene);
(56) above-mentioned (55) described regulator, wherein: X 1Be (i) key or (ii) can have the C of being selected from 1-6Alkyl and C 6-14Substituent C in the aryl 1-6Alkylidene;
(57) above-mentioned (4), (5), (41), (42) and (43) described regulator, wherein, the interval base of representing with X is:
(i) key,
(ii)-X 1-O-(X 1The expression key maybe can have substituent C 1-6Alkylidene),
(iii)-N (R 4)-X 3-O-(X 3Expression can have substituent C 1-6Alkylidene, R 4Expression C 1-6Alkyl),
(iv)-S-X 3-O-(X 3Expression can have substituent C 1-6Alkylidene),
(v)-N (R 4)-X 3-(X 3Expression can have substituent C 1-6Alkylidene, R 4Expression hydrogen atom or C 1-6Alkyl),
(vi)-CO-N (R 5)-(R 5Expression hydrogen atom or C 1-6Alkyl),
(vii)-X 3-S-(X 3Expression can have substituent C 1-6Alkylidene) or
(viii)-S-X 3-S-(X 3Expression can have substituent C 1-6Alkylidene);
(58) above-mentioned (4), (5), (41), (42) and (43) described regulator, wherein: Y is-W 5-Y 1-(Y 1Expression can have substituent C 1-6Alkylidene, W 5The expression key ,-O-,-N (R 6)-,-CO-N (R 7)-or-S-, R 6And R 7Represent hydrogen atom or C respectively 1-6Alkyl);
(59) above-mentioned (4), (5), (41), (42) and (43) described regulator, wherein: Y can have substituent C 1-6Alkylidene;
(60) above-mentioned (4), (5), (41), (42) and (43) described regulator, wherein: Y can have substituent ethylidene;
(61) above-mentioned (4), (5), (41), (42) and (43) described regulator, wherein: Y is-O-Y 1-(Y 1Expression can have substituent C 1-6Alkylidene);
(62) above-mentioned (4), (5), (41), (42) and (43) described regulator, wherein :-Y-COOH is replaced in ring Q, ring Q 1Or in the para-position of ring C;
(63) above-mentioned (40) described regulator, wherein, Z is:
(1) by being selected from-C (R 8) (R 8 ')-,-O-,-CO-,-N (R 8 ")-(R 8, R 8 'And R 8 "Represent hydrogen atom or C respectively 1-6Alkyl) and-chain that 4 bases among the S-form or
(2) by
Figure A20038010826000201
With, be selected from-C (R 8) (R 8 ')-,-O-,-CO-,-N (R 8 ")-(R 8, R 8 'And R 8 "Represent hydrogen atom or C respectively 1-6Alkyl) and-2 chains that base forms among the S-;
(64) above-mentioned (40) described regulator, wherein, Z is:
(1)-(CH 2) 4-、
(2)-O-(CH 2) 3、
(3)
, or
(4)
Figure A20038010826000203
(65) above-mentioned (43) described regulator, wherein: the expression of B ring can have substituent group and can also contain 1 to 3 heteroatomic 5 to the 7 yuan of ring that is selected from nitrogen-atoms, oxygen atom and the sulphur atom except carbon atom;
(66) above-mentioned (43) described regulator, wherein: partial structural formula
Be
Figure A20038010826000205
Or
Figure A20038010826000206
(67) above-mentioned (43) described regulator, wherein: partial structural formula
Be
Figure A20038010826000212
Or
(68) above-mentioned (43) described regulator, wherein: the interval base of representing with X be can have substituent methylene ,-O-or-S-, the interval basis representation of representing with Y can have substituent C 1-6Alkylidene ,-N (R 6)-Y 1-(R 6Expression hydrogen atom or C 1-6Alkyl, Y 1Expression can have substituent C 1-6Alkylidene) ,-O-Y 1-(Y 1Expression can have substituent C 1-6Alkylidene) or-S-Y 1-(Y 1Expression can have substituent C 1-6Alkylidene);
(69) above-mentioned (1) described regulator, wherein: contain and have the formula of using
Figure A20038010826000214
(in the formula, X represents base, ring P at interval 1Expression can have substituent ring) the carboxylic acid or derivatives thereof of skeleton of expression;
(70) above-mentioned (2) described regulator, wherein: contain useful formula
Figure A20038010826000215
(in the formula, ring P 3Has the substituent aromatic rings that has phenyl ring, ring Q represents can also have substituent aromatic rings except the-Y-COOH, X and Y represent base at interval respectively,-Y-COOH is replaced in the optional position of ring on the Q) compound or its salt or its prodrug (wherein, removing (i) 2-ethyoxyl-4-[[2-[(5-methyl-2-phenyl-4-oxazolyl) methoxyl group of expression] phenyl] methoxyl group] benzenpropanoic acid, (ii) 2-ethyoxyl-4-[[3-[(5-methyl-2-phenyl-4-oxazolyl) methoxyl group] phenyl] methoxyl group] benzenpropanoic acid, (iii) 2-ethyoxyl-4-[[4-[(5-methyl-2-phenyl-4-oxazolyl) methoxyl group] phenyl] methoxyl group] benzenpropanoic acid, (iv) 4-[[4-[(5-methyl-2-phenyl-4-oxazolyl) methoxyl group] phenyl] methoxyl group] benzenpropanoic acid))
(71) above-mentioned (2) described regulator, wherein: contain useful formula
Figure A20038010826000221
(in the formula, ring P 3Have the substituent aromatic rings that has phenyl ring, ring R represents to have substituent phenylene, X 1The expression key maybe can have substituent C 1-6Alkylidene, W 5The expression key ,-O-,-N (R 6)-,-CO-N (R 7)-or-S-, R 6And R 7Represent hydrogen atom or C respectively 1-6Alkyl, Y 1Expression can have substituent C 1-6Alkylidene) Biao Shi compound or its salt or its prodrug;
(72) above-mentioned (71) described regulator, wherein: X 1Be to have substituent C 1-6Alkylidene, W 5Be key, Y 1Be to have substituent C 1-6Alkylidene;
(73) above-mentioned (71) described regulator, wherein: X 1Be to have substituent methylene, W 5Be key, Y 1Be to have substituent ethylidene;
(74) above-mentioned (70) described regulator is used formula
Figure A20038010826000222
(in the formula, ring S 1Expression has the substituent phenyl ring that has phenyl ring, and ring R represents to have substituent phenylene) represent;
(75) above-mentioned (70) arrive (74) described regulator, and wherein: having the substituent group of phenyl ring, is to use formula: R 11-E 2-(R 11Expression can have substituent phenyl, indanyl or naphthyl, E respectively 2Expression key or basic at interval) substituent group of expression;
(76) above-mentioned (75) described compound or its salt or its prodrug, wherein :-E 2-be key ,-O-,-CH 2-O-,-CO-,-CONH-,-N (CH 3) CH 2-,-S-CH 2-or-C=C-, preferably key ,-O-or-CH 2-O-;
(77) above-mentioned (75) described compound or its salt or its prodrug, wherein: R 11Be can have the halogen atom of being selected from, nitro, carboxyl, can be by halogenated C 1-6Alkyl, hydroxyl-C 1-6Alkyl, carboxyl-C 1-6Alkyl-carbonylamino-C 1-6Alkyl, can be by halogenated C 1-6Alkoxyl, C 6-14Aryl, C 6-14Aryloxy group and C 7-16Substituent phenyl in the aralkoxy;
(78) above-mentioned (2) described regulator, wherein: contain useful formula
Figure A20038010826000231
(in the formula, A 1Expression substituent group (but except hydrogen atom and chlorine atom), ring D represents except A 1The phenyl ring that can also have substituent group (but except nitro and hydroxyl) in addition, the ring E represent to have substituent phenylene) expression compound or its salt or its prodrug (but except 2-ethyoxyl-4-[[3-[(5-methyl-2-phenyl-4-oxazolyl) methoxyl group] phenyl] methoxyl group] benzenpropanoic acid);
(79) above-mentioned (78) described regulator, wherein: A 1It is bromine atoms;
(80) above-mentioned (2) described regulator, wherein: contain useful formula
Figure A20038010826000232
(in the formula, ring F represents to have substituent ring, and ring G represents to have substituent phenyl ring, and ring E represents to have substituent phenylene.Here, partial structural formula
Figure A20038010826000233
Be not the naphthyl that do not have to replace, do not have the 1H-indazolyl that replaces and do not have substituent quinolyl) compound or its salt or its prodrug of expression;
(81) above-mentioned (2) described regulator, wherein: contain useful formula
Figure A20038010826000234
(in the formula, ring A represents to have substituent phenyl ring, ring H represents to have substituent five-membered ring, ring R represents to have substituent phenylene) compound or its salt or its prodrug (but except 3,5-two bromo-4-((the 5-chlorobenzene is (b) thiene-3-yl-also) methoxyl group) benzenpropanoic acid, 4-(1H-benzotriazole-1-ylmethoxy) benzenpropanoic acid and 4-(1H-indol-3-yl methoxyl group) benzenpropanoic acid) of expression
(82) above-mentioned (81) described regulator, wherein: partial structural formula
Figure A20038010826000235
Be to have the halogen atom of being selected from and can be respectively by halogenated C 1-6Substituent following substances in the alkyl:
Figure A20038010826000241
Or
Figure A20038010826000242
(83) above-mentioned (2) described regulator, wherein: contain useful formula
Figure A20038010826000243
(in the formula, ring A represents to have substituent phenyl ring, J represents-O-,-S-,-CH 2-or-NR 12-(R 12Expression hydrogen atom or C 1-6Alkyl), K represents key or C 1-3Alkoxyl,
Expression singly-bound or two key, ring R represents to have substituent phenylene, ring I can have substituent group) compound or its salt or its prodrug of expression;
(84) above-mentioned (83) described compound or its salt or its prodrug, wherein: partial structural formula
Figure A20038010826000244
Be
Figure A20038010826000245
Or
Figure A20038010826000246
, the substituent group of ring A is (i) halogen atom, (ii) C 1-6Alkyl, (iii) C 1-6Alkoxyl, (iv) can have the halogen atom of being selected from and C 1-6Substituent C in the alkyl 6-14Aryl, (v) C 6-14Aryloxy group or (vi) C 7-15Aralkoxy, the substituent group of ring R is a halogen atom; And
(85) above-mentioned (1) described regulator, wherein: contain above-mentioned (10), (13), (24) or (28) described compound or its salt or its prodrug.
Description of drawings
Fig. 1 represents to investigate that the chemical compound of embodiment 41 produces from the result of the insulin secretion facilitation of MIN6.The Concentration of transverse axis represents to have added embodiment 41 compound concentrations (μ M).**，p＜0.01(Student’st test)。
Fig. 2 represents to investigate the result of The compounds of this invention for the blood glucose reduction effect of rat.● expression matched group (0.5% methylcellulose is thrown to group), zero expression chemical compound are thrown to group (chemical compound of embodiment 41 is thrown to group).Transverse axis represent behind the glucose load time (minute).The longitudinal axis is represented blood glucose value amplitude of fluctuation (ng/dl).1 group is 6, its numeric representation meansigma methods ± standard deviation.
Fig. 3 represents to investigate the result of The compounds of this invention for the insulin secretion effect of rat.● expression matched group (0.5% methylcellulose is thrown to group), zero expression chemical compound are thrown to group (chemical compound of embodiment 41 is thrown to group).Transverse axis represent behind the glucose load time (minute).The longitudinal axis is represented insulin immunocompetence amplitude of fluctuation (μ U/ml).1 group is 6, its numeric representation meansigma methods ± standard deviation.
The specific embodiment
Employed chemical compound among the present invention, it is the chemical compound that contains aromatic rings and can emit cationic base, the carboxylic acid or derivatives thereof that preferably contains aromatic rings, the carboxylic acid or derivatives thereof that more preferably contains 2 above aromatic rings, concrete is above-claimed cpd (I '), chemical compound (I), chemical compound (I-1), chemical compound (I-2), chemical compound (I-2A), chemical compound (I-3), chemical compound (I-4), chemical compound (I-4A), chemical compound (Ia), chemical compound (Ib), chemical compound (II), chemical compound (IIa), chemical compound (IIb), chemical compound (III), chemical compound (IV), chemical compound (IVa), chemical compound (IVb), chemical compound (A), chemical compound (B), chemical compound (C), chemical compound (D).Chemical compound (I-1), chemical compound (I-2), chemical compound (I-2A), chemical compound (I-3), chemical compound (I-4), chemical compound (I-4A) are new compounds.
In present specification, so-called aromatic rings is represented aromatic hydrocarbon ring and heteroaromatic.
As the aromatic hydrocarbon ring, the carbon number that uses phenyl ring, naphthalene nucleus etc. is 6 to 14 hydrocarbon ring, wherein preferably uses phenyl ring.
As heteroaromatic, for example except carbon atom, can also use to contain to be selected from 1 in nitrogen-atoms, sulphur atom and the oxygen atom or 2 kind, 1 to 4 heteroatomic 5 to 14 yuan (monocycle, 2 ring or 3 ring types), to be preferably 5 to 10 yuan, 5 or 6 yuan heteroaromatic more preferably.As above-mentioned " heteroaromatics of 5 to 14 yuan (being preferably 5 to 10 yuan) ", can use for example thiophene, furan oxazole, benzo [b] thiophene, benzo [b] furan, benzimidazole benzoxazole, benzothiazole, benzisothiazole, naphtho-[2,3-b] thiophene, furan, the pyrroles, imidazoles, pyrazoles, pyridine, pyrazine, pyrimidine, pyridazine, indole, iso-indoles, the 1H-indazole, purine, the 4H-quinolizine, isoquinolin, quinoline, phthalazines, naphthyridines, quinoxaline, quinazoline, cinnolines, carbazole, B-carboline, phenanthridines, acridine, azophenlyene, thiazole, isothiazole, phenothiazine isoxazole, the heteroaromatic of furazan phenoxazine etc., or these rings (being preferably monocycle) and 1 ring that forms to the aromatic rings of a plurality of (being preferably 1 or 2) (for example phenyl ring etc.) condensation.Wherein, preferred not with alkaline heteroaromatic, heteroaromatic such as thiophene, benzo [b] thiophene, benzo [b] furan, benzoxazole, benzothiazole, benzisothiazole, naphtho-[2,3-b] thiophene, furan, indole, carbazole, thiazole, isothiazole, isoxazole or use these rings (being preferably monocycle) and 1 ring that does not form to a plurality of (being preferably 1 or 2) etc. for example with the aromatic rings of alkalescence (for example phenyl ring etc.) condensation.
In present specification, can emit cationic base, (for example can be in chemical, the chemical reaction of oxidation, reduction or hydrolysis etc. etc.) or property biology, be that (for example, organism internal reaction of the oxidation that is caused by the organism endoenzyme, reduction or hydrolysis etc. etc.) can emit cationic base and maybe can become its base under the physiological condition.
As emitting cationic base, for example can use (1) can emit cationic five yuan heterocyclic radical, (2) carboxyl, (3) sulfonic group, (4) and can use C 1-4C can be used in the mono-substituted sulfamoyl of alkyl, (5) phosphonate group, (6) 1-4The mono-substituted carbamoyl of alkyl (for example, methyl, ethyl, propyl group, butyl, isobutyl group, the tert-butyl group etc.), (7) C 2-7Alkyl sulphonyl thiocarbamoyl (for example methyl sulphonyl thiocarbamoyl, ethylsulfonyl thiocarbamoyl etc.) or (8) trifluoromethanesulfonic acid amide groups (NHSO 2CF 3) etc.
As emitting above-mentioned cationic quinary heterocyclic radical, use 1 to 4 the five-ring heterocycles that is selected among N, O, the S as ring atom, for example can enumerate:
Figure A20038010826000263
Or
Figure A20038010826000264
Deng.Wherein be preferably
Or
Be preferably especially
Figure A20038010826000267
Can emit cationic base, particularly preferably be carboxyl.
At chemical compound (I '), (I) with (Ia), ring P represents to have substituent aromatic rings.
As the aromatic rings of representing with ring P, preferably phenyl ring or thiophene, benzo [b] thiophene, benzo [b] furan, benzoxazole, benzothiazole, benzisothiazole, naphtho-[2,3-b] thiophene, furan, indole, carbazole, thiazole, isothiazole, isoxazole etc. are with the heteroaromatic of alkalescence, phenyl ring more preferably.
At chemical compound (I '), (I) with (IV), ring Q represent except
Figure A20038010826000271
Or-can also have substituent aromatic rings beyond the Y-COOH.
As the aromatic rings of representing with ring Q, be preferably phenyl ring or thiophene, benzo [b] thiophene, benzo [b] furan, benzoxazole, benzothiazole, benzisothiazole, naphtho-[2,3-b] thiophene, furan, indole, carbazole, thiazole, isothiazole, isoxazole etc. with the heteroaromatic of alkalescence, are not preferably phenyl ring especially.
Substituent group that can have as above-mentioned ring P and above-mentioned ring Q except
Figure A20038010826000272
Or-substituent group that can also have beyond the Y-COOH, for example can use the substituent group of selecting among the following substituent group etc. (being designated hereinafter simply as the substituent A group), this substituent group is to be selected from the oxo base; Halogen atom (for example fluorine, chlorine, bromine, iodine etc.); C 1-3Alkylenedioxy group (for example methylene dioxy base, ethylidene dioxy base etc.); Nitro; Cyano group; Can esterified carboxyl; Can substituted rudimentary (C 1-6) alkyl; Can substituted rudimentary (C 2-6) alkenyl; Can substituted rudimentary (C 2-6) alkynyl; Can substituted C 3-8Cycloalkyl; Can substituted rudimentary (C 1-6) alkoxyl; Hydroxyl; Sulfydryl; Can substituted rudimentary (C 1-6) alkylthio group; Formoxyl; Can substituted rudimentary (C 1-6) alkyl-carbonyl; Can substituted rudimentary C 3-8Cycloalkyl-carbonyl; Rudimentary (C 1-6) alkyl sulphonyl (for example methyl sulphonyl, ethylsulfonyl etc.); Rudimentary (C 1-6) alkyl sulphinyl (for example methylsulfinyl, ethyl sulfinyl etc.); Formoxyl amino; Can substituted rudimentary (C 1-6) alkyl-carbonylamino; Can substituted C 3-8Cycloalkyl-carbonylamino; Can substituted rudimentary (C 1-6) alkoxyl-carbonylamino; Can substituted rudimentary (C 1-6) alkyl sulfonyl amino; Can substituted rudimentary (C 1-6) alkoxyl-carbonyl oxygen base; Can the rudimentary (C of substituted list 1-6) alkyl-carbamoyloxy; Can substituted two rudimentary (C 1-6) alkyl-carbamoyloxy; Sulfo group; Sulfamoyl; Sufinamoyl; Sulfenamoyl; Can substitutedly except carbon atom, contain and be selected from 1 in nitrogen-atoms, sulphur atom and the oxygen atom or 2 kind, 1 to 4 heteroatomic 5 to 7 yuan of heterocycle carbonyls; As with formula R described later 1The substituent group object lesson that-E-represents can substituted C 6-14Aryloxy group, can substituted C 7-16Aralkoxy, can substituted C 6-14The virtue thio group, can substituted C 7-16Aromatic alkylthio, can substituted C 6-14Aryl-carbonyl, can substituted C 7-16Aralkyl-carbonyl, can substituted C 6-14Aryl-carbonylamino, can substituted C 6-14Aryl-carbonyl oxygen base, can substituted single or two-C 6-14Aryl-carbamoyloxy, can substituted C 6-14Aryl sulfonyl, can substituted C 6-14Aryl sulfonyl kia, can substituted C 6-14Arlysulfonylamino, can substituted heteroaromatic oxygen base, can substituted C 6-14Aryl, can substituted C 7-16Aralkyl and can substituted C 6-14Aryl-C 2-6Alkenyl; Can substituted heterocyclic radical; Thiocarbamoyl; Can substituted carbamoyl; And; Substituent group in can substituted amino; And above-mentioned these substituent groups base that (for example 2～3) combine more than 2 etc.Ring P can have 1 to 5, preferably have 1 to 3 above-mentioned substituent group on the position that can replace, replace radix and be 2 when above, each substituent group can be identical or different.
" can esterified carboxyl " as the substituent A group can use for example carboxyl, C 1-6Alkoxyl-carbonyl (for example methoxycarbonyl, ethoxy carbonyl, propoxycarbonyl, tert-butoxycarbonyl etc.), C 6-14Aryloxy-carbonyl (for example phenyloxycarbonyl etc.), C 7-16Aralkoxy-carbonyl (for example benzyloxycarbonyl, phenethyl oxygen base carbonyl etc.) etc.
As the substituent A group " can substituted rudimentary (C 1-6) alkyl " and " rudimentary (C 1-6) alkyl ", can use for example methyl, ethyl, propyl group, isopropyl, butyl, isobutyl group, sec-butyl, the tert-butyl group, amyl group, isopentyl, neopentyl, hexyl etc.
As the substituent A group " can substituted rudimentary (C 2-6) alkenyl " and " rudimentary (C 2-6) alkenyl ", can use for example vinyl, acrylic, isopropenyl, 2-butylene-1-base, 4-amylene-1-base, 5-hexene-1-base etc.
As the substituent A group " can substituted rudimentary (C 2-6) alkynyl " and " rudimentary (C 2-6) alkynyl ", can use for example 2-butyne-1-base, 4-pentyne-1-base, 5-hexin-1-base etc.
As the substituent A group " can substituted rudimentary (C 1-6) alkoxyl " and " rudimentary (C 1-6) alkoxyl ", can use for example methoxyl group, ethyoxyl, propoxyl group, isopropoxy, butoxy, isobutoxy, sec-butoxy, amoxy, hexyloxy etc.
As the substituent A group " can substituted rudimentary (C 1-6) alkylthio group " and " rudimentary (C 1-6) alkylthio group ", can use for example methyl mercapto, ethylmercapto group, rosickyite base, iprotiazem base, butylthio, secondary butylthio, uncle's butylthio etc.
As the substituent A group " can substituted rudimentary (C 1-6) alkyl-carbonyl " and " rudimentary (C 1-6) alkyl-carbonyl ", can use for example acetyl group, propiono, pivaloyl group etc.
As the substituent A group " can substituted rudimentary (C 1-6) alkyl-carbonylamino " and " rudimentary (C 1-6) alkyl-carbonylamino ", can use for example acetamido, propionamido-, pivaloyl amido etc.
As the substituent A group " can substituted rudimentary (C 1-6) alkoxyl-carbonylamino " and " rudimentary (C 1-6) alkoxyl-carbonylamino ", can use for example methoxycarbonyl amino, ethoxy carbonyl amino, propoxycarbonyl amino, butoxy carbonyl amino etc.
As the substituent A group " can substituted rudimentary (C 1-6) alkyl sulfonyl-amino " and " rudimentary (C 1-6) alkyl sulfonyl-amino ", can use for example methyl sulphonyl amino, ethylsulfonyl amino etc.
As the substituent A group " can substituted rudimentary (C 1-6) alkyl-ketonic oxygen base " and " rudimentary (C 1-6) alkyl-ketonic oxygen base ", can use for example acetoxyl group, propionyloxy etc.
As the substituent A group " can substituted rudimentary (C 1-6) alkoxyl-ketonic oxygen base " and " rudimentary (C 1-6) alkoxyl-ketonic oxygen base ", can use for example methoxycarbonyl oxygen base, ethoxy carbonyl oxygen base, propoxycarbonyl oxygen base, butoxy carbonyl oxygen base etc.
As the substituent A group " can the rudimentary (C of substituted list 1-6) alkyl-carbamoyloxy " and " single rudimentary (C 1-6) alkyl-carbamoyloxy ", can use for example methylamino formyloxy, ethylamino formyloxy etc.
As the substituent A group " can substituted two rudimentary (C 1-6) alkyl-carbamoyloxy " and " two rudimentary (C 1-6) alkyl-carbamoyloxy ", can use for example dimethylamino formyloxy, diethylamino formyloxy etc.
These " low alkyl groups ", " low-grade alkenyl ", " low-grade alkynyl ", " lower alkoxy ", " lower alkylthio ", " low alkyl group-carbonyl ", " low alkyl group-carbonylamino ", " lower alkoxy-carbonylamino ", " low alkyl group sulfuryl amino ", " low alkyl group-ketonic oxygen base ", " lower alkoxy-ketonic oxygen base ", " single low alkyl group-carbamoyloxy " and " two low alkyl groups-carbamoyloxy " can have on the position that can replace respectively and for example be selected from halogen atom (fluorine atom for example, the chlorine atom, bromine atoms, the iodine atom); Hydroxyl; Amino; Except carbon atom, also contain be selected from 1 in nitrogen-atoms, sulphur atom and the oxygen atom or 2 kind, 1 to 4 heteroatomic single or 5 to 7 yuan of heterocyclic radical (for example furyl, pyridine radicals, thienyl etc.) of two (this heterocyclic radical can use halogen atom, hydroxyl, amino, can be by halogenated rudimentary (C 1-6) alkyl, list or two rudimentary (C 1-6) alkylamino, list or two (C 6-14) virtue is amino, C 3-8Cycloalkyl, rudimentary (C 1-6) alkoxyl, rudimentary (C 1-6) alkoxyl-carbonyl, rudimentary (C 1-6) alkylthio group, rudimentary (C 1-6) alkyl sulphinyl, rudimentary (C 1-6) alkyl sulphonyl, above-mentioned can esterified carboxyl, carbamoyl, thiocarbamoyl, single rudimentary (C 1-6) alkyl-carbamoyl, two rudimentary (C 1-6) alkyl-carbamoyl, list or two C 6-14Replacements such as aryl-carbamoyl); List or two rudimentary (C 1-6) alkyl amino; List or two C 6-14Arylamino; C 3-8Cycloalkyl; Can be by halogenated rudimentary C 1-6Alkoxyl; Rudimentary (C 1-6) alkoxyl-carbonyl; Rudimentary (C 1-6) alkylthio group; Rudimentary (C 1-6) alkyl sulphinyl; Rudimentary (C 1-6) alkyl sulphonyl; Above-mentioned can esterified carboxyl; Carbamoyl; Thiocarbamoyl; Single rudimentary (C 1-6) alkyl-carbamoyl (for example methylamino formoxyl, ethylamino formoxyl etc.); Two rudimentary (C 1-6) alkyl-carbamoyl (for example formyl-dimethylamino, diethylamino formoxyl, ethylmethylamino formoxyl etc.); List or two C 6-14Aryl-carbamoyl (for example phenyl amino formoxyl, 1-naphthyl carbamoyl, 2-naphthyl carbamoyl etc.); Except carbon atom, also contain and be selected from 1 in nitrogen-atoms, sulphur atom and the oxygen atom or 2 kind, 1 to 4 heteroatomic single or 5 to 7 yuan of heterocyclic amino group formoxyl (for example 2-pyridinylamino formoxyl, 3-pyridinylamino formoxyl, 4-pyridinylamino formoxyl, 2-thienyl carbamoyl, 3-thienyl carbamoyl etc.) of two; Can use the C of carboxyl substituted 1-61 to 5 substituent group in alkyl-carbonylamino (for example acetamido, propionamido-) etc.
As the substituent A group " can substituted C 3-8Cycloalkyl " " C 3-8Cycloalkyl ", can use for example cyclopropyl, cyclobutyl, cyclopenta, cyclohexyl etc.
As the substituent A group " can substituted C 3-8Cycloalkyl-carbonyl " " C 3-8Cycloalkyl-carbonyl ", can use for example cyclopropyl carbonyl, cyclopentylcarbonyl, cyclohexyl-carbonyl etc.
As the substituent A group " can substituted C 3-8Cycloalkyl-carbonylamino " " C 3-8Cycloalkyl-carbonylamino ", can use for example cyclopropyl carbonyl amino, cyclopentylcarbonyl amino, cyclohexyl-carbonyl amino etc.
As " except carbon atom, also contain and be selected from 1 in nitrogen-atoms, sulphur atom and the oxygen atom or 2 kind, 1 to 4 heteroatomic single or 5 to 7 yuan of heterocycle carbonyl of two " of substituent A group " can substitutedly except carbon atom, also contain and be selected from 1 in nitrogen-atoms, sulphur atom and the oxygen atom or 2 kind, 1 to 4 heteroatomic single or 5 to 7 yuan of heterocycle carbonyl of two ", can use for example nicotinoyl, different nicotinoyl, Thenoyl, furanylcarbonyl, morpholine carbonyl, thiomorpholine carbonyl, piperazine-1-base carbonyl, pyrrolidine-1-base carbonyl etc.
As the substituent A group " can substituted C 6-14Aryloxy group " " C 6-14Aryloxy group ", can use for example phenoxy group, 1-naphthoxy, 2-naphthoxy etc.
As the substituent A group " can substituted C 7-16Aralkoxy " " C 7-16Aralkoxy ", can use for example benzyloxy, benzene ethyoxyl etc.
As the substituent A group " can substituted C 6-14Arylthio " " C 6-14Arylthio ", can use for example thiophenyl, 1-naphthalene sulfenyl, 2-naphthalene sulfenyl etc.
As the substituent A group " can substituted C 7-16Aromatic alkylthio " " C 7-16Aromatic alkylthio ", can use for example benzylthio, benzene ethylmercapto group etc.
As the substituent A group " can substituted C 6-14Aryl-carbonyl " " C 6-14Aryl-carbonyl ", can use for example benzoyl, 1-naphthoyl, 2-naphthoyl etc.
As the substituent A group " can substituted C 7-16Aralkyl-carbonyl " " C 7-16Aralkyl-carbonyl ", can use for example phenyl acetyl, 3-phenyl propiono etc.
As the substituent A group " can substituted C 6-14Aryl-carbonylamino " " C 6-14Aryl-carbonylamino ", can use for example benzoyl-amido, naphthoyl amino etc.
As the substituent A group " can substituted C 6-14Aryl-carbonyl oxygen base " " C 6-14Aryl-carbonyl oxygen base ", can use for example benzoyloxy, naphthoyl oxygen base etc.
As the substituent A group " can substituted single or two C 6-14Aryl-carbamoyloxy " " single or two C 6-14Aryl-carbamoyloxy ", can use for example phenyl amino formyloxy, naphthyl carbamoyloxy etc.
As the substituent A group " can substituted C 6-14Aryl sulfonyl " " C 6-14Aryl sulfonyl ", can use for example phenyl sulfonyl, 1-naphthyl sulfonyl, 2-naphthyl sulfonyl etc.
As the substituent A group " can substituted C 6-14Aryl sulfonyl kia " " C 6-14Aryl sulfonyl kia ", can use for example phenyl sulfinyl, 1-naphthyl sulfinyl, 2-naphthyl sulfinyl etc.
As the substituent A group " can substituted C 6-14Arlysulfonylamino " " C 6-14Arlysulfonylamino ", can use for example phenyl sulfonyl amino etc.
" heteroaromatic oxygen base " as " can substituted heteroaromatic oxygen base " of substituent A group, can use for example except carbon atom, can also contain and be selected from 1 in nitrogen-atoms, sulphur atom and the oxygen atom or 2 kind, 1 to 4 heteroatomic 5 to 10 yuan of heteroaromatic-oxygen bases, specifically, can use pyrazinyl oxygen base etc.
These " C 3-8Cycloalkyl ", " C 3-8Cycloalkyl-carbonyl ", " C 3-8Cycloalkyl-carbonylamino ", " except carbon atom, also contain and be selected from 1 in nitrogen-atoms, sulphur atom and the oxygen atom or 2 kind, 1 to 4 heteroatomic 5 to 7 yuan of heterocycle carbonyls ", " C 6-14Aryloxy group ", " C 7-16Aralkoxy ", " C 6-14Arylthio ", " C 7-16Aromatic alkylthio ", " C 6-14Aryl-carbonyl ", " C 7-16Aralkyl-carbonyl ", " C 6-14Aryl-carbonylamino ", " C 6-14Aryl-carbonyl oxygen base ", " single or two C 6-14Aryl-carbamoyloxy ", " C 6-14Aryl sulfonyl ", " C 6-14Aryl sulfonyl kia ", " C 6-14Arlysulfonylamino " and " heteroaromatic oxygen base ", can on the position that can replace, have respectively and be selected from for example halogen atom (for example fluorine atom, chlorine atom, bromine atoms, iodine atom); Hydroxyl; Amino; Above-mentioned can substituted low alkyl group; Above-mentioned can substituted low-grade alkenyl; Above-mentioned can substituted low-grade alkynyl; C 6-14Aryl (this C 6-14Aryl can use halogen atom, hydroxyl, amino, can be by halogenated rudimentary (C 1-6) alkyl, list or two rudimentary (C 1-6) alkyl amino, list or two C 6-14Arylamino, C 3-8Cycloalkyl, rudimentary (C 1-6) alkoxyl, rudimentary (C 1-6) alkoxyl-carbonyl, rudimentary (C 1-6) alkylthio group, rudimentary (C 1-6) alkyl sulphinyl, rudimentary (C 1-6) alkyl sulphonyl, above-mentioned can esterified carboxyl, carbamoyl, thiocarbamoyl, single rudimentary (C 1-6) alkyl-carbamoyl, two rudimentary (C 1-6) alkyl-carbamoyl, list or two C 6-14Replacements such as aryl-carbamoyl); C 6-14Aryloxy group (this C 6-14Aryloxy group can use halogen atom, hydroxyl, amino, can be by halogenated rudimentary (C 1-6) alkyl, list or two rudimentary (C 1-6) alkyl amino, list or two C 6-14Arylamino, C 3-8Cycloalkyl, rudimentary (C 1-6) alkoxyl, rudimentary (C 1-6) alkoxyl-carbonyl, rudimentary (C 1-6) alkylthio group, rudimentary (C 1-6) alkyl sulphinyl, rudimentary (C 1-6) alkyl sulphonyl, above-mentioned can esterified carboxyl, carbamoyl, thiocarbamoyl, single rudimentary (C 1-6) alkyl-carbamoyl, two rudimentary (C 1-6) alkyl-carbamoyl, list or two C 6-14Replacements such as aryl-carbamoyl); C 7-16Aralkoxy (this C 7-16Aralkoxy can use halogen atom, hydroxyl, amino, can be by halogenated rudimentary (C 1-6) alkyl, list or two rudimentary (C 1-6) alkyl amino, list or two C 6-14Arylamino, C 3-8Cycloalkyl, rudimentary (C 1-6) alkoxyl, rudimentary (C 1-6) alkoxyl-carbonyl, rudimentary (C 1-6) alkylthio group, rudimentary (C 1-6) alkyl sulphinyl, rudimentary (C 1-6) alkyl sulphonyl, above-mentioned can esterified carboxyl, carbamoyl, thiocarbamoyl, single rudimentary (C 1-6) alkyl-carbamoyl, two rudimentary (C 1-6) alkyl-carbamoyl, list or two C 6-14Replacements such as aryl-carbamoyl); Except carbon atom, also contain be selected from 1 in nitrogen-atoms, sulphur atom and the oxygen atom or 2 kind, (this heterocyclic radical can be used halogen atom, hydroxyl, amino, list or two rudimentary (C to 1 to 4 heteroatomic single or 5 to 7 yuan of heterocyclic radical (for example furyl, pyridine radicals, thienyl etc.) of two 1-6) alkyl amino, list or two C 6-14Arylamino, C 3-8Cycloalkyl, rudimentary (C 1-6) alkoxyl, rudimentary (C 1-6) alkoxyl-carbonyl, rudimentary (C 1-6) alkylthio group, rudimentary (C 1-6) alkyl sulphinyl, rudimentary (C 1-6) alkyl sulphonyl, above-mentioned can esterified carboxyl, carbamoyl, thiocarbamoyl, single rudimentary (C 1-6) alkyl-carbamoyl, two rudimentary (C 1-6) alkyl-carbamoyl, list or two C 6-14Replacements such as aryl-carbamoyl); List or two rudimentary (C 1-6) alkyl amino; List or two C 6-14Arylamino; C 3-8Cycloalkyl; Above-mentioned can substituted rudimentary (C 1-6) alkoxyl; Rudimentary (C 1-6) alkoxyl-carbonyl; Rudimentary (C 1-6) alkylthio group; Rudimentary (C 1-6) alkyl sulphinyl; Rudimentary (C 1-6) alkyl sulphonyl; Above-mentioned can esterified carboxyl; Carbamoyl; Thiocarbamoyl; Single rudimentary (C 1-6) alkyl-carbamoyl (for example methylamino formoxyl, ethylamino formoxyl etc.); Two rudimentary (C 1-6) alkyl-carbamoyl (for example formyl-dimethylamino, diethylamino formoxyl, ethylmethylamino formoxyl etc.); List or two C 6-14Aryl-carbamoyl (for example phenyl amino formoxyl, 1-naphthyl carbamoyl, 2-naphthyl carbamoyl etc.); Except carbon atom, also contain 1 to 5 substituent group that is selected from 1 in nitrogen-atoms, sulphur atom and the oxygen atom or 2 kind, 1 to 4 heteroatomic single or 5 to 7 yuan of heterocyclic amino group formoxyl (for example, 2-pyridinylamino formoxyl, 3-pyridinylamino formoxyl, 4-pyridinylamino formoxyl, 2-thienyl carbamoyl, 3-thienyl carbamoyl) of two etc.
As the substituent A group " can substituted C 6-14Aryl " " C 6-14Aryl ", can use for example phenyl, 1-naphthyl, 2-naphthyl, 2-xenyl, 3-xenyl, 4-xenyl, 2-anthryl etc.This C 6-14Aryl can be partly by saturated, as partly by saturated C 6-14Aryl can be enumerated tetralyl etc.
As the substituent A group " can substituted C 7-16Aralkyl " " C 7-16Aralkyl "; can use for example benzyl, phenethyl, diphenyl methyl, 1-naphthyl methyl, 2-naphthyl methyl, 2,2-diphenyl-ethyl, 3-phenyl propyl, 4-phenyl butyl, 5-phenylpentyl, 2-xenyl methyl, 3-xenyl methyl, 4-xenyl methyl etc.
As the substituent A group " can substituted C 6-14Aryl-C 2-6Alkenyl " " C 6-14Aryl-C 2-6Alkenyl ", can use for example styryl etc.
These " C 6-14Aryl ", " C 7-16Aralkyl " and " C 6-14Aryl-C 2-6Alkenyl ", can on the position that can replace, have respectively and be selected from for example halogen atom; Hydroxyl; Nitro; Cyano group; Above-mentioned can substituted low alkyl group; Above-mentioned can substituted low-grade alkenyl; Above-mentioned can substituted low-grade alkynyl; Above-mentioned can substituted C 3-8Cycloalkyl; Above-mentioned can substituted lower alkoxy; Above-mentioned can substituted lower alkylthio; Above-mentioned can substituted low alkyl group sulfinyl; Above-mentioned can substituted low alkyl group sulfonyl; Above-mentioned can esterified carboxyl; Carbamoyl; Thiocarbamoyl; Single rudimentary (C 1-6) alkyl-carbamoyl; Two rudimentary (C 1-6) alkyl-carbamoyl; List or two C 6-14Aryl-carbamoyl; Except carbon atom, also contain 1 to 5 substituent group that is selected from 1 in nitrogen-atoms, sulphur atom and the oxygen atom or 2 kind, 1 to 4 heteroatomic single or 5 to 7 yuan of heterocyclic amino group formoxyl (for example 2-pyridinylamino formoxyl, 3-pyridinylamino formoxyl, 4-pyridinylamino formoxyl, 2-thienyl carbamoyl, 3-thienyl carbamoyl etc.) of two etc.
" heterocyclic radical " as " can substituted heterocyclic radical " of substituent A group, can use for example except carbon atom, also to contain and be selected from nitrogen-atoms, in sulphur atom and the oxygen atom 1 or 2 kind, 1 to 4 heteroatomic single or 5 to 14 yuan of (monocycle of two, dicyclo or three rings) heterocyclic radical, preferably can use aromatic heterocycle from (i) 5 to 14 yuan (being preferably 5 to 10 yuan), (ii) 5 to 10 yuan of non-aromatic heterocyclic radicals or (iii) remove arbitrarily the base etc. of 1 valency that 1 hydrogen atom forms on 7 to 10 yuan of hybridization connection rings more preferably use 5-membered aromatic family heterocyclic radical.Specifically, for example can use thienyl (2-thienyl for example, the 3-thienyl), furyl (2-furyl for example, the 3-furyl), pyridine radicals (2-pyridine radicals for example, the 3-pyridine radicals, the 4-pyridine radicals), thiazolyl (2-thiazolyl for example, the 4-thiazolyl, the 5-thiazolyl) oxazolyl (2-oxazolyl for example, the 4-oxazolyl), quinolyl (2-quinolyl for example, the 3-quinolyl, the 4-quinolyl, the 5-quinolyl, the 8-quinolyl), isoquinolyl (1-isoquinolyl for example, the 3-isoquinolyl, the 4-isoquinolyl, the 5-isoquinolyl), pyrazinyl, pyrimidine radicals (2-pyrimidine radicals for example, the 4-pyrimidine radicals), pyrrole radicals (1-pyrrole radicals for example, the 2-pyrrole radicals, the 3-pyrrole radicals), imidazole radicals (1-imidazole radicals for example, the 2-imidazole radicals, the 4-imidazole radicals), pyrazolyl (1-pyrazolyl for example, the 3-pyrazolyl, the 4-pyrazolyl), pyridazinyl (3-pyridazinyl for example, the 4-pyridazinyl), isothiazolyl (for example 3-isothiazolyl) isoxazolyl (for example 3-isoxazolyl), indyl (1-indyl for example, the 2-indyl, the 3-indyl), the 2-[4-morpholinodithio base, benzo [b] thienyl (2-benzo [b] thienyl for example, 3-benzo [b] thienyl), benzo [b] furyl (2-benzo [b] furyl for example, 3-benzo [b] furyl) etc. aromatic heterocycle; Pyrrolidinyl (the non-aromatic heterocyclic radical in 1-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl), oxazolidinyl (for example 2-oxazolidinyl), imidazolinyl (for example 1-imidazolinyl, 2-imidazolinyl, 4-imidazolinyl), piperidyl (for example piperidino, 2-piperidyl, 3-piperidyl, 4-piperidyl), piperazinyl (for example 1-piperazinyl, 2-piperazinyl), morpholino, thiomorpholine generation etc. etc. for example for example.
This heterocyclic radical on commutable position, can have be selected from halogen atom for example, hydroxyl, nitro, cyano group, above-mentioned can substituted low alkyl group; Above-mentioned can substituted low-grade alkenyl; Above-mentioned can substituted low-grade alkynyl; Above-mentioned can substituted C 3-8Cycloalkyl; Above-mentioned can substituted C 6-14Aryl; Above-mentioned can substituted lower alkoxy; Above-mentioned can substituted lower alkylthio; Above-mentioned can substituted C 6-14Arylthio; Above-mentioned can substituted C 7-16Aromatic alkylthio; Above-mentioned can substituted low alkyl group sulfinyl; Above-mentioned can substituted C 6-14Aryl sulfonyl kia; Above-mentioned can substituted C 1-6Alkyl sulphonyl; Above-mentioned can substituted C 6-14Aryl sulfonyl; Above-mentioned can esterified carboxyl; Carbamoyl; Thiocarbamoyl; Single rudimentary (C 1-6) alkyl-carbamoyl; Two rudimentary (C 1-6) alkyl-carbamoyl; List or two rudimentary C 6-14Aryl-carbamoyl; Except carbon atom, also contain 1 to 5 substituent group that is selected from 1 in nitrogen-atoms, sulphur atom and the oxygen atom or 2 kind, 1 to 4 heteroatomic single or 5 to 7 yuan of heterocyclic amino group formoxyl (for example 2-pyridinylamino formoxyl, 3-pyridinylamino formoxyl, 4-pyridinylamino formoxyl, 2-thienyl carbamoyl, 3-thienyl carbamoyl etc.) of two etc.
As " can substituted carbamoyl " of substituent A group, can use be selected from above-mentioned can substituted low alkyl group; Above-mentioned can substituted low-grade alkenyl; Above-mentioned can substituted low-grade alkynyl; Above-mentioned can substituted C 3-8Cycloalkyl; Above-mentioned can substituted C 6-14Aryl; Above-mentioned can substituted heterocyclic radical; The carbamoyl that above-mentioned 1 or 2 substituent group in can substituted lower alkoxy etc. replaces specifically, can use for example carbamoyl, single C 1-6Alkyl-carbamoyl (for example methylamino formoxyl, ethylamino formoxyl etc.), two C 1-6Alkyl-carbamoyl (for example formyl-dimethylamino, diethylamino formoxyl, ethylmethylamino formoxyl), C 1-6Alkyl (C 1-6Alkoxyl)-carbamoyl (for example methyl (methoxyl group) carbamoyl, ethyl (ethyoxyl) carbamoyl); List or two C 6-14Aryl-carbamoyl (for example phenyl amino formoxyl, 1-naphthyl carbamoyl, 2-naphthyl carbamoyl etc.); Except carbon atom, also contain and be selected from 1 in nitrogen-atoms, sulphur atom and the oxygen atom or 2 kind, 1 to 4 heteroatomic single or 5 to 7 yuan of heterocyclic amino group formoxyl (for example 2-pyridinylamino formoxyl, 3-pyridinylamino formoxyl, 4-pyridinylamino formoxyl, 2-thienyl carbamoyl, 3-thienyl carbamoyl etc.) of two.In addition, as " can substituted carbamoyl ", can use 5 to 7 yuan of cyclic amino formoxyls (for example 1-pyrrolidinyl carbonyl, piperidino carbonyl, hexamethyleneimino carbonyl).
As " can substituted amino " of substituent A group, can use can be selected from above-mentioned can substituted low alkyl group, above-mentioned can substituted low-grade alkenyl, above-mentioned can substituted low-grade alkynyl, above-mentioned can substituted C 3-8Cycloalkyl, above-mentioned can substituted C 6-14The amino that aryl, above-mentioned 1 or 2 substituent group in can substituted lower alkoxy etc. replace.
Substituent group as ring P is preferably the substituent group with aromatic rings, specifically, can use and use formula R 1-E-(R 1Expression can have substituent fragrant cyclic group, E and represent key or base at interval) substituent group of expression etc.
As using R 1" the fragrant cyclic group " of expression " can have substituent fragrant cyclic group " can use aromatic cyclic hydrocarbon group and aromatic heterocycle.
As aromatic cyclic hydrocarbon group, can use the C of phenyl, naphthyl etc. 6-14Aryl more preferably uses phenyl.
As aromatic heterocycle, for example can enumerate except carbon atom, also to contain and be selected from 1 in nitrogen-atoms, sulphur atom and the oxygen atom or 2 kind, 1 to 4 heteroatomic 5 to 14 yuan (monocycle, 2 ring or 3 ring types) aromatic heterocycles, be preferably from (i) 5 to 14 yuan (being preferably 5 to 10 yuan) aromatic heterocycle or (ii) 7 to 10 yuan of aromatic series hybridization connection ring remove arbitrarily the base etc. of 1 valency that 1 hydrogen atom forms, wherein preferably use the monocyclic aromatic heterocycle.Specifically, for example can use thienyl (2-thienyl for example, the 3-thienyl), furyl (2-furyl for example, the 3-furyl), pyridine radicals (2-pyridine radicals for example, the 3-pyridine radicals, the 4-pyridine radicals), thiazolyl (2-thiazolyl for example, the 4-thiazolyl, the 5-thiazolyl) oxazolyl (2-oxazolyl for example, the 4-oxazolyl), quinolyl (2-quinolyl for example, the 3-quinolyl, the 4-quinolyl, the 5-quinolyl, the 8-quinolyl), isoquinolyl (1-isoquinolyl for example, the 3-isoquinolyl, the 4-isoquinolyl, the 5-isoquinolyl), pyrazinyl, pyrimidine radicals (2-pyrimidine radicals for example, the 4-pyrimidine radicals), pyrrole radicals (1-pyrrole radicals for example, the 2-pyrrole radicals, the 3-pyrrole radicals), imidazole radicals (1-imidazole radicals for example, the 2-imidazole radicals, the 4-imidazole radicals), pyrazolyl (1-pyrazolyl for example, the 3-pyrazolyl, the 4-pyrazolyl), pyridazinyl (3-pyridazinyl for example, the 4-pyridazinyl), isothiazolyl (for example 3-isothiazolyl) isoxazolyl (for example 3-isoxazolyl), indyl (1-indyl for example, the 2-indyl, the 3-indyl), the 2-[4-morpholinodithio base, benzo [b] thienyl (2-benzo [b] thienyl for example, 3-benzo [b] thienyl), benzo [b] furyl (2-benzo [b] furyl for example, 3-benzo [b] furyl) etc.
As using R 1" substituent group " of " the fragrant cyclic group " of expression can be used the substituent group that is selected from the above-mentioned substituent A group.Substituent group quantity for example is 1 to 3.
As R 1, be preferably (i) can have the halogen atom of being selected from, nitro, carboxyl, illustrative in above-mentioned substituent A group can substituted C 1-6[being preferably can be by halogenated C for alkyl 1-6Alkyl, hydroxyl-C 1-6Alkyl, carboxyl-C 1-6Alkyl-carbonylamino-C 1-6Alkyl], illustrative in above-mentioned substituent A group can substituted C 1-6[being preferably can be by halogenated C for alkoxyl 1-6Alkoxyl], C 6-14Aryl, C 6-14Aryloxy group and C 7-16Aralkoxy, formoxyl, cyano group, hydroxyl, C 1-6Alkylthio group, C 1-6Alkoxyl-carbonyl, carbamoyl, single C 1-6Alkyl-carbamoyl, two C 1-6Alkyl-carbamoyl and C 3-8Substituent phenyl in the cycloalkyl (be preferably can have the halogen atom of being selected from, can be by halogenated C 1-6Alkyl, can be by halogenated C 1-6Alkoxyl, C 6-14Aryl, C 6-14Aryloxy group and C 7-16Substituent phenyl in the aralkoxy) or (ii) can have that be selected from can be by halogenated C 1-6Alkyl, C 6-14Aryl and C 6-14Aryl-C 2-6Substituent in the alkenyl also contains 1 to 4 heteroatomic 5 to 14 yuan of aromatic heterocycle in nitrogen-atoms, oxygen atom and the sulphur atom (thiazolyl (for example 2-thiazolyl, 4-thiazolyl, 5-thiazolyl), oxazolyl (for example 2-oxazolyl, 4-oxazolyl) etc.) for example except carbon atom.
As the interval base of representing with E, be can have substituent alkylidene maybe can have substituent alkylene group, can use in alkylidene or the alkylene group-C-can with-O-,-N-or-base that S-replaces.In alkylidene or the alkylene group-C-is replaced in-O-,-N-or-position on the S-, be that the end or any position in the chain of alkylidene or alkylene group can.
" alkylidene " as the interval base of representing with E " can have substituent alkylidene " can use for example C 1-13Alkylidene (for example methylene, ethylidene, propylidene, butylidene etc.), wherein preferred C 1-6Alkylidene.
" alkylene group " as the interval base of representing with E " can have substituent alkylene group " can use for example C 2-13Alkylene group (for example ethenylidene, allylidene, different allylidene, 2-butylene-1-irene, 4-amylene-1-irene, 5-hexene-1-irene), wherein preferred C 2-6Alkylene group (for example ethenylidene, allylidene, different allylidene, 2-butylene-1-irene, 4-amylene-1-irene, 5-hexene-1-irene).
As the substituent group of " alkylidene " or " alkylene group ", preferred (for example methyl, ethyl, propyl group, isopropyl, butyl, isobutyl group, sec-butyl, the tert-butyl group, amyl group, isopentyl, neopentyl, hexyl), oxo base, the C of using 6-14Aryl (for example phenyl) etc., wherein preferred oxygen is for base.Substituent group quantity for example is 1 to 3.
Specifically, as E, be preferably (i) key or
(ii) use-(CH 2) m 1-W 1-(CH 2) m 2-(m 1And m 2Represent 0 to 3 integer, W respectively 1Expression-O-,-N (R 2)-,-S-,-CO-or-CO-N (R 3)-, R 2And R 3Represent hydrogen atom or C respectively 1-6Alkyl) Biao Shi interval base,
Wherein, be preferably
(i) key,
(ii) use-(CH 2) m 1-W 1The interval base of-(each mark represented meaning as hereinbefore) expression etc.,
(iii) use-W 1-(CH 2) m 2The interval base of-(each mark represented meaning as hereinbefore) expression etc.
As m 1, preferred 0 or 1.
As m 2, preferred 0 or 1.
As m 1And m 2Combination, preferred both be 0 situation and 1 be 0 another be 1 situation.
As using R 2And R 3The C of expression 1-6Alkyl can use methyl, ethyl, propyl group, isopropyl, butyl, isobutyl group, sec-butyl, the tert-butyl group, amyl group, isopentyl, neopentyl, hexyl.
Particularly as E, be preferably key ,-O-,-CH 2-O-,-CO-,-CONH-,-N (R 2)-CH 2-(R 2Expression hydrogen atom or C 1-6Alkyl, preferably represent methyl) ,-S-CH 2-or-CH=CH-, particularly key ,-O-or-CH 2-O-is suitable.
When ring P was phenyl ring, ring P preferably had substituent situation in a position to being incorporated into the X on the ring P.
Chemical compound (I '), (I), (II), (IIa), (IIb), (III) and (IV) in, X and Y represent base at interval respectively, basic at interval as this, same with the aforesaid interval base of representing with E, use " be can have substituent alkylidene maybe can have substituent alkylene group, in alkylidene or the alkylene group-C-can with-O-,-N-or-base that S-replaces ".Wherein be preferably " be to have substituent alkylidene, in the alkylidene-C-can with-O-,-N-or-base that S-replaces ".
In chemical compound (I-1), Xa represents the interval base beyond the alkylidene, basic at interval as this, use " be to have substituent alkylidene; in the alkylidene-C-can with-O-,-N-or-base that S-replaces " or " be to have substituent alkylene group, in the alkylene group-C-can with-O-,-N-or-base that S-replaces ".Wherein, preferred " be to have substituent alkylidene, in the alkylidene-C-can with-O-,-N-or-base that S-replaces ".Specifically, among the above-mentioned interval base of representing with E, can use alkylidene base in addition.
As the interval base of representing with X or Xa, preferred
(i)-X 1-W 2-X 2-(X 1And X 2Expression can have substituent C respectively 1-6Alkylidene, W 2Expression-O-,-N (R 4)-,-CO-N (R 5)-or-S-, R 4And R 5Represent hydrogen atom or C respectively 1-6Alkyl) or
(ii)-W 3-X 6-W 4-(X 3Expression can have substituent C 1-6Alkylidene, W 3And W 4Respectively expression-O-,-N (R 4)-,-CO-N (R 5)-or-S-, R 4And R 5Represent hydrogen atom or C respectively 1-6Alkyl).
As using X 1, X 2And X 6That represents " can have substituent C 1-6Alkylidene " " C 1-6Alkylidene ", can use methylene, ethylidene, propylidene, butylidene, pentylidene, hexylidene, the C of wherein preferred methylene, ethylidene, propylidene, butylidene 1-4Alkylidene.
As this " C 1-6Alkylidene " substituent group, can preferably use C 1-6Alkyl (for example methyl, ethyl, propyl group, isopropyl, butyl, isobutyl group, sec-butyl, the tert-butyl group, amyl group, isopentyl, neopentyl, hexyl), C 6-14Aryl (for example phenyl) etc.Substituent group quantity is for example 1 to 3.
As using R 4And R 5The C of expression 1-6Alkyl can use methyl, ethyl, propyl group, isopropyl, butyl, isobutyl group, sec-butyl, the tert-butyl group, amyl group, isopentyl, neopentyl, hexyl.
As W 2, preferred-O-etc.
As W 3And W 4, preferred-S-etc.
Wherein, as the interval base of representing with X or Xa, preferred-X 1-O-X 1-(X 1And X 2Represent that respectively key maybe can have substituent C 1-6Alkylidene), particularly-X 1-O-(X 1The expression key maybe can have substituent C 1-6Alkylidene) is fit to.
As X 1, preferred key or have the C of being selected from 1-6Alkyl and C 6-14Substituent C in the aryl 1-6Alkylidene (C particularly 1-4Alkylidene).
As X 1And X 2Combination, preferably both be key situation ,-individual be the situation of key.
More particularly, as the interval base of representing with X or Xa, preferred
(i) key,
(ii)-X 1-O-(X 1The expression key maybe can have substituent C 1-6Alkylidene),
(iii)-N (R 4)-X 3-O-(X 3Expression can have substituent C 1-6Alkylidene, R 4Expression hydrogen atom or C 1-6Alkyl),
(iv)-S-X 3-O-(X 3Expression can have substituent C 1-6Alkylidene),
(v)-N (R 4)-X 3-(X 3Expression can have substituent C 1-6Alkylidene, R 4Expression hydrogen atom or C 1-6Alkyl),
(vi)-CO-N (R 5)-(R 5Expression hydrogen atom or C 1-6Alkyl),
(vii)-X 3-S-(X 3Expression can have substituent C 1-6Alkylidene) or
(viii)-S-X 6-S-(X 6Expression can have substituent C 1-6Alkylidene).
As Xa, especially preferably-O-.
As Y, preferred-W 5-Y 1-(Y 1Expression can have substituent C 1-6Alkylidene, W 5The expression key ,-O-,-N (R 6)-,-CO-N (R 7)-or-S-, R 6And R 7Represent hydrogen atom or C respectively 1-6Alkyl) etc.
As using Y 1That represents " can have substituent C 1-6Alkylidene " " C 1-6Alkylidene ", can use methylene, ethylidene, propylidene, butylidene, pentylidene, hexylidene, the C of wherein preferred methylene, ethylidene, propylidene, butylidene 1-4Alkylidene.
As using R 6And R 7The C of expression 1-6Alkyl can use methyl, ethyl, propyl group, isopropyl, butyl, isobutyl group, sec-butyl, the tert-butyl group, amyl group, isopentyl, neopentyl, hexyl.
As W 5, preferred key or-O-, preferred especially key.
Particularly as Y, preferred (i) can have substituent C 1-6Alkylidene or (ii)-Y 1-(Y 1Expression can have substituent C 1-6Alkylidene), wherein, preferably can have substituent C 1-6Alkylidene (for example methylene, ethylidene, propylidene), it is suitable especially to have a substituent ethylidene.In addition, preferably use Y and Y 1The C of expression 1-6Alkylidene is not have the situation that replaces.
At chemical compound (I), (II), (IIa), (IIb) with (IV) ,-Y-COOH can be at ring Q, ring Q 1Or the optional position combination on the ring C, but ring Q, ring Q 1Or ring C is when being phenyl ring (phenyl), and these encircle with respect to encircling bonded X with these, preferably in the para-position combination.
At chemical compound (I-1), (I-2), (I-4), (Ia), (Ib), (IVa), (IVb), (C) with (D), ring R represents to have substituent phenylene.As substituent group with phenylene of representing with ring R, can use the substituent group that is selected from the above-mentioned substituent A group, wherein can preferably use halogen atom, hydroxyl, C 1-6Alkyl, C 1-6Alkoxyl etc.This substituent group quantity for example is 1 to 3, preferably 1 to 2.
At chemical compound (I-1), (I-2), (I-3) with (I-4),, can use the substituent group that is selected from the above-mentioned substituent A group as the substituent group of representing with Ra.As this substituent group, be preferably halogen atom (for example fluorine, chlorine, bromine, iodine), C 1-6Alkyl (for example methyl, ethyl, propyl group), C 1-6Alkoxyl (for example methoxyl group, ethyoxyl, propoxyl group) etc.
In chemical compound (Ib), ring S represents to have substituent phenyl ring.As substituent group with phenyl ring of representing with ring S, can use the substituent group that is selected from the above-mentioned substituent A group, wherein preferably use C 1-6Alkyl etc.Substituent group quantity for example is 1 to 3.
In chemical compound (Ib), Z represents the chain that formed by 4 keys.As the chain of representing with Z, can use
(1) by being selected from-C (R 8) (R 8 ')-,-O-,-CO-,-N (R 8 ")-(R 8, R 8 'And R 8 "Represent hydrogen atom or C respectively 1-6Alkyl) and-chain that 4 bases among the S-form or
(2) by
Be selected from-C (R 8) (R 8 ')-,-O-,-CO-,-N (R 8 ")-(R 8, R 8 'And R 8 "Represent hydrogen atom or C respectively 1-6Alkyl) and-2 chains that base forms among the S-, specifically, can use
(1)-(CH 2) 4-、
(2)-O-(CH 2) 3-、
(3)
Or
(4)
Deng.
As using R 8, R 8 'And R 8 "The C of expression 1-6Alkyl can use as above-mentioned R 6Illustrated material.
At chemical compound (I-1), (IIa), (IIb), (C) with (D), ring A represents to have substituent phenyl ring.As having the substituent group of representing phenyl ring with ring A, use the substituent group that is selected from the above-mentioned substituent A group.Substituent quantity for example is 1 to 3.
At chemical compound (II) with (III), ring P 1And the ring P in the chemical compound (IIa) 2Expression can have substituent ring.
As using ring P 1With ring P 2The ring of expression can use carbocyclic ring or heterocycle.
As carbocyclic ring, can use the aromatic hydrocarbon ring of carbon number 6 to 14 of the loop chain alkane, (2) phenyl ring, naphthalene nucleus etc. of the carbon number 5 to 7 of (1) Pentamethylene., cyclohexane extraction etc., wherein, the carbon number that preferably uses cyclohexane extraction etc. is 5 to 7 loop chain alkane
As this heterocycle, can use for example except carbon atom, also to contain to be selected from 1 in nitrogen-atoms, sulphur atom and the oxygen atom or 2 kind, 1 to 4 heteroatomic 5 to 14 yuan (monocycle, 2 ring or 3 ring types) heterocycles, can use (i) 5 to 14 yuan, be preferably 5 to 10 yuan, more preferably 5 to or 6 yuan heteroaromatic, (ii) 5 to 10 yuan of non-aromatic heterocycles or (iii) 7 to 10 yuan of hybridization connection rings.
As above-mentioned " heteroaromatics of 5 to 14 yuan (being preferably 5 to 10 yuan) ", can use for example thiophene, furan oxazole, benzo [b] thiophene, benzo [b] furan, benzimidazole benzoxazole, benzothiazole, benzisothiazole, naphtho-[2,3-b] thiophene, the pyrroles, imidazoles, pyrazoles, pyridine, pyrazine, pyrimidine, pyridazine, indole, iso-indoles, the 1H-indazole, purine, the 4H-quinolizine, isoquinolin, quinoline, phthalazines, naphthyridines, quinoxaline, quinazoline, cinnolines, carbazole, B-carboline, phenanthridines, acridine, azophenlyene, thiazole, isothiazole, phenothiazine isoxazole, furazan phenoxazine oxadiazole, the heteroaromatic of thiadiazoles etc., or these rings (being preferably monocycle) and 1 ring that forms to the aromatic rings of a plurality of (being preferably 1 or 2) (for example phenyl ring etc.) condensation.
As above-mentioned " 5 to 10 yuan of non-aromatic heterocycles ", can enumerate for example pyrrolidine, imidazoline, pyrazolidine, pyrazoline, piperidines, piperazine, morpholine, thiomorpholine, Er oxazole, oxadiazole quinoline, Thiadiazoline, triazoline, dithiazole etc.
As above-mentioned " 7 to 10 yuan of hybridization connection rings ", can enumerate for example quinuclidine, 7-azabicyclo [2.2.1] heptane etc.
As ring P 1With ring P 2, be preferably carbocyclic ring, more preferably the carbon number of cyclohexane extraction etc. is 5 to 7 loop chain alkane.
As having with ring P 1With ring P 2The substituent group of the ring of expression can be used the substituent group that is selected from the above-mentioned substituent A group.Substituent group quantity for example is 1 to 3.
At chemical compound (II) with (IIa), ring Q 1Expression can also have substituent aromatic rings except the-Y-COOH.
As using ring Q 1The aromatic rings of expression can use and the identical aromatic rings of representing with above-mentioned ring Q of aromatic rings, wherein preferred phenyl ring.
As using ring Q 1The substituent group of the ring of expression except having the-Y-COOH can be used the substituent group that is selected from the above-mentioned substituent A group.Substituent group quantity for example is 1 to 3.
In chemical compound (IIb), ring B represents to have substituent 5 to 7 yuan ring.
As with 5 to 7 yuan of rings representing of ring B, can use and except carbon atom, can also contain 1 to 3 heteroatomic ring of 5 to 7 yuan being selected from nitrogen-atoms, sulphur atom and the oxygen atom etc.Wherein preferred 5 to 7 yuan carbocyclic ring.
Particularly at chemical compound (IIa) with (IIb), as
Figure A20038010826000401
Or
Figure A20038010826000402
, be preferably
Or
Figure A20038010826000404
More preferably
Figure A20038010826000405
Or
Figure A20038010826000406
Be preferably especially
Figure A20038010826000407
Or
As 5 to 7 yuan of substituent groups that ring can have representing with ring B, can use the substituent group that is selected from the above-mentioned substituent A group.Substituent group quantity for example is 1 to 3.
At chemical compound (IV) with (IVa), ring P 3Expression has the substituent aromatic rings that contains phenyl ring.
As using ring P 3The aromatic rings of expression can use and the same aromatic rings of representing with ring P of aromatic rings, wherein preferred phenyl ring.
At chemical compound (I-2) with (IVb), ring S 1Expression has the substituent phenyl ring that contains phenyl ring.
Just encircle S 1, except the substituent group that contains phenyl ring, can also have substituent group again.As this substituent group, can use the substituent group that is selected from the above-mentioned substituent A group, wherein being preferably selected from can substituted C 1-6Alkyl, can substituted C 1-6Alkoxyl, halogen atom (for example fluorine, chlorine, bromine, iodine), C 7-16Substituent group in the aralkoxy (for example benzyloxy), more preferably C 1-6Alkyl.Substituent group quantity for example is 1 to 3.Here, as can substituted C 1-6Alkyl and can substituted C 1-6Alkoxyl is preferably C respectively 1-6Alkyl (for example methyl) and C 1-6Alkoxyl (for example methoxyl group).
As having with above-mentioned ring P 3The aromatic rings of expression and with encircling S 1" substituent group that contains phenyl ring " of the phenyl ring of expression can be used and for example use formula R 11-E 2-(R 11Expression can have substituent phenyl, indanyl or naphthyl, E respectively 2Expression key or base at interval) substituent group etc. of expression.
As using R 11" phenyl ", " substituent group " of " indanyl " and " naphthyl " of expression can be used the substituent group that is selected from the above-mentioned substituent A group.Substituent group quantity for example is 1 to 3.
As R 11, preference as have respectively the halogen atom of being selected from (for example fluorine, chlorine), nitro, carboxyl, illustrative in above-mentioned substituent A group can substituted C 1-6Alkyl [preferably can be by halogenated C 1-6Alkyl (for example methyl, ethyl, propyl group, isopropyl, butyl, isobutyl group, trifluoromethyl), hydroxyl-C 1-6Alkyl (for example methylol, ethoxy), carboxyl-C 1-6Alkyl-carbonylamino-C 1-6Alkyl (for example carboxy ethyl carbonylamino methyl)], illustrative in above-mentioned substituent A group can substituted C 1-6Alkoxyl [preferably can be by halogenated C 1-6Alkoxyl (for example methoxyl group, ethyoxyl, isopropoxy, trifluoromethoxy)], C 6-14Aryl (for example phenyl), C 6-14Aryloxy group (for example phenoxy group), C 7-16Aralkoxy (benzyloxy), formoxyl, cyano group, hydroxyl, C 1-6Alkylthio group (for example methyl mercapto), C 1-6Alkoxyl-carbonyl (for example methoxycarbonyl, ethoxy carbonyl), carbamoyl, single C 1-6Alkyl-carbamoyl (for example methylamino formoxyl, ethylamino formoxyl), two C 1-6Alkyl-carbamoyl (for example formyl-dimethylamino, diethylamino formoxyl), C 3-81 to 3 substituent phenyl, indanyl or naphthyl in the cycloalkyl (for example cyclohexyl) (preferred phenyl or indanyl) etc., wherein preferably have the halogen atom of being selected from, nitro, carboxyl, can be by halogenated C 1-6Alkyl, hydroxyl-C 1-6Alkyl, carboxyl-C 1-6Alkyl-carbonylamino-C 1-6Alkyl, can be by halogenated C 1-6Alkoxyl, C 6-14Aryl, C 6-14Aryloxy group and C 7-16Substituent phenyl in the aralkoxy especially preferably has the halogen atom of being selected from and can be by halogenated C 1-6In the alkyl 1 is to 3 substituent phenyl.
As using E 2The interval base of expression can be enumerated above-mentioned as the illustrative material of E.Wherein, preferably use
(i) key or
(ii)-(CH 2) m 1-W 1-(CH 2) m 2-(m 1And m 2Represent 0 to 3 integer respectively, W 1Expression-O-,-N (R 2)-,-S-,-CO-or-CO-N (R 3)-, R 2And R 3Represent hydrogen atom or C respectively 1-6Alkyl) Biao Shi interval base,
Be more preferably
(i) key,
(ii)-(CH 2) m 1-W 1The interval base of-(each mark represent meaning as hereinbefore) expression,
(iii)-W 1-(CH 2) m 2The interval base of-(each mark represent meaning as hereinbefore) expression etc.
In the middle of these, preferred key ,-O-,-CH 2-O-,-CO-,-CONH-,-N (CH 3) CH 2-,-S-CH 2-or-C=C-.
And, as using E 2The interval base of expression can be enumerated-SO 2-CH 2-CH 2-N (R 2)-CH 2-,-O-CH (CH 3)-CH 2-N (R 2)-CH 2-,-CH (Ph)-CH 2-N (R 2)-CH 2-,-CH (Pyr)-CH 2-N (R 2)-CH 2-,-CH (CH 2-Pyr)-N (R 2)-CH 2-,-CH 2-N (Ph)-CH 2-,-CH 2-N (CH 2-Ph)-CH 2-,-N (CH 2-CH 2-CN)-CH 2-,-N (CH 2-CH 2-Imd)-CH 2-(R 2Expression hydrogen atom or C 1-6Alkyl, Ph represents phenyl, Pyr represents that pyrrolidinyl, Imd represent imidazopyridyl).
As using E 2The interval base of expression, preferred key ,-O-,-CH 2-O-,-CO-,-CONH-,-N (R 2) CH 2-,-S-CH 2-,-C=C-,-(CH 2) 2-,-(CH 2) 2O-,-(CH 2) 3O-,-C (=CH 2)-,-N (R 2)-,-CH 2-N (R 2)-,-CH 2-N (R 2)-CH 2-,-SO 2-CH 2-CH 2-N (R 2)-CH 2-,-O-CH (CH 3)-CH 2-N (R 2)-CH 2-,-CH (Ph)-CH 2-N (R 2)-CH 2-,-CH (Pyr)-CH 2-N (R 2)-CH 2-,-CH (CH 2-Pyr)-N (R 2)-CH 2-,-CH 2-N (Ph)-CH 2-,-CH 2-N (CH 2-Ph)-CH 2-,-N (CH 2-CH 2-CN)-CH 2-,-N (CH 2-CH 2-Imd)-CH 2-(R 2Expression hydrogen atom or C 1-6Alkyl, Ph represents phenyl, Pyr represents pyrrolidinyl, Imd represents imidazopyridyl) etc., preferred especially key ,-O-or-CH 2-O-.
In chemical compound (I-2), ring S 1Has the formula of using R 11-E 2During the substituent group of-(mark represent meaning as hereinbefore) expression, R 11Can with E 2And ring S 1Form ring together,, for example can use as such ring
Deng.
In chemical compound (IIb), ring C represents can also have substituent phenyl ring except the-Y-COOH base.
As with the substituent group of the phenyl ring represented of ring C, can use the substituent group that is selected from the above-mentioned substituent A group except having the-Y-COOH.Substituent group quantity for example is 1 to 3.
In chemical compound (A), A 1Expression substituent group (but except hydrogen atom and chlorine atom).
As using A 1The substituent group (except hydrogen atom and chlorine atom) of expression can use the substituent group that is selected from the above-mentioned substituent A group (but except chlorine atom, C 1-3Alkylenedioxy group), wherein preferred bromine atoms.
Ring D represents except A 1The phenyl ring that can also have substituent group (but except nitro and hydroxyl) in addition.
As with the phenyl ring represented of ring D except A 1The substituent group that can also have (but except nitro and hydroxyl) can be used the substituent group (but except nitro and hydroxyl) that is selected from the above-mentioned substituent A group in addition.Substituent group quantity for example is 1 to 3
At chemical compound (I-3), (A) with (B), ring E represents to have substituent phenylene, can use with encircling " can have substituent phenylene " same phenylene that R represents.But, on the position that usefulness-H represents, do not have substituent group.
In chemical compound (B), ring F represents to have substituent ring, can use and use ring P 1" can have substituent ring " same ring of expression.
In chemical compound (B), ring G represents to have substituent phenyl ring, can use and " can have substituent phenyl ring " same phenyl ring of representing with ring A.
In addition, partial structural formula:
Figure A20038010826000431
Not the naphthyl that do not have to replace, do not have the 1H-indazolyl that replaces and can have substituent quinolyl.
In chemical compound (C), ring H represents to have substituent five-membered ring.
Five-membered ring as representing with ring H can use five yuan carbocyclic ring or heterocycle.
As five yuan carbocyclic ring, can use Pentamethylene. etc.
As five yuan heterocycle, can use for example except carbon atom, also to contain to be selected from 1 in nitrogen-atoms, sulphur atom and the oxygen atom or 2 kind, 1 to 4 heteroatomic five yuan heterocycle etc.Specifically, can enumerate thiophene, dihydro-thiophene, furan, dihydrofuran, thiazole, isothiazole, oxazole, isoxazole, pyrroles, pyrrolin, imidazoles, imidazoline, pyrazoles, pyrrolidine, imidazoline, pyrazolidine, pyrazoline, oxadiazole, thiadiazoles etc.
As ring H, preferred thiophene, pyrroles etc.
As the substituent group that the five-membered ring of representing with ring H can have, can use the substituent group that is selected from the above-mentioned substituent A group.Substituent group quantity for example is 1 to 3.
As partial structural formula
Figure A20038010826000432
, can have the halogen atom of being selected from (for example chlorine atom) and can be respectively by halogenated C 1-6The substituent group of alkyl (for example methyl, trifluoromethyl).
Or Deng.
In chemical compound (D), J represents-O-,-S-,-CH 2-or-NR 12-(R 12Expression hydrogen atom or C 1-6Alkyl).
As using R 12The C of expression 1-6Alkyl can use methyl, ethyl, propyl group, isopropyl, butyl, isobutyl group, sec-butyl, the tert-butyl group, amyl group, isopentyl, neopentyl, hexyl.
K represents key or C 1-3Alkylidene.
As the C that represents with K 1-3Alkylidene can use methylene, ethylidene, propylidene.
As K, preferred key or methylene.
Figure A20038010826000443
Expression singly-bound or two key.
As the substituent group that ring I can have, can use the substituent group that is selected from the above-mentioned substituent A group.Substituent group quantity for example is 1 to 3.
As partial structural formula
, be preferably
Figure A20038010826000445
Or
Deng.As the substituent group of ring A of this moment, be preferably (i) halogen atom, (ii) C 1-6Alkyl (for example methyl, ethyl, propyl group), (iii) C 1-6Alkoxyl (for example methoxyl group, ethyoxyl), (iv) can have halogen atom of being selected from (for example fluorine atom, chlorine atom, bromine atoms) and C 1-6Substituent C in the alkyl 6-14Aryl (for example phenyl, naphthyl), (v) C 6-14Aryloxy group (for example phenoxy group) or (vi) C 7-15Aralkoxy (for example naphthoxy), the substituent group as ring R is preferably halogen atom (for example fluorine atom, chlorine atom, bromine atoms).
In chemical compound (IIb), the interval base of representing with X be can have substituent methylene ,-O-or-S-; The interval base of representing with Y is to have substituent C 1-6Alkylidene ,-N (R 6)-Y 1-(R 6Expression hydrogen atom or C 1-6Alkyl, Y 1Expression can have substituent C 1-6Alkylidene) ,-O-Y 1-(Y 1Expression can have substituent C 1-6Alkylidene) or-S-Y 1-(Y 1Expression can have substituent C 1-6Alkylidene); Ring B is 5 to 7 yuan of carbocyclic rings preferably.
In chemical compound (IVa), ring P 3Preferably has the formula of using R 11-E 2-(R 11Expression can have substituent phenyl, indanyl or naphthyl, E respectively 2Expression key or basic at interval) situation of the ring of " the substituent group " of expression with phenyl ring.As E 2, preferred key ,-O-or-CH 2-O-.As R 11, be preferably and have the halogen atom of being selected from and can be by halogenated C 1-6Substituent phenyl in the alkyl.
As X 1, be preferably and have C 1-6Alkyl and C 6-14The substituent C of aryl etc. 1-6Alkylidene (particularly methylene).
As W 5, preferred key.
As Y 1, preferably can have substituent C 1-6Alkylidene (particularly ethylidene).
As ring R, preferably can have C 1-6The phenylene of alkoxyl.
In chemical compound (IVb), ring S 1Preferably has the formula of using R 11-E 2-(R 11Expression has substituent phenyl, indanyl or naphthyl, E respectively 2Expression key or basic at interval) phenyl ring of " the substituent group " of expression with phenyl ring.As E 2, preferred key ,-O-,-CH 2-O-,-CO-,-CONH-,-N (R 2)-CH 2-(R 2Expression hydrogen atom or C 1-6Alkyl) ,-S-CH 2-or-CH=CH-, more preferably key ,-O-or-CH 2-O-.As R 11, preferably have respectively the halogen atom of being selected from, nitro, carboxyl, can be by halogenated C 1-6Alkyl, hydroxyl-C 1-6Alkyl, carboxyl-C 1-6Alkyl-carbonylamino-C 1-6Alkyl, can be by halogenated C 1-6Alkoxyl, C 6-14Aryl, C 6-14Aryloxy group and C 7-16Substituent phenyl, indanyl or naphthyl in the alkoxyl (being preferably phenyl or indanyl) etc., wherein preferably have the halogen atom of being selected from, can be by halogenated C 1-6Alkyl, can be by halogenated C 1-6Alkoxyl, C 6-14Aryl, C 6-14Aryloxy group and C 7-16Substituent phenyl in the aralkoxy especially preferably has the halogen atom of being selected from and can be by halogenated C 1-6Substituent phenyl in the alkyl.
In chemical compound (A), A 1Bromine atoms preferably.
In chemical compound (C), partial structural formula
Figure A20038010826000451
Preferably can have the halogen atom of being selected from (for example chlorine atom) and can be respectively by halogenated C 1-6Substituent in the alkyl (for example methyl, trifluoromethyl)
Or
Figure A20038010826000453
Situation.
In chemical compound (D), partial structural formula
Preferably
Figure A20038010826000462
Or
Figure A20038010826000463
, the substituent group of ring A is (i) halogen atom, (ii) C preferably 1-6Alkyl, (iii) C 1-6Alkoxyl, (iv) can have the halogen atom of being selected from and C 1-6C in the alkyl 6-14Aryl, (v) C 6-14Aryloxy group or (vi) C 7-15Aralkoxy, the substituent group of ring R is halogen atom preferably.
In chemical compound (I-1), it is 0 to 4 carbochain that p and q represent to have substituent carbon number respectively.
Here, be 0 to 4 carbochain as carbon number, can use key or C 1-4Alkylidene (for example methylene, ethylidene etc.) etc., wherein preferred C 1-4Alkylidene (for example methylene, ethylidene etc.), especially preferred methylene, ethylidene, preferred especially methylene.
As partial structural formula
, be preferably
Figure A20038010826000465
Or
Figure A20038010826000466
Deng.
As having the substituent group that carbon number is 0 to 4 carbochain, can use the substituent group that is selected from the above-mentioned substituent A group.Substituent group quantity for example is 1 to 3.
As the substituent group that ring A can have, preferred (1) halogen atom (for example fluorine atom, chlorine atom, bromine atoms), (2) C 1-6Alkyl (the C of methyl etc. for example 1-3Alkyl), (3) C 1-6Alkoxyl (the C of methoxyl group etc. for example 1-3Alkoxyl), (4) can use halogen atom (for example fluorine atom, chlorine atom), C 1-6Alkyl (the C of methyl etc. for example 1-3Alkyl), C 1-6Alkoxyl (the C of methoxyl group etc. for example 1-3Alkoxyl) C of Qu Daiing 6-14Aryl (for example phenyl), (5) C 6-14Aryloxy group (for example phenoxy group) or (6) C 7-16Aralkoxy (for example benzyloxy, benzene ethyoxyl, benzene propoxyl group, benzene butoxy).Substituent group quantity for example is 1 to 3.
As the substituent group that ring R can have, preferred halogen atom (for example fluorine atom, chlorine atom) or C 1-6Alkyl (the C of methyl etc. for example 1-3But more preferably encircle the situation of R alkyl), for do not have replacing.
As Ra, preferred hydrogen atom.
As the interval base of representing with Xa, preferred oxygen atom.
In chemical compound (I-2),, preferably use formula R as substituent group with phenyl ring 11-E 2-(R 11Expression has substituent phenyl, indanyl or naphthyl, E respectively 2Expression key or basic at interval) substituent group of expression.
Ring S 1Can also have that be selected from can substituted C 1-6Alkyl, can substituted C 1-6Alkoxyl, halogen atom (for example fluorine, chlorine, bromine, iodine), C 7-16Substituent group in the aralkoxy (for example benzyloxy); Preferably can have C 1-6Alkyl.Here, as can substituted C 1-6Alkyl and can substituted C 1-6Alkoxyl, can use in above-mentioned substituent A group illustrative, preferred C respectively 1-6Alkyl (for example methyl) and C 1-6Alkoxyl (for example methoxyl group).
Ring S 1Also preferably there is not substituent phenyl ring.
As R 11, preferably can have substituent phenyl.
As R 11, preference as have respectively the halogen atom of being selected from (for example fluorine, chlorine), nitro, carboxyl, illustrative in above-mentioned substituent A group can substituted C 1-6Alkyl [preferably can be by halogenated C 1-6Alkyl (for example methyl, ethyl, propyl group, isopropyl, butyl, isobutyl group, trifluoromethyl), hydroxyl-C 1-6Alkyl (for example methylol, ethoxy), carboxyl-C 1-6Alkyl-carbonylamino-C 1-6Alkyl (for example carboxy ethyl carbonylamino methyl)], illustrative in above-mentioned substituent A group can substituted C 1-6Alkoxyl [preferably can be by halogenated C 1-6Alkoxyl (for example methoxyl group, ethyoxyl, isopropoxy, trifluoromethoxy)], C 6-14Aryl (for example phenyl), C 6-14Aryloxy group (for example phenoxy group), C 7-16Aralkoxy (for example benzyloxy), formoxyl, cyano group, hydroxyl, C 1-6Alkylthio group (for example methyl mercapto), C 1-6Alkoxyl-carbonyl (for example methoxycarbonyl, ethoxy carbonyl), carbamoyl, single C 1-6Alkyl-carbamoyl (for example methylamino formoxyl, ethylamino formoxyl), two C 1-6Alkyl-carbamoyl (for example formyl-dimethylamino, diethylamino formoxyl), C 3-81 to 3 substituent phenyl, indanyl or naphthyl in the cycloalkyl (for example cyclohexane extraction) (preferred phenyl or indanyl) etc., wherein preferably have the halogen atom of being selected from, nitro, carboxyl, can be by halogenated C 1-6Alkyl, hydroxyl-C 1-6Alkyl (for example methylol, ethoxy), carboxyl-C 1-6Alkyl-carbonylamino-C 1-6Alkyl (for example carboxy ethyl carbonylamino methyl), can be by halogenated C 1-6Alkoxyl, C 6-14Aryl, C 6-14Aryloxy group and C 7-16Substituent phenyl in the aralkoxy.
As E 2, preferred key ,-O-,-CH 2-O-,-CO-,-CONH-,-N (CH 3) CH 2-,-S-CH 2-,-C=C-,-(CH 2) 2-,-(CH 2) 2O-,-(CH 2) 3O-,-C (=CH 2)-,-N (R 2)-,-CH 2-N (R 2)-,-CH 2-N (R 2)-CH 2-,-SO 2-CH 2-CH 2-N (R 2)-CH 2-,-O-CH (CH 3)-CH 2-N (R 2)-CH 2-,-CH (Ph)-CH 2-N (R 2)-CH 2-,-CH (Pyr)-CH 2-N (R 2)-CH 2-,-CH (CH 2-Pyr)-N (R 2)-CH 2-,-CH 2-N (Ph)-CH 2-,-CH 2-N (CH 2-Ph)-CH 2-,-N (CH 2-CH 2-CN)-CH 2-,-N (CH 2-CH 2-Imd)-CH 2-(R 2Expression hydrogen atom or C 1-6Alkyl, Ph represents phenyl, Pyr represents pyrrolidinyl, Imd represents imidazopyridyl) etc.
E 2Especially preferably key ,-O-or-CH 2-O-.
Ring S 1Has the formula of using R 11-E 2During the substituent group of-(mark represent meaning as hereinbefore) expression, R 11Can with E 2And ring S 1The common ring that forms.
As R 11With E 2And ring S 1The common ring that forms is preferably
Figure A20038010826000481
Deng, but preferred R 11Not with E 2And ring S 1The common ring that forms.
As the substituent group that ring R can have, preferred C 1-6Alkyl (the C of methyl etc. for example 1-3Alkyl), halogen atom (for example fluorine, chlorine, bromine, iodine), C 1-6Alkoxyl (for example methoxyl group, ethyoxyl, propoxyl group), hydroxyl etc.
As Ra, preferred hydrogen atom, halogen atom (for example fluorine, chlorine, bromine, iodine), C 1-6Alkyl (for example methyl, ethyl, propyl group) or C 1-6Alkoxyl (for example methoxyl group, ethyoxyl, propoxyl group); More preferably halogen atom (preferred fluorine).
As the object lesson of chemical compound (I-2), can enumerate following chemical compound etc., that is:
Substituent group with phenyl ring is to use formula R 11-E 2-(R 11Expression can have substituent phenyl or indanyl, E respectively 2Expression key or basic at interval) substituent group of expression, ring S 1Can also be by C 1-6Alkyl replaces, R 11Can with E 2And ring S 1The common ring that forms;
And, R 11Be preferably have respectively the halogen atom of being selected from, nitro, carboxyl, can be by halogenated C 1-6Alkyl, hydroxyl-C 1-6Alkyl, carboxyl-C 1-6Alkyl-carbonylamino-C 1-6Alkyl, can be by halogenated C 1-6Alkoxyl, C 6-14Aryl, C 6-14Aryloxy group and C 7-16Substituent phenyl, indanyl or naphthyl in the aralkoxy (being preferably phenyl or indanyl),
E 2Be key ,-O-,-CH 2-O-,-CO-,-CONH-,-N (CH 3) CH 2-,-S-CH 2-or-C=C-,
Ring S 1Can use C 1-6Alkyl replaces,
R 11With E 2And ring S 1The common ring that forms is
Figure A20038010826000482
The substituent group that ring R can have is C 1-6Alkyl, Ra are hydrogen atoms.
In chemical compound (I-2), the substituent group that preferably has phenyl ring is to use formula R 11-E 2-(R 11Expression can have substituent phenyl, indanyl or naphthyl, E respectively 2Expression key or basic at interval) substituent group of expression, and preferably use E 2The interval base of expression is-(CH 2) m 1-W 1-(CH 2) m 2-(m 1And m 2Represent 0 to 3 integer respectively, W 1Expression-O-,-N (R 2)-,-S-,-CO-or-CO-N (R 3)-, R 2And R 3Represent hydrogen atom or C respectively 1-6Alkyl) situation.
Chemical compound (I-2) is preferably used formula
(in the formula, R 11aExpression has 1 to 2 substituent phenyl, and Ea represents key, oxygen atom or can substituted methylene, ring S 1aExpression can also have that be selected from can substituted C 1-6Alkyl, can substituted C 1-6Substituent phenyl ring in alkoxyl and the halogen atom, R 16And R 17Identical or different, expression hydrogen atom, halogen atom, C 1-6Alkyl or C 1-6Alkoxyl) Biao Shi chemical compound.
Here, as using R 11aSubstituent group in expression " having 1 to 2 substituent phenyl " can be used as above-mentioned R 11In the illustrative substituent group of substituent group.This substituent group preferably can substituted C 1-6Alkyl, can substituted C 1-6Alkoxyl, halogen atom etc.Here, as can substituted C 1-6Alkyl, can substituted C 1-6Alkoxyl, halogen atom can use illustrative substituent group in above-mentioned substituent A group respectively.
R 11aPreferably having 2, be selected from can substituted C 1-6Alkyl, can substituted C 1-6Substituent phenyl in alkoxyl, the halogen atom.
" can substituted methylene " as representing with Ea can enumerate as above-mentioned E 2Alkylidene among illustrative " can substituted alkylidene " is the material of methylene.Ea is key, oxygen atom or methylene further preferably, especially preferably key.
With ring S 1aThe phenyl ring of expression on the position that can replace, can also have that be selected from can substituted C 1-6Alkyl, can substituted C 1-6Substituent group in alkoxyl, the halogen atom.Here, as can substituted C 1-6Alkyl, can substituted C 1-6Alkoxyl and halogen atom can use illustrative substituent group in above-mentioned substituent A group respectively.Ring S 1aPreferably also there is not substituent phenyl ring.
R 16And R 17Identical or different, expression hydrogen atom, halogen atom (for example fluorine, chlorine, bromine, iodine), C 1-6Alkyl (for example methyl, ethyl, propyl group) or C 1-6Alkoxyl (for example methoxyl group, ethyoxyl, propoxyl group).Especially preferred R 16Be hydrogen atom and R 17It is the situation of fluorine atom.
In chemical compound (I-2A), preferably following situation, that is: R 11aBe to have 2 be selected from can substituted C 1-6Alkyl, can substituted C 1-6Substituent phenyl in alkoxyl and the halogen atom; Ea is key, oxygen atom or methylene; R 16And R 17Identical or different, expression hydrogen atom or halogen atom.At this moment, being more preferably Ea is key, R 16Be hydrogen atom and R 17It is the situation of fluorine atom.
In chemical compound (I-2A), be preferably partial structural formula
Be
Figure A20038010826000502
The situation of [mark in the formula is represented the meaning identical with following formula], and R more preferably 11aHaving 2, be selected from can substituted C 1-6Alkyl, can substituted C 1-6Substituent phenyl in alkoxyl and the halogen atom, Ea are key, ring S 1aIt is the situation that does not also have substituent phenyl ring.
In chemical compound (I-3), ring M represents to have substituent phenyl ring.As the substituent group that the phenyl ring of representing with ring M can have, can use the substituent group that is selected from the above-mentioned substituent A group.
Ring N represents to have substituent five-ring heterocycles.
As the five-ring heterocycles of representing with ring N, can use and for example except carbon atom, can also contain 1 to 3 the heteroatomic five yuan heterocycle that is selected from nitrogen-atoms, oxygen atom and the sulphur atom, specifically, can use thiophene, furan, thiazole, oxazole, pyrans, pyrroles, imidazoles, pyrazoles, isothiazole, isoxazole etc.
As the substituent group that the five-ring heterocycles of representing with ring N can have, can use the substituent group that is selected from the above-mentioned substituent A group.Substituent group quantity for example is 1 to 3.
The substituent group among the N as ring M or ring, preferred halogen atom, can substituted C 1-6Alkyl (for example can be by halogenated C 1-6Alkyl), can substituted C 1-6Alkoxyl (for example can be used C 1-6The C that alkoxyl replaces 1-6Alkoxyl), C 1-6Alkoxyl-carbonyl, can substituted C 7-16Aralkoxy (for example can be used C 1-6The C that alkyl replaces 7-16Aralkoxy) etc.
In chemical compound (I-3), partial structural formula
Figure A20038010826000503
Preferably, can have respectively the halogen atom of being selected from (for example chlorine atom), can substituted C 1-6Alkyl (for example can be by halogenated C 1-6Alkyl (for example methyl, trifluoromethyl)), can substituted C 1-6Alkoxyl (for example can be used C 1-6The C that alkoxyl replaces 1-6Alkoxyl (for example methoxymethoxy)), C 1-6Alkoxyl-carbonyl (for example tert-butoxycarbonyl) and can substituted C 7-16Aralkoxy (for example can be used C 1-6The C that alkyl replaces 7-16Aralkoxy (for example benzyloxy)) substituent in
Figure A20038010826000504
Or
Figure A20038010826000505
More preferably can have the halogen atom of being selected from (for example chlorine atom) and can substituted C respectively 1-6Alkyl (preferably can be by halogenated C 1-6Alkyl (for example methyl, trifluoromethyl)) substituent in
Figure A20038010826000511
Or
As ring E, the preferred phenylene that does not have replacement.
As Ra, preferred hydrogen atom.
In chemical compound (I-4), ring S 2Expression is except using formula R 13-E 1Can also have substituent phenyl ring beyond the substituent group of-(mark represent meaning as hereinbefore) expression.
As ring S 2The substituent group that can also have can be used the substituent group that is selected from the above-mentioned substituent A group, but preferably encircles S 2For the situation 2 that do not have to replace promptly, as ring S 2, be preferably phenyl ring.
R 13Expression can have substituent thiazolyl (preferred 2-thiazolyl).As the substituent group that this thiazolyl can have, can use the substituent group that is selected from the above-mentioned substituent A group, but preferred above-mentioned " can substituted C 6-14Aryl " and above-mentioned " can substituted C 1-6Alkyl ", preferred especially (1) can have the halogen atom of being selected from (for example fluorine, chlorine, bromine, iodine), can be by halogenated C 1-6Alkyl (for example methyl, trifluoromethyl), can be by halogenated C 1-6Alkoxyl (for example methoxyl group, ethyoxyl), C 3-81 to 3 substituent C in the cycloalkyl (for example cyclohexane extraction) etc. 6-14Aryl (for example phenyl) (this C 6-14Aryl can be partly by saturated, as partly by saturated C 6-14Aryl can be enumerated for example tetralyl etc.); (2) can be with the C that can esterified carboxyl (for example carboxyl) replaces 1-6Alkyl (the C of methyl, ethyl, propyl group, isopropyl etc. for example 1-3Alkyl).Preferably 1 to 2 of substituent group quantity.
In addition, the substituent group in this thiazolyl can form ring with a part of thiazolyl, as such ring, for example can enumerate can with the C of phenyl ring condensation 3-10Cycloolefin (for example cyclopropylene, cyclobutane, cyclopentenes, cyclohexene) etc.
As R 13, preferred (1) can have the halogen atom of being selected from (for example fluorine, chlorine, bromine, iodine), can be by halogenated C 1-6Alkyl (for example methyl, trifluoromethyl), can be by halogenated C 1-6Alkoxyl (for example methoxyl group, ethyoxyl), C 3-81 to 3 substituent C in the cycloalkyl (for example cyclohexane extraction) etc. 6-14Aryl (for example phenyl) (this C 6-14Aryl can be partly by saturated, as partly by saturated C 6-14Aryl can be enumerated for example tetrahydronaphthalene etc.); And (2) can have, and be selected from can be with the C that can esterified carboxyl (for example carboxyl) replaces 1-6Alkyl (the C of methyl, ethyl, propyl group, isopropyl etc. for example 1-3Alkyl) 1 in is to 2 substituent thiazolyls (preferably 2-thiazolyl); More preferably can have the C of being selected from 6-14Aryl (for example phenyl) and C 1-6Alkyl (the C of methyl etc. for example 1-3Alkyl) 1 in is to 2 substituent thiazolyls (preferred 2-thiazolyl).In addition, the substituent group in this thiazolyl can form ring with a part of thiazolyl, as such ring, for example can enumerate can with the C of phenyl ring condensation 3-10Cycloolefin (for example cyclopropylene, cyclobutane, cyclopentenes, cyclohexene) etc.
As E 1The interval base of expression can use and the above-mentioned interval base identical distance base of representing with E.
As E 1, for example be preferably
(i) key,
(ii) use-(CH 2) m 1-W 1-(CH 2) m 2-(m 1, m 2And W 1The expression meaning same as described above) expression the interval base,
Wherein be preferably
(i) key,
(ii) C 1-6Alkylidene,
(iii)-N (R 14)-(CH 2) m 2-(R 14Expression hydrogen atom or C 1-6Alkyl, m 2The integer of expression 0 to 3),
(iv)-S-(CH 2) m 2-(m 2The integer of expression 0 to 3),
Be preferably especially
(i)-N (R 14)-(CH 2) m 2-(R 14Expression hydrogen atom or C 1-6Alkyl, m 2The integer of expression 0 to 3),
(ii)-S-(CH 2) m 2-(m 2The integer of expression 0 to 3) etc.
R 14Expression hydrogen atom or C 1-6Alkyl wherein is preferably C 1-6Alkyl.
As using R 14The C of expression 1-6Alkyl can use methyl, ethyl, propyl group, isopropyl, butyl, isobutyl group, sec-butyl, the tert-butyl group, amyl group, isopentyl, neopentyl, hexyl, wherein the C of preferable methyl etc. 1-3Alkyl.
As m 2, be preferably 1 to 3 integer, be preferably 1 especially.
As E 1, be preferably-N (R 14)-(CH 2) m 2-or-S-(CH 2) m 2-(R 14Expression hydrogen atom or C 1-6Alkyl, m 2The integer of expression 0 to 3), wherein preferably-N (R 14)-(CH 2) m 2-.
As Ra, be preferably hydrogen atom, halogen atom (for example fluorine, chlorine, bromine, iodine), C 1-6Alkyl (for example methyl, ethyl, propyl group) or C 1-6Alkoxyl (for example methoxyl group, ethyoxyl, propoxyl group); More preferably hydrogen atom or halogen atom (preferred fluorine).
Chemical compound (I-4) is preferably used formula
Figure A20038010826000521
(in the formula, E 1aExpression-N (R 14)-(CH 2)-,-CH (R 22)-O-or-CH (R 22)-CH 2-(R 14And R 22Expression hydrogen atom or C 1-6Alkyl), R 18And R 19Identical or different, expression hydrogen atom, halogen atom, C 1-6Alkyl or C 1-6Alkoxyl, R 20And R 21Identical or different, the expression hydrogen atom, can substituted C 6-14Aryl or can substituted C 1-6Alkyl, perhaps R 20And R 21In conjunction with forming ring) chemical compound of expression.
As using R 22The C of expression 1-6Alkyl can be enumerated as above-mentioned R 14Illustrated.
R 18And R 19Identical or different, expression hydrogen atom, halogen atom (for example fluorine, chlorine, bromine, iodine), C 1-6Alkyl (for example methyl, ethyl, propyl group) or C 1-6Alkoxyl (for example methoxyl group, ethyoxyl, propoxyl group).Especially, R 18And R 19Identical or different, preferably represent hydrogen atom, halogen atom (preferred fluorine).
As using R 20Or R 21Expression " can substituted C 6-14Aryl " and " can substituted C 1-6Alkyl ", can use in above-mentioned substituent A group illustrated respectively.
Being somebody's turn to do " can substituted C 6-14Aryl ", preferably can have the halogen atom of being selected from (for example fluorine, chlorine, bromine, iodine), can be by halogenated C 1-6Alkyl (for example methyl, trifluoromethyl), can be by halogenated C 1-6Alkoxyl (for example methoxyl group, ethyoxyl), C 3-81 to 3 substituent C in the cycloalkyl (for example cyclohexyl) etc. 6-14Aryl (for example phenyl).In addition, this C 6-14Aryl can be partly by saturated, as this partly by saturated C 6-14Aryl can be enumerated tetralyl etc.
Being somebody's turn to do " can substituted C 1-6Alkyl ", preferably can be with the C that can esterified carboxyl (for example carboxyl) replaces 1-6Alkyl (for example methyl, carboxymethyl, ethyl, propyl group, isopropyl) etc.
As R 20Or R 21In conjunction with and the ring that forms, for example can enumerate can with the C of phenyl ring condensation 3-10Cycloolefin (for example cyclopropylene, cyclobutane, cyclopentenes, cyclohexene) etc.
E 1aPreferably-N (R 14)-CH 2-(R 14The meaning of expression is same as described above).And, R 18And R 19Identical or different, preferably hydrogen atom, halogen atom (preferably fluorine).
Following table is shown in the object lesson of operable preferred compound among the present invention.
(R)-and 4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid (embodiment 41);
4-[[3-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] phenyl] methoxyl group] benzenpropanoic acid (embodiment 136);
3-[4-[(2 ', 6 '-dimethyl diphenyl base-3-yl) methoxyl group]-the 2-fluorophenyl] propanoic acid (embodiment 205);
3-[4-[[4-[[4,5-dihydro-naphtho [1,2-d] [1,3] thiazol-2-yl (propyl group) amino] methyl] benzyl] the oxygen base] phenyl] propanoic acid (embodiment 223);
3-[4-[[4-(2, the 6-dimethyl benzyl) benzyl] the oxygen base] phenyl] propanoic acid (embodiment 253);
3-{4-[(4-{[isopropyl (4-phenyl-1,3-thiazoles-2-yl) amino] methyl) benzyl] the oxygen base] phenyl } propanoic acid (embodiment 259);
3-(4-((4-(((2-phenoxy propyl) amino) methyl) benzyl) oxygen base) phenyl) propanoic acid (embodiment 312);
3-(4-((4-((dibenzyl amino) methyl) benzyl) oxygen base) phenyl) propanoic acid (embodiment 330);
3-(4-((4-(((2-imidazo [1,5-a] pyridin-3-yl ethyl (phenyl) amino) methyl) benzyl) oxygen base) phenyl) propanoic acid (embodiment 334);
3-(2-(4-((3-phenoxy benzyl) oxygen base) phenyl) ethyl)-1,2,4-oxadiazole-5 (4H)-ketone (reference example 213).
As operable chemical compound among the present invention, also can use the spy open 2002-265457 number, spy open 2002-212171 number, spy open 2001-226350 number, spy open 2001-199971 number, spy open 2000-198772 number, spy open 2000-80086 number, spy open 2000-34266 number, spy open flat 09-323983 number, spy open flat 08-311065 number etc. in the chemical compound of record.
As the salt of operable chemical compound in the present invention, can enumerate slaine for example, ammonium salt, with the salt of organic base, with the salt of mineral acid, with organic acid salt, with the salt of alkalescence or acidic amino acid etc.As the preferred example of slaine, can enumerate for example alkali metal salt of sodium salt, potassium salt etc.; The alkali salt of calcium salt, magnesium salt, barium salt etc.; Ammonium salt etc.As with the preferred example of the salt of organic base, for example can enumerate and trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidines, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, hexanamine, N, the salt of N '-dibenzyl-ethylenediamin etc.As with the preferred example of the salt of mineral acid, for example can enumerate salt with hydrochloric acid, hydrobromic acid, nitric acid, sulphuric acid, phosphoric acid.As with the preferred example of organic acid salt, for example can enumerate salt with formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, p-methyl benzenesulfonic acid etc.As with the preferred example of the salt of basic amino acid, can enumerate the salt with arginine, lysine, ornithine etc., as with the preferred example of the salt of acidic amino acid, can enumerate salt with aspartic acid, glutamic acid etc.
Wherein, preferably at the salt that pharmaceutically can allow.For example, in chemical compound, have under the situation of acid functional groups, the inorganic salt of alkali metal salt (for example sodium salt, potassium salt etc.), alkali salt (for example calcium salt, magnesium salt, barium salt etc.) etc., ammonium salt etc., in addition, in chemical compound, have under the situation of basic functional group, preference as with the salt of mineral acids such as hydrochloric acid, hydrobromic acid, nitric acid, sulphuric acid, phosphoric acid or with organic acid salt such as acetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, methanesulfonic acid, p-methyl benzenesulfonic acid.
Chemical compound of the present invention (I '), (I), chemical compound (I-1), chemical compound (I-2), chemical compound (I-2A), chemical compound (I-3), chemical compound (I-4), chemical compound (I-4A), chemical compound (Ia), chemical compound (Ib), chemical compound (II), chemical compound (IIa), chemical compound (IIb), chemical compound (III), chemical compound (IV), chemical compound (IVa), chemical compound (IVb), chemical compound (A), chemical compound (B), chemical compound (C), chemical compound (D) or its salt (below, sometimes abbreviate the situation of chemical compound (I) as) prodrug, be meant the chemical compound that is changed to chemical compound of the present invention (I) under the physiological condition in vivo by the reaction of enzyme or gastric acid etc., promptly cause oxidation by enzyme, reduction, hydrolysis etc. and be changed to the chemical compound of The compounds of this invention, cause hydrolysis by gastric acid etc. and be changed to the chemical compound of The compounds of this invention (I).
Prodrug as The compounds of this invention (I), can enumerate: the amino of The compounds of this invention (I) carries out the chemical compound of acidylate, alkylation, phosphorylation (amino of chemical compound for example of the present invention (I) carries out that eicosane acidylate, alanylization, amyl group amino carbonylization, (5-methyl-2-oxo-1,3-dioxolanes-4-yl) methoxycarbonylization, tetrahydrofuran baseization, pyrrolidinyl methylate, the chemical compound of pivaloyl HM, tert-butylation etc.); The hydroxyl of chemical compound of the present invention (I) carries out the chemical compound (hydroxyl of chemical compound for example of the present invention (I) carries out chemical compound of acetyl groupization, palmitoylation, propionoization, pivaloylization, succinylated, fumarylization, alanylization, dimethylaminomethyl carbonylation etc.) of acidylate, alkylation, phosphorylation, boration; The carboxyl of chemical compound of the present invention (I) carries out esterification, (carboxyl of chemical compound for example of the present invention (I) carries out the ethyl esterification to amidated chemical compound, the phenyl esterification, the carboxymethyl esterification, the dimethylaminomethyl esterification, the esterification of pivaloyl hydroxymethyl, the esterification of ethyoxyl carbonyl oxygen base ethyl, the esterification of phthalone base, (5-methyl-2-oxo-1,3-dioxolanes-4-yl) methyl-esterified, the esterification of cyclohexyl oxygen base carbonyl ethyl, the chemical compound of methyl nitrosoureaization etc.) etc., wherein can preferably use the carboxyl methyl of chemical compound of the present invention (I), ethyl, the C of the tert-butyl group etc. 1-6Alkyl carries out the chemical compound of esterification.These chemical compounds can be made by chemical compound of the present invention (I) by known method own.
In addition, the prodrug of chemical compound of the present invention (I) also can be rolled up the material that be changed to chemical compound of the present invention (I) under such physiological condition of MOLECULE DESIGN from 163 pages to 198 pages of records in wide river bookstore nineteen ninety distribution " exploitations of pharmaceuticals " the 7th.
The manufacture method of compound or its salt of the present invention below is described.
About the manufacture method of chemical compound of the present invention (I-1), chemical compound (I-2), chemical compound (I-3) and chemical compound (I-4), in following narration.
In addition, chemical compound of the present invention (I-2A) and chemical compound (I-4A) can similarly be made with chemical compound (I-2) and chemical compound (I-4) respectively.
Each mark of chemical compound in the sketch map in the following reaction equation, special record does not then represent meaning same as described above.Chemical compound in the reaction equation also comprises the salifiable situation of shape, as this salt, for example can enumerate and same salt of the salt of the chemical compound that uses in the invention described above etc.
Product, can directly use reactant liquor or also can be used as semifinished product and be used for down-individual reaction, but also can from reactant mixture, separate according to usual way, also can be refining easily by common separation method (for example recrystallization, distillation, chromatography etc.).
Chemical compound of the present invention (I-1) for example can be made according to method of representing with following reaction equation 1 or the method for taking this as the standard.
Chemical compound (V), (VI), (VII) and (VIII) can buy from market easily in addition, also can be made according to known method own or the method for taking this as the standard.
Reaction equation 1
Chemical compound (VI) can be made by the carbonyl of reducing compound (V).
As the Reducing agent that uses in the reduction, can enumerate the alkali metal/liquid ammonia (birch reduction) etc. of the metal species, sodium, lithium etc. of the boron alkyl alkanes, diborane, zinc, aluminum, stannum, ferrum etc. of borane complex class, thexylborane, the disiamylborane etc. of the metallic hydrogen complex class, borine tetrahydrofuran complex, borine dimethyl disulfide ether complexes etc. of the metal hydride class, lithium aluminium hydride, sodium borohydride etc. of for example aluminum hydride, diisobutylaluminium hydride, tributyltin hydride etc.The use amount of Reducing agent, to for example metal hydride class, metallic hydrogen complex time-like, with respect to 1 mole compound (V) is respectively about 1 to about 10 moles, preferably about 1 to about 5 moles, when borane complex class, boron alkyl alkanes or diborane, with respect to 1 mole compound (V) is respectively about 1 to about 10 moles, preferably about 1 to about 5 moles, and about 1 to about 20 equivalents, preferably about 1 to about 5 equivalents during metal species.In this reaction, also can use Louis's acids according to required.As this " Louis's acids ", can use for example aluminum chloride, aluminium bromide, titanium chloride (IV), stannic chloride (II), zinc chloride, boron chloride, Boron tribromide, boron trifluoride etc.Lewis acidic use amount is respectively about 1 to about 10 moles, preferably about 1 to about 5 moles with respect to 1 mole compound (V).
In addition, also can reduce, at this moment, can use catalyst of for example palladium carbon, platinum oxide (IV), Raney nickel (Raney-nickel), Raney cobalt (Raney-cobalt) etc. etc. by hydrogenation reaction.The use amount of catalyst is about 5 to about 1000 weight %, preferably about 10 to about 300 weight % with respect to 1 mole compound (V).Also can use various hydrogen sources to replace gaseous hydrogen.As this " hydrogen source ", can use formic acid, ammonium formate, formic acid triethylamine, phosphinic acid sodium, hydrazine etc.The use amount of hydrogen source is respectively about 1 to about 10 moles, preferably about 1 to about 5 moles with respect to 1 mole compound (V).
With regard to this reaction, using for reaction is favourable for inert solvent.As such solvent, just there is no particular limitation as long as reaction is carried out, but be preferably for example alcohols of methanol, ethanol, 1-propanol, 2-propanol, the tert-butyl alcohol etc., diethyl ether, diisopropyl ether, diphenyl ether, oxolane, 1,4-diox, 1, the ethers of 2-dimethoxy-ethane etc., hydro carbons, the N of benzene, toluene, cyclohexane extraction, hexane etc., the solvent of the organic acid of the amide-type of the Disnalon (Ferrer). of dinethylformamide, N,N-dimethylacetamide, hempa etc., formic acid, acetic acid, propanoic acid, trifluoroacetic acid, methanesulfonic acid etc. etc. or their mixed solvent etc.
With regard to the response time, change according to employed Reducing agent kind and amount or activity of such catalysts and amount, but normally about 1 hour to about 100 hours, preferably about 1 hour to about 50 hours.Normally about-20 ℃ to about 120 ℃, preferably about 0 ℃ to about 80 ℃ of reaction temperature.When having used hydrogenation catalyst, normally about 1 to 100 air pressure of the pressure of hydrogen.
Chemical compound (VII) [L represents to break away from base in the formula] can be transformed to " disengaging base " by the hydroxyl of chemical compound (VI) and makes.
As " breaking away from base " of representing with L, can enumerate for example halogen atom of fluorine, chlorine, bromine, iodine etc., for example mesyloxy, ethanesulfonyloxy group, trichlorine mesyloxy etc. can be by halogenated C 1-6Alkylsulfonyloxy, can have substituent C 6-10Aryl-sulfonyl oxygen etc.As " having substituent C 6-10Aryl-sulfonyl oxygen ", can enumerate and have 1 to 3 and be selected from for example C of methyl, ethyl etc. 1-6The C of alkyl, for example methoxyl group, ethyoxyl etc. 1-6The C of the substituent phenyl sulfonyloxy in alkoxyl and the nitro, naphthyl sulfonyloxy etc. 6-10Aryl-sulfonyl oxygens etc. as object lesson, can be enumerated phenyl sulfonyloxy, m-nitro base sulfonyloxy, tolysulfonyl oxygen base etc.
In " break away from base " represented with L when being halogen atom, as being used to halogenated halogenating agent, the halogenation of halogenation phosphinylidyne class, phosphorus pentachloride, Phosphorous chloride., phosphorus pentabromide, phosphorus tribromide etc. that can enumerate the halogenation thionyl class, phosphoryl chloride, bromination phosphinylidyne etc. of for example thionyl chloride, protobromide sulfonyl etc. is Phosphorus, oxalyl halogenide class of oxalyl chlorination thing etc., phosgene etc.With respect to 1 mole compound (VI), use about 0.1 to about 30 moles, preferred about 0.2 to about 10 moles, more preferably from about 1 to about 10 moles of halogenating agents.
This reaction is carried out in the presence of alkali according to desired.As this " alkali ", can enumerate triethylamine, tripropyl amine (TPA), tri-n-butylamine, N-ethyl diisopropylamine, cyclohexyl dimethylamine, 4-dimethylaminopyridine, N, the tertiary amines of accelerine, N-methyl piperidine, N-crassitude, N-methylmorpholine etc. etc.With respect to 1 mole compound (VI), use about 1 to about 20 moles, be preferably about 1 to about 10 mol alkali.
This reaction is with solvent-free or use atent solvent to carry out to favourable in reaction.As such solvent, just there is no particular limitation as long as reaction is carried out, but hydro carbons, diethyl ether, diisopropyl ether, diphenyl ether, the oxolane, 1 of preference such as benzene, toluene, cyclohexane extraction, hexane etc., 4-diox, 1, ethers, the N of 2-dimethoxy-ethane etc., dinethylformamide, N, amide-type, dichloromethane, chloroform, the carbon tetrachloride, 1 of the Disnalon (Ferrer). of N-dimethyl acetylamide, hempa etc., the solvent of the halogenated hydrocarbons of 2-dichloroethanes etc. etc. or their mixed solvent.
Normally about 10 minutes to about 12 hours response time, preferably about 10 minutes to about 5 hours.Normally about-10 ℃ to about 200 ℃, preferably about-10 ℃ to about 120 ℃ of reaction temperatures.
In " breaking away from base " of representing with L is can be by halogenated C 1-6Alkylsulfonyloxy, can have substituent C 6-10During aryl-sulfonyl oxygen,, can enumerate for example halogenation C of chlorination methylsulfonyl etc. as sulfonyl agent 1-6The halogenation C of alkyl sulfonyl, Benzene Chloride sulphonyl, chlorination tolysulfonyl etc. 6-10Arylsulfonyl etc.With respect to 1 mole compound (VI), use about 1 to about 20 moles, be preferably about 1 to about 10 moles of sulfonyl agents.
This reaction is with solvent-free or use atent solvent to carry out to favourable in reaction.As such solvent, just there is no particular limitation as long as reaction is carried out, but hydro carbons, diethyl ether, diisopropyl ether, diphenyl ether, the oxolane, 1 of preference such as benzene, toluene, cyclohexane extraction, hexane etc., 4-diox, 1, ethers, dichloromethane, chloroform, the carbon tetrachloride, 1 of 2-dimethoxy-ethane etc., the solvent of the esters of the halogenated hydrocarbons of 2-dichloroethanes etc., methyl acetate, ethyl acetate, butyl acetate etc. etc. or their mixed solvent etc.
This reaction is carried out in the presence of alkali according to desired.As this " alkali ", can enumerate triethylamine, tripropyl amine (TPA), tri-n-butylamine, N-ethyl diisopropylamine, cyclohexyl dimethylamine, 4-dimethylaminopyridine, N, the alkaline salt of the inorganic base of the tertiary amines of accelerine, N-methyl piperidine, N-crassitude, N-methylmorpholine etc., sodium hydroxide, potassium hydroxide, Lithium hydrate, barium hydroxide etc., sodium carbonate, potassium carbonate, cesium carbonate, sodium bicarbonate, sodium acetate, ammonium acetate etc. etc.With respect to 1 mole compound (VI), use about 1 to about 20 moles, be preferably about 1 to about 10 mol alkali.
Normally about 10 minutes to about 12 hours response time, preferably about 10 minutes to about 5 hours.Normally about-30 ℃ to about 150 ℃, preferably about-20 ℃ to about 100 ℃ of reaction temperatures.
Chemical compound (IX) [in the formula, R 15Expression can have substituent alkyl], when Xa is oxygen atom or sulphur atom, in the presence of alkali by chemical compound (VII) and chemical compound (VIII) condensation are made.
As using R 15" can have substituent alkyl " of expression, what be preferably above-mentioned substituent A group " can substituted rudimentary (C 1-6) alkyl ", " can substituted rudimentary (C 2-6) alkenyl ", " can substituted rudimentary (C 2-6) alkynyl ", " can substituted rudimentary (C 2-6) alkynyl ", " can substituted C 3-8Cycloalkyl ", " can substituted C 6-14Aryl " and " can substituted C 7-16Aralkyl " etc.
As using R 15The substituent group that " alkyl " of expression " can have substituent alkyl " can have, preferred above-mentioned substituent A group etc.As using R 13" alkyl " of " can have substituent alkyl " of expression can have 1 to 5, preferably have 1 to 3 above-mentioned substituent group on the commutable position of alkyl, replace radix and be 2 when above, and each substituent group also can be identical or different.
As the alkali that uses in this reaction, can enumerate sodium hydroxide, potassium hydroxide, Lithium hydrate, the inorganic base of barium hydroxide etc., sodium carbonate, potassium carbonate, cesium carbonate, sodium bicarbonate, sodium acetate, the alkaline salt of ammonium acetate etc., pyridine, the aromatic amine of lutidines etc., triethylamine, tripropyl amine (TPA), tri-n-butylamine, the N-ethyl diisopropylamine, the cyclohexyl dimethylamine, 4-dimethylaminopyridine, N, accelerine, the N-methyl piperidine, the N-crassitude, the tertiary amines of N-methylmorpholine etc., sodium hydride, the alkali metal hydride class of hydrofining etc., sodium amide, the diisopropylaminoethyl lithium, the metal amine of hexamethyl two silicon nitrogen lithiums (lithiumhexamethyldisilazide) etc., Feldalat NM, Sodium ethylate, sodium tert-butoxide, the metal alkoxide class of potassium tert-butoxide etc. etc.These alkali with respect to 1 mole compound (IX), use about 1～10 mole, are preferably about 1～3 mole.
It is favourable for inert solvent that this reaction is used for reaction.As such solvent, as long as reaction carries out just that there is no particular limitation, but the alcohols of preference such as methanol, ethanol, 1-propanol, 2-propanol, the tert-butyl alcohol etc.; Diethyl ether, diisopropyl ether, diphenyl ether, oxolane, 1,4-diox, 1, the ethers of 2-dimethoxy-ethane etc.; The hydro carbons of benzene, toluene, cyclohexane extraction, hexane etc.; N, the amide-type of the Disnalon (Ferrer). of dinethylformamide, N,N-dimethylacetamide, hempa etc.; Dichloromethane, chloroform, carbon tetrachloride, 1, the halogenated hydrocarbons of 2-dichloroethanes etc.; The nitrile of acetonitrile, propionitrile etc.; The esters of methyl acetate, ethyl acetate, butyl acetate etc.; The sulfoxide class of dimethyl sulfoxide etc.; The solvent of water etc. or their mixed solvent etc.
Normally about 10 minutes to about 12 hours response time, preferably about 20 minutes to about 6 hours.Normally about-50 ℃ to about 150 ℃, preferably about-20 ℃ to about 100 ℃ of reaction temperatures.
Chemical compound (IX), when Xa is oxygen atom or sulphur atom, can be according to desired in the presence of dehydrant, by chemical compound (VI) and chemical compound (VIII) condensation are made.
As operable dehydrant among the present invention, can enumerate for example acidic catalyst of hydrochloric acid, sulphuric acid, phosphoric acid, potassium acid sulfate, oxalic acid, p-methyl benzenesulfonic acid, 10-camphorsulfonic acid, boron trifluoride ether complexes etc.; The base catalyst of sodium hydroxide, potassium hydroxide etc. etc., but also can use for example N, the Carbodiimides of N '-dicyclohexyl carbodiimide etc.; Aluminium oxide, sodium dioxide, hydroxyl phosphorus chloride, thionyl chloride, methanesulfonyl chloride etc.These bronsted lowry acids and bases bronsted lowries with respect to 1 mole compound (VIII), use about 0.1～10 mole, are preferably about 0.1～5.0 mole.
This reaction is with solvent-free or use atent solvent to carry out to favourable in reaction.As such solvent, as long as reaction carries out just that there is no particular limitation, but the alcohols of preference such as methanol, ethanol, propanol etc.; Diethyl ether, oxolane, diox, 1, the ethers of 2-dimethoxy-ethane etc.; The organic acid of formic acid, acetic acid etc.; The hydro carbons of benzene, toluene, cyclohexane extraction, hexane etc.; N, the amide-type of dinethylformamide, N,N-dimethylacetamide etc.; The solvent of the sulfoxide class of dimethyl sulfoxide etc. etc. or their mixed solvent etc.
Normally 30 minutes～24 hours response time, preferably 30 minutes～5 hours.Normally 0～200 ℃, preferably 0～150 ℃ of reaction temperature.
Chemical compound (IX), when Xa is oxygen atom, can utilize light prolong reaction (synthetic (Synthesis), 1981,1～27 page), by chemical compound (VI) and chemical compound (VIII) condensation are made.
This reaction is diethylazodicarboxylate, diisopropyl azo-2-carboxylic acid, 1, under the existence of the phosphine class of the azodicarboxy acid diesters class of 1 '-(azo-dicarboxylic) two piperidines etc. etc. and triphenylphosphine, tributylphosphine etc., make the reaction of chemical compound (VIII) and chemical compound (VI).
The use amount of chemical compound (VI) is about 1 to about 5 moles, preferably about 1 to about 2 moles with respect to 1 mole compound (VIII).
Being somebody's turn to do the use amount of " azodicarboxy acid diesters class " and " phosphine class ", is respectively about 1 to about 5 moles, preferably about 1 to about 2 moles with respect to 1 mole compound (VIII).
It is favourable for inert solvent that this reaction is used for reaction.As such solvent, as long as reaction carries out just that there is no particular limitation, but preference such as diethyl ether, diisopropyl ether, diphenyl ether, oxolane, 1,4-diox, 1, the ethers of 2-dimethoxy-ethane etc.; The hydro carbons of benzene, toluene, cyclohexane extraction, hexane etc.; N, the amide-type of the Disnalon (Ferrer). of dinethylformamide, N,N-dimethylacetamide, hempa etc.; Dichloromethane, chloroform, carbon tetrachloride, 1, the halogenated hydrocarbons of 2-dichloroethanes etc.; The nitrile of acetonitrile, propionitrile etc.; The ketone of acetone, butanone etc.; The solvent of the sulfoxide class of dimethyl sulfoxide etc. etc. or their mixed solvent etc.
Normally about 5 minutes to about 48 hours response time, preferably about 10 minutes to about 24 hours.Normally about-20 ℃ to about 200 ℃, preferably about 0 ℃ to about 100 ℃ of reaction temperature.
Chemical compound (I-1) is to use acid or alkali by the hydrolysis of ester group of chemical compound (IX) is made.In acid hydrolysis, can use mineral acids or Louis's acids, lewis acid and the mercaptan of boron chloride, Boron tribromide etc. or the also organic acid of usefulness, trifluoroacetic acid, p-methyl benzenesulfonic acid etc. of thioether of hydrochloric acid, sulphuric acid etc. usually.In basic hydrolysis, can use the inorganic base of sodium hydroxide, potassium hydroxide, barium hydroxide etc.; The alkaline salt of sodium carbonate, potassium carbonate etc.; The metal alkoxide class of Feldalat NM, Sodium ethylate, potassium tert-butoxide etc.; Organic bases of triethylamine, imidazoles, carbonamidine etc. etc.These bronsted lowry acids and bases bronsted lowries are about 0.5～10 mole, preferably about 0.5～6 mole with respect to 1 mole compound (IX).
This reaction is with solvent-free or use atent solvent to carry out to favourable in reaction.As such solvent, as long as reaction carries out just that there is no particular limitation, but the alcohols of preference such as methanol, ethanol, propanol etc.; Benzene, toluene etc. aromatic hydrocarbon based; The saturated hydrocarbons of cyclohexane extraction, hexane etc.; The organic acid of formic acid, acetic acid etc.; Oxolane, diox, 1, the ethers of 2-dimethoxy-ethane etc.; N, the amide-type of dinethylformamide, N,N-dimethylacetamide etc.; Dichloromethane, chloroform, carbon tetrachloride, 1, the halogenated hydrocarbons of 2-dichloroethanes etc.; The nitrile of acetonitrile, propionitrile etc.; The ketone of acetone, butanone etc.; The sulfoxide class of dimethyl sulfoxide etc.; The solvent of water etc. or their mixed solvent etc.
Normally 10 minutes～60 hours response time, preferably 10 minutes～12 hours.Reaction temperature normally-10 ℃～200 ℃, preferably 0 ℃～120 ℃.
Chemical compound of the present invention (I-2) can be made according to method of for example representing with following reaction equation 2 or the method for taking this as the standard.
Reaction equation 2
Figure A20038010826000601
Chemical compound (X) and (XI) can easily buy the market sale product in addition, also can be made according to known method own or the method for taking this as the standard.
Chemical compound (XII) can by with chemical compound (X) and chemical compound (XI) [in the formula, L 1Expression breaks away from base] condensation makes.
As using L 1" break away from base " of expression, can enumerate and " breaking away from basic " of representing with above-mentioned L same disengaging base or hydroxyl etc.
Use L 1Expression " breaking away from base " can be utilized and the identical method of method of making chemical compound (IX) from chemical compound (VI) when being hydroxyl, makes chemical compound (XII) from chemical compound (X) and chemical compound (XI).
Use L 1" break away from base " of expression be halogen atom, can be by halogenated C 1-6Alkylsulfonyloxy maybe can have substituent C 6-10During aryl-sulfonyl oxygen, can utilize and the identical method of method of making chemical compound (IX) from chemical compound (VII), make chemical compound (XII) from chemical compound (X) and chemical compound (XI).
Chemical compound (I-2) can utilize and the identical method of method of making chemical compound (I-1) from chemical compound (IX), and (XII) makes from chemical compound.
Chemical compound of the present invention (I-2) also can be made according to method of for example representing with following reaction equation 3 or the method for taking this as the standard.
Reaction equation 3
Chemical compound (XIII) and (XIV) can easily buy the market sale product in addition, also can be made according to known method own or the method for taking this as the standard.
Chemical compound (XV) can by with chemical compound (XIII) [in the formula, B 1Be illustrated in and can also have substituent phenyl ring beyond the L] and chemical compound (XIV) [in the formula, M represents metal, B 2Being illustrated in and can also having substituent phenyl ring beyond the M or beyond M, have the substituent aromatic rings that has phenyl ring] condensation makes.
As using B 1And B 2The same ring of A etc. can be enumerated and encircle to " can also have substituent phenyl ring " of expression.With " metal " that M represents, can enumerate potassium, sodium, lithium, magnesium, hydrargyrum, zinc, thallium, stannum and boron etc., they also can complexationization.
As using B 1And B 2" can also have substituent phenyl ring " substituent group that can have of expression can be enumerated the substituent group that is selected from the above-mentioned substituent A group etc.
This reaction is carried out in the presence of catalyst according to desired.As this " catalyst ", can enumerate nickel complex, palladium complex, copper etc.With respect to 1 mole compound (XIII), use catalyst about 0.005 to about 2 moles, be preferably about 0.01 to about 1 mole.
This reaction is carried out to favourable to use atent solvent in reaction.As such solvent, as long as reaction carries out just that there is no particular limitation, but the hydro carbons of preference such as benzene, toluene, cyclohexane extraction, hexane etc.; Diethyl ether, diisopropyl ether, diphenyl ether, oxolane, 1,4-diox, 1, the ethers of 2-dimethoxy-ethane etc.; Dichloromethane, chloroform, carbon tetrachloride, 1, the solvent of the halogenated hydrocarbons of 2-dichloroethanes etc. etc. or their mixed solvent etc.
Normally 10 minutes to 48 hours response time, preferably 10 minutes～24 hours.Normally about-80 ℃ to about 250 ℃, preferably about-20 ℃ to about 150 ℃ of reaction temperatures.
Chemical compound (I-2) also can utilize the method identical with the method for making chemical compound (I-1) from chemical compound (IX) to make from chemical compound (XV).
Chemical compound of the present invention (I-3) can be made according to method of for example representing with following reaction equation 4 or the method for taking this as the standard.
Reaction equation 4
Chemical compound (XVI) and (XVII) can easily buy the market sale product in addition, also can be made according to known method own or the method for taking this as the standard.
Chemical compound (XVIII) can utilize and makes the identical method of the method for chemical compound (XII) from chemical compound (X) and chemical compound (XI) and make from chemical compound (XVI) and chemical compound (XVII).
Chemical compound (I-3) can utilize the method identical with the method for making chemical compound (I-1) from chemical compound (IX) to make from chemical compound (XVIII).
Chemical compound of the present invention (I-4) can be made by method of for example representing with following reaction equation 5 or the method for taking this as the standard.
Reaction equation 5
Chemical compound (X) and (XIX) can easily buy the market sale product in addition, also can be made according to known method own or the method for taking this as the standard.
Chemical compound (XX) can utilize and the identical method of method of making chemical compound (XII) from chemical compound (X) and chemical compound (XI), makes from chemical compound (X) and chemical compound (XIX).
Chemical compound (I-4) can utilize and the identical method of method of making chemical compound (I-1) from chemical compound (IX), and (XX) makes from chemical compound.
E among the chemical compound of the present invention (I-4) 1Be-N (R 14)-(CH 2) m 2-chemical compound, can make according to method of for example representing with following reaction equation 6 or the method for taking this as the standard.
Reaction equation 6
Chemical compound (X), (XXI) and (XXIII) can easily buy the market sale product in addition, also can be made according to known method own or the method for taking this as the standard.
Chemical compound (XXII) can utilize and the identical method of method of making chemical compound (XII) from chemical compound (X) and chemical compound (XI), by chemical compound (X) and chemical compound (XXI) condensation are made.In addition, also can make from chemical compound (X) through the protection that comprises the functional group, the multistage reaction of deprotection.
E among the chemical compound (XX) 1Be-N (R 14)-(CH 2) m 2-chemical compound, also can use and the identical method of method of making chemical compound (IX) from chemical compound (VII) and chemical compound (VIII), make from chemical compound (XXII) and chemical compound (XXIII).
E among the chemical compound (I-4) 1Be-N (R 14)-(CH 2) m 2-chemical compound, can utilize and make the identical method of method of chemical compound (I-1), from E from chemical compound (IX) 1Be-N (R 14)-(CH 2) m 2-chemical compound (XX) make.
In above-mentioned each reaction, when starting compound has as substituent amino, carboxyl, hydroxyl, can utilize chemistry of peptides etc. that normally used protecting group is introduced on these bases, after reaction, remove protecting group as required, can obtain the purpose chemical compound.
As the protecting group of amino, for example can use formoxyl or also can have substituent C respectively 1-6Alkyl-carbonyl (for example acetyl group, propiono etc.), benzoyl, C 1-6Alkoxyl-carbonyl (for example methoxycarbonyl, ethoxy carbonyl etc.), phenyloxycarbonyl, C 7-10Aralkoxy-carbonyl (for example benzyloxycarbonyl etc.), trityl, phthalyl etc.As these substituent groups, can use halogen atom (for example fluorine, chlorine, bromine, iodine etc.), C 1-6Alkyl-carbonyl (for example acetyl group, propiono, valeryl), nitro etc., replacing radix is about 1 to 3.
As the protecting group of carboxyl, for example can use to have substituent C respectively 1-6Alkyl (for example methyl, ethyl, propyl group, isopropyl, butyl, the tert-butyl group etc.), phenyl, trityl, silicyl etc.As these substituent group, can use halogen atom (for example fluorine, chlorine, bromine, iodine etc.), formoxyl, C 1-6Alkyl-carbonyl (for example acetyl group, propiono, butyl carbonyl etc.), nitro, C 1-6Alkyl (for example methyl, ethyl, the tert-butyl group etc.), C 1-6Aryl (for example phenyl, naphthyl etc.) etc., replacing radix is about 1 to 3.
As the protecting group of hydroxyl, for example can use formoxyl or also can have substituent C respectively 1-6Alkyl (for example methyl, ethyl, propyl group, isopropyl, butyl, the tert-butyl group etc.), phenyl, C 7-10Aralkyl (for example benzyl etc.), C 1-6Alkyl-carbonyl (for example acetyl group, propiono etc.), phenyloxycarbonyl, C 7-10Aralkoxy-carbonyl (for example benzyloxycarbonyl etc.), Pentamethylene oxide., tetrahydrofuran base, silicyl etc.As these substituent group, can use halogen atom (for example fluorine, chlorine, bromine, iodine etc.), C 1-6Alkyl (for example methyl, ethyl, the tert-butyl group etc.), C 7-10Aralkyl (for example benzyl etc.), C 6-10Aryl (for example phenyl, naphthyl etc.), nitro etc., replacing radix is about 1 to 4.
In addition; as the method for removing protecting group; the method of also can the known method of use own or taking this as the standard, method or the reduction reaction that can use for example acid, alkali, ultraviolet light, hydrazine, phenylhydrazine, sodium N methyl dithiocarbamate, tetrabutyl ammonium fluoride, acid chloride (II) etc. to handle.
At any time undertaken by carrying out respectively or separately that deprotection reaction, acylation reaction, alkylated reaction, hydrogenation reaction, oxidation reaction, reduction reaction, carbochain prolong reaction, substituent group exchange reaction or they are made up more than 2 according to desired, can synthetic compound (I-1), chemical compound (I-2), chemical compound (I-3) and chemical compound (I-4).As these reactions, can adopt the method for record in for example new experimental chemistry lecture 14,15 volumes, 1977 (ball is kind to be published) etc.
The chemical compound that uses among the present invention can be opened 2002-265457 number, spy according to above-mentioned autofrettage or spy and open 2002-212171 number, spy and open 2001-226350 number, spy and open 2001-199971 number, spy and open 2000-198772 number, spy and open 2000-80086 number, spy and open 2000-34266 number, spy and open flat 09-323983 number, spy and the disclosed method manufacturing such as open flat 08-311065 number.
By above-mentioned reaction, when the goal object that obtains is free state, also can change salify according to well-established law, in addition, obtain be salt the time, also can convert episome or other salt to according to well-established law.And the compound or its salt of the present invention that obtains can be according to known method, for example by changeing molten, concentrated, solvent extraction, fractional distillation, crystallization, recrystallization, chromatography etc., separates from reaction solution, makes with extra care.
When chemical compound of the present invention exists with configurational isomer (configuration isomer), diastereomer, conformer etc., as requested, can be according to above-mentioned separation, each self-separation of process for purification.In addition, when The compounds of this invention is racemic modification, can be separated into S body and R body according to common optical fractionation method.
When having stereoisomer in the The compounds of this invention, the individualism of these isomers and their mixture all comprise in the present invention.
In addition, The compounds of this invention can be a hydrate, also can be non-hydrate.
Chemical compound of the present invention, also available isotope (for example, 3H, 14C, 35S) etc. carry out labelling.
The GPR40 receptor function controlling regulating action of The compounds of this invention, the method for record or measure in the available aftermentioned experimental example 4 based on the method for this method.
Chemical compound of the present invention, its salt and prodrug thereof (below, sometimes also brief note is The compounds of this invention), has GPR40 receptor function controlling regulating action, especially it is excited active to have the GPR40 receptor, and toxicity is little, few side effects, so the GPR40 receptor function controlling agent for safety preferably uses as the GPR40 agonist.
The medicine that contains The compounds of this invention, for mammal (for example, mice, rat, hamster, rabbit, cat, Canis familiaris L., cattle, sheep, monkey, people etc.) have good GPR40 receptor function controlling regulating action, use so can be used as prevention, the therapeutic agent of the physiological function regulator relevant or morbid state of being correlated with or disease with the GPR40 receptor with the GPR40 receptor.
Specifically, contain the medicine of The compounds of this invention, useful as insulin secretion regulator (preferred insulin secretion stimulators), blood sugar lowering, pancreatic beta Fine born of the same parents protective agent.
And, the medicine that contains The compounds of this invention, as diabetes, glucose intolerance, ketosis, acidosis, diabetic neuropathy, diabetic nephropathy, the diabetic retinopathy, hyperlipidemia, sexual dysfunction, dermatosis, joint disease, osteopenia disease, arteriosclerosis, thrombotic disease, dyspepsia, learning memory disorder, fat, hypoglycemia, hypertension, edema, insulin resistant, unstable diabetes, lipoatrophy, insulin allergy, insulinoma, the fat poison, hyperinsulinemia, diseases such as cancer, especially conduct is to diabetes, glucose intolerance, ketosis, acidosis, diabetic neuropathy, diabetic 1 nephropathy, diabetic nethike embrane disease, hyperlipidemia, sexual dysfunction, dermatosis, joint disease, bone reduces disease, arteriosclerosis, thrombotic disease, dyspepsia, the prevention of diseases such as learning memory disorder, therapeutic agent is useful.Here, diabetes comprise insulin-dependent (I type) diabetes, insulin independent form (II type) diabetes and gestational diabetes.In addition, hyperlipidemia comprises hypertriglyceridemia, high blood cholesterol disease, low HDL mass formed by blood stasis, food back hyperlipidemia etc.
About the criterion of diabetes, Japanese diabetes association report in 1999 has new criterion.
According to this report, diabetes represent that blood glucose value (concentration of glucose in the venous plasma) is for more than the 126mg/dl on an empty stomach, and 2 hours value of 75g per os glucosieloading test (75gOGTT) (concentration of glucose in the venous plasma) is that 200mg/dl is above, blood glucose value (concentration of glucose in the venous plasma) is the above arbitrary state of 200mg/dl at any time.In addition, do not meet above-mentioned diabetes, and the state of " be not the state of blood glucose value (concentration of glucose in the venous plasma) not enough 110mg/dl or the not enough 140mg/dl of 2 hours value of 75g per os glucosieloading test (75gOGTT) (concentration of glucose in the venous plasma) " on an empty stomach (normal type) is called " boundary type ".
In addition, about the criterion of diabetes, ADA (american diabetes association), WHO in 1998 all reported new criterion in 1997.
According to these reports, diabetes represent that blood glucose value (concentration of glucose in the venous plasma) is more than the 126mg/dl on an empty stomach, and 2 hours value of 75g per os glucosieloading test (75gOGTT) (concentration of glucose in the venous plasma) is the above state of 200mg/dl.
In addition, according to above-mentioned report, anti-sugared functional defect is to represent the not enough 126mg/dl of blood glucose value (concentration of glucose in the venous plasma) on an empty stomach, and 2 hours value of 75g per os glucosieloading test (75gOGTT) (concentration of glucose in the venous plasma) is that 140mg/dl is above, the state of not enough 200mg/dl.And according to the report of ADA, blood glucose value (concentration of glucose in the venous plasma) is called IFG (Impaired Fasting Glucose) for the state of above, the discontented 126mg/dl of 110mg/dl on an empty stomach.On the other hand, if the Reported according to WHO accuses, among this IFG (Impaired Fasting Glucose), 2 hours value of 75g per os glucosieloading test (concentration of glucose in the venous plasma) is called IFG (ImpairedFasting Glycemia) for the state of not enough 140mg/dl.
Chemical compound of the present invention, the prevention, the therapeutic agent that also can be used as diabetes, boundary type, anti-sugared dysfunction, IFG (Impaired Fasting Glucose) and the IFG (Impaired Fasting Glycemia) of above-mentioned new criterion decision use.And The compounds of this invention also can prevent boundary type, anti-sugared dysfunction, IFG (Impaired Fasting Glucose) and develop to diabetes from IFG (Impaired Fasting Glycemia).
The toxicity of medicine that contains The compounds of this invention is low, can be according to as the manufacture method of pharmaceutical preparation and the general known method of using, The compounds of this invention directly or with carrier that the pharmacology allows is mixed, after for example making pharmaceutical preparations such as tablet (comprising coated tablet, thin membrane coated tablet), powder, granule, capsule (comprising soft capsule), liquid agent, injection, suppository, slow releasing agent, per os or non-per os (for example, part, rectum, intravenously administrable etc.) safe administration.
Content in the The compounds of this invention pharmaceutical preparation is whole about 0.01～100 weight % of preparation.This dosage, because of differences such as administration object, route of administration, the state of an illness, symptoms, for example for diabetics (the about 60kg of body weight), effective ingredient (The compounds of this invention) as every day, be about 0.01～30mg/kg body weight, be preferably about 0.1～20mg/kg body weight, more preferably about 1～20mg/kg body weight, 1 natural gift 1～oral administration all can several times.
As can be used for the carrier that the medical pharmacology who makes of the present invention allows, can use as the habitual various organic or inorganic carrier mass of preparation material, the for example excipient in the solid preparation, lubricant, binding agent and disintegrating agent, or the lytic agent in the liquid preparation, cosolvent, suspensoid, isotonic agent, buffer agent and the pain agent etc. that disappears.And as required, can suitably add additives such as antiseptic, antioxidant, coloring agent, sweeting agent, adhesive agent, wetting agent in right amount.
As excipient, for example can be lactose, white sugar, D-mannitol, starch, corn starch, crystalline cellulose, light anhydrous silicic acid etc.
Lubricant can be enumerated magnesium stearate, calcium stearate, Pulvis Talci, silica gel etc.
Binding agent can be enumerated crystalline cellulose, white sugar, D-mannitol, dextrin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, polyvinylpyrrolidone, starch, sucrose, gelatin, methylcellulose, sodium carboxymethyl cellulose etc.
Disintegrating agent can list starch, carboxymethyl cellulose, carboxymethylcellulose calcium, carboxymethyl cellulose Starch Sodium, L-hydroxypropyl cellulose etc.
Solvent can be used water for injection, ethanol, propylene glycol, Polyethylene Glycol, Oleum sesami, Semen Maydis oil, Fructus Canarii albi wet goods.
Cosolvent can be enumerated Polyethylene Glycol, propylene glycol, D-mannitol, benzyl benzoate, ethanol, Trisaminomethane, cholesterol, triethanolamine, sodium carbonate, sodium citrate etc.
Suspensoid, can list, surfactants such as stearoyl triethanolamine, sodium laurylsulfate, laurylamino-propionic acid, lecithin, benzalkonium chloride, benzethonium chloride, glyceryl monostearate for example, and hydrophilic macromolecules such as polyvinyl alcohol, polyvinylpyrrolidone, sodium carboxymethyl cellulose, methylcellulose, hydroxy methocel, hydroxyethyl-cellulose, hydroxypropyl cellulose for example.
Isotonic agent can list glucose, D-sorbitol, sodium chloride, glycerol, D-mannitol etc.
Buffer agent can list buffer such as phosphate, acetate, carbonate, citrate.
The pain that disappears agent can list benzyl alcohol etc.
Antiseptic can list parabens, the chlorine tert-butyl alcohol, benzyl alcohol, phenethanol, dehydroactic acid, sorbic acid etc.
Antioxidant can be enumerated sodium sulfite, ascorbic acid, alpha-tocopherol etc.
And, The compounds of this invention can with The compounds of this invention beyond medication combined use.
As can with the medicine of The compounds of this invention and usefulness (following abbreviate as sometimes and use medicine), can list other Remedies for diabetes, the diabetic complications therapeutic agent, the hyperlipidemia therapeutic agent, depressor, antiobesity agent, diuretic, chemotherapeutics, the immunotherapy agent, immunomodulator, anti-inflammatory agent, antithrombotic agents, the osteoporosis therapy agent, antimicrobial drug, antifungal agent, antiparasitic, antibiotic, antisussive and expectorant agent, tranquilizer, anesthetics, antiulcerative, neuroleptic, psychosis, anticarcinogen, muscle relaxant, spasmolytic, antidepressants, antiallergic agent, cardiac tonic, antiarrhythmics, vasodilator, vasoconstrictor, narcotic antagonist, vitamin, the vitamin-derived body, the anti-medicine of panting, the dementia medicine, the agent of frequent micturition treatment of urinary incontinence, the dysuria therapeutic agent, heredity anaphylaxis dermatosis (atopic dermatitis) therapeutic agent, the allergic rhinitis therapeutic agent, pressor agent, endotoxin antagonistic or antibody, signal transmits Inhibitors, struvite intermediation depressant, struvite intermediation suppresses antibody, anti-inflammatory intermediation depressant, the anti-inflammatory intermediation suppresses antibody etc.Concrete enumerate following medicine.
As other Remedies for diabetes, (for example, the pancreas from cattle, pig extracts the animal insulin preparation that obtains can to enumerate insulin preparation; With escherichia coli, yeast, by the synthetic human insulin preparation of genetic engineering; Zinc insulin; PI zinc; The segment of insulin or derivant are (for example, INS-1 etc.), Macrulin etc.), insulin sensitivity enhancer (for example, than lattice row ketone (Pioglitazone) or its salt (being preferably hydrochlorate), troglitazone (Troglitazone), rosiglitazone (Rosiglitazone) or its salt (being preferably maleate), Reglixane (JTT-501), Netoglitazone (MCC-555), YM-440, GI-262570, KRP-297, FK-614, CS-011, (γ E)-γ-[[[4-[(5-methyl-2-phenyl-4-oxazole) methoxyl group] phenyl] methoxyl group] imino group] phenylbutyric acid etc., the chemical compound of putting down in writing among the WO99/58510 (for example (E)-4-[4-(5-methyl-2-phenyl-4-oxazole methoxyl group) benzyloxy imino group]-the 4-phenylbutyric acid), the chemical compound of putting down in writing among the WO01/38325, Tesaglitazar (AZ-242), insulin sensitivity agent (Ragaglitazar) (NN-622), BMS-298585, ONO-5816, BM-13-1258, LM-4156, MBX-102, LY-519818, MX-6054, LY-510929, Balaglitazone (NN-2344), T-131 or its salt, THR-0921), alpha-glucosidase inhibitor (for example, the voigelibo sugar-tablet, acarbose, miglitol, emiglitate emiglitate etc.), the biguanide agent (for example, insoral, metformin, buformin etc.), [the iodoxy ureas (for example for insulin secretion stimulators, the tolbutamide sheet, the glibenclamide sheet, gliclazide, the chlorpropamide sheet, first sulphur nitrogen grass urea, Acetohexamide, glyclopyramide, glimepiride etc.), repaglinide, insulin secretagogue (senaglinide), Mitiglinide (mitiglinide) or its calcium salt hydrate, Nateglinide (nateglinide) etc.], the GLP-1 receptor stimulating agent [for example, GLP-1, the GLP-1MR agent, NN-2211, AC-2993 (exendin-4), BIM-51077, Aib (8,35) hGLP-1 (7,37) NH 2CJC-1131 etc.], inhibitor (for example for dipeptide amido peptidase TV (dipeptidyl peptidaseIV), NVP-DPP-278, PT-100, P32/98, P93/01, NVP-DPP-728, LAF237, TS-021 etc.), β 3 agonist (for example, CL-316243, SR-58611-A, UL-TG-307, AJ-9677, AZ40140 etc.), dextrin (amylin) agonist (for example, Pramlintide (pramlintide) etc.), inhibitor (for example for phosphotyrosine phosphatase (phosphotyrosine phosphatase), vanadic acid etc.), the newborn inhibitor of sugar (for example, the glycogen phosphorglase inhibitor, the G-6-Pase inhibitor, glucagon antagonist etc.), SGLT (the collaborative transportation of sodium-glucose (sodium-glucose cotransporter)) inhibitor (example, T-1095 etc.), 11beta-Hydroxysteroid dehydrogenase depressant (example, BVT-3498 etc.), adiponectin (adiponectin) or its agonist, IKK depressant (for example, AS-2868 etc.), leptin (leptin) opposing improvement medicine, Somat receptor stimulating agent (WO01/25228, the chemical compound that WO03/42204 discloses, WO98/44921, WO98/45285, the chemical compound that WO99/22735 discloses etc.), active chemical medicine (the example of glucokinase, Ro-28-1675) etc.
As diabetic complication therapeutic agent, (for example can enumerate aldose reductase inhibitor, this naphthalene of Toure (tolrestat), benefit Pa Ruisite (epalrestat), zenarestat (zenarestat), zopolrestat (zopolrestat), Fei Dasita (fidarestat) (SNK-860), minalrestat (ARI-509), CT-112 etc.), neurotrophic factor and increase medicine (example thereof, NGF, NT-3, BDNF, the neurenergen that discloses among the WO01/14372 (neurotrophin) produces, secernent (for example, 4-(4-chlorphenyl)-2-(2-methyl isophthalic acid-imidazoles)-5-[3-(2-methylphenoxy) propyl group] oxazole etc.) etc.), Protein kinase C (PKC) depressant (example, LY-333531 etc.), AGE depressant (example, ALT-945, pimagedine (pimagedine), pyratoxanthine, N-phenacylate thiazole bromide (N-phenacyl thiazolium bromide) (ALT-766), EXO-226, ALT-711, Pyridorin, pyridoxamine etc.), active oxygen (is for example removed medicine, thioctic acid etc.), cerebral vasodilator (for example, tiapride (tiapride) etc.), Somat receptor agonism medicine (BIM23190), apoptotic signal regulation and control kinases-1 (apoptosis signal regulatinig kinase-1) are depressant etc. (ASK-1).
As the hyperlipidemia therapeutic agent; the statin compounds that can enumerate cholesterol synthetic inhibitor (for example; pravastatin (pravastatin); simvastatin (simvastatin); lovastatin (lovastatin); his spit of fland (Atorvastatin) is cut down in holder; fluvastatin (fluvastatin); simvastatin (cerivastatin) or their salt are (for example; sodium salt etc.) etc.; inhibitor for squalene synthetic enzyme (for example; the chemical compound that discloses among the WO97/10224; N-[[(3R for example; 5S)-1-(3-acetoxyl group-2; the 2-dimethylpropyl)-7-chloro-5-(2; the 3-dimethoxy phenyl)-the 2-Oxy-1; 2; 3; 5-tetrahydroxy-4; the 1-benzoxazepin-3-yl] acetyl group] piperidines-4-acetic acid etc.); Bei Te (fibrate) based compound (for example, bezafibrate sheet (bezafibrate); clofibrate (clofibrae); simfibrate (simfibrate); clinofibrate (clinofibrate) etc.); antioxidant (for example, thioctic acid; probacol (probucol)) etc.
Depressor (for example can list the angiotensin converting enzyme inhibitor, captopril (captopril), Enalapril (enalapril), delapril (delapril) etc.), angiotensin II antagonist (for example, losartan (losartan), CARDESARTAN ester (candesartan cilexetil), eprosartan (eprosartan), valsartan (valsartan), telmisartan (telmisartan), irbesartan (irbesartan), Tasosartan (tasosartan), 1-[[2 '-(2,5-dihydro-5-oxygen base-4H-1,2,4-oxadiazole-3-yl) biphenyl-4-yl] methyl]-2-ethyoxyl-1H-benzimidazole-7-carboxylic acid etc.), calcium antagonist (for example, Manidipine (manidipine), nifedipine (nifedipine), benzenesulfonic acid peace Lip river Horizon (amlodipine), efonidipine (efonidipine), nicardipine (nicardipine) etc.), clonidine (clonidine) etc.
Antiobesity agent (for example: fenfluramine hydrochloride (dexfenfluramine), fenfluramine (fenfluramine), Duromine (phentermine), sibutramine (sibutramine), amfepramone (amfepramone), dextro-amphetamine (dexamphetamine), indole (mazindol), phenylpropanolamine (phenylpropanolamine), clobenzorex (clobenzorex) can list the central antiadipositas drug; MCH receptor antagonistic (for example, SB-568849; SNAP-7941; The chemical compound that WO01/82925 and WO01/87834 contain etc.); Neuropeptide tyrosine antagonistic (example, CP-422935 etc.); Cannabinoid receptors antagonist ((example, SR-141716, SR-147778 etc.); Motilin (ghrelin) antagonist; 11 beta-hydroxy Cholesterol dehydrogenase depressant (examples, BVT-3498 etc.) etc.), pancreatic lipase inhibitor (example, orlistat (orlistat), ATL-962 etc.), β 3 agonist (examples, CL-316243, SR-58611-A, UL-TG-307, AJ-9677, AZ40140 etc.), albumen appetite suppressant (peptidic anorexiants) (for example, leptin, CNTF (ciliary neurotrophic factor) etc.), cholecystokinin (cholecystokinin) agonist (for example, Lintitript (lintitript), FPL-15849 etc.), the depressant (for example, p-57 etc.) etc. of ingesting.
Diuretic (for example can list xanthine derivative, diuretin, calcium diuretin etc.), the thiazide preparation (for example, ethiazide (ethiazide), cyclopenthiazide (cyclopenthiazide), trichlormethiazide (trichloromethiazide), Hydrochlorothiazide (hydrochlorothiazide), hydroflumethiazide (hydroflumethiazide), benzyl hydrochlorothiazide (benzylhydrochlorothiazide), penflutizide (penflutizide), polythiazide (polythiazide), methyclothiazide (methyclothiazide) etc.), the aldosterone antagonist preparation (for example, spironolactone (spironolactone), triamterene (triamterene) etc.), carbonic anhydrase inhibitor (for example, acetyl Cuo amine (acetazolamide) etc.), chlorobenzene sulfonamide class preparation (for example, chlortalidone (chlortalidone), mefruside (mefruside), indopamide (indapamide) etc.), azosemide (azosemide), isosorbide (isosorbide), etacrynic acid (etacrynic acid), piretanide (piretanide), bumetanide (bumetanide), furosemide (furosemide) etc.
The Chemo-Therapy therapy (for example can be enumerated alkylating agent (for example cyclophosphamide (cyclophosphamide), ifosfamide etc.), metabolic antagonist, methotrexate (methotrexate), 5-fluorouracil (5-fluorouracil) etc.), the cancer resistance antibiotic (for example, mitomycin (mitomycin), amycin (adriamycin) etc.), botanical anticancer agent (for example, vincristine (vincristin), vindesine (vindesine), paclitaxel (taxol) etc.), cisplatin, carboplatin, etoposide (etoposide) etc.Wherein preferably as the doxifluridine (furtulon) of 5-fluorouracil derivant or neofurtulon etc.
The immunotherapy preparation with microorganism or antibacterial composition (for example can be enumerated, the muramyldipeptide derivant, molten chain bacterium etc.), the active polysaccharide of enhance immunity (for example, lentinan (lentinan), Sizofiran (sizofiran), kresatin (krestin) etc.), the cytokine that gene engineering method etc. obtain (cytokines) (for example, interferon, interleukin (IL) etc.), colony stimulating factor (for example, granulocyte colony-stimulating factor, erythropoietin etc.) etc., IL-1 preferably wherein, IL-2, interleukin classes such as IL-12.
Anti-inflammatory agent can be enumerated the anti-inflammatory agent of on-steroidals such as aspirin, acetaminophen, indometacin etc.
Antithrombotic agents can be enumerated heparin (heparin sodium for example, calciparine, dalteparin sodium (dalteparin sodium) etc.), warfarin (for example, potassium warfarin etc.), the antithrombase medicine (for example, argatroban (aragatroban) etc.), thrombolytic (for example, urokinase (urokinase), Tisokinase (tisokinase), alteplase (alteplase), Nateplase (nateplase), Monteplase (monteplase), pamiteplase etc.), platelet aggregation depressant (for example, hydrochlorinate ticlopidine (ticlopidine hydrochloride), cilostazol (cilostazol), ethyl icosapentate, Beraprost Sodium (beraprost sodium), sarpogrelate hydrochloride (sarpogrelate hydrochloride) etc.) etc.
The osteoporosis therapy agent can be enumerated for example Alfacalcidol (alfacalcidol), calcitriol (calcitriol), elcatonin (elcatonin), salmon calcitonin see calcimar (calcitonin salmon), estriol (estriol), ipriflavone (ipriflavone), Pamidronate Disodium (pamidronate disodium), alendronic Acid sodium hydrate (alendronate sodium hydrate), ineadronic acid disodium (incadronate disodium) etc.
The vitamin medicine can be enumerated for example vitamin B 1, vitamin B 12Deng.
The dementia agent for example can be enumerated tacrine (tacrine), Buddhist nun Du time (donepezil), Leix for bright (rivastigmine), galantamine (galanthamine) etc.
The agent of frequent micturition treatment of urinary incontinence can be enumerated for example flavoxate hydrochloride (flavoxate hydrochloride), ditropan XL (oxybutynin hydrochloride), hydrochloric acid Propiverine (propiverine hydrochloride) etc.
The dysuria therapeutic agent can be enumerated acetylcholinesterase inhibitor (for example, ground this bright (distigmine)) etc.
And, animal model or the medicament that improves the dyscrasia effect is arranged clinically, be cyclooxygenase (cyclooxygenase) inhibitor (for example, indometacin (indometacin) etc.) [Cancer Research, the 49th volume, 5935～5939 pages, 1989], Progesterone (progesterone) derivant (for example, acetic acid megestrol (megesterol acetate)) [Journal of Clinical Oncology, the 12nd volume, 213～225 pages, 1994], the saccharic cholesterol (for example, dexamethasone (dexamethasone) etc.), metoclopramide class (metoclopramide) medicine, tetrahydrocannabinol class (tetrahydrocannabinol) medicine (document is all same as described above), lipid metabolism improving agent (for example, eicosapentaenoic acid etc.) [British Journal of Cancer, the 68th volume, 314～318 pages, 1993], growth hormone, IGF-1, or as TNF-α, LIF, IL-6, the antibody of inducing cachectin of oncostatin M etc. etc. also can and be used with The compounds of this invention.
And, the saccharifying inhibitor (for example, ALT-711 etc.), neuranagenesis (for example promotes medicine, Y-128, VX853, prosaptide etc.), antidepressants (for example, desipramine, amitriptyline, imipramine), antuepileptic (for example, Lamictal, Qu Lai, levetiracetam, zonisamide, lyrica (Pregabalin), Harkoseride, carbamazepine), antiarrhythmics (for example, the mexiletine sheet), the acetylcholinergic receptor ligand (for example, ABT-594), Endothelin (endothelin) receptor antagonist (for example ABT-627), the monoamine uptake depressant (for example, tramadol hydrochloride (tramadol)), the anaesthetic analgesic (for example, morphine), GABA receptor stimulating agent (for example, gabapentin (gabapentin), gabapentin MR agent), α 2Receptor stimulating agent (for example, clonidine), Bangesic (for example, capsaicin), antianxiety drugs (for example, benzothiazole product (benzothiazepines)), phosphodiesterase inhibitor (for example, sldenafil), dopamine agonist (for example, apomorphine) etc. also can and be used with The compounds of this invention.
By with The compounds of this invention with and be used in combination with medicine, can obtain the following different effect of section, that is:
(1) with The compounds of this invention or and compare with medicine is individually dosed, can reduce dosage
(2) can be according to patient's symptom (light disease, serious symptom etc.), the medicine of selection and The compounds of this invention and usefulness
(3) by selecting different with the The compounds of this invention mechanism of action and use medicine, prolongation during can treating.
(4) by selecting different with the The compounds of this invention mechanism of action medicines, the therapeutic effect that can obtain to continue also used
(5) The compounds of this invention with and use medication combined use, can obtain synergy preferably.
Below, with The compounds of this invention with and be called of the present invention and use agent with medication combined use.
Use of the present invention and when using agent, do not limit The compounds of this invention with and with the administration time of medicine, but can and and give administration object, also life period difference administration simultaneously with The compounds of this invention with medicine.And can also can suitably select according to the dosage of using clinically according to administration object, route of administration, symptom etc. with the dosage of medicine.
The present invention and with the administering mode of agent is not particularly limited, during administration, the combination The compounds of this invention with and get final product with medicine.As this administering mode, for example, can enumerate (1) The compounds of this invention with and with the unitary agent administration of medicine preparation acquisition simultaneously, (2) The compounds of this invention with and with the respectively same route of administration of the 2 kinds of preparations administration simultaneously of preparation acquisition of medicine, (3) The compounds of this invention with and with respectively 2 kinds of same route of administration time differences of preparation administration of preparation acquisition of medicine, (4) The compounds of this invention with and with respectively 2 kinds of preparation different way of administration administrations simultaneously of preparation acquisition of medicine, (5) The compounds of this invention with and with medicine respectively the preparation acquisition the administration of 2 kinds of preparation different way of administration time differences (for example, with The compounds of this invention, and with the order administration of medicine, or opposite order administration) etc.
Of the present invention and use agent, toxicity is low, for example, according to self disclosed method with The compounds of this invention or (with) above-mentioned and be mixed and made into medical composition for example behind tablet (comprising coated tablet, thin membrane coated tablet), powder, granule, capsule, (comprising soft capsule), liquid preparation, injection, suppository, the slow releasing agent etc. with the carrier that medicine and pharmacology allow, but per os or non-per os (for example, part, rectum, intravenously administrable etc.) safe administration.Injection, but administration or directly sick place's administration in intravenous, intramuscular, the subcutaneous or internal organs.
As the carrier that is used for the present invention and allows with the pharmacology of agent manufacturing, the carrier that can allow with the pharmacology that the above-mentioned the present invention's of being used for medicine is made is identical.In addition, further as required, can suitably add the antiseptic that can be used for the invention described above medicine and make, antioxidant, coloring agent, sweeting agent, adsorbent, wetting agent etc. in right amount.
Of the present invention and with the The compounds of this invention in the agent with and with the ratio that cooperates of medicine, can be according to suitably selection such as administration object, route of administration, disease.
For example, also with the content of the The compounds of this invention in the agent, because of the preparation form is different, but usually with respect to all about 0.01～100 weight % of preparation, preferred about 0.1～50 weight % is more preferably from about about 0.5～20 weight % in the present invention.
Of the present invention and with in the agent and use content of medicines, because of the preparation form is different, but usually with respect to all about 0.01～100 weight % of preparation, preferred about 0.1～50 weight % is more preferably from about about 0.5～20 weight %.
Of the present invention and with the content of additive such as carrier in the agent, because of the preparation form is different, but usually with respect to all about 1～99.99 weight % of preparation, about preferred about 10～90 weight %.
In addition, with The compounds of this invention and and also be that same content gets final product during preparation respectively with medicine.
These preparations can be made according to usually used self known method in the preparation process.
For example, chemical compound of the present invention or and use medicine, with dispersant (for example, (AtlasPower makes tween (Tween) 80, the U.S.), HCO60 (daylight chemicals manufacturing), Polyethylene Glycol, carboxymethyl cellulose, sodium alginate, hydroxypropyl methylcellulose, dextrin etc.), stabilizing agent (for example, ascorbic acid, sodium pyrosulfite etc.), surfactant (for example, polysorbate 80, Polyethylene Glycol etc.), dissolvable agents (for example, glycerol, ethanol etc.), buffer agent (for example, phosphoric acid and alkali metal salt thereof, citric acid and alkali metal salt thereof etc.), isotonic agent (for example, sodium chloride, potassium chloride, mannitol, sorbitol, glucose etc.), the pH regulator agent (for example, hydrochloric acid, sodium hydroxide etc.), preservative agent (for example, ethylparaben, benzoic acid, methyl parahydroxybenzoate, propyl p-hydroxybenzoate, benzyl alcohol etc.), lytic agent (for example, concentrated glycerin, meglumine etc.), cosolvent (for example, propylene glycol, white sugar etc.), the pain that disappears agent (for example, glucose, benzyl alcohol etc.) etc. be dissolved in jointly in the aqueous injection, or be dissolved in olive oil, Oleum Ricini, Oleum Gossypii semen, corn wet goods vegetable oil, in the cosolvents such as propylene glycol, suspendible or emulsifying form the oily injection agent, make injection.
In addition, according to self known method, at The compounds of this invention or also with in the medicine, (for example for example add excipient, lactose, white sugar, starch etc.), disintegrating agent (for example, starch, calcium carbonate etc.), binding agent (for example, starch, arabic gum, carboxymethyl cellulose, polyvinylpyrrolidone, hydroxypropyl cellulose etc.) or lubricant (for example, Pulvis Talci, magnesium stearate, polyethylene glycol 6000 etc.) etc., compression forming, then as required, for reaching taste masking, the purpose of enteric solubility or persistence is carried out coating according to self known method and can be made oral Preparation.As the coating materials that is used for coating, can use for example hypromellose, ethyl cellulose, hydroxy methocel, hydroxypropyl cellulose, polyoxyethylene glycol, Tween 80, Pluronic F68, cellulose ethanoate phthalic acid ester, Hydroxypropyl methyl cellulose phtalate, hydroxy methocel acetas succinate, Eudragit (manufacturing of Rohm society, Germany, methacrylic acid-acrylic copolymer) and pigment (for example, colcother, titanium dioxide etc.) etc.Oral Preparation is that quick releasing formulation, slow releasing preparation all can.
And, according to self known method, with chemical compound of the present invention or and mix with oleaginous base, aqueous matrix or aqueous gel substrate with medicine, can be made into solid, semisolid or the liquid suppository of oiliness or aqueous.As above-mentioned oleaginous base, for example [for example can enumerate higher fatty acids glyceride, (Dynamite Nobel society makes for cocoa butter, witepsols class, Germany) etc.], the middle rank fatty acid [for example, Miglyols class (Dynamite Nobe society makes, Germany) etc.] or vegetable oil (for example, Oleum sesami, soybean oil, Semen Gossypii wet goods) etc.In addition, as aqueous matrix, for example, polyethylene glycols, propylene glycol etc.Aqueous gel substrate can be enumerated for example natural rubber class, cellulose derivative, ethene polymers, acrylate copolymer etc.
As above-mentioned slow releasing preparation, can enumerate slow-releasing microcapsule agent etc.This slow-releasing microcapsule agent can make according to the method for self known method for example following [2] expression.
Chemical compound of the present invention is preferably made rectally preparations such as solid preparation oral Preparations such as (for example, powder, granule, tablet, capsules) or suppository.Be more preferably oral Preparation.
And can make above-mentioned dosage form according to medicament categories with medicine.
Below, to [1] The compounds of this invention or and with the injection of medicine and modulation thereof, [2] The compounds of this invention or and with the slow releasing preparation of medicine or quick releasing formulation and modulation thereof, [3] The compounds of this invention or also be specifically described with Sublingual tablet, buccal tablet or oral rapidly disintegrating agent and the modulation thereof of medicine.
[1] injection and modulation thereof
Preferably with The compounds of this invention or also with the water-soluble injection of making of medicine.Also benzoate can be contained in this injection or/and Salicylate.
This injection can be as requested, with The compounds of this invention or and make or/and Salicylate is water-soluble with medicine and benzoate.
As above-mentioned benzoic acid, Salicylate, can enumerate alkali metal salts such as sodium, potassium; Alkali salt such as calcium, magnesium; Ammonium salt; Meglumine salt; Other trometamol acylates such as (tromethamol) etc.
The compounds of this invention in the injection or and be about 0.5～50w/v%, preferred 3～20w/v% with drug concentrations.Benzoate is or/and the concentration of Salicylate is 0.5～50w/v%, about preferred 3～20w/v%.
In addition; in this injection; the additive that generally is used for injection; (for example for example can suitably add stabilizing agent; ascorbic acid; sodium pyrosulfite etc.); surfactant (for example; polysorbate 80; Polyethylene Glycol etc.); dissolvable agents (for example; glycerol; ethanol etc.); buffer agent (for example; phosphoric acid and alkali metal salt thereof; citric acid and alkali metal salt thereof etc.); isotonic agent (for example; sodium chloride; potassium chloride etc.); dispersant (for example; hypromellose; dextrin); the pH regulator agent (for example; hydrochloric acid; sodium hydroxide etc.); protective agent (for example, ethylparaben; benzoic acid etc.); lytic agent (for example, concentrated glycerin; meglumine etc.); cosolvent (for example; propylene glycol; white sugar etc.); the pain that disappears agent (for example, glucose; benzyl alcohol etc.) etc.Generally add these additives with the common ratio that is used for injection.
By adding the pH regulator agent, injection is adjusted to pH2～12, preferably pH2.5～8.0.
This injection can be as requested, with The compounds of this invention or and with medicine and benzoate or/and Salicylate or as required that above-mentioned additive is water-soluble and make.The no requirement (NR) of dissolving order can similarly be carried out with existing injection method for making.
Aqueous solution for injection can heat, and can equally with common injection carry out making injection as filtration, sterilization, high pressure heat sterilization etc. again.
Aqueous solution for injection, for example can be under 100～121 ℃ of conditions high pressure heat sterilization 5～30 minutes better.
And, for as repeatedly drug-delivery preparation use respectively, make preparation and also can with solution antibiotic property.
[2] slow releasing preparation or quick releasing formulation and modulation thereof
The preferred nuclear coating that will contain The compounds of this invention with peplos agent such as water-insoluble materials or swelling polymer as requested or also use medicine.For example, the oral administration slow releasing preparation of preferred 1 day 1 administration type.
The water-insoluble materials that is used for the peplos agent for example can be enumerated cellulose etherses such as ethyl cellulose, butyl cellulose; Cellulose esters such as cellulose ethanoate, cellulose propionate; Polyethylene esters such as polyvinylacetate, polyethylene butyrate; Acrylic acid/methacrylic acid copolymer, methylmethacrylate copolymer, methacrylic acid ethoxy ethyl ester/methacrylic acid Cortex Cinnamomi ethyl ester/amino alkyl methacrylate copolymer, polyacrylic acid, polymethylacrylic acid, methacrylic acid alkane amide copolymer, poly-(methyl methacrylate), polymethacrylates, PMAm, methacrylic acid aminoalkyl ester copolymer, poly-(methacrylic anhydride), glycidyl methacrylate copolymer, especially Eudragit RS-100, RL-100, RS-30D, RL-30D, RL-PO, RS-PO (ethyl acrylate-methyl methacrylate-methacrylic acid chlorination trimethyl-QAE quaternary aminoethyl copolymer), EudragitNE-30D Eudragit class (Rhomphama society) acrylic acid series polymeric compounds such as (methyl methacrylate-ethyl acrylate copolymers), fixed oils such as hardened castor oil (for example, lovery paraffin (Freund industry) etc.), palm wax, fatty glyceride, the wax class of paraffin etc., polyglyceryl fatty acid ester etc.
The swelling polymer preferably has dissociate base and demonstrate the expansible polymer of pH dependency of acidity, preferably in the acidic region of gastric, expand less, bigger the dissociate polymer of base of acidity that has expands in neutral regions such as small intestinal or large intestine.
As these have acidity dissociate base, demonstrate the expansible polymer of pH dependency, for example, can enumerate carbomer (Carbomer) 934P, 940,941,974P, 980,1342 etc., polycarbophil (polycarbophil), WL-140 (carcium polycarbophil) (above-mentioned make), Hibiswako103,104,105,304 cross-linking type acrylic acid polymers such as (by making) with the pure medicine of light (strain) by BF Goodrich society.
The peplos agent that is used for slow releasing preparation also can contain hydroaropic substance.
As this hydroaropic substance, for example can enumerate polysaccharide that polysaccharide that pullulan, dextrin, alginic acid alkali metal salt etc. also can contain sulfate, hydroxypropyl cellulose, hypromellose, sodium carboxymethyl cellulose etc. have hydroxyalkyl or carboxyalkyl, methylcellulose, polyvinylpyrrolidone, polyvinyl alcohol, Polyethylene Glycol etc.
The content of the water-insoluble materials in the agent of slow releasing preparation peplos is about 30～about 90% (w/w), and preferred about 35～about 80% (w/w) is more preferably about 40～about 75% (w/w); The content of swelling polymer is about 3～about 30% (w/w), preferred about 3～about 15% (w/w).The peplos agent also can contain hydroaropic substance, and the content of the hydroaropic substance in the peplos agent at this moment is below about 50% (w/w), is preferably about 5～about 40% (w/w), more preferably about 5～about 35% (w/w).Here desolvate with respect to from the peplos agent solution, the removing weight % of the peplos agent compositions after (for example, lower alcohols such as water, methanol, ethanol etc.) of above-mentioned % (w/w) expression.
Slow releasing preparation, as follows, modulation contains the nuclear of medicine, utilizes water-insoluble materials or swelling polymer heating for dissolving then or is dissolved or dispersed in the peplos agent solution that forms in the solvent resulting nuclear coating is made.
I. contain the modulation of the nuclear of medicine
The form of the nuclear that contains medicine of peplos agent coating (below, abbreviate nuclear sometimes as) is not particularly limited, but preferably makes particle shapes such as granule or particulate.
Nuclear is during for granule or particulate, and its mean diameter is preferably about 150～2,000 μ m, about 500～1,400 μ m more preferably.
The modulation of nuclear can be undertaken by common manufacture method.For example, can be in medicine suitably admixed excipients, binding agent, disintegrating agent, lubricant, stabilizing agent etc., with modulation such as wet type extruding pelletization method, fluidized bed granulation.
About 0.5～about 95% (w/w) of medicament contg in the nuclear, preferred about 5.0～about 80% (w/w), more preferably from about 30～about 70% (w/w).
Excipient as containing in the nuclear for example can use saccharides such as white sugar, lactose, mannitol, glucose, starch, crystalline cellulose, calcium phosphate, corn starch etc.Wherein, preferred crystalline cellulose, corn starch.
As binding agent, for example can use polyvinyl alcohol, hydroxypropyl cellulose, Polyethylene Glycol, polyvinylpyrrolidone, Pluronic F68, arabic gum, gelatin, starch etc.Disintegrating agent can use for example carboxymethylcellulose calcium (ECG505), cross-linking sodium carboxymethyl cellulose (Ac-Di-Sol), cross-linked type polyethylene ketopyrrolidine (polyvinylpolypyrrolidone), low degree of substitution hydroxypropyl cellulose (L-HPC) etc.Wherein, preferred hydroxypropyl cellulose, polyvinylpyrrolidone, low degree of substitution hydroxypropyl cellulose.Can use Pulvis Talci, magnesium stearate and inorganic salt thereof etc. as lubricant, anticoagulant, and lubricant uses Polyethylene Glycol etc.Stabilizing agent can use acid such as tartaric acid, citric acid, succinic acid, fumaric acid, maleic acid.
With regard to nuclear, except that above-mentioned autofrettage, for example also can utilize binding agent in, lower alcohol (for example, methanol, the ethanol etc.) appropriate solvent of etc.ing water-soluble in spraying on the non-active carrier particle at nuclear center, simultaneously a small amount of mixture that adds medicine or itself and excipient, lubricant etc. one by one rotation comminution granulation, coating pan coating method, fluidized bed coating or dissolve comminution granulation and modulate.As the non-active carrier particle, can use the material of for example making, the preferably about 100 μ m of its mean diameter～about 1,500 μ m by white sugar, lactose, starch, crystalline cellulose, wax class.
For medicine and the peplos agent that contains in the isolated nuclei, the surface of available protective agent coating nuclear.Protective agent can use above-mentioned hydroaropic substance or water-insoluble materials etc.Protective agent, preferred Polyethylene Glycol or have hydroxyalkyl or the polysaccharide of carboxyalkyl, more preferably hypromellose, hydroxypropyl cellulose.Can contain acid such as tartaric acid, citric acid, succinic acid, fumaric acid, maleic acid in this protective agent as stabilizing agent, also can contain lubricants such as Pulvis Talci.When using protective agent, its coating amount, with respect to nuclear, about 1～about 15% (w/w), preferred about 1～about 10% (w/w), more preferably from about 2～about 8% (w/w).
Protective agent can carry out coating according to common coating method, specifically, can be with protective agent with fluidized bed coating, coating pan coating method etc. by spray coating in nuclear and coating.
II. the coating of examining by the peplos agent
The nuclear utilization that above-mentioned I is obtained is with above-mentioned water-insoluble materials and dependent swelling polymer of pH and hydroaropic substance heating for dissolving or be dissolved or dispersed in the peplos agent solution that forms in the solvent and carry out coating, makes slow releasing preparation thus.
As the method for examining coating by the peplos agent solution, can enumerate spray coating method etc.
The ratio of components of the water-insoluble materials in the peplos agent solution, swelling polymer or hydroaropic substance can select suitably to make that each component content is respectively above-mentioned containing ratio in its peplos.
The coating amount of peplos agent is with respect to nuclear (the coating amount that does not contain protective agent) about 1～about 90% (w/w), preferred about 5～about 50% (w/w), 5～about 35% (w/w) more preferably from about.
The solvent of peplos agent can make water or organic solvent separately, perhaps uses both mixed liquors.When using mixed liquor, the mixing ratio of water and organic solvent (water/organic solvent: weight ratio) can in 1～100% scope, change preferred 1～about 30%.As this organic solvent,, can use lower alkyl ketone such as lower alcohols such as methanol, ethanol, isopropyl alcohol, n-butyl alcohol, acetone, acetonitrile, chloroform, dichloromethane etc. so long as getting final product of dissolving water-insoluble materials is not particularly limited.Wherein preferred lower alcohol, more preferably ethanol, isopropyl alcohol.The mixed liquor of preferred water and water and organic solvent uses as the solvent of peplos agent.At this moment, if need can be in wherein adding acid such as tartaric acid, citric acid, succinic acid, fumaric acid, maleic acid for making that the peplos agent solution is stable.
Operation during by spray coating method coating can be carried out according to common coating method.Specifically, can be with the peplos agent solution by spray coating such as fluidized bed coating, coating pan coating method for example in nuclear.At this moment, if need, can add Pulvis Talci, titanium oxide, magnesium stearate, calcium stearate, light anhydrous silicic acid etc. as lubricant, fatty acid glyceride, hardened castor oil, triethyl citrate, spermol, stearyl alcohol etc. are as plasticizer.
Behind peplos agent coating, can mix Pulvis Talci etc. as required and prevent charged dose.
Quick releasing formulation can be liquid (solution, suspension, an emulsion etc.), also can be solid (particle shape, pill, tablet etc.).As quick releasing formulation, can use non-oral Preparations such as oral Preparation, injection, but the preferred oral form of administration.
Quick releasing formulation except that the medicine that contains as active component, also can contain carrier, additive or excipient (being designated hereinafter simply as excipient) habitual in the formulation art usually.Used excipient is that formulation excipients excipient commonly used gets final product, and is not particularly limited.For example, as the oral solid formulation excipient, can enumerate lactose, starch, corn starch, crystalline cellulose (Asahi Chemical Industry's (strain) manufacturing, Avicel pH 101 etc.), pulverized sugar, Saccharum Sinensis Roxb., mannitol, light anhydrous silicic acid, magnesium carbonate, calcium carbonate, L-cysteine etc., preferred corn starch and mannitol etc.These excipient can use one or two or more kinds to be used in combination.The content of excipient with respect to the quick releasing formulation total amount, is about 4.5～about 99.4w/w%, is preferably about 20～about 98.5w/w%, more preferably about 30～about 97w/w%.
The content of quick releasing formulation Chinese medicine, with respect to the quick releasing formulation total amount, can about 0.5～about 95%, be preferably about scope of 1～about 60% and suitably select.
When quick releasing formulation is oral solid formulation, except that mentioned component, also contain disintegrating agent usually.These disintegrating agents, (five moral medicines are made can to use carboxymethylcellulose calcium, ECG-505), crosscarmelose sodium (for example, Asahi Chemical Industry's (strain) makes, Ac-Di-Sol), polyvinylpolypyrrolidone (for example, BASF society makes, Kollidon CL), low degree of substitution hydroxypropyl cellulose (SHIN-ETSU HANTOTAI's chemistry (strain)), carboxymethyl starch (loose paddy chemistry (strain), carboxymethyl starch sodium (make by Kimura's industry, exprotab), (Asahi Chemical Industry's (strain) makes the part alphalysed starch, PCS) etc., for example, meet the water moisture absorption, swelling or between effective ingredient that constitutes nuclear and excipient, produce passage and the disintegrate granule.These disintegrating agents can use one or two or more kinds to be used in combination.The consumption of disintegrating agent can suitably be selected according to kind or consumption, the delivery formulations design etc. of used medicine, but with respect to the quick releasing formulation total amount, for example be about 0.05～about 30w/w%, preferred about 0.5～about 15w/w%.
When quick releasing formulation is oral solid formulation, except that above-mentioned composition, also can further contain additive habitual in the solid preparation as requested during oral solid formulation.As these additives, for example (for example can use binding agent, sucrose, gelatin, Arabic buffings, methylcellulose, hydroxypropyl cellulose, hypromellose, carboxymethyl cellulose, polyvinylpyrrolidone, pullulan, dextrin etc.), lubricant (for example, Polyethylene Glycol, magnesium stearate, Pulvis Talci, light anhydrous silicic acid (for example, aerosil (Aerosil) (Japanese Aerosil)), surfactant (for example, anion surfactants such as alkyl sodium sulfate, polyoxyethylene fatty acid esters and polyethylene glycol oxide sorbitan aliphatic ester, non-ionic surface active agents such as polyoxyethylene castor oil derivant etc.), coloring agent (for example, tar class pigment, caramel, colcother, titanium oxide, the riboflavin class), if need, also can use correctives (for example, sweeting agent, spice etc.), adsorbent, antiseptic, wetting agent, charged preventor etc.In addition, also can add organic acid such as tartaric acid, citric acid, succinic acid, fumaric acid as stabilizing agent.
As above-mentioned binding agent, preferably use hydroxypropyl cellulose, Polyethylene Glycol and polyvinylpyrrolidone etc.
Quick releasing formulation can mix above-mentioned each composition based on common preparation manufacturing technology, as required, and then kneading, molding and make.Above-mentioned mixing can be according to the method for general use, and for example, mixing, kneading etc. are carried out.Specifically; when for example quick releasing formulation being made the particle shape; according to the identical method of modulation method of above-mentioned slow releasing preparation nuclear; use after the mixing such as vertical granulator, omnipotent kneader (cigarette ironworker manufacturing), fluidized bed pelletizer FD-5S (manufacturings of Powrex society), make with pelletize such as wet method extruding pelletization method, fluidized bed granulation method.
Quick releasing formulation of Huo Deing and slow releasing preparation like this, directly or with appropriate formulations excipient etc. according to well-established law respectively after the preparationization, also can be made into the preparation of while or arbitrary interval administration combination medicine-feeding, both directly or with the appropriate formulations excipient can be made a kind of oral Preparation (for example, granule, granula subtilis, tablet, capsule etc.) jointly again.Also two preparations can be made granule or particulate, be filled in same capsule etc. and make oral medicinal preparation.
[3] Sublingual tablet, buccal tablet or oral rapidly disintegrating agent and modulation thereof
Sublingual tablet, buccal tablet, oral rapidly disintegrating agent can be solid preparations such as tablet, also can be oral mucosa and attach sheet (thin film).
Collapse agent as speed in Sublingual tablet, buccal tablet or the oral cavity, preferably contain The compounds of this invention or and with the preparation of medicine and excipient.In addition, also can contain adjuvant such as lubricant, isotonic agent, hydrophilic carrier, aqueous dispersion polymers, stabilizing agent.In addition, be to absorb easily, to improve bioavailability, also can contain beta-schardinger dextrin-or beta-cyclodextrin derivative (for example, HP-etc.) etc.
As above-mentioned excipient, can enumerate lactose, sucrose, D-mannitol, starch, crystalline cellulose, light anhydrous silicic acid etc.Lubricant can be enumerated magnesium stearate, calcium stearate, Pulvis Talci, silica sol etc., preferred magnesium stearate or silica sol.Isotonic agent can list sodium chloride, glucose, fructose, mannitol, sorbitol, lactose, sucrose, glycerol, carbamide etc., preferred mannitol.Hydrophilic carrier can list swelling hydrophilic carriers such as crystalline cellulose, ethyl cellulose, cross-linked type polyethylene ketopyrrolidine, light anhydrous silicic acid, silicic acid, dicalcium phosphate, calcium carbonate, preferred crystalline cellulose (for example, microcrystalline Cellulose etc.).Aqueous dispersion polymers (for example can list natural gum, tragacanth, arabic gum, guar gum), alginate (for example, sodium alginate), cellulose derivative (for example, methylcellulose, carboxymethyl cellulose, hydroxy methocel, hydroxypropyl cellulose, hypromellose), gelatin, water soluble starch, polyacrylic acid (for example, carbomer), polymethylacrylic acid, polyvinyl alcohol, Polyethylene Glycol, polyvinylpyrrolidone, Merlon, ascorbyl palmitate etc., preferred hypromellose, polyacrylic acid, alginic acid, gelatin, carboxymethyl cellulose, polyvinylpyrrolidone, Polyethylene Glycol etc.More preferably hypromellose.Stabilizing agent can list cysteine, thiosorbitol, tartaric acid, citric acid, sodium carbonate, ascorbic acid, glycine, sodium sulfite etc., optimization citric acid or ascorbic acid.
Speed collapses agent in Sublingual tablet, buccal tablet or the oral cavity, can be by self known method by mixing The compounds of this invention or and making with medicine and excipient.And, as requested, also can mix adjuvant such as above-mentioned lubricant, isotonic agent, hydrophilic carrier, aqueous dispersion polymers, stabilizing agent, coloring agent, sweeting agent, antiseptic.Simultaneously or after mixing mentioned component blanking time, tabletting is made fast disintegrating tablet in Sublingual tablet, buccal tablet or the oral cavity.For obtaining suitable hardness, water or ethanol equal solvent humidification, moistening as required before and after the tabletting, the molding after drying is made.
When making mucosa attaching sheet (membrane), with The compounds of this invention or and with in the water-soluble equal solvents such as medicine and above-mentioned aqueous dispersion polymers (preferred hydroxypropyl cellulose, hypromellose), excipient, casting (cast) resulting solution is made membrane.And, also can add additives such as plasticizer, stabilizing agent, antioxidant, protective agent, coloring agent, buffer agent, sweeting agent.The glycols that also can contain Polyethylene Glycol or propylene glycol etc. in the membrane for the elasticity that obtains appropriateness, in order to improve the adhesion of membrane for the oral mucosa lining, also can contain bioadhesive polymers (for example, polycarbofil, Ka Baihan resin (Carbopol)).Casting is by solution being watered in the non-adhesive surface, with coating apparatus such as scrapers it is extended to homogeneous thickness (preferred about 10～1000 microns), and then, drying solution forms membrane.The membrane of Xing Chenging descends drying, is cut into desired area in room temperature or heating like this.
Preferred oral rapidly disintegrating agent can be enumerated The compounds of this invention or and with medicine and The compounds of this invention or and with the solid rapid diffusion form of administration of medicine with inactive water solublity or water diffusibility carrier formation reticulate body.This reticulate body is from The compounds of this invention or and be dissolved in distillation solvent this constituent of the solid, shaped that the solution of appropriate solvent constitutes with medicine and make.
Speed collapses in the agent constituent in this oral cavity, remove to add The compounds of this invention or and the medication beyond the region of objective existence, preferably contain substrate and form agent and secondary component.
Form agent as this substrate, contain animal protein class or vegetable protein classes such as gelatin class, dextrin class and Semen sojae atricolor, Semen Tritici aestivi and Caulis et Folium Lini (psyllium) seed albumen; Rubber materials such as arabic gum, guar gum, agar and xanthan gum; Polysaccharide; The Sargassum acids; The carboxymethyl cellulose class; The antler glue class; The dextrin class; The pectin class; Synthetic polymer classes such as polyvinylpyrrolidone; Derived materials such as gelatin-gum arabic complex.And, saccharides such as mannitol, dextrin, lactose, galactose and trehalose; Ring-type saccharides such as cyclodextrin: inorganic salts such as sodium phosphate, sodium chloride and aluminium silicate; Carbonic acid atomic numbeies such as glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-hydroxyproline, L-isoleucine, L-leucine and L-phenylalanine are 2～12 aminoacid etc.
Substrate forms agent and can before forming solid it be imported in solution or the suspension more than a kind or a kind.Such substrate forms the existence of agent, add surfactant also can, remove surfactant and also can.Substrate forms agent except helping to form the skeleton, also helps to keep The compounds of this invention in this solution or the suspension or and with the disperse state of medicine.
Can contain secondary components such as protective agent, antioxidant, surfactant, thickening agent, coloring agent, pH adjustment agent, spice, sweeting agent or odor mask in the compositions.Can enumerate the FD﹠amp of redness, black and yellow iron oxide class and the manufacturing of Elis and Eberald company as the appropriate colouring agent; C blue No. 2 and FD﹠amp; The FD﹠amp of red No. 40 grades of C; The C dyestuff.Suitable spice comprises Herba Menthae, Fructus Rubi (raspberry), Radix Glycyrrhizae, Fructus Citri junoris, Fructus Citri Limoniae, grapefruit, caramel, Rhizoma et radix valerianae, Fructus Pruni pseudocerasi and grape essence and their combination.Suitable pH regulator agent comprises citric acid, tartaric acid, phosphoric acid, hydrochloric acid and maleic acid.Suitable sweeting agent comprises aspartame (aspartame), acesulfame K (acesulfame K) and tremnble sweet (thaumatin) etc.Suitable odor mask comprises sodium bicarbonate, ion exchange resin, cyclodextrin clathrate, adsorbability material and microencapsulation apomorphine.
Usually contain the 0.1～about 50 weight % that have an appointment in the preparation, preferably contain the The compounds of this invention of the 0.1～about 30 weight % that have an appointment or also use medicine, between about 1 minute～about 60 minutes, be preferable over about 1 minute～between about 15 minutes, more preferably between about 2 minutes～about 5 minutes (in the water), dissolving The compounds of this invention or also (above-mentioned with the preparation more than 90% of medicine, Sublingual tablet, buccal tablet etc.) or entered the mouth 1～60 second in, in preferred 1～30 second, more preferably 1～10 second with the oral rapidly disintegrating agent of interior disintegrate for well.
Above-mentioned excipient is with respect to the content of total preparation, about 10～about 99 weight %, preferred about 30～about 90 weight %.Beta-schardinger dextrin-or beta-cyclodextrin derivative are 0～about 30 weight % with respect to the content of total preparation.Lubricant is about 0.01～about 10 weight % with respect to the content of total preparation, preferred about 1～about 5 weight %.Isotonic agent is about 0.1～about 90 weight % with respect to the content of total preparation, is preferably about 10～about 70 weight %.Hydrophilic carrier is about 0.1～about 50 weight % with respect to the content of total preparation, is preferably about 10～about 30 weight %.Aqueous dispersion polymers is about 0.1～30 weight % with respect to the content of total preparation, is preferably about 10～about 25 weight %.Stabilizing agent is about 0.1～about 10 weight % with respect to the content of total preparation, is preferably about 1～about 5 weight %.Except that above-mentioned preparation, can also contain additives such as coloring agent, sweeting agent, antiseptic as required.
The present invention also uses the dosage of agent, according to during the kind of chemical compound of the present invention, age, body weight, symptom, dosage form, medication, the dispensing etc. and different, for example, diabetics (adult, the about 60kg of body weight) everyone, usually as chemical compound of the present invention and and use medicine, one day about 0.01～about 1000mg/kg of difference, be preferably about 0.01～about 100mg/kg, more preferably about 0.1～about 100mg/kg, preferred especially about 0.1～about 50mg/kg, wherein with about 1.5～about 30mg/kg once a day to being divided into the several intravenously administrable.Certainly, change because of various conditions as above-mentioned dosage, thus situation is fully also arranged to be less than above-mentioned dosage, and the situation of the administration that need overrun is also arranged.
And use medicine, can set any amount with the unquestioned scope of side effect.As the dosage on the one of also using medicine, according to age of the degree of symptom, administration object, sex, body weight, susceptibility difference, administration time, at interval, the kind of the character of pharmaceutical preparation, adjustment, kind, live part etc. and different, there is no particular restriction, but amount as medicine, usually the about 0.001～2000mg of the every 1kg body weight of oral administration mammal for example, be preferably about 0.01～500mg, about more preferably about 0.1～100mg, usually with 1～4 administration of these natural gift.
When taking of the present invention and using agent, can take simultaneously chemical compound of the present invention and and use medicine, also can take earlier and, also can take chemical compound of the present invention earlier with taking chemical compound of the present invention behind the medicine again, obey again afterwards and use medicine.Blanking time is when differing from administration, time difference is according to the live part of administration, dosage form, medication administration method and difference, for example, take earlier and the situation with medicine under, can list take and with behind the medicine in 1 minute～3 days, be preferable over 10 minutes～in one day, the more preferably method of in 15 minutes～1 hour, taking chemical compound of the present invention.Take the situation of chemical compound of the present invention earlier, can list and take after the chemical compound of the present invention, in 1 minute～1 day, be preferable over 10 minutes～in 6 hours, more preferably took and with the method for medicine with interior in 15 minutes to 1 hour.
Preferred medication, for example, as one day dosed administration, oral make oral Preparation and with the about 0.001～200mg/kg of medicine, about 15 minutes deutostoma systems of mourning become the about 0.005～100mg/kg of chemical compound of the present invention of oral Preparation.
The g protein coupled receptor protein (GRP40) that uses among the present invention is, contains and uses serial number: 1, serial number: 3, serial number: 5, serial number: 7 or serial number: the receptor protein of the identical or aminoacid sequence that essence is identical of the aminoacid sequences of 9 expressions.
GPR40, (for example for example can be from people or mammal, Cavia porcellus, rat, mice, rabbit, pig, sheep, cattle, monkey etc.) all cells (for example, splenocyte, neurocyte, glial cell, pancreatic beta cell, islets of langerhans, medullary cell, mesangial cell, lachs cell (Langerhans cells), epidermis cell, epithelial cell, endotheliocyte, fibroblast, fibrocyte, the myocyte, adipose cell, immunocyte (for example, macrophage, the T cell, the B cell, natural killer cell, mastocyte, neutrophilic leukocyte, basophil, the oxyphil cell, mononuclear cell), megalokaryocyte, the synovial cell, chondrocyte, osteocyte, osteoblast, osteoclast, mammary glandular cell, hepatocyte or Interstitial cell, or the precursor of these cells, stem cell or cancer Fine born of the same parents etc.) etc. the cell of blood cell system, or the institute that these cells exist in a organized way, for example, brain, each position of brain (for example, olfactory bulb, tonsil, ganglion basal, Hippocampus, ganglion cerebral, hypothalamus, nucleus hypothalamicus, cerebral cortex, oblongata, cerebellum, occipital lobe, frontal lobe, lateral lobe, shell nuclear, caudatum, corpus callosum, black substance), spinal cord, pendant, stomach, pancreas, kidney, liver, gonad, thyroid, gallbladder, bone marrow, the adrenal gland, skin, muscle, lung, digestive tube (for example, large intestine, small intestinal), blood vessel, heart, thymus, spleen, the lower jaw gland, periphery blood, the periphery blood cell, prostate, testis, spermary, ovary, Placenta Hominis, the uterus, skeleton, the joint, the protein of skeletal muscle etc. can also be again synthetic protein.Particularly, GPR40 finds in islets of langerhans in a large number.
As with use serial number: 1, serial number: 3, serial number: 5, serial number: 7 or serial number: the identical aminoacid sequences of aminoacid sequence essence of 9 expressions for example can list and use serial number: 1, serial number: 3, serial number: 5, serial number: 7 or serial number: 9 aminoacid sequences of representing have about more than 85%, be preferably more than 90%, the aminoacid sequence etc. of the homogeny more than 95% more preferably from about.
As containing and the serial number of using of the present invention: 1, serial number: 3, serial number: 5, serial number: 7 or serial number: the protein of the aminoacid sequence that the aminoacid sequence essence of 9 expressions are identical, for example, preferably have and use serial number: 1, serial number: 3, serial number: 5, serial number: 7 or serial number: the identical aminoacid sequences of aminoacid sequence essence of 9 expressions, have with by using serial number: 1, serial number: 3, serial number: 5, serial number: 7 or serial number: the active protein of the protein essence homogeneity that the aminoacid sequences of 9 expressions constitute etc.
As the activity of essence homogeneity, for example can list: ligand is in conjunction with activity, signal message transfer function etc.So-called essence homogeneity is that their activity of expression is identical in nature.Therefore, preferred ligand (for example, about 0.01～100 times, is preferably about 0.5～20 times on an equal basis in conjunction with activity or signal message transfer function isoreactivity, more preferably about 0.5～2 times), the key element of the amount of the level of activity of this class or proteinic molecular weight etc. also can be different.
Ligand can be carried out based on self known method in conjunction with the determination of activity of activity or signal message transfer function etc., for example can measure according to the screening technique that discloses later.
In addition, as GPR40, also can use a) the disappearance serial number: 1, serial number: 3, serial number: 5, serial number: 7 or serial number: (being preferably about 1～30 more than 1 or 2 in 9 aminoacid sequences of representing, more preferably about 1～10, most preferably be a plurality of (1～5)) amino acid whose aminoacid sequence; B) using serial number: 1, serial number: 3, serial number: 5, serial number: 7 or serial number: add (being preferably about 1～30 more than 1 or 2 in the aminoacid sequences of 9 expressions, more preferably about 1～10, most preferably be a plurality of (1～5)) amino acid whose aminoacid sequence; C) with other aminoacid replacement serial number: 1, serial number: 3, serial number: 5, serial number: 7 or serial number: (being preferably about 1～30 more than 1 or 2 in the aminoacid sequences of 9 expressions, more preferably about 1～10, most preferably be a plurality of (1～5)) amino acid whose aminoacid sequence; Perhaps d) contains the protein etc. of their aminoacid sequence of combination.
GPR40 in this description, according to peptide-labeled convention, left end is N-terminal (amino terminal), right-hand member is C-terminal (carboxyl terminal).To contain useful serial number: the GPR40 headed by the GPR40 of the aminoacid sequence of 1 expression, C-terminal is carboxyl (COOH), carboxylate (COO -), amide (CONH 2) or ester (any one COORx).
As the Rx in the ester, can use for example C such as methyl, ethyl, n-pro-pyl, isopropyl or normal-butyl herein 1-6Alkyl; C such as cyclopenta, cyclohexyl for example 3-8Cycloalkyl; C such as phenyl, Alpha-Naphthyl for example 6-12Aryl; Phenyl-C such as benzyl, phenethyl for example 1-2Alpha-Naphthyl-C such as alkyl or α-menaphthyl 1-2C such as alkyl 7-14Aralkyl in addition, as ester for oral use, uses pivalate (pivaloyl oxygen methyl pivaloyloxymethyl) commonly used etc.
When GPR40 has carboxyl (or carboxylate) beyond C-terminal, also contain carboxyl among the GPR40 of the present invention by ammonification or esterification person.As the ester of this situation, for example use the ester of above-mentioned C-terminal etc.
Moreover, among the GPR40, in above-mentioned protein, also contain: the amino protected base of the methionine residue of N-terminal (for example, C such as formoxyl, acetyl group 2-6The C of alkanoyl etc. 1-6Acyl group etc.) protect; Distolateral being cut off in vivo of N and the glutamyl that generates carries out the pyroglutamic acid person; Substituent group on the intramolecular amino acid side chain (for example ,-OH ,-SH, amino, imidazole radicals, indyl, guanidine radicals etc.) is by suitable protecting group (for example, C such as formoxyl, acetyl group 2-6The C of alkanoyl etc. 1-6Acyl group etc.) protect; Perhaps, compound protein of bonded so-called glycoprotein of sugar chain etc. etc.
As the concrete example of GPR40, for example, use to contain useful serial number: the mice GPR40 of the aminoacid sequence of 1 expression; Contain useful serial number: the rat GPR40 of the aminoacid sequence of 3 expressions; Contain useful serial number: the people GPR40 of the aminoacid sequence of 5 expressions; Contain useful serial number: macaque (cynomolgus) GPR40 of the aminoacid sequence of 7 expressions; Contain useful serial number: the hamster GPR40 of the aminoacid sequence of 9 expressions etc.Wherein mice GPR40, rat GPR40, macaque GPR40 and hamster GPR40 are novel protein.People GPR40 is that Oct 20 at WO2000-22129, Biochem Biophys Res Commun.1997; 239 (2); The well-known protein that discloses among the 543-547.
As the partial peptide of GPR40 (below, brief note is " partial peptide " sometimes).If the partial peptide of above-mentioned GPR40 then can be anyly, for example, among the GPR40 protein molecule, use the position expose outside cell membrane promptly to have the receptor-binding activity person etc. of essence homogeneity.
Specifically, use serial number as having: 1, serial number: 3, serial number: 5, serial number: 7 or serial number: the partial peptide of the GPR40 of the aminoacid sequences of 9 expressions, if zone, extracellular during the hydrophobicity profile tabulation is analysed (hydrophilic (Hydrophilic) position) then is the peptide that contains the part of analyzing to some extent.In addition, also can similarly use the peptide that contains some hydrophobicity (Hydrophobic) position.Can use and contain each regional peptide respectively, but the peptide that contains the part in a plurality of zones simultaneously also can.
The amino acid no of partial peptide of the present invention preferably has among the formation aminoacid sequence of receptor protein of the invention described above more than 20, peptides preferred more than 50, more preferably 100 above aminoacid sequences etc. at least.
The aminoacid sequence that essence is identical is expression and these aminoacid sequences have about 85% or more, preferred about more than 90%, the aminoacid sequence of the homogeny more than 95% more preferably from about.
Herein, " receptor active of essence homogeneity " represents meaning same as described above.The mensuration of " receptor active of essence homogeneity " can similarly be carried out with above-mentioned.
In addition, partial peptide of the present invention lacks the aminoacid that (is preferably about 1～10 more preferably a plurality of (1～5)) more than 1 or 2 in the above-mentioned aminoacid sequence; Perhaps in this aminoacid sequence, add (being preferably about 1～20, about 1～10, most preferably is a plurality of (1～5) more preferably) aminoacid more than 1 or 2; (be preferably about 1～10, more preferably a plurality of, most preferably be about 1～5) aminoacid more than 1 or 2 in perhaps also available other this aminoacid sequence of aminoacid replacement.
In addition, the C-terminal of partial peptide of the present invention is carboxyl (COOH), carboxylate (COO -), amide groups (CONH 2) or ester (any one COOR) all can.When partial peptide of the present invention has carboxyl (or carboxylate) beyond C-terminal, also contain carboxyl in the partial peptide of the present invention by amination or esterification person.As the ester of this situation, for example can use the ester of above-mentioned C-terminal etc.
Moreover, same in the partial peptide of the present invention with above-mentioned GPR40, also contain: the amino protected basic protector of the methionine residue of N-terminal; Distolateral being cut off in vivo of N and the glutamyl that generates carries out the pyroglutamic acid person; Substituent group on the intramolecular amino acid side chain is protected by suitable protecting group; Perhaps, compound protein of bonded so-called glycoprotein of sugar chain etc. etc.
As the salt of GPR40 or its partial peptide, can list and acid or the compatible salt of alkali physiology, the preferably compatible acid-addition salts of physiology.As this salt, for example can use with the salt of mineral acid (for example hydrochloric acid, phosphoric acid, hydrobromic acid, sulphuric acid) or with the salt of organic acid (for example acetic acid, formic acid, propanoic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) etc.
GPR40 or its salt can be made according to the process for purification of self known receptor protein from above-mentioned people or mammiferous cell or tissue, also can make according to the transformant that the cultivation that discloses later contains the DNA of the GPR40 that encodes.In addition, the protein synthesis assay that discloses later or make also passable based on this.
Under the situation that people or mammiferous tissue or cell are made, after people or mammiferous tissue or cell homogenization, extract with acid etc., this extracting solution can be made with extra care separation by chromatography such as combination reverse-phase chromatography method, ion exchange chromatographies.
In GPR40 or its partial peptide or its salt or its amide body synthetic, can use commercially available protein synthesis resin usually.As this kind resin, for example can list: chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxy benzyl alcohol resin, 4-methyldiphenyl methyl amine resin, PAM resin, 4-methylol aminomethyl phenyl acetamide methyl resin, polyacrylamide resin, 4-(2 ', 4 '-Dimethoxyphenyl-methylol) phenoxy resin, 4-(2 ', 4 '-Dimethoxyphenyl-Fmoc amino-ethyl) phenoxy resin etc.Use these resins, with suitably protecting alpha-amido and side chain functional group's aminoacid, as destination protein matter sequence-sample, according to self known various method of condensing, condensation on resin.Reaction is excised protein at last and is removed various protecting groups simultaneously on resin, implement the intramolecular disulfide ehter bond again and form reaction in highly diluted solution, obtains destination protein matter or its amide body.
About the amino acid whose condensation of above-mentioned protection, can use the various activation reagent that can in protein synthesis, use, particularly preferably be carbodiimides.As carbodiimides, can use DCC, N, N '-diisopropyl carbodiimides, N-ethyl-N '-(3-dimethylamino dried meat amine acyl group) carbodiimides etc.In the activation that causes by them, directly in resin, (for example add the racemization suppressant additive simultaneously; HOBt; HOOBt) and protection aminoacid, perhaps, make an addition in the resin after can protecting amino acid whose activation in advance as symmetric anhydride or HOBt ester or HOOBt ester.
As the amino acid whose activation of protection or with the condensation of resin in the solvent that uses, the suitable selection from the known solvent that the protein condensation reaction, can use.For example, can use N, sour amide-types such as dinethylformamide, N,N-dimethylacetamide, N-Methyl pyrrolidone; Halogenated hydrocarbons such as chlorination methene, chloroform; Alcohols such as trifluoroethanol; Sulfoxide classes such as dimethyl sulfoxide; Pyridine; Ethers such as diox, oxolane; Nitrile such as acetonitrile, propionitrile; Esters such as methyl acetate, ethyl acetate or their suitable mixture.Reaction temperature knows that from oneself the protein key forms suitable selection the in the scope that can use the reaction, usually suitable selection the in-20～50 ℃ the scope approximately.Superfluous usually 1.5～4 times of ground of the amino acid derivativges of activation use.Use the result of ninhydrin reaction test, under the inadequate situation of condensation, can carry out sufficient condensation by the condensation reaction that repeats the disengaging of unprotect base.Repeat to react when can not obtain sufficient condensation, can use acetic anhydride or acetyl imidazole unreacted amino acid acetylation.
As the protecting group of the amino of raw material, for example can use Z, Boc, tert-pentyloxy carbonyl, isoborneol oxygen base carbonyl (isobornyloxy carbonyl), 4-methoxy-benzyl carbonyl, Cl-Z, Br-Z, Buddha's warrior attendant alkoxy carbonyl (adamantyloxy carbonyl), trifluoroacetyl group, phthalyl, formoxyl, 2-nitrobenzophenone sulfinyl (2-nitrophenylsulfenyl), diphenylphosphothioy (diphenylphosphinothioyl), Fmoc etc.
Carboxyl; for example can be (for example by the alkyl esterification; straight chain shape, branch-like or the cyclic alkyl esterification of methyl, ethyl, propyl group, butyl, the tert-butyl group, cyclopenta, cyclohexyl, suberyl, ring octyl group, 2-adamantyl etc.), aralkyl esterification (for example, benzyl ester, 4-nitrobenzyl ester, 4-methoxy-benzyl ester, 4-chlorine benzyl ester, benzhydryl esterification), phenacyl esterification, benzyloxycarbonyl hydrazidesization, tert-butoxycarbonyl hydrazidesization, trityl hydrazidesization wait and protect.
The hydroxyl of serine for example, can be protected by esterification or etherificate.As the base that is suitable for this esterification, for example can use aroyls such as low-grade alkane acidyl, benzoyl, benzyloxycarbonyl, ethoxy carbonyls etc. such as acetyl group from deutero-base of carbonic acid etc.In addition, as the base that is suitable for etherificate, for example, benzyl, THP trtrahydropyranyl, the tert-butyl group etc.
As the protecting group of the phenol hydroxyl of tyrosine, for example can use Bzl, Cl 2-Bzl, 2-nitrobenzyl, Br-Z, the tert-butyl group etc.
As the protecting group of the imidazoles of histidine, for example can use Tos, 4-methoxyl group-2,3,6-trimethylbenzene sulfonyl, DNP, benzyloxymethyl, Bum, Boc, Trt, Fmoc etc.
Activation person as the carboxyl of raw material, for example can use corresponding anhydride, repeatedly nitrilo, active ester [with alcohols (for example, pentachlorophenol, 2,4,5-trichlorophenol, 2,4,6,-T, 2,2, 4-dinitrophenol, cyanogen methylol, paranitrophenol, HONB, N-hydroxy-succinamide, N-hydroxyphthalimide, HOBt) ester] etc.
As the activation person of the amino of raw material, for example can use corresponding phosphoamide.
As the method for removing (disengaging) protecting group; for example; at Pd-catalyst such as black or Pd-carbon in the presence of contact reduction in hydrogen stream; or carry out acid treatment by anhydrous hydrogen fluoride, methanesulfonic acid, trifluoromethanesulfonic acid, trifluoroacetic acid or their mixed liquor; or carry out alkali treatment, or by sodium reduction in the liquid ammonia etc. by diisopropylethylamine, triethylamine, piperidines, piperazine etc.Above-mentioned acid-treated disengaging reaction, generally in carrying out under-20～40 ℃ of temperature approximately, in acid treatment, for example, methyl phenyl ethers anisole, phenol, thio phenyl methyl ether, metacresol, paracresol, dimethyl sulfide, 1, the interpolation of the cation capture agent of 4-succinimide mercaptans, 1 etc. and so on is effective.In addition; as the imidazoles protecting group of histidine use 2; the 4-dinitrophenyl; be removed by phenylmercaptan.; the formoxyl that uses as the indole protecting group of tryptophan is by above-mentioned 1,1; acid treatment under the existence such as 4-succinimide mercaptans is carried out beyond the deprotection, also can carry out alkali treatment by diluted sodium hydroxide solution, weak ammonia etc. and remove.
With the incoherent functional group's of reaction of raw material protection and protecting group, with and the disengaging of protecting group, the functional group's relevant activation etc. with reaction can select aptly according to known base or known means.
As other method that obtains proteinic amide body; for example; at first; after the amino acid whose α of carboxyl terminal-Carboxylamide protection; after amino side arrives expectation length with peptide (protein) chain elongation; make the protein of the alpha-amino protecting group only removed this peptide chain N-terminal and only remove the protein of protecting group of the carboxyl of C-terminal, these two kinds of protein of condensation in above-mentioned mixed solvent.About detailed condensation reaction, same as described above.After the refining protein, remove all protecting groups by said method, the thick protein that can obtain to expect by the condensation acquisition.Use known various process for purification to make with extra care this thick protein, the lyophilization major part then can obtain the amide body of desirable protein matter.
In order to obtain proteinic ester body, for example, make amino acid whose α-carboxyl of carboxyl terminal and expectation the alcohols condensation and after having carried out the aminoacid esterification, the same with proteinic amide body, can obtain the ester body of desirable protein matter.
The partial peptide of GPR40 or its salt can be according to the synthetic methods of known peptide itself, or by making with suitable peptidase cut-out GPR40.As the synthetic method of peptide, for example, any of solid-phase synthesis, liquid phase synthesizing method all can.That is, break away from protecting group by making the partial peptide that can constitute GPR40 or aminoacid and nubbin carry out condensation and having at product under the situation of protecting group, but the manufacturing purpose peptide.As the disengaging of known method of condensing or protecting group, for example, can list following a)～e) method of middle record.
A) M.Bodanszky and M.A.Ondetti, peptide synthesizes (Peptide Synthesis), IntersciencePublishers, New York (1966)
B) Schroeder and Luebke, peptide (The Peptide), Academic Press, New York (nineteen sixty-five)
C) spring room letter husband he, synthetic basis of peptide and experiment, ball is apt to (strain) (1975)
D) vow that bright Yi is controlled on the island Ji the former person of outstanding talent of Sakaki is flat, biochemical experiment lecture 1, proteinic chemical IV, 205, (1977)
E) the arrow island is controlled bright prison and is repaiied the synthetic wide river of exploitation the 14th volume peptide bookstore of continuous pharmaceuticals
In addition, the method for refining that the reaction back is common, solvent extraction for example capable of being combined, distillation, column chromatography, liquid chromatography, recrystallize wait the refining partial peptide of the present invention that separates.The partial peptide that obtains with said method is under the situation of episome, is changed to suitable salt by known method is variable, under the situation that mutually anticaustic salt obtains, can be transformed to suitable episome by known method.
As the polynucleotide of coding GPR40, get final product so long as contain base sequence (DNA or RNA, the preferred DNA) person of the above-mentioned GPR40 that encodes.As these polynucleotide, be the RNA such as DNA, mRNA of coding GPR40, two strands or strand all can.Under the double-stranded situation, the mixing of double-stranded DNA, double-stranded RNA or DNA: RNA all can.Under the situation of strand, positive-sense strand (being coding strand) and antisense strand (that is noncoding strand) all can.
Use the polynucleotide of coding GPR40, for example, according to the methods of known experimental medicine supplementary issue " new PCR and application thereof " 15 (7), 1997 records or based on its method, the quantitatively mRNA of GPR40.
As the DNA of coding GPR40, genomic DNA, genomic DNA storehouse, from the cDNA of above-mentioned cell tissue, all can from the cDNA storehouse of above-mentioned cell tissue, in the synthetic DNA any.The carrier that uses in the storehouse, any in phage, plasmid, cosmid, the phasmid (phagemid) etc. all can.In addition, use has been modulated total DNA or mRNA part person by above-mentioned cell tissue and can directly have been passed through reverse transcription-polymerase chain reaction (Reverse Transcriptase Polymerase Chain Reaction) (below, abbreviate the RT-PCR method as) and amplify.
Specifically, DNA as coding GPR40, for example so long as contain useful serial number: 2, serial number: 4, serial number: 6, serial number: 8 or serial number: the DNA of 10 represented base sequences, perhaps, have and use serial number: 2, serial number: 4, serial number: 6, serial number: 8 or serial number: the base sequence that 10 represented base sequences are hybridized under highly rigorous condition, to have and use serial number: 1, serial number: 3, serial number: 5, serial number: 7 or serial number: the activity of the GPR40 essence homogeneity that 9 represented aminoacid sequences constitute (for example, ligand is in conjunction with activity, signal message transfer function etc.) receptor protein carries out coded DNA, anyly all can.
As can with use serial number: 2, serial number: 4, serial number: 6, serial number: 8 or serial number: the DNA of 10 represented base sequence hybridization, for example, can use and contain and use serial number: 2, serial number: 4, serial number: 6, serial number: 8 or serial number: 10 represented base sequences have about more than 85%, preferred DNA about more than 90%, the more preferably from about base sequence of 95% above homogeny etc.
Hybridization can be according to known method own or based on this method, for example the method for record etc. is carried out in molecular cloning (MolecularCloning) 2nd (J.Sambrook et al., Cold Spring Harbor Lab.Press, 1989).In addition, use under the situation in commercially available storehouse, can carry out according to the method for putting down in writing in the incidental operation instructions.More preferably can carry out according to highly rigorous condition.
This highly rigorous condition represents that for example na concn is about 19～40mM, is preferably about 19～20mM, and temperature is about 50～70 ℃, is preferably about 60～65 ℃.Preferred especially na concn is that about 19mM, temperature are about 65 ℃ situation.
More particularly, contain useful serial number as coding: the DNA of the mice GPR40 of the aminoacid sequence of 1 expression, use to contain useful serial number: the DNA of the base sequence of 2 expressions etc.
Contain useful serial number as coding: the DNA of the mice GPR40 of the aminoacid sequence of 3 expressions, use to contain useful serial number: the DNA of the base sequence of 4 expressions etc.
Contain useful serial number as coding: the DNA of the mice GPR40 of the aminoacid sequence of 5 expressions, use to contain useful serial number: the DNA of the base sequence of 6 expressions etc.
Contain useful serial number as coding: the DNA of the macaque GPR40 of the aminoacid sequence of 7 expressions, use to contain useful serial number: the DNA of the base sequence of 8 expressions etc.
Contain useful serial number as coding: the DNA of the hamster GPR40 of the aminoacid sequence of 9 expressions, use to contain useful serial number: the DNA of the base sequence of 10 expressions etc.
As the DNA of coding partial peptide of the present invention, all can so long as contain the base sequence person of the partial peptide of the invention described above of encoding.In addition, genomic DNA, genomic DNA storehouse, from the cDNA of above-mentioned cell tissue, all can from the cDNA storehouse of above-mentioned cell tissue, in the synthetic DNA any.The carrier that uses in the storehouse, phage, plasmid, cosmid, phasmid etc. all can.In addition, use and to have modulated mRNA part person by above-mentioned cell tissue and can directly amplify by reverse transcription-polymerization transcriptase chain reaction (Reverse TranscriptasePolymerase Chain Reaction) (being designated hereinafter simply as RT-PCR).
Specifically, DNA as coding partial peptide of the present invention, for example use (1) to have to contain and use serial number: 2, serial number: 4, serial number: 6, serial number: 8 or serial number: the DNA of the DNA part base sequence of 10 represented base sequences, perhaps (2) have and use serial number: 2, serial number: 4, serial number: 6, serial number: 8 or serial number: the base sequence that 10 represented base sequences are hybridized under highly rigorous condition, to have and use serial number: 1, serial number: 3, serial number: 5, serial number: 7 or serial number: (for example, ligand is in conjunction with activity for the activity of the GPR40 essence homogeneity that 9 represented aminoacid sequences constitute, signal message transfer function etc.) receptor protein carries out the DNA etc. of the part base sequence of coded DNA.
As can with use serial number: 2, serial number: 4, serial number: 6, serial number: 8 or serial number: the DNA of 10 represented base sequence hybridization, for example, can use and contain and use serial number: 2, serial number: 4, serial number: 6, serial number: 8 or serial number: 10 represented base sequences have about more than 85%, preferred DNA about more than 90%, the more preferably from about base sequence of 95% above homogeny etc.
Dna clone method as encode fully GPR40 or its partial peptide (the following GPR40 that abbreviates as sometimes), the synthetic DNA primer that use has the part base sequence of GPR40 amplifies by the PCR method, the DNA that perhaps will make up in appropriate carriers uses the part of coding GPR40 or the DNA part or the synthetic DNA labelling in full field, by selecting with tagger's hybridization.The method of hybridization for example can be carried out according to the method for record among molecular cloning (Molecular Cloning) 2nd (J.Sambrook et al., Cold Spring Harbor Lab.Press, 1989) etc.In addition, use under the situation in commercially available storehouse, can carry out according to the method for putting down in writing in the incidental operation instructions.
The conversion of DNA base sequence can be used PCR or known method, for example, and Mutan TM-superExpress Km (precious wine is made (strain)), Mutan TM-K (precious wine is made (strain)) etc. carry out according to own known method such as ODA-LAPCR method, breach reparation (Gapped duplex) method, Kunkel methods or based on their method.
The DNA of GPR40 of coding cloning can keep intact according to purpose, perhaps according to the enzymic digestion of expectation available constraints, and can add connexon and uses.This DNA can have the ATG that begins codon as translation at its 5 ' end side, has TAA, TGA or the TAG that ends codon as translation at 3 ' end side.Codon is ended in these translation beginning codons or translation, also can use the adaptive son of suitable synthetic DNA additional.
The expression vector of GPR40, for example, (1) cuts out DNA part as purpose by the DNA of coding GPR40, and (2) are linked to the promoter downstream in the suitable expression with this DNA part and make.
As carrier, (for example can use from colibacillary plasmid, pBR322, pBR325, pUC12, pUC13), from the plasmid of hay bacterium (for example, pUB110, pTP5, pC194), from zymic plasmid (for example, pSH19, pSH15), animal viruss such as phage, retrovirus, vaccinia virus, baculovirus such as bacteriophage lambda etc., also have pA1-11, pXT1, pRc/CMV, pRc/RSV, pcDNAI/Neo etc.
As the promoter of using among the present invention, so long as all can corresponding to the suitable promoter of the host who in gene expression, uses.For example, using under the situation of zooblast as the host, can list: SR α promoter, SV40 promoter, LTR promoter, CMV promoter, HSV-TK promoter etc.
Wherein, preferably use CMV promoter, SR α promoter etc.The host is under the situation of Escherichia, preferred trp promoter, lac promoter, recA promoter, λ P LPromoter, Ipp promoter etc.; The host is that bacillus cereus (Bacillus) belongs under the situation of bacterium, preferred SPO1 promoter, SPO2 promoter, penP promoter etc.; The host is under the zymic situation, preferred PHO5 promoter, PGK promoter, GAP promoter, ADH promoter etc.The host is under insecticide Fine born of the same parents' the situation, preferred polyhedron promoter, P10 promoter etc.
In expression vector, except that above,, can use and contain enhancer, splicing signal, many A additional signal, selected marker, SV40 and duplicate persons such as origin (below, abbreviate SV40ori sometimes as) according to expectation.As selected marker, for example can list: dihydrofolate reductase (below, abbreviate dhfr sometimes as) gene [methotrexate (MTX) patience], ampicillin tolerance gene (below, abbreviate Amp sometimes as r), the neomycin tolerance gene (below, abbreviate Neo sometimes as r, G418 patience) etc.Particularly, use CHO (dhfr -) cell and when using the dhfr gene as selected marker, even utilize the culture medium that does not contain thymidine also can not select genes of interest.
In addition, as required, at the additional signal sequence that is suitable for the host of the N-terminal side of receptor protein of the present invention.When the host belongs to bacterium for dust Xi Shi, can utilize PhoA signal sequence, OmpA signal sequence etc., when the host is the bacillus bacterium, can utilize α-Dian Fenmei signal sequence, subtilisin signal sequence etc., when the host is yeast, MF alpha signal sequence, SUC2 signal sequence etc. can be utilized, when the host is zooblast, insulin signaling sequence, alpha-interferon signal sequence, antibody molecule signal sequence etc. can be utilized.
Use contains the carrier of the DNA of the GPR40 that coding so constructs, can make transformant.
As the host, for example can using, dust Xi Shi belongs to bacterium, bacillus bacterium, yeast, insect cell, insecticide, zooblast etc.
Concrete example as the Escherichia bacterium, can use dust Xi Shi escherichia coli (Escherichia coli) K12-DH1 (Proceedings of the National Academy of Sciences of the USA (Proc.Natl.Acad.Sci.USA), 60 volumes, 160 (1968)), JM103 (nucleic acids research (Nucleic Acids Research), 9 volumes, 309 (1981)), JA221 (molecular biology magazine (Journal of Molecular Biology), 120 volumes, 517 (1978)), HB101 (molecular biology magazine, 41 volumes, 459 (1969)), C600 (hereditism (Genetics), 39 volumes, 440 (1954)) etc.
As the bacillus bacterium, for example, can use bacillus subtilis (Bacillus subtilis) MI114 (Gene, 24 volumes, 255 (1983)), 207-21 (journal of biological chemistry (Journal of Biochemistry), 95 volumes, 87 (1984)) etc.
As yeast, for example, can use saccharomyces cerevisiae (Saccharomyces cerevisiae) AH22, AH22R-, NA87-11A, DKD-5D, 20B-12, fission yeast bacterium (Schizosaccharomycespombe) NCYC1913, NCYC2036, methanol yeast bacterium (Pichia pastoris) etc.
As insect cell, for example, when virus is AcNPV, can use strain cell (Spodoptera frugiperda cell from burglar's moth larvae; The Sf cell), from the MG1 cell of cabbage looper (Trichoplusia ni) midgut, from the High Five of cabbage looper ovum TMCell, from the cell of lopper worm (Mamestrabrassicae) or from cell of Estigmena acrea etc.When virus is BmNPV, can use strain cell (Bombyx mori N from silkworm; The BmN cell) etc.As The Sf cell, for example, can use Sf9 cell (ATCC CRL1711), Sf21 cell (more than, Vaughn, J.L. etc., In Vivo, 13,213-217, (1977)) etc.
As insecticide, for example, can use (preceding field etc., nature (Nature), 315 volumes, 592 (1985)) such as larvas of silkworm.
As zooblast, for example, can use MC COS-7, Vero, Chinese hamster cell CHO (below, abbreviate Chinese hamster ovary celI as), dhff gene owe to decrease Chinese hamster cell CHO (below, abbreviate CHO (dhff as -) cell), mouse Lcell, mice AtT-20, murine myeloma cell, rat GH3, people FL cell etc.
In order to transform the Escherichia bacterium, for example, can be according to Proceedings of the National Academyof Sciences of the USA (Proc.Natl.Acad.Sci.USA), 69 volumes, 2110 (1972) or gene (Gene), 17 volumes, 107 (1982) methods of putting down in writing in waiting are carried out.
For transforming bacillus belongs to bacterium, for example, can be according to Molecular ﹠amp; General Genetics, 168 volumes, 111 (1979) methods of putting down in writing in waiting are carried out.
For transformed yeast, for example, can be according to Methods in Enzymology, 194 volumes, 182-187 (1991), Proceedings of the National Academy of Sciences of the USA (Proc.Natl.Acad.Sci.USA), 75 volumes, 1929 (1978) methods of putting down in writing in waiting are carried out.
In order to transform insect cell or insecticide, for example, can be according to Bio/Technology, 6, the method for record is carried out among the 47-55 (1988) etc.
For the transformed animal cell, for example, can carry out according to the method for record in " the other volume 8 new cell engineering experiment protocols (cell Gong Do volume 8 new cell Gong experiment Port ロ ト コ one Le) of cell engineering; 263-267 (1995) (the elegant society of moistening issues) ", " virology (Virology); 52 volumes, 456 (1973) ".
Like this, can obtain the transformant that is transformed with the expression vector of DNA that contains the GPR40 that encodes.
When the cultivation host is the transformant of Escherichia bacterium, bacillus bacterium, the culture medium of using during as cultivation, the preferred liquid culture medium can contain materials such as the required carbon source of this transformant growth, nitrogenous source, inorganic matter therein.As carbon source, for example can list: glucose, dextrin, soluble starch, sucrose etc.; As nitrogenous source, for example can list: inorganic or organic substances such as ammonium salt class, Nitrates, Semen Maydis pulp, peptone, casein, meat extract, soybean cake, Rhizoma Solani tuber osi extracting solution; As inorganic matter, for example can list: calcium chloride, sodium dihydrogen phosphate, magnesium chloride etc.; In addition, also can add yeast extract, vitamins, positive growth factor etc.The pH value of culture medium preferably about 5～8.
Culture medium during as cultivation Escherichia bacterium, M9 culture medium (the Miller that for example preferably contains glucose, acid hydrolysis casein, (Journal of Experiments in Molecular Genetics), 431-433, Cold Spring Harbor Laboratory, New York 1972).In order to start promoter as required effectively, for example can add the medicament of 3 β-indole acrylic acid salt and so at this.
When the host is the Escherichia bacterium, under about 15～43 ℃ of temperature, carry out usually cultivating in about 3～24 hours, also can ventilate or stir as required.
When the host is the bacillus bacterium, under about 30～40 ℃ of temperature, carry out usually cultivating in about 6～24 hours, also can ventilate or stir as required.
When the cultivation host is zymic transformant, as culture medium, for example can list, Burkholder minimal medium (Bostian, K.L etc., Proceedings of the National Academy of Sciences ofthe USA (Proc.Natl.Acad.Sci.USA), 77 volumes, 4505 (1980)) or contain the SD culture medium (Bitter of 0.5% acid hydrolysis casein, G A. etc., Proceedings of the National Academy of Sciences ofthe USA (Proc.Natl.Acad.Sci.USA), 81 volumes, 5330 (1984)).The pH value of culture medium preferably is adjusted into about 5～8.Usually under about 20～35 ℃ of temperature, carry out cultivating in about 24～72 hours, can ventilate or stir as required.
When the cultivation host is the transformant of insecticide Fine born of the same parents or insecticide,, can use (Grace at Grace ' sInsect Medium as culture medium, T.C.C., nature (Nature), 195,788 (1962)) suitable additive persons such as 10% Ox blood serum that add non-movingization etc. in.The pH value of culture medium preferably is adjusted into about 6.2～6.4.Usually under about 27 ℃ of temperature, carry out cultivating in about 3～5 days, can ventilate or stir as required.
When the cultivation host is the transformant of zooblast, as culture medium, for example, can use the MEM culture medium (science (Science) that contains 5～20% the fetal bovine serum of having an appointment, 122 volumes, 501 (1952)), DMEM culture medium (virology (Virology), 8 volumes, 396 (1959)), RPMI 1640 culture medium ((TheJournal of the American Medical Association) 199 volumes, 519 (1967)), 199 culture medium ((Proceeding of the Society for the Biological Medicine), 73 volumes, 1 (1950)) etc.PH value preferably about 6～8.Usually under about 30～40 ℃ of temperature, carry out cultivating in about 15～60 hours, can ventilate or stir as required.
As mentioned above, can be in the cell of transformant, cell membrane or extracellular generate GPR40.
For separation and purification GPR40 from above-mentioned culture, for example can use following method to carry out.
When from cultivate thalline or cell, extracting GPR40, after the cultivation, collect thalline or cell with known method, it is suspended in the suitable buffer, utilize ultrasound wave, lysozyme and/or freezing melt etc. destroy thalline or cell after, the suitable method etc. that obtains the crude extract of GPR40 by centrifugalize or filtration etc. of using.Can contain protein denaturant or Triton X-100 such as carbamide or guanidine hydrochloride in the buffer TMIn surfactant.When in culture fluid, secreting GPR40, after cultivation finishes,, collect supernatant with itself known method separating thallus or cell and supernatant.
The GPR40's that contains in culture supernatant of Huo Deing or the extracting solution is refining like this, the known separation and purification method of combination that can be suitable itself and carrying out.As these known separation and purification methods, can use and saltout or solvent precipitation etc. utilizes the method for dissolubility; Dialysis, ultrafiltration, gel filtration and SDS-polyacrylamide gel electrophoresis etc. are mainly utilized the method for molecular weight difference; Ion exchange chromatographies etc. utilize the method for charged difference; The affinity chromatography is utilized the method for pathoklisis; Anti-phase high performance liquid chromatography (HPLC) etc. utilizes the method for hydrophobic difference; Isoelectric point, IP electrophoresis method etc. utilizes the method for isoelectric point, IP difference etc.
When the form with episome obtains the GPR40 of gained like this, can be by known method own or based on this method conversion salify, when obtaining with the form of salt on the contrary, can be transformed into episome or other salt by known method own or based on this method.
Moreover the GPR40 of generation recon by suitable protein modification enzyme effect, at random adds modification before refining or after refining, can partly remove polypeptide.As the protein modification enzyme, for example can use trypsin, Chymotrypsin, arginyl endopeptidase (arginyl endopeptidase), protein kinase, glycosidase etc.
Like this activity of the GPR40 that generates can be by measuring with the enzyme immunoassay that combine experiment and use specific antibody of the ligand of institute labelling etc.
Below, carry out detailed narration about changing GPR40 with screening technique as the chemical compound of the associativity of the fatty acid of its physiology ligand (that is, with respect to other ligand, GPR40 agonist or GPR40 antagonist etc. of the GPR40).
As mentioned above, activate active because chemical compound of the present invention has GPR40, so by use GPR40 (containing the cell of express recombinant or endogenous GPR40 and cell membrane part thereof etc.) and as agency's (surrogate) ligand use chemical compound of the present invention in conjunction with the mensuration system, can from test compound, screen GPR40 ligand, agonist or antagonist effectively.
GPR40 ligand and agonist are to be incorporated into GPR40 and the physiological and unphysiologic chemical compound of showed cell stimulating activity (below, be also referred to as " GPR40 agonist ").
As cell-stimulating activity, for example can list: promotion or inhibition arachidonic acid dissociate, acetylcholine is free, the interior Ca of cell 2+The activity of the phosphorylation of the interior cAMP generation of free, cell, intracellular cGMP generation, inositol monophosphate generation, cell membrane potential change, intracellular protein, the activation of c-fos, pH value reduction etc. etc., the particularly interior Ca of cell 2+The concentration rising is active, the interior cAMP of cell generates and suppresses activity.
The GPR40 antagonist is to be incorporated into GPR40, but does not show the chemical compound of this cell-stimulating activity or demonstration and this cell-stimulating activity opposite effect (the contrary activity that activates).That is, " the GPR40 antagonist " in this description as notion, not only comprises neutral antagonist but also comprises inverse agonist.
In addition, the screening technique of the application of the invention can screen the chemical compound of the adhesion that strengthens fatty acid and GPR40 or also can screen the chemical compound of the adhesion that reduces fatty acid and GPR40.
Promptly, the invention provides the screening technique of a kind of GPR40 agonist or GPR40 antagonist, it is characterized in that: carry out (i) GPR40 and the contacted situation of chemical compound of the present invention and the (ii) comparison of GPR40 and chemical compound of the present invention and the contacted situation of test compound.
In screening technique of the present invention, it is characterized in that: the chemical compound for example of the present invention in the time of to (i) and is (ii) measured and is compared with respect to the binding capacity of GPR40, cell-stimulating activity etc.
More particularly, the invention provides:
A) screening technique of a kind of GPR40 agonist or GPR40 antagonist, it is characterized in that: when the chemical compound of the present invention of labelling contacts with GPR40 making and when the chemical compound of the present invention of institute's labelling and test compound are contacted with GPR40, measure also relatively the chemical compound of the present invention of institute's labelling for the binding capacity of this GPR40;
B) screening technique of a kind of GPR40 agonist or GPR40 antagonist, it is characterized in that: when the chemical compound of the present invention of labelling contacts with the membrane portions of the cell that contains GPR40 or this cell making and when the chemical compound of the present invention of institute's labelling and test compound are contacted with the membrane portions of the cell that contains GPR40 or this cell, measure also relatively the chemical compound of the present invention of institute's labelling for the binding capacity of this cell or this membrane portions;
C) screening technique of a kind of GPR40 agonist or GPR40 antagonist, it is characterized in that: when the GPR40 that the chemical compound of the present invention of labelling is expressed on cell membrane with containing the transformant of GPR40 DNA by cultivation making contacts and when the chemical compound of the present invention of institute's labelling and GPR40 that test compound is expressed on cell membrane with containing the transformant of GPR40 DNA by cultivation are contacted, measure also relatively the chemical compound of the present invention of institute's labelling for the binding capacity of GPR40;
D) screening technique of a kind of GPR40 agonist or GPR40 antagonist is characterized in that: in the presence of test compound and in the presence of non-, measure the cell-stimulating activity by means of GPR40 in the cell that contains GPR40 respectively, and compare both;
E) screening technique of a kind of GPR40 agonist or GPR40 antagonist, it is characterized in that: in the presence of test compound and in the presence of non-, measure respectively by cultivation and contain the transformant of GPR40 DNA and the GPR40 that expresses is the cell-stimulating activity of media on cell membrane, and relatively both;
F) screening technique of a kind of GPR40 agonist or GPR40 antagonist, it is characterized in that: when making chemical compound of the present invention and containing the cells contacting of GPR40 and when making chemical compound of the present invention and test compound and containing the cells contacting of GPR40, measure and comparison by means of the cell-stimulating activity of GPR40; And
G) screening technique of a kind of GPR40 agonist or GPR40 antagonist, it is characterized in that: when the GPR40 that chemical compound of the present invention is expressed on cell membrane with containing the transformant of GPR40 DNA by cultivation contacts and the GPR40 that chemical compound of the present invention and test compound are expressed on cell membrane with containing the transformant of GPR40 DNA by cultivation when contacting, measure and relatively by means of the cell-stimulating activity of GPR40.
Chemical compound of the present invention is compared with the fatty acid as natural ligand, and easy labelling is so be suitable for screening.
As test compound, for example can use peptide, protein, non-peptide chemical compound, synthetic compound, fermenting and producing thing, cell extract, plant extraction liquid, animal tissue's extracting solution etc., these chemical compounds both can be novel chemical compounds, can also be known chemical compounds.
Test compound also can form salt, as the salt of test compound, can use the salt of compatible acid of physiology (for example, mineral acid etc.) or alkali (for example, organic acid etc.) etc., the preferred especially compatible acid-addition salts of physiology.As such salt, for example can use with mineral acid (for example, hydrochloric acid, phosphoric acid, hydrobromic acid, sulphuric acid etc.) salt or with the salt of organic acid (for example, acetic acid, formic acid, propanoic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid etc.).
In addition, as test compound, based on the position of atomic coordinates and ligand land (the binding pocket) of GPR40 active site, the preferred chemical compound that designs in order to combine that uses with the ligand land.The mensuration of the position of the atomic coordinates of GPR40 active site and ligand land can be used known method or carries out based on this method.
Below specifically describe screening technique of the present invention.
At first, as the GPR40 that uses in the screening technique of the present invention, as long as contain above-mentioned GPR40, but the best is the cell membrane part that contains the mammiferous internal organs of GPR40.But, because the extremely difficult internal organs that obtain from the people, thus as employed GPR40 in the screening, preferably use recon and great expression from people's GPR40 etc.
In order to make GPR40, use said method, but preferably by carrying out with mammalian cell or insect cell expression GPR40 DNA.Use complementary DNA in the DNA part of coding destination protein matter part, but not restricted by this.For example, also can use gene part or synthetic DNA.In order in host animal cell, to import GPR40 DNA part, this is expressed effectively, preferably this DNA part group is gone into to belong to nuclear polyhedrosis virus (the nuclear polyhedrosis virus of insecticide as host's baculovirus; The downstream of polyhedral body promoter NPV), promoter, metallothioneins promoter, human heat shock promoter, cytomegalovirus promoter, SR α promoter etc. from the promoter of SV40, retrovirus.The amount of expressed receptor protein and the inspection of matter can be carried out with known method own.For example, can carry out according to the method for record in the document [Nambi, P. etc., The Journal of biological chemistry (J.Biol.Chem.), 267 volumes, 19555～19559 pages, 1992].
Therefore, in screening technique of the present invention,, can be according to the purified GPR40 of itself known method as containing GPR40 person, both can use the cell that contains this GPR40, also can use the membrane portions of the cell that contains this GPR40.
In screening technique of the present invention, use when containing the cell of GPR40, can use glutaraldehyde, formalin etc. with this cell fixation.Process for fixation can carry out according to itself known method.
As the cell that contains GPR40, be meant the host cell of having expressed this GPR40, as this host cell, be preferably escherichia coli, hay bacterium, yeast, insect cell, zooblast etc.
As cell membrane part, be meant smudge cells after, contain the part of the cell membrane that itself known method of a large amount of usefulness obtains.As the breaking method of cell, can list: with Potter-Elvehjem type homogenizer with cell squeeze broken method, with Waring blender or the fragmentation of multistable element (polytron) (kinematica society system), hyperacoustic fragmentation, wait pressurization and cell sprayed and fragmentation etc. from thinner nozzle with French cell press (french press).The fractionated of cell membrane mainly uses fractional centrifugation partition method or density gradient centrifugation etc. to utilize the fractionated method of centrifugal force.For example, cell breakage liquid is centrifugal with low speed (500～3000rpm) short time (usually, about 1～10 minute), again with supernatant with at a high speed (15000～30000rpm) carry out usually 30 minutes～2 hours centrifugal, with the precipitation that obtained as membrane portions.In this membrane portions, contain expressed GPR40 in a large number and from film components such as the phospholipid of cell or memebrane proteins.
The amount that contains cell or the GPR40 in the membrane portions of GPR40, preferred per 1 cell is 10 3～10 8Molecule, more preferably 10 5～10 7Moreover the ligand of every membrane portions is high more in conjunction with active (specific activity) more at most for expression, not only can construct highly sensitive screening system, and can measure a large amount of samples in same group.
For implement to screen GPR40 agonist or antagonist above-mentioned a)～c), for example, the suitable GPR40 part and the chemical compound of the present invention of institute's labelling are necessary.
As GPR40 part, the GPR40 of preferred natural type part or have equal active recombinant type GPR40 part etc. therewith.Be meant that with isoreactivity equal ligand is in conjunction with activity, signal message transfer function etc. herein.
As the chemical compound of the present invention of institute's labelling, for example can use by ( 3H), ( 125I), 14C), ( 35S) etc. labellings such as radiosiotope, fluorescent material, enzyme chemical compound of the present invention.
Specifically, when carrying out the screening of GPR40 agonist or antagonist, at first the outstanding turbid membrane portions that contains cell or the cell of GPR40 in the buffer that is fit to screening is modulated the GPR40 standard substance.The phosphate buffer, Tris hydrochloride buffer etc. of (preferred pH value 6～8) can not hinder the bonded buffer of ligand and GPR40 and get final product buffer so long as pH value 4～10.In addition, be purpose to reduce non-specific binding, also can in buffer, add CHAPS, Tween-80 TMSurfactants such as (flower king-Atras society), digitonin, deoxycholic acid.Moreover, GPR40 that causes with the Profilin enzyme or test compound (peptide chemical compound) be decomposed into purpose, also can add protease inhibitor such as PMSF, leupeptin, E-64 (peptide institute system), pepstatin.In this receptor protein solution of 0.01～10ml, add a certain amount of (5000～500000cpm) labelling ligand, coexist 10 simultaneously -4M～10 -10The test compound of M.In order to know non-specific binding amount (NSB), also to prepare to have added the reaction tube of excessive unlabelled The compounds of this invention.React under about 0～50 ℃, preferred about 4～37 ℃, carried out approximately 20 minutes～24 hours, preferred about 30 minutes～3 hours.After the reaction, filter, after cleaning with an amount of same buffer, utilize liquid scintillation counter or γ-enumerator to measure remaining radioactivity on the glass fiber filter paper with glass fiber filter paper etc.Count value (B with from no antagonistic substance the time 0) deduct the count value (B that non-specific binding amount (NSB) obtains 0-NSB) be 100% o'clock, for example be that test compound below 50% is selected as having the candidate substance that antagonism hinders ability with specificity binding capacity (B-NSB).
In order to implement to screen the above-mentioned d of GPR40 agonist or antagonist)～g) method, for example, can use known method or commercially available mensuration with medicament box measure cell-stimulating activity by means of GPR40 (for example, promote or suppress that arachidonic acid is free, acetylcholine is free, Ca in the cell 2+The activity of the phosphorylation of the interior cAMP generation of free, cell, intracellular cGMP generation, inositol monophosphate generation, cell membrane potential change, intracellular protein, the activation of c-fos, pH value reduction etc. etc., the particularly interior Ca of cell 2+CAMP generates and suppresses activity in concentration rising activity, the cell).
Specifically, at first, in porous cell culture plate (multiwell plates) etc., cultivate the cell that contains GPR40.When screening, not show in the toxic buffer in fresh culture medium or for cell in advance to exchange that interpolation test compound etc. extract cell or reclaim supernatant, according to the quantitative product that generates of method separately after the certain hour hatching.Become material (for example, the Ca of the index of cell-stimulating activity 2+, cAMP etc.) generation, when the catabolic enzyme that is contained by cell is difficult to identify, can adds for the inhibitor of this catabolic enzyme and measure.In addition, the activity that generate to suppress etc. about cAMP can detect with the generation inhibitory action of Buddhist SCH conducts such as (Forskolin) to the cell of the basic generation increase that makes cell.
Measure cell-stimulating activity and when screening, the cell of having expressed suitable GPR40 is necessary.As the cell of having expressed GPR40, preferably have natural type GPR40 cell strain, expressed the cell strain of above-mentioned recombinant type GPR40 etc.
The chemical compound that utilizes screening to obtain is GPR40 agonist or GPR40 antagonist, and concrete evaluation methodology can or (ii) be carried out according to following (i).
(i) carry out above-mentioned screening technique a)～c), obtained changing after the compound or its salt of chemical compound of the present invention and the associativity (especially suppressing to combine) of GPR40, measure this compound or its salt and whether have above-mentioned cell-stimulating activity.Compound or its salt with this cell-stimulating activity is an agonist, and the compound or its salt that does not have this cell-stimulating activity is an antagonist.
(ii) (a) makes test compound and the cells contacting that contains GPR40, measures above-mentioned cell-stimulating activity.Chemical compound with cell-stimulating activity is the agonist for GPR40.
(b) measure when making chemical compound of the present invention and the cell-stimulating activity when making chemical compound of the present invention and test compound and containing the cells contacting of GPR40, and compare with the cells contacting that contains GPR40.The test compound that can make the cell-stimulating activity minimizing that causes because of chemical compound of the present invention is the antagonist for GPR40.
More particularly, can use the evaluation criterion of record among the embodiment 202.
The kit that screening GPR40 agonist or GPR40 antagonist are used is to contain chemical compound of the present invention and GPR40, contain the cell of GPR40 or contain the kit of membrane portions of the cell of GPR40.
Example as screening with medicament box of the present invention can be listed below.
1. screen and use reagent
A) measure with buffer and the clean buffer of using
In Hanks ' balanced salt solution (Gibco society system), add 0.05% bovine serum albumin (Sigma society system).
With the membrane filtration sterilization of aperture 0.45 μ m, preserve down at 4 ℃, perhaps modulation also can in use.
B) GPR40 standard substance
To express the Chinese hamster ovary celI of GPR40, in 12 well culture plates with 5 * 10 5The cultivation of going down to posterity of individual/hole is in 37 ℃, 5%CO 2, 95% air cultivated 2 days down.
C) chemical compound of the present invention that has identified (below, be called labelled compound)
Utilize commercially available ( 3H), ( 125I), ( 14C), ( 35S) etc. labelling chemical compound of the present invention.The aqueous solution state person utilizes to measure to be diluted to 1 μ m with buffer in 4 ℃ or-20 ℃ of preservations in use.
D) titer of chemical compound of the present invention (hereinafter referred to as the nonlabelled compound titer)
Dissolve chemical compound of the present invention to 1mM with the PBS that contains 0.1% bovine serum albumin (Sigma society system), preserve down in-20 ℃.
2. algoscopy
A) will express at the GPR40 that 12 hole tissue cultures cultivate in culture plate Chinese hamster ovary celI with measure clean 2 times with buffer 1ml after, in each hole, add the mensuration buffer of 490 μ l.
B) add 10 -3～10 -10After the test compound solution 5 μ l of M, add 5 μ l mark compounds, reaction is 1 hour under room temperature.In order to know the non-specific binding amount, add 10 -3The non-mark compounds titer (10 of M -3M) 5 μ l replace test compound.
C) remove reactant liquor, clean 3 times with cleaning of 1ml with buffer.Dissolve the sign ligand that is incorporated into cell with 0.2N NaOH-1%SDS, and mix with the flash liquid agent A (with the pure medicine system of light) of 4ml.
D) use liquid scintillation counter (Beckman society system) to measure radioactivity, ask with following formula and calculate PercentMaximum Binding (PMB).
PMB＝[(B-NSB)/(B 0-NSB)]×100
PMB：Percent Maximum Binding
B: the value when adding sample
NSB:Non-specific Binding (non-specific binding amount)
B 0: Bmax
Screening technique of the present invention is characterised in that: will use GPR40 and as the chemical compound of the present invention that fatty acid screened of its endogenous ligand as acting on behalf of ligand, screening GPR40 agonist or GPR40 antagonist.Use relevant synthetic ligand, thereby consider that easily tagged-ligand screens the aspect effectively, use the endogenous ligand of natural goods favourable.
The compound or its salt that uses screening technique of the present invention or screening with medicament box to obtain is GPR40 agonist or GPR40 antagonist.
Use GPR40 agonist that screening technique of the present invention or screening with medicament box obtain or GPR40 antagonist etc. can form salt, as such salt, (for example can use the acid compatible with the physiology, inorganic salt etc.) or alkali (for example, organic acid etc.) etc. salt, the especially preferably compatible acid-addition salts of physiology.As this salt, for example can use with mineral acid (for example, hydrochloric acid, phosphoric acid, hydrobromic acid, sulphuric acid) salt or with salt of organic acid (for example, acetic acid, formic acid, propanoic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) etc.
The GPR40 agonist owing to have and the identical effect of the physiologically active that fatty acid had that for GPR40 is ligand, uses so can be used as safe and hypotoxic medicine according to the physiologically active that fatty acid had.
The GPR40 antagonist is because can to suppress for GPR40 be the physiologically active that fatty acid had of ligand, so can be used as the safety and the hypotoxic medicine use of the physiologically active that is used to suppress fatty acid.
Strengthening the chemical compound of the adhesion of fatty acid and GPR40, is the physiologically active that fatty acid had of ligand owing to can strengthen for GPR40, uses so can be used as safe and hypotoxic medicine according to the physiologically active that fatty acid had.
Reducing the chemical compound of fatty acid and the adhesion of GPR40, is the physiologically active that fatty acid had of ligand owing to can reduce for GPR40, so can be used as the safety and the hypotoxic medical use of the physiologically active that is used to suppress fatty acid.
Specifically; use (i) GPR40 agonist that screening technique of the present invention or screening with medicament box obtain or the compound or its salt that (ii) strengthens the adhesion of fatty acid and GPR40; for example; as for diabetes; glucose intolerance; ketosis; acidosis; the diabetic mental disorder; diabetic nephropathy; the diabetic retinopathy; hyperlipidemia; sexual dysfunction; dermatosis; arthritis; osteopenia disease; arteriosclerosis; thrombotic disease; dyspepsia; the prophylactic treatment agent of diseases such as learning memory disorder; pancreas function controlling agent (for example, pancreas function improving agent); insulin secretion stimulators; the blood glucose depressant; the pancreatic beta cell protective agent is useful.Diabetes comprise insulin-dependent (I type) diabetes, insulin independent form (II type) diabetes, gestational diabetes etc.
Use (i) that screening technique of the present invention or screening with medicament box obtain for the antagonist of GPR40 or (ii) reduce the compound or its salt of the adhesion of fatty acid and GPR40; for example; as for obesity; hyperlipidemia; type 2 diabetes mellitus; hypoglycemia; hypertension; the diabetic mental disorder; diabetic nephropathy; the diabetic retinopathy; edema; the insulin resistance syndrome; unstable diabetes; lipoatrophy; insulin allergy disease; insulinoma; arteriosclerosis; thrombotic disease; fat toxicity; hyperinsulinemia; the prophylactic treatment agent of diseases such as cancer; pancreas function controlling agent (for example, pancreas function improving agent); the insulin secretion inhibitor; the pancreatic beta cell protective agent; the blood sugar increasing agent is useful.Herein, hyperlipidemia comprises hypertriglyceridemia, high blood cholesterol disease, low blood HDL disease, food back hyperlipidemia etc.Especially, effective to hypoglycemia for the antagonist of GPR40, similarly effective to type 2 diabetes mellitus by (protection of pancreatic beta cell) tired out of the pancreatic beta cell that prevents to produce because of too much insulin secretion by suppressing superfluous insulin secretion.
The GPR40 agonist or the GPR40 antagonist that use screening technique of the present invention or screening with medicament box to obtain can be with above-mentioned and be used in combination with medicine.At this moment, use GPR40 agonist that screening technique of the present invention or screening with medicament box obtain or GPR40 antagonist and and do not limit with the administration time of medicine, for the administration object, administration simultaneously, but also difference ground administration blanking time.And with the dosage of medicine, can suit to select as benchmark with use amount clinically.In addition, the GPR40 agonist or the GPR40 antagonist and the proportioning of also using medicine that use screening technique of the present invention or screening with medicament box to obtain can suit to select according to administration object, route of administration, object disease, symptom, combination etc.For example administration to as if man-hour, for example with respect to GPR40 agonist 1 weight portion, use 0.01～100 weight portion and get final product with medicine.
Use under the situation that GPR40 agonist that screening technique of the present invention or screening with medicament box obtain or GPR40 antagonist use as above-mentioned medicine, can with the medicine of the chemical compound that contains the invention described above preparationization similarly.
So carry out the preparation safety and the hypotoxicity that are obtained, so can be for for example people or mammal (for example, rat, mice, rabbit, sheep, pig, cattle, cat, Canis familiaris L., monkey etc.) administration.
The dosage of GPR40 agonist or GPR40 antagonist, according to administration object, object organ, symptom, medication etc. and different, under the case of oral administration, generally for example, diabetics (body weight 60kg), give the about 0.1～100mg of GPR40 agonist every day, preferred about 1.0～50mg, more preferably from about 1.0～20mg.Under the non-case of oral administration, dosage once, according to administration object, object organ, symptom, medication etc. and different, for example with the form of injection, diabetics (body weight 60kg), give every day about the about 0.01～30mg of GPR40 agonist, about preferred about 0.1～20mg, be more preferably about about 0.1～10mg and pass through intravenous administration.Under the situation of other animal, can be scaled the amount administration of average weight 60kg.
For the present invention, further at length be illustrated, but these examples only are to implement that the present invention is defined in this, can change in the scope that does not break away from the scope of the invention according to following reference example, embodiment, formulation example and experimental example.
About 10 ℃ to about 35 ℃ of following reference example, " room temperature " ordinary representation among the embodiment.With regard to %, for yield, expression mol/mol%, for the solvent that in chromatography, uses, expression volume %, during other situation, expression weight %.For can not the affirmant with broad peaks such as proton N MR spectrum, OH or NH protons record data not then.
The meaning that other symbolic representation used herein is following.
S: unimodal (singlet)
D: doublet (doublet)
T: triplet (triplet)
Q: quartet (quartet)
M: multiplet (multiplet)
Br: broad peak (broad)
J: binding constant (coupling constant)
Hz: hertz (Hertz)
CDCl 3: heavy chloroform
DMSO-d 6: heavy dimethyl sulfoxide
1H NMR: proton magnetic resonance (PMR)
In this description and accompanying drawing, under symbolization base or the amino acid whose situation, based on the symbol of IUPAC-IUBCommission on Biochemical Nomenclature or the conventional symbol person in this field, it for example down.Have under the situation of optical isomer about aminoacid in addition, do not express especially, then represent the L body if having.
DNA: DNA (deoxyribonucleic acid)
CDNA: complementary DNA (cDNA)
A: adenine
T: thymus pyrimidine
G: guanine
C: cytosine
U: uracil
RNA: ribonucleic acid
MRNA: Messenger RNA
DATP: deoxyadenosine triphosphate
DTTP: deoxythymidine triphosphate
DGTP: deoxyguanosine triphosphate
DCTP: deoxycytidine triphosphate
ATP: adenosine triphosphate
EDTA: ethylenediaminetetraacetic acid
SDS: sodium lauryl sulphate
Gly: glycine
Ala: alanine
Val: valine
Leu: leucine
Ile: isoleucine
Ser: serine
Thr: threonine
Cys: cysteine
Met: methionine
Glu: glutamic acid
Asp: aspartic acid
Lys: lysine
Arg: arginine
His: histidine
Phe: phenylalanine
Tyr: tyrosine
Trp: tryptophan
Pro: proline
Asn: agedoite
Gln: glutamine
PGlu: pyroglutamic acid
*: corresponding to termination codon
Me: methyl
Et: ethyl
Bu: butyl
Ph: phenyl
TC: Thiazolidine-4 (R)-carboxamide groups
In addition, in this description frequent substituent group, protecting group and the reagent that uses with following symbolic representation.
Tos: p-toluenesulfonyl
CHO: formoxyl
Bzl: benzyl
Cl 2Bzl:2, the 6-dichloro benzyl
Bom: benzyloxymethyl
Z: benzyloxycarbonyl
Cl-Z:2-chlorine benzyloxycarbonyl
Br-Z:2-bromo-benzyloxy-carbonyl
Boc: tert-butoxycarbonyl
DNP: dinitrophenol,DNP
Trt: trityl
Bum: tert-butoxy methyl
Fmoc:N-9-fluorenyl methoxy carbonyl
The HOBt:1-hydroxybenzotriazole
HOOBt:3,4-dihydro-3-hydroxyl-4-oxygen-1,2,3-phentriazine
HONB:1-hydroxyl-5-norborene-2, the 3-dicarboximide
DCC:N, N '-dicyclohexylcarbodiimide
In following embodiment, mass spectrum (MS) is measured according to following condition.
Determining instrument: the ZMD of Waters society, the ZQ2000 of Waters society or the Platform II of Micromass society.
Ionizing method: electronic impact ionizing method (Electron Spray Ionization:ESI), or atmospheric pressure chemical ionizing method (Atmospheric Pressure Chemical Ionization:APCI).Do not have when special instruction, used ESI.
In addition, getting refining that HPLC carries out with branch and carry out among the embodiment according to following condition.
Divide and get the HPLC instrument: the high through-put of Gilson society refining system
Post: YMC Combiprep ODS-A S-5 μ m, 20 * 50mm
Solvent: A liquid; 0.1% trifluoroacetic acid contains water,
B liquid; 0.1% trifluoroacetic acid contains acetonitrile
Gradient circulation A: 0.00 minute (A liquid/B liquid=90/10), 1.20 minutes (A liquid/B liquid=90/10), 4.75 minutes (A liquid/B liquid=0/100), 7.30 minutes (A liquid/B liquid=0/100), 7.40 minutes (A liquid/B liquid=90/10), 7.50 minutes (A liquid/B liquid=90/10).
Gradient circulation B:0.00 branch (A liquid/B liquid=95/5), 1.00 minutes (A liquid/B liquid=95/5), 5.20 minutes (A liquid/B liquid=5/95), 6.40 minutes (A liquid/B liquid=5/95), 6.50 minutes (A liquid/B liquid=95/5), 6.60 minutes (A liquid/B liquid=95/5).
Flow velocity: 25ml/min, detection method: UV220nm
The serial number of this description sequence table is represented following sequence.
Serial number: 1
The aminoacid sequence of expression mice GPR40.
Serial number: 2
The cDNA base sequence of presentation code mice GPR40.
Serial number: 3
The aminoacid sequence of expression rat GPR40.
Serial number: 4
The cDNA base sequence of presentation code rat GPR40.
Serial number: 5
The aminoacid sequence of expression people GPR40.
Serial number: 6
The cDNA base sequence of presentation code people GPR40.
Serial number: 7
The aminoacid sequence of expression macaque GPR40.
Serial number: 8
The cDNA base sequence of presentation code macaque GPR40.
Serial number: 9
The aminoacid sequence of expression hamster GPR40.
Serial number: 10
The cDNA base sequence of presentation code hamster GPR40.
Serial number: 11
Be illustrated in the base sequence of the positive-sense strand primer that uses in the PCR reaction below with reference to example 129.
Serial number: 12
Be illustrated in the base sequence of the antisense strand primer that uses in the PCR reaction below with reference to example 129.
Serial number: 13
Be illustrated in the base sequence of the primer 1 that uses in the PCR reaction below with reference to example 130.
Serial number: 14
Be illustrated in the base sequence of the primer 2 that uses in the PCR reaction below with reference to example 130.
Serial number: 15
Be illustrated in the base sequence of the primer 3 that uses in the PCR reaction below with reference to example 131.
Serial number: 16
Be illustrated in the base sequence of the primer 4 that uses in the PCR reaction below with reference to example 131.
Serial number: 17
Be illustrated in the base sequence of the primer 1 that uses in the PCR reaction below with reference to example 132.
Serial number: 18
Be illustrated in the base sequence of the primer 2 that uses in the PCR reaction below with reference to example 132.
Serial number: 19
Be illustrated in the base sequence of the primer 3 that uses in the PCR reaction below with reference to example 132.
Serial number: 20
Be illustrated in the base sequence of the primer 4 that uses in the PCR reaction below with reference to example 132.
Serial number: 21
Be illustrated in the base sequence of the primer 1 that uses in the PCR reaction below with reference to example 133.
Serial number: 22
Be illustrated in the base sequence of the primer 2 that uses in the PCR reaction below with reference to example 133.
The transformant Escherichia coli TOP10/Zero Blunt-mGPR40 that reference example 130 described later obtains is deposited in the biological preservation of the Independent Administrative Leged Industrial Technology Complex Inst's patent center that a kind of ground of 1 fourth order, east, ripple city the 6th (postcode 305-8566) of 1 central authorities built in the Ibaraki, Japan from March 18th, 2002, preserving number is FERM BP-7967, be deposited in juridical person's fermentation research institute (IFO) of 13 raised path between farm fields 2-17-85 in river district, shallow lake, Osaka City, Japan (postcode 532-8686) from February 14th, 2002, preserving number is IFO16762.
The transformant Escherichia coli JM109/PCR2.1-rGPR40 that reference example 131 described later obtains is deposited in the biological preservation of Independent Administrative Leged Industrial Technology Complex Inst's patent center from March 18th, 2002, preserving number is FERM BP-7968, be deposited in juridical person's fermentation research institute (IFO) from February 14th, 2002, preserving number is IFO 16763.
The transformant Escherichia coli JM109/PCR2.1-monkeyGPR40 that reference example 132 described later obtains is deposited in the biological preservation of Independent Administrative Leged Industrial Technology Complex Inst's patent center from July 23rd, 2002, and preserving number is FERM BP-8125.
The transformant Escherichia coli JM109/pTA hamstarGPR40 that reference example 133 described later obtains, be deposited in the biological preservation of Independent Administrative Leged Industrial Technology Complex Inst's patent center as transformant Escherichia coli JM109/pTAhamsterGPR40 on the 11st from December in 2002, preserving number is FERMBP-8258.
Reference example 1 4-(phenyl methoxyl group) methyl phenylpropionate
In oxolane (5mL) solution of ice-cold 4-hydroxy phenylpropionic acid methyl ester (0.70g, 3.9mmol), benzylalcohol (0.48mL, 4.7mmol) and triphenylphosphine (1.2g, 4.7mmol), splash into diethylazodicarboxylate (0.73mL, 4.7mmol), mixture was stirred 2 hours down ice-cold.Add water in the reactant liquor, use ethyl acetate extraction.Behind the washing extracting solution, concentrating under reduced pressure.With the refining residue (hexane/ethyl acetate=17: 3) of silica gel column chromatography, with the Powdered table title chemical compound (0.62g, yield 59%) that obtains.
1H NMR(CDCl 3)δ2.59(2H，t，J＝7.5Hz)，2.89(2H，t，J＝7.5Hz)，3.66(3H，s)，5.04(2H，s)，6.90(2H，d，J＝8.6Hz)，7.11(2H，d，J＝8.6Hz)，7.29-7.44(5H，m)。
Reference example 2 4-(phenyl methoxyl group) benzenpropanoic acid
In methanol (20mL) suspension of 4-(phenyl methoxyl group) methyl phenylpropionate (0.60g, 2.2mmol), add 2 Equivalent Hydrogen aqueous solution of sodium oxide (2mL), mixture was stirred 15 hours down at 60 ℃.Add 2 equivalent hydrochloric acid (3mL) in the reactant liquor, use ethyl acetate extraction.Behind the washing extracting solution, concentrating under reduced pressure.By ethyl acetate-hexane recrystallize residue, obtain table title chemical compound (0.38g, yield 67%).Fusing point 123-124 ℃.
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.5Hz)，2.90(2H，t，J＝7.5Hz)，5.04(2H，s)，6.91(2H，d，J＝8.6Hz)，7.11(2H，d，J＝8.6Hz)，7.28-7.44(5H，m)。
Reference example 3 4-(2-phenyl ethoxy) methyl phenylpropionate
Method with identical with reference example 1 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and phenethanol.Yield 89%.
Oily.
1H NMR(CDCl 3)δ2.58(2H，t，J＝7.5Hz)，2.88(2H，t，J＝7.5Hz)，3.08(2H，t，J＝7.1Hz)，4.14(2H，t，J＝7.1Hz)，6.81(2H，d，J＝8.6Hz)，7.09(2H，d，J＝8.6Hz)，7.20-7.34(5H，m)。
Reference example 4 4-(2-phenyl ethoxy) benzenpropanoic acid
In methanol (3mL) solution of 4-(2-phenyl ethoxy) methyl phenylpropionate (0.65g, 2.3mmol), add 2 Equivalent Hydrogen aqueous solution of sodium oxide (3mL), mixed liquor was stirred 1 hour down at 50 ℃.Add 2 equivalent hydrochloric acid (2.5mL) in the reactant liquor, use ethyl acetate extraction.Behind the washing extracting solution, concentrating under reduced pressure.By ethyl acetate-hexane recrystallize residue, obtain table title chemical compound (0.50g, yield 81%).Fusing point 91-92 ℃.
1H NMR(CDCl 3)δ2.63(2H，t，J＝7.5Hz)，2.89(2H，t，J＝7.5Hz)，3.08(2H，t，J＝7.2Hz)，4.15(2H，t，J＝7.2Hz)，6.82(2H，d，J＝8.6Hz)，7.10(2H，d，J＝8.6Hz)，7.20-7.34(5H，m)。
Reference example 5 4-(3-phenyl propoxyl group) benzenpropanoic acid ethyl ester
N at ice-cold 4-hydroxy-benzenepropanoic acid ethylester (0.40g, 2.1mmol), in dinethylformamide (15mL) solution, add 60% sodium hydride (0.11g, 2.7mmol), stir after 30 minutes, add 1-bromo-3-phenyl-propane (0.53g, 2.7mmol), mixed liquor was at room temperature stirred 3 hours.In reactant liquor, add water, use ethyl acetate extraction.The washing extracting solution, dry back concentrates.With the refining residue (hexane/ethyl acetate=18: 1) of silica gel column chromatography, obtain table title chemical compound (0.29g, yield 46%).
Oily.
1H NMR(CDCl 3)δ1.23(3H，t，J＝7.1Hz)，2.04-2.13(2H，m)，2.58(2H，t，J＝8.1Hz)，2.88(2H，t，J＝8.1Hz)，3.94(2H，t，J＝6.3Hz)，4.12(2H，q，J＝7.1Hz)，6.81(2H，d，J＝8.6Hz)，7.10(2H，d，J＝8.6Hz)，7.19-7.31(5H，m)。
Reference example 6 4-(3-phenyl propoxyl group) benzenpropanoic acid
Method with identical with reference example 4 obtains the table title chemical compound, yield 45% by 4-(3-phenyl propoxyl group) benzenpropanoic acid ethyl ester.
Fusing point 109-110 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.05-2.13(2H，m)，2.65(2H，t，J＝7.8Hz)，2.80(2H，t，J＝7.8Hz)，2.90(2H，t，J＝7.9Hz)，3.94(2H，t，J＝6.3Hz)，6.82(2H，d，J＝8.5Hz)，7.11(2H，d，J＝8.5Hz)，7.16-7.31(5H，m)。
Reference example 7 4-(4-phenyl butoxy) benzenpropanoic acid ethyl ester
Method with identical with reference example 5 obtains the table title chemical compound, yield 55% by 4-hydroxy-benzenepropanoic acid ethylester and 1-chloro-4-phenyl butane.
Oily.
1H NMR(CDCl 3)δ1.23(3H，t，J＝7.1Hz)，1.76-1.85(4H，m)，2.57(2H，t，J＝7.4Hz)，2.66-2.70(2H，m)，2.88(2H，t，J＝8.1Hz)，3.92-3.96(2H，m)，4.12(2H，q，J＝7.1Hz)，6.79-6.82(m，2H)，7.08-7.11(m，2H)，7.18-7.20(m，3H)，7.26-7.30(m，2H)。
Reference example 8 4-(4-phenyl butoxy) benzenpropanoic acid
Method with identical with reference example 4 obtains the table title chemical compound by 4-(4-phenyl butoxy) benzenpropanoic acid ethyl ester.Yield is 61%.
Fusing point 79.5-80.0 ℃ (by diethyl ether-hexane recrystallize)
1H NMR(CDCl 3)δ1.70-1.90(4H，m)，2.61-2.70(4H，m)，2.89(2H，t，J＝7.9Hz)，3.92-3.96(2H，m)，6.81(2H，d，J＝8.6Hz)，7.06(2H，d，J＝8.6Hz)，7.12-7.31(m，5H)。
Reference example 9 4-[(4-phenoxy group benzoyls) amino] the benzenpropanoic acid ethyl ester
N at 4-amino-benzene ethylformic acid ethyl ester (0.70g, 3.6mmol), in dinethylformamide (25mL) solution, add 4-phenoxy benzoic acid (0.85g, 4.0mmol), 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (0.76g, 4.0mmol), I-hydroxybenzotriazole-hydrate (0.61g, 4.0mmol), at room temperature stirred 16 hours.In reactant liquor, add water, use ethyl acetate extraction.The washing extracting solution, dry back concentrates.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=2: 1), obtain white powder table title chemical compound (0.96g, yield 68%).
1H NMR(CDCl 3)δ1.24(3H，t，J＝7.1Hz)，2.61(2H，t，J＝8.0Hz)，2.94(2H，t，J＝7.9Hz)，4.13(2H，q，J＝7.1Hz)，7.03-7.08(4H，m)，7.16-7.21(3H，m)，7.36-7.43(2H，m)，7.54(2H，t，J＝8.5Hz)，7.73(1H，s)，7.84(2H，d，J＝8.7Hz)。
Reference example 10 4-[(4-phenoxy group benzoyls) amino] benzenpropanoic acid
With the method identical, by 4-[(4-phenoxy group benzoyl with reference example 4) amino] the benzenpropanoic acid ethyl ester obtains the table title chemical compound.Yield 76%.
Fusing point 214-215 ℃ (by oxolane-hexane recrystallize)
1H NMR(DMSO-d 6)δ2.52(2H，t，J＝7.6Hz)，2.79(2H，t，J＝7.6Hz)，7.07-7.12(4H，m)，7.18-7.25(3H，m)，7.45(2H，t，J＝7.4Hz)，7.65(2H，d，J＝8.4Hz)，7.98(2H，d，J＝8.7Hz)，10.11(1H，s)。
Reference example 11 4-[3-[methyl (4-phenyl-2-thiazole) amino] propoxyl group] the benzenpropanoic acid ethyl ester
N at ice-cold N-methyl-4-phenyl-abadol (0.30g, 1.7mmol), in dinethylformamide (5mL) solution, add 60% sodium hydride (72mg, 1.8mmol), stir after 30 minutes, add the 4-[(3-bromopropyl) the oxygen base] benzenpropanoic acid ethyl ester (0.57g, 1.8mmol), at room temperature stirred mixture 3 hours.In reactant liquor, add water, use ethyl acetate extraction.The washing extracting solution, dry back concentrates.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=15: 1), obtain table title chemical compound (0.58g, yield 80%).
Oily.
1H NMR(CDCl 3)δ1.25(3H，t，J＝7.1Hz)，2.10-2.30(2H，m)，2.58(2H，t，J＝6.8Hz)，2.88(2H，t，J＝6.8Hz)，3.14(3H，s)，3.73(2H，t，J＝6.8Hz)，4.03(2H，t，J＝6.0Hz)，4.12(2H，q，J＝7.1Hz)，6.70(1H，d，J＝3.8Hz)，6.83(2H，d，J＝8.6Hz)，7.10(2H，d，J＝8.6Hz)，7.20-7.30(1H，m)，7.30-7.38(2H，m)，7.82-7.85(2H，m)。
Reference example 12 4-[3-[methyl (4-phenyl-2-thiazole) amino] propoxyl group] benzenpropanoic acid
With the method identical, by 4-[3-[methyl (4-phenyl-2-thiazole) amino with reference example 4] propoxyl group] the benzenpropanoic acid ethyl ester obtains the table title chemical compound.Yield 13%.
Fusing point 89-90 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.14-2.23(2H，m)，2.64(2H，t，J＝7.9Hz)，2.90(2H，t，J＝7.9Hz)，3.14(3H，s)，3.73(2H，d，J＝6.8Hz)，4.03(2H，t，J＝6.0Hz)，6.69(1H，s)，6.84(2H，d，J＝8.5Hz)，7.11(2H，d，J＝8.5Hz)，7.23-7.33(1H，m)，7.35(2H，t，J＝7.7Hz)，7.82(2H，d，J＝7.2Hz)。
Reference example 13 1-[(4-bromo-2,6-difluorophenyl) oxygen base]-2,3-dihydro-1H-indenes method identical with reference example 1, by 1-indanol and 4-bromo-2, the 6-difluorophenol obtains the table title chemical compound.Yield 74%.
Fusing point 46-46 ℃ (by the ethyl acetate recrystallize).
1H NMR(CDCl 3)δ2.34-2.40(2H，m)，2.83-2.92(1H，m)，3.20-3.31(1H，m)，5.64(1H，t，J＝4.4Hz)，7.04-7.13(2H，m)，7.17-7.22(1H，m)，7.28-7.32(3H，m)。
Reference example 14 4-[[4-[[methyl (4-phenyl-2-thiazole) amino] methyl] benzoyl] amino] the benzenpropanoic acid ethyl ester
With the method identical, by 3-(4-aminophenyl) ethyl propionate and 4-[[methyl (4-phenyl-2-thiazole) amino with reference example 9] methyl] benzoic acid obtains the table title chemical compound of white powder.Yield 89%.
1H NMR(CDCl 3)δ1.24(3H，t，J＝7.1Hz)，2.61(2H，t，J＝7.9Hz)，2.94(2H，t，J＝7.9Hz)，3.10(3H，s)，4.12(2H，q，J＝7.1Hz)，4.86(2H，s)，6.75(1H，s)，7.20(2H，d，J＝8.4Hz)，7.26-7.30(2H，m)，7.38(2H，t，J＝7.8Hz)，7.46(2H，d，J＝8.2Hz)，7.54(2H，d，J＝8.4Hz)，7.75(1H，s)，7.82-7.87(3H，m)。
Reference example 15 4-[[4-[[methyl (4-phenyl-2-thiazole) amino] methyl] benzoyl] amino] benzenpropanoic acid
With the method identical, by 4-[[4-[[methyl (4-phenyl-2-thiazole) amino with reference example 4] methyl] benzoyl] amino] the benzenpropanoic acid ethyl ester obtains the table title chemical compound.Yield 79%.
Fusing point 183-184 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.66(2H，t，J＝7.5Hz)，2.94(2H，t，J＝7.5Hz)，3.08(3H，s)，4.84(2H，s)，6.75(1H，s)，7.20(2H，d，J＝8.5Hz)，7.22-7.30(1H，m)，7.30-7.44(4H，m)，7.55(2H，d，J＝8.4Hz)，7.80-7.87(5H，m)。
Reference example 16 (E)-3-[4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base]-3, the 5-difluorophenyl]-the 2-acrylic acid methyl ester.
With the method identical with reference example 34, by 1-[(4-bromo-2, the 6-difluorophenyl) the oxygen base]-2,3-dihydro-1H-indenes obtains the table title chemical compound.Yield 40%.
Fusing point 74-75 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.37-2.43(2H，m)，2.84-2.93(1H，m)，2.32-3.32(1H，m)，3.81(3H，s)，5.74(1H，t，J＝4.5Hz)，6.34(1H，d，J＝16Hz)，7.03-7.12(2H，m)，7.16-7.23(1H，m)，7.28-7.35(2H，m)，7.53(1H，d，J＝16Hz)。
Reference example 17 4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] methyl phenylacetate
With the method identical with reference example 1, by 4-hydroxyl phenylacetic acid methyl ester and 2,3-dihydro-1H-indenes-1-alcohol obtains the table title chemical compound.Yield 69%.
Oily.
1H NMR(CDCl 3)δ2.10-2.30(1H，m)，2.45-2.65(1H，m)，2.52-2.57(1H，m)，3.09-3.19(1H，m)，3.59(2H，s)，3.70(3H，s)，5.75(1H，dd，J＝6.6Hz，4.4Hz)，6.95-6.98(2H，m)，7.21-7.32(5H，m)，7.43(1H，d，J＝7.2Hz)。
Reference example 18 4-[(4-nitrobenzophenones) methoxyl group] methyl phenylpropionate
With the method identical, obtain the table title chemical compound of yellow powder shape by 4-hydroxy phenylpropionic acid methyl ester and 4-nitrobenzyl bromine with reference example 5.Yield 41%.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.66(3H，s)，5.15(2H，s)，6.88(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.60(2H，d，J＝8.7Hz)，8.23-8.28(2H，m)。
Reference example 19 4-[(4-nitrobenzophenones) methoxyl group] benzenpropanoic acid
With the method identical, by the 4-[(4-nitrobenzophenone with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 26%.
Fusing point 179-181 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.7Hz)，2.91(2H，t，J＝7.7Hz)，5.15(2H，s)，6.89(2H，d，J＝8.5Hz)，7.15(2H，d，J＝8.5Hz)，7.60(2H，d，J＝8.5Hz)，8.24(2H，d，J＝8.6Hz)。
Reference example 20 4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] phenylacetic acid
With the method identical,, 3-dihydro-1H-indenes-1-yl) oxygen base by 4-[(2 with reference example 4] methyl phenylacetate obtains the table title chemical compound.Yield 52%.
Fusing point 121.0-121.5 ℃ (by ethyl acetate-hexane recrystallize).
1HNMR(CDCl 3)δ2.10-2.26(1H，m)，2.45-2.60(1H，m)，2.80-2.97(1H，m)，3.09-3.14(1H，m)，3.61(2H，s)，5.74(1H，dd，J＝6.7Hz，4.4Hz)，6.97(2H，d，J＝8.6Hz)，6.99-7.34(5H，m)，7.42(1H，d，J＝7.2Hz)。
Reference example 21 4-(4-phenoxy group phenoxy group) benzaldehyde
At the N of 4-phenoxy phenyl (1.0g, 5.4mmol), in dinethylformamide (20mL) solution, add 4-fluorobenzaldehyde (0.67g, 5.4mmol), calcium carbonate (0.75g, 5.4mmol) stirs mixture 15 hours down at 100 ℃.In reactant liquor, add water, use ethyl acetate extraction.The washing extracting solution, dry back concentrates.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=9: 1), obtain table title chemical compound (1.4g, yield 89%).
1H NMR(CDCl 3)δ7.02-7.12(9H，m)，7.36(2H，dd，J＝7.5Hz，8.5Hz)，7.85(2H，d，J＝8.7Hz)，9.92(1H，s)。
Reference example 22 4-([1,1 '-xenyl]-4-base oxygen base) benzaldehyde
Method with identical with reference example 21 obtains the table title chemical compound by 4-hydroxyl hexichol and 4-fluorobenzaldehyde.Yield 37%.
1H NMR(CDCl 3)δ7.10-7.19(4H，m)，7.35-7.49(3H，m)，7.58-7.66(4H，m)，7.87(2H，d，J＝8.7Hz)，9.94(1H，s)。
Reference example 23 4-[4-(phenyl methoxyl group) phenoxy group] benzaldehyde
Method with identical with reference example 21 obtains the table title chemical compound by 4-benzyl oxygen base phenol and 4-fluorobenzaldehyde.Yield 57%.
1H NMR(CDCl 3)δ5.08(2H，s)，7.00-7.03(6H，m)，7.34-7.46(5H，m)，7.83(2H，d，J＝8.7Hz)，9.91(1H，s)。
Reference example 24 4-(4-phenoxy group phenoxy group) benzylalcohol
Method with identical with reference example 32 obtains the table title chemical compound by 4-(4-phenoxy group phenoxy group) benzaldehyde.Yield 82%.
1H NMR(CDCl 3)δ1.64(1H，s)，4.66(2H，s)，6.98-7.01(8H，m)，7.09(1H，t，J＝7.3Hz)，7.31-7.36(4H，m)。
Reference example 25 4-([1,1 '-xenyl]-4-base oxygen base) benzylalcohol
With the method identical, obtain the table title chemical compound by 4-([1,1 '-xenyl]-4-base oxygen base) benzaldehyde with reference example 32.Yield 66%.
1H NMR(CDCl 3)δ1.64(1H，s)，4.69(2H，s)，7.03-7.08(4H，m)，7.35-7.48(5H，m)，7.54-7.58(4H，m)。
Reference example 26 4-[[methyl (4-phenyl-2-thiazole) amino] methyl] benzaldehyde
At 4-[[methyl (4-phenyl-2-thiazole) amino] methyl] add manganese dioxide (4.0g) in ethyl acetate (40mL) solution of benzyl alcohol (1.0g, 3.2mmol), at room temperature stirred 3 hours.Filter insoluble matter, concentrated filtrate with the refining residue of silica gel column chromatography (hexane/ethyl acetate=5: 1), obtains table title chemical compound (0.80g, yield 81%).
Oily.
1H NMR(CDCl 3)δ3.10(3H，s)，4.88(2H，s)，6.75(1H，s)，7.25-7.30(1H，m)，7.35-7.40(2H，m)，7.51(2H，d，J＝8.0Hz)，7.83-7.88(4H，m)，10.00(1H，s)。
Reference example 27 (E)-3-[4-[[methyl (4-phenyl-2-thiazole) amino] methyl] phenyl] ethyl acrylate
In the solution of the oxolane (10mL) of ice-cold diethyl phosphonyl ethyl acetate (0.81g, 3.6mmol), add 60% sodium hydride (0.14g, 3.4mmol); stir after 30 minutes, splash into 4-[[methyl (4-phenyl-2-thiazole) amino] methyl] oxolane (10mL) solution of benzaldehyde (0.80g, 2.6mmol).After mixed liquor at room temperature stirred 3 hours, add water, use ethyl acetate extraction.Dry extraction liquid concentrates.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=18: 1), obtain Powdered table title chemical compound (0.96g, yield 98%).
1H NMR(CDCl 3)δ1.33(3H，t，J＝7.1Hz)，3.08(3H，s)，4.26(2H，q，J＝7.1Hz)，4.80(2H，s)，6.42(1H，d，J＝16.0Hz)，6.74(1H，s)，7.25-7.39(5H，m)，7.50(2H，d，J＝8.2Hz)，7.67(1H，d，J＝16.0Hz)，7.86(2H，d，J＝7.2Hz)。
Reference example 28 4-[[methyl (4-phenyl-2-thiazole) amino] methyl] the benzenpropanoic acid ethyl ester
At (E)-3-[4-[[methyl (4-phenyl-2-thiazole) amino] methyl] phenyl] in ethanol (25mL) solution of ethyl acrylate (0.60g, 1.6mmol), six water Nickel dichloride .s (0.41g, 3.2mmol), add sodium borohydride (0.30g, 8.0mmol), at room temperature stirred 2 hours.In reactant liquor, add water, use ethyl acetate extraction.The washing extracting solution, dry back concentrates.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=18: 1), obtain table title chemical compound (0.39g, yield 64%).
Oily.
1H NMR(CDCl 3)δ1.23(3H，t，J＝7.1Hz)，2.60(2H，t，J＝8.0Hz)，2.94(2H，t，J＝8.0Hz)，3.06(3H，s)，4.12(2H，q，J＝7.1Hz)，4.73(2H，s)，6.72(1H，s)，7.17(2H，d，J＝8.0Hz)，7.25-7.30(3H，m)，7.35-7.40(2H，m)，7.85-7.88(2H，m)。
Reference example 29 4-[[methyl (4-phenyl-2-thiazole) amino] methyl] benzenpropanoic acid
With the method identical, by 4-[[methyl (4-phenyl-2-thiazole) amino with reference example 4] methyl] the benzenpropanoic acid ethyl ester obtains the table title chemical compound.Yield 64%.
Fusing point 109-110 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.66(2H，t，J＝7.9Hz)，2.94(2H，t，J＝7.9Hz)，3.06(3H，s)，4.73(2H，s)，6.71(1H，s)，7.17(2H，d，J＝8.0Hz)，7.25-7.34(3H，m)，7.37(2H，t，J＝7.8Hz)，7.86(2H，d，J＝7.2Hz)。
Reference example 30 4-[4-(phenyl methoxyl group) phenoxy group] benzylalcohol
With the method identical, by 4-[4-(phenyl methoxyl group) phenoxy group with reference example 32] benzaldehyde obtains the table title chemical compound.Yield 88%.
1HNMR(CDCl 3)δ1.60(1H，s)，4.65(2H，s)，5.05(2H，s)，6.92-6.96(6H，m)，7.29-7.45(7H，m)。
Reference example 31 2,3-dihydro-5-(phenyl methoxyl group)-1H-1-Indanone
In oxolane (30mL) solution of 5-hydroxy indene ketone (1.0g, 6.2mmol), benzylalcohol (0.65g, 5.6mmol) and tributylphosphine (1.7g, 8.4mmol), add 1,1 '-(azo dicarbapentaborane) two piperidines (2.1g, 8.4mmol) at room temperature stirred mixture 16 hours.After filtering insoluble matter, concentrated filtrate with the refining residue of silica gel column chromatography (hexane/ethyl acetate=10: 1), obtains Powdered table title chemical compound (1.3g, yield 97%).
1H NMR(CDCl 3)δ2.67(2H，t，J＝6.1Hz)，3.08(2H，t，J＝6.1Hz)，5.15(2H，s)，6.97(2H，s)，7.30-7.45(5H，m)，7.70(1H，d，J＝9.1Hz)。
Reference example 32 2,3-dihydro-5-(phenyl methoxyl group)-1H-indenes-1-alcohol
2,3-dihydro-5-(phenyl methoxyl group)-1H-1-Indanone (1.3g, 5.46mmol) is dissolved in the mixed liquid of oxolane (20mL) and methanol (10mL), behind the adding sodium borohydride (0.41g, 11mmol), at room temperature stirs 2 hours.In reactant liquor, add water, use ethyl acetate extraction.Behind the dry extraction liquid, concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=3: 1), obtain white powder table title chemical compound (1.16g, yield 89%).
1H NMR(CDCl 3)δ1.70(1H，d，J＝5.0Hz)，1.85-2.05(1H，m)，2.40-2.55(1H，m)，2.70-2.85(1H，m)，2.95-3.10(1H，m)，5.05(2H，s)，5.10-5.20(1H，m)，6.85-6.87(1H，m)，7.25-7.45(6H，m)。
Reference example 33 2-(4-bromine phenoxy group)-2,3-dihydro-1H-indenes
Method with identical with reference example 1 obtains the table title chemical compound by 2-indanol and 4-bromophenol.Yield 59%.
Fusing point 83-84 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ3.13(1H，d，J＝3.0Hz)，3.18(1H，d，J＝3.0Hz)，3.33(1H，d，J＝6.2Hz)，3.39(1H，d，J＝6.2Hz)，5.09-5.15(1H，m)，6.78(2H，d，J＝9.0Hz)，7.16-7.26(4H，m)，7.37(2H，d，J＝9.0Hz)。
Reference example 34 (E)-3-[4-(2,3-dihydro-1H-indenes-2-yl) oxygen base] phenyl]-the 2-acrylic acid methyl ester.
At 2-(4-bromine phenoxy group)-2, the N of 3-dihydro-1H-indenes (1.4g, 4.7mmol), in dinethylformamide (4.7mL) solution, add sodium bicarbonate (1.0g, 12mmol), acrylic acid methyl ester. (0.86mL, 9.5mmol), tetrabutylammonium chloride (2.0g, 7.1mmol) and acid chloride (31mg, 0.14mmol) stirred 24 hours down at 100 ℃.Reactant liquor filters turning back under the room temperature, adds water, uses ethyl acetate extraction.After cleaning with saturated aqueous common salt, use anhydrous magnesium sulfate drying, concentrated.By ethyl acetate-hexane recrystallize residue, obtain table title chemical compound (0.96g, yield 69%).
Fusing point 115-116 ℃.
1H NMR(CDCl 3)δ3.16(1H，d，J＝2.9Hz)，3.21(1H，d，J＝2.9Hz)，3.37(1H，d，J＝6.4Hz)，3.43(1H，d，J＝6.4Hz)，3.80(3H，s)，5.17-5.23(1H，m)，6.31(1H，d，J＝16Hz)，6.91(2H，d，J＝9.0Hz)，7.17-7.27(4H，m)，7.47(2H，d，J＝9.0Hz)，7.65(1H，d，J＝16Hz)。
Reference example 35 (4-methoxyl group phenoxy group) ethyl acetate
At the N of 4-methoxyphenol (5.0g, 40mmol), at the ice-cold sodium hydride (1.6g, 40mmol) of adding 60% down, mixture was stirred 30 minutes in dinethylformamide (50mL) solution.Afterwards, add bromoacetate (7.4g, 44mmol), at room temperature stirred 1 hour.In reactant liquor, add water, use ethyl acetate extraction.Behind the washing extracting solution, concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=7: 1), obtain table title chemical compound (8.0g, yield 94%).
Oily.
1H NMR(CDCl 3)δ1.30(3H，t，J＝7.1Hz)，3.77(3H，s)，4.26(2H，q，J＝7.1Hz)，4.57(2H，s)，6.81-6.89(4H，m)。
Reference example 36 (4-hydroxyphenoxy) ethyl acetate
With (4-methoxyl group phenoxy group) ethyl acetate (2.0g, 9.5mmol), ethyl mercaptan (2.8mL, 38mmol) and aluminum chloride (5.1g, dichloromethane 38mmol) (20mL) solution stirred 40 minutes down ice-cold.Reactant liquor is injected in the mixed liquor of chloroform and saturated sodium bicarbonate, carries out diatomite filtration then.After separating organic layer, clean with saturated aqueous common salt, behind anhydrous magnesium sulfate drying, concentrating under reduced pressure.Make residue by ethyl acetate-diisopropyl ether recrystallize, obtain table title chemical compound (1.4g, yield 75%).
Fusing point 123-124 ℃.
1H NMR(CDCl 3)δ1.30(3H，t，J＝7.1Hz)，4.26(2H，q，J＝7.1Hz)，4.56(2H，s)，6.73-6.84(4H，m)。
Reference example 37 [4-(4-phenyl butoxy) phenoxy group] ethyl acetate
With (4-hydroxyphenoxy) ethyl acetate (0.49g, 2.5mmol), 4-phenyl butyl bromide (0.59g, 2.8mmol), potassium carbonate (0.69g, 5.0mmol) and potassium iodide (30mg, 0.50mmol) N, dinethylformamide (5mL) solution at room temperature stirred 30 minutes, stirred 3 hours down at 50 ℃ in addition.The solvent decompression is heated up in a steamer, after ethyl acetate and saturated common salt water dispenser, concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=4: 1), obtain table title chemical compound (0.62g, yield 76%).
Oily.
1H NMR(CDCl 3)δ1.30(3H，t，J＝7.1Hz)，1.78-1.83(4H，m)，2.66-2.71(2H，m)，3.90-3.94(2H，m)，4.26(2H，q，J＝7.1Hz)，4.56(2H，s)，6.79-6.87(4H，m)，7.18-7.21(3H，m)，7.27-7.31(2H，m)。
Reference example 38 [4-(4-phenyl butoxy) phenoxy group] acetic acid
With [4-(4-phenyl butoxy) phenoxy group] ethyl acetate (0.59g, 1.8mmol), (0.15g, 3.6mmol), oxolane (5mL), the mixture of methanol (1mL) and water (3mL) at room temperature stirred 48 hours Lithium hydrate-hydrate.After being adjusted to acidity with 1N hydrochloric acid, use ethyl acetate extraction.Behind the clean extracting solution of saturated aqueous common salt, use anhydrous magnesium sulfate drying, the solvent decompression is heated up in a steamer.Residue obtains table title chemical compound (0.48g, yield 89%) by the ethyl acetate recrystallize.
Fusing point 116-117 ℃.
1H NMR(CDCl 3)δ1.78-1.82(4H，m)，2.66-2.71(2H，m)，3.90-3.94(2H，m)，4.62(2H，s)，6.81-6.88(4H，m)，7.16-7.21(3H，m)，7.27-7.31(2H，m)。
Reference example 39 [(4-methoxyphenyl) sulfenyl] ethyl acetate
4-methoxyl group thiophenol (15g, 0.11mol), (28mL, 0.20mol) and in the ice-cold mixture of oxolane (150mL), (21g 0.13mol), at room temperature, stirs generation's evening to triethylamine to add bromoacetate.After adding ethanol (10mL), heat up in a steamer under the decompression and desolvate, with ethyl acetate and water dispenser.Behind the concentrated organic layer,, obtain table title chemical compound (22g, yield 92%) under the decompression with the refining residue of silica gel column chromatography (hexane/ethyl acetate=10: 1).
Oily.
1H NMR(CDCl 3)δ1.22(3H，t，J＝7.1Hz)，3.51(2H，s)，3.79(3H，s)，4.14(2H，q，J＝7.1Hz)，6.83(2H，d，J＝8.8Hz)，7.42(2H，d，J＝8.8Hz)。
Reference example 40 [(4-hydroxy phenyl) sulfenyl] ethyl acetate
Method with identical with reference example 36 obtains the table title chemical compound by [(4-methoxyphenyl) sulfenyl] ethyl acetate.Yield 91%.
Oily.
1H NMR(CDCl 3)δ1.22(3H，t，J＝7.1Hz)，3.51(2H，s)，4.14(2H，q，J＝7.1Hz)，6.76(2H，d，J＝8.8Hz)，7.37(2H，d，J＝8.8Hz)。
Reference example 41 [[4-(4-phenyl butoxy) phenyl] sulfenyl] ethyl acetate
Method with identical with reference example 37 obtains the table title chemical compound by [(4-hydroxy phenyl) sulfenyl] ethyl acetate.Yield 88%.
Oily.
1H NMR(CDCl 3)δ1.22(3H，t，J＝7.1 Hz)，1.76-1.84(4H，m)，2.66-2.71(2H，m)，3.50(2H，s)，3.93-3.97(2H，m)，4.13(2H，q，J＝7.1Hz)，6.82(2H，d，J＝8.8Hz)，7.18-7.21(3H，m)，7.26-7.29(2H，m)，7.39(2H，d，J＝8.8Hz)。
Reference example 42 [[4-(4-phenyl butoxy) phenyl] sulfenyl] acetic acid
Method with identical with reference example 38 obtains the table title chemical compound by [[4-(4-phenyl butoxy) phenyl] sulfenyl] ethyl acetate.Yield 75%.
Fusing point 73.5-74.5 ℃ (by the ethyl acetate recrystallize).
1H NMR(CDCl 3)δ1.76-1.82(4H，m)，2.66-2.71(2H，m)，3.55(2H，s)，3.93-3.97(2H，m)，6.83(2H，d，J＝8.8Hz)，7.16-7.21(3H，m)，7.26-7.31(2H，m)，7.43(2H，d，J＝8.8Hz)。
Reference example 43 4-[(2,3-dihydro-1H-indenes-2-yl) the oxygen base] methyl phenylpropionate
With (E)-3-[4-[(2,3-dihydro-1H-indenes-2-yl) oxygen base] phenyl]-mixture of 2-acrylic acid methyl ester. (0.76g, 2.6mmol), oxolane (10mL), methanol (5mL) and 10% palladium carbon (50% moisture product, 0.10g), under hydrogen environment atmosphere, one evening of stirring at room.Filtering reacting liquid concentrates, add water after, use ethyl acetate extraction.After the washing, use anhydrous magnesium sulfate drying, concentrate.Residue obtains table title chemical compound (0.85g, yield 89%) by ethyl acetate-methanol recrystallize.
Fusing point 73-74 ℃.
1H NMR(CDCl 3)δ2.60(2H，t，J＝7.9Hz)，2.90(2H，t，J＝7.9Hz)，3.13(1H，d，J＝3.2Hz)，3.19(1H，d，J＝3.2Hz)，3.33(1H，d，J＝6.3Hz)，3.38(1H，d，J＝6.3Hz)，5.11-5.17(1H，m)，6.84(2H，d，J＝8.6Hz)，7.12(2H，d，J＝6.6Hz)，7.17-7.25(4H，m)。
Reference example 44 4-[(2,3-dihydro-1H-indenes-2-yl) the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-1H-indenes-2-yl) oxygen base by 4-[(2 with reference example 38] methyl phenylpropionate obtains the table title chemical compound.Yield 90%.
Fusing point 138-139 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.66(2H，t，J＝7.9Hz)，2.91(2H，t，J＝7.9Hz)，3.13(1H，d，J＝3.2Hz)，3.19(1H，d，J＝3.2Hz)，3.33(1H，d，J＝6.3Hz)，3.38(1H，d，J＝6.3Hz)，5.11-5.17(1H，m)，6.84(2H，d，J＝8.6Hz)，7.12(2H，d，J＝6.6Hz)，7.16-7.25(4H，m)。
Reference example 45 4-[(4-aminophenyls) methoxyl group] methyl phenylpropionate
At the 4-[(4-nitrobenzophenone) methoxyl group] in methanol (30mL) solution of methyl phenylpropionate (0.55g, 1.67mmol), bismuth chloride (III) (0.79g, 2.5mmol), add sodium borohydride (0.51g, 13mmol), mixture was at room temperature stirred 2 hours.After filtering insoluble matter, concentrated filtrate, add water in the residue after, use ethyl acetate extraction.Clean extracting solution with saturated sodium bicarbonate, dry back concentrates.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=5: 1), obtain Powdered table title chemical compound (0.13g, yield 25%). 1H NMR(CDCl 3)δ2.59(2H，t，J＝8.0Hz)，2.89(2H，t，J＝8.0Hz)，3.66(5H，br s)，4.90(2H，s)，6.69(2H，d，J＝8.6Hz)，6.89(2H，d，J＝8.6Hz)，7.10(2H，d，J＝8.3Hz)，7.21(2H，d，J＝8.3Hz)。
Reference example 46 4-(naphthalene-2-ylmethoxy) methyl phenylpropionate
Method with identical with reference example 1 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and naphthalene-2-methanol.Yield 83%.
Fusing point 111-112 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.60(2H，t，J＝7.4Hz)，2.90(2H，t，J＝7.4Hz)，3.86(3H，s)，5.21(2H，s)，6.94(2H，d，J＝8.6Hz)，7.12(2H，d，J＝8.6Hz)，7.47-7.55(3H，m)，7.82-7.88(4H，m)。
Reference example 47 4-(naphthalene-2-ylmethoxy) benzenpropanoic acid
Method with identical with reference example 38 obtains the table title chemical compound by 4-(naphthalene-2-ylmethoxy) methyl phenylpropionate.Yield 96%.
Fusing point 173-174 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.4Hz)，2.91(2H，t，J＝7.4Hz)，5.21(2H，s)，6.94(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.47-7.55(3H，m)，7.82-7.88(4H，m)。
Reference example 48 4-(naphthalene-1-ylmethoxy) methyl phenylpropionate
Method with identical with reference example 1 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and naphthalene-1-methanol.Yield 84%.
Oily.
1H NMR(CDCl 3)δ2.62(2H，t，J＝7.4Hz)，2.92(2H，t，J＝7.4Hz)，3.68(3H，s)，5.47(2H，s)，6.98(2H，d，J＝8.6Hz)，6.99(2H，d，J＝8.6Hz)，7.44-7.60(4H，m)，7.84-7.91(2H，m)，8.03-8.06(1H，m)。
Reference example 49 4-(naphthalene-1-ylmethoxy) benzenpropanoic acid
Method with identical with reference example 38 obtains the table title chemical compound by 4-(naphthalene-1-ylmethoxy) methyl phenylpropionate.Yield 81%.
Fusing point 105-106 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.4Hz)，2.91(2H，t，J＝7.4Hz)，5.44(2H，s)，6.97(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.42-7.58(4H，m)，7.82-7.90(2H，m)，8.01-8.05(1H，m)。
Reference example 50 1H-indole-2-methanol
At indole-2-carboxylic acid (2.0g, 12mmol), N, in the mixture of dinethylformamide (10mL), oxolane (20mL) and N-hydroxy-succinamide (1.5g, 13mmol), add 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (2.9g, 15mmol), at room temperature stirring-evening.Add the 0.5M aqueous citric acid solution, behind ethyl acetate extraction, use anhydrous magnesium sulfate drying, concentrate.Down oxolane (20mL), Sodium Borohydride (1.9g, 50mmol) are joined in the residue ice-cold, at room temperature, stirred 6 hours.Add the 0.5M aqueous citric acid solution, behind ethyl acetate extraction, use anhydrous magnesium sulfate drying, concentrate.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=5: 1), obtain the table title chemical compound.Yield 56%.
Fusing point 73.5-74.4 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ1.79(1H，br s)，4.83(2H，s)，6.41(1H，s)，7.07-7.13(1H，m)，7.16-7.21(1H，m)，7.34(1H，d，J＝8.3Hz)，7.58(1H，d，J＝7.9Hz)，8.33(1H，br s)。
Reference example 51 4-[(3-bromophenyls) methoxyl group] methyl phenylpropionate
Method with identical with reference example 1 obtains white powder table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 3-bromobenzyl alcohol.Yield 68%.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.66(3H，s)，5.00(2H，s)，6.88(2H，d，J＝8.6Hz)，7.12(2H，d，J＝8.6Hz)，7.21-7.27(1H，m)，7.34(1H，d，J＝7.5Hz)，7.45(1H，d，J＝7.8Hz)，7.59(1H，s)。
Reference example 52 4-[(3-bromophenyls) methoxyl group] benzenpropanoic acid
With the method identical, by the 4-[(3-bromophenyl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 43%.
Fusing point 97-98 ℃ (by diisopropyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.8Hz)，2.91(2H，t，J＝7.8Hz)，5.01(2H，s)，6.89(2H，d，J＝8.5Hz)，7.13(2H，d，J＝8.5Hz)，7.22-7.27(1H，m)，7.34(1H，d，J＝7.6Hz)，7.45(1H，d，J＝7.8Hz)，7.59(1H，s)。
Reference example 53 4-[(2,3-Dihydrobenzofuranes-3-yl) the oxygen base] methyl phenylpropionate
In ethanol (20mL) solution of 3-coumaran ketone (0.50g, 3.7mmol), add Sodium Borohydride (0.28g, 7.5mmol), at room temperature, stirred 1 hour.Add 0.5 equivalent hydrochloric acid (10mL), at room temperature, stir after 10 minutes, add saturated aqueous common salt, use ethyl acetate extraction.Behind anhydrous magnesium sulfate drying, concentrate.In residue, add oxolane (10mL), 4-hydroxy phenylpropionic acid methyl ester (0.46g, 2.6mmol), triphenylphosphine (0.98g, 3.8mmol) and diethylazodicarboxylate (0.91mL, 4.7mmol), at room temperature stirred 2 hours.In reactant liquor, add water, use ethyl acetate extraction.Behind the washing extracting solution, concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=20: 1), obtain the table title chemical compound.Yield 17%.
Oily.
1H NMR(CDCl 3)δ2.61(2H，t，J＝8.0Hz)，2.91(2H，t，J＝8.0Hz)，3.67(3H，s)，4.58-4.70(2H，m)，5.85-5.88(1H，m)，6.85(2H，d，J＝8.6Hz)，6.91-6.96(2H，m)，7.14(2H，d，J＝8.6Hz)，7.25-7.33(1H，m)，7.38-7.40(1H，m)。
Reference example 54 4-[(2,3-Dihydrobenzofuranes-3-yl) the oxygen base] benzenpropanoic acid
With the method identical with reference example 38, by 4-[(2,3-Dihydrobenzofuranes-3-yl) the oxygen base] methyl phenylpropionate.Yield 60%.
Fusing point 106-107 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.67(2H，t，J＝8.0Hz)，2.93(2H，t，J＝8.0Hz)，4.59-4.71(2H，m)，5.86-5.89(1H，m)，6.85(2H，d，J＝8.6Hz)，6.91-6.96(2H，m)，7.15(2H，d，J＝8.6Hz)，7.26-7.33(1H，m)，7.38-7.40(1H，m)。
Reference example 55 4-[[3-(3-thiophene) phenyl] methoxyl group] methyl phenylpropionate
The 4-[(3-bromophenyl) methoxyl group] methyl phenylpropionate (0.96g, 2.8mmol), two valeryl two boron (bis (pinacolato) diboron) (0.77g, 3.0mmol), potassium acetate (0.81g, 8.3mmol) be dissolved into N, dinethylformamide (30mL), after carrying out the argon displacement, adding 1,1 '-two (diphenylphosphine) ferrocene dichloro palladium (II) (0.067g, 0.083mmol).Reactant liquor under the ar gas environment under 80 ℃, heating-evening.Behind the cooling reactant liquor, in reactant liquor, add 3 bromo thiophene (0.43g, 2.6mmol), 1,1 '-two (diphenylphosphine) ferrocene dichloro palladium (II) (0.067g, 0.083mmol), 2 equivalent aqueous sodium carbonates (6.9mL, 14mmol).Reactant liquor under ar gas environment atmosphere, under 80 ℃, heating-evening.Behind the cooling reactant liquor, use ethyl acetate extraction.The washing extracting solution, dry back concentrates.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=15: 1), obtain oily table title chemical compound (0.21g, yield 22%).
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.66(3H，s)，5.08(2H，s)，6.89-6.94(2H，m)，7.10-7.14(2H，m)，7.33-7.44(4H，m)，7.47(1H，t，J＝2.2Hz)，7.55(1H，dt，J＝7.5Hz，1.6Hz)，7.66(1H，s)。
Reference example 56 4-[[3-(3-thienyl) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[3-(3-thienyl) phenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 33%.
Fusing point 153.0-153.5 ℃ (by diisopropyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝8.0Hz)，2.91(2H，t，J＝8.0Hz)，5.08(2H，s)，6.93(2H，d，J＝8.6Hz)，7.14(2H，d，J＝8.6Hz)，7.33-7.47(5H，m)，7.55(1H，dt，J＝7.5Hz，1.5Hz)，7.65(1H，s)。
Reference example 57 4-[[3-[[5-(trifluoromethyl)-2-pyridine] the oxygen base] phenyl] methoxyl group] methyl phenylpropionate
With the method identical, by 4-hydroxy phenylpropionic acid methyl ester and 3-[[5-(trifluoromethyl)-2-pyridine with reference example 1] the oxygen base] benzylalcohol obtains the table title chemical compound.Yield 89%.
Oily.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.89(2H，t，J＝8.0Hz)，3.66(3H，s)，5.07(2H，s)，6.89(2H，d，J＝8.6Hz)，7.01(1H，d，J＝8.7Hz)，7.09-7.13(3H，m)，7.23(1H，br s)，7.31(1H，d，J＝7.6Hz)，7.44(1H，t，J＝7.9Hz)，7.90(1H，dd，J＝8.7Hz，2.4Hz)，8.44(1H，br s)。
Reference example 58 4-[[3-[[5-(trifluoromethyl)-2-pyridine] the oxygen base] phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[3-[[5-(trifluoromethyl)-2-pyridine with reference example 4] the oxygen base] phenyl] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 28%.
Fusing point 112-113 ℃ (by diisopropyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，5.07(2H，s)，6.93(2H，d，J＝8.6Hz)，7.01(1H，d，J＝8.7Hz)，7.09-7.17(3H，m)，7.24(1H，br s)，7.31(1H，d，J＝9.2Hz)，7.44(1H，t，J＝7.9Hz)，7.90(1H，dd，J＝8.7Hz，2.5Hz)，8.44-8.45(1H，m)。
Reference example 59 4-[[3-(2-thienyl) phenyl] methoxyl group] methyl phenylpropionate
Method with identical with embodiment 22 obtains white powder table title chemical compound by the 2-thienyl boric acid.Yield 33%.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.1Hz)，2.90(2H，t，J＝8.1Hz)，3.66(3H，s)，5.06(2H，s)，6.92(2H，d，J＝8.6Hz)，7.06-7.14(3H，m)，7.28(1H，dd，J＝5.1Hz，1.1Hz)，7.30-7.41(3H，m)，7.56(1H，dt，J＝7.4Hz，1.6Hz)，7.66(1H，s)。
Reference example 60 4-[[3-(2-thienyl) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[3-(2-thienyl) phenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 52%.
Fusing point 127-128 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝8.0Hz)，2.91(2H，t，J＝8.0Hz)，5.07(2H，s)，6.93(2H，d，J＝8.6Hz)，7.08(1H，dd，J＝4.5Hz，3.5Hz)，7.14(2H，d，J＝8.6Hz)，7.27-7.41(4H，m)，7.57(1H，dt，J＝7.4Hz，1.6Hz)，7.66(1H，s)。
Reference example 61 4-[[3-(2-pyrimidine) phenyl] methoxyl group] methyl phenylpropionate
The 4-[(3-bromophenyl) methoxyl group] methyl phenylpropionate (0.70g, 2.0mmol), two valeryl two boron (0.56g, 2.2mmol), potassium acetate (0.59g, 6.0mmol) be dissolved into N, in the dinethylformamide (20mL), after carrying out the argon displacement, adding 1,1 '-two (diphenylphosphine) ferrocene dichloro palladium (II) (0.049g, 0.060mmol).Reactant liquor under ar gas environment atmosphere, under 80 ℃, was heated 8 hours.Behind the cooling reactant liquor, in reactant liquor, add water, use ethyl acetate extraction.The washing extracting solution, dry back concentrates.Residue is dissolved in toluene-methanol-water (5: 1: 1,35mL), adds sodium carbonate (0.64g, 6.0mmol), after the argon displacement, add tetra-triphenylphosphine palladium (tetrakistriphenylphosphinepalladium) (0.12g, 0.10mmol).Reactant liquor under argon, reflux-evening.Behind the cooling reactant liquor, add water in the reactant liquor, use ethyl acetate extraction.The washing extracting solution, dry back concentrates.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=5: 1), obtain colorless oil table title chemical compound (0.13g, yield 16%).
1H NMR(CDCl 3)δ2.59(2H，t，J＝8.1Hz)，2.89(2H，t，J＝8.1Hz)，3.66(3H，s)，5.13(2H，s)，6.92-6.94(2H，m)，7.09-7.13(2H，m)，7.17-7.20(1H，m)，7.41-7.86(2H，m)，8.41(1H，dt，J＝7.6Hz，1.6Hz)，8.42-8.52(1H，m)，8.80(2H，d，4.8Hz)。
Reference example 62 4-[[3-(2-pyrimidine radicals) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[3-(2-pyrimidine radicals) phenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 26%.
Fusing point 152-153 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.9Hz)，2.91(2H，t，J＝7.9Hz)，5.14(2H，s)，6.94(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.22(1H，t，J＝4.9Hz)，7.49-7.60(2H，m)，8.40(1H，d，J＝7.6Hz)，8.50(1H，s)，8.83(2H，d，J＝4.8Hz)。
Reference example 63 4-[[3-(2-pyridine radicals) phenyl] methoxyl group] methyl phenylpropionate
The 4-[(3-bromophenyl) methoxyl group] methyl phenylpropionate (0.70g, 2.0mmol), 2-pyridine tin trimethyl (0.60g, 2.4mmol) be dissolved in N, dinethylformamide (15mL), after the argon displacement, add the two triphenyl phasphine palladiums (II) (0.10g, 0.070mmol) of dichloro.Reactant liquor under ar gas environment atmosphere, reflux-evening.Behind the cooling reactant liquor, add water in the reactant liquor, use ethyl acetate extraction.The washing extracting solution, dry back concentrates.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=5: 1), obtain colorless oil table title chemical compound (0.24g, yield 35%).
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.1Hz)，2.90(2H，t，J＝8.1Hz)，3.66(3H，s)，5.13(2H，s)，6.93(2H，d，J＝8.6Hz)，7.12(2H，d，J＝8.6Hz)，7.22-7.27(1H，m)，7.46-7.51(2H，m)，7.73-7.79(2H，m)，7.93(1H，dt，J＝1.8Hz，5.0Hz)，8.07(1H，s)，8.70(1H，dt，J＝4.7Hz，1.4Hz)。
Reference example 64 4-[[3-(2-pyridine radicals) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[3-(2-pyridine) phenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 57%.
Fusing point 160-161 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.63(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，5.12(2H，s)，6.93(2H，d，J＝8.6Hz)，7.12(2H，d，J＝8.6Hz)，7.24-7.29(1H，m)，7.46-7.52(2H，m)，7.71-7.81(2H，m)，7.87-7.91(1H，m)，8.05(1H，s)，8.72-8.75(1H，m)。
Reference example 65 4-[[3-(2-naphthyl) phenyl] methoxyl group] methyl phenylpropionate
Method with identical with embodiment 22 obtains white powder table title chemical compound by 2-naphthyl boric acid.Yield 93%.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.66(3H，s)，5.13(2H，s)，6.94(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.42-7.53(4H，m)，7.68(1H，dt，J＝7.4 Hz，1.5Hz)，7.73-7.80(2H，m)，7.85-7.93(3H，m)，8.05(1H，br s)。
Reference example 66 4-[[3-(2-naphthyl) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[3-(2-naphthyl) phenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 52%.
Fusing point 134-135 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.9Hz)，2.91(2H，t，J＝7.9Hz)，5.13(2H，s)，6.95(2H，d，J＝8.6Hz)，7.14(2H，d，J＝8.6Hz)，7.43-7.53(4H，m)，7.68(1H，dt，J＝7.5Hz，1.5Hz)，7.75(1H，dd，J＝8.6Hz，1.8Hz)，7.78(1H，s)，7.85-7.93(3H，m)，8.05(1H，br s)。
Reference example 67 4-[[3-(5-pyrimidine) phenyl] methoxyl group] benzenpropanoic acid
The 4-[(3-bromophenyl) methoxyl group] methyl phenylpropionate (0.70g, 2.0mmol), two valeryl two boron (0.56g, 2.2mmol), potassium acetate (0.59g, 6.0mmol) be dissolved into N, dinethylformamide (20mL), after the argon displacement, 1,1 '-two (diphenylphosphine) ferrocene dichloro palladium (II) (0.049g, 0.060mmol).Reactant liquor under ar gas environment atmosphere, under 80 ℃, heating-evening.Behind the cooling reactant liquor, in reactant liquor, add water, use ethyl acetate extraction.The washing extracting solution, dry back concentrates.Residue is dissolved in toluene-methanol-water (5: 1: 1,35mL), adds sodium carbonate (0.64g, 6.0mmol), after the argon displacement, add tetra-triphenylphosphine palladium (0.12g, 0.10mmol).Reactant liquor under ar gas environment atmosphere, reflux-evening.Behind the cooling reactant liquor, in reactant liquor, add water, use ethyl acetate extraction.Then, with in the 1 equivalent hydrochloric acid and behind the water layer, use ethyl acetate extraction.The washing extracting solution, dry back concentrates.By oxolane-hexane recrystallize, obtain table title chemical compound (0.94g, yield 14%).
Fusing point 166-167 ℃.
1H NMR(CDCl 3+DMSO-d 6)δ2.60(2H，t，J＝8.1Hz)，2.91(2H，t，J＝8.1Hz)，5.13(2H，s)，6.92(2H，d，J＝8.6Hz)，7.16(2H，d，J＝8.6Hz)，7.54(3H，s)，7.65(1H，s)，8.96(2H，s)，9.21(1H，s)。
Reference example 68 5,6-dihydro-4H-Pentamethylene. [b] thiophene-4-ketone
In the dichloroethanes (400ml) of N,N-DMAA (6.6g, 71mmol), at ice-cold dichloroethanes (50mL) solution that slowly drips trifluoromethanesulfanhydride anhydride (20g, 71mmol) down.In mixture, add dichloroethanes (50mL) solution of thiophene (6.0g, 71mmol), reflux 15 hours.The concentrating under reduced pressure reactant liquor adds saturated sodium bicarbonate solution, uses ethyl acetate extraction.Behind the washing extracting solution, concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=9: 1 to 4: 1), obtain white powder table title chemical compound (3.8g, yield 39%).
1H NMR(CDCl 3)δ3.00(2H，t，J＝4.7Hz)，3.19(2H，t，J＝4.7Hz)，7.15(1H，d，J＝5.1Hz)，7.31(1H，d，J＝5.1Hz)。
Reference example 69 4-hydroxy benzenes propionic acid amide .s
In 4-hydroxy phenylpropionic acid methyl ester (1.5g, 8.3mmol), add 25% ammonia (30mL), at room temperature stirred 15 hours.Add dilute hydrochloric acid in the reactant liquor, use ethyl acetate extraction.Behind the washing extracting solution, pressurization concentrates, and by ethyl acetate-hexane recrystallize, has obtained table title chemical compound (0.43g, yield 31%).
1H NMR(CDCl 3)δ2.49(2H，t，J＝7.9Hz)，2.90(2H，t，J＝7.9Hz)，4.65(1H，s)，5.25(2H，br s)，6.76(2H，d，J＝8.5Hz)，7.08(2H，d，J＝8.5Hz)。
Reference example 70 4-[(5-chloro-2,3-dihydro-1H-indenes-1-yl) the oxygen base] hydrocinnamamide
Method with identical with reference example 32 obtains 5-chloro-2 by 5-chloro-1-indone, 3-dihydro-1H-indenes-1-alcohol.Its method,, obtain the table title chemical compound with the condensation of 4-hydroxy benzenes propionic acid amide. according to reference example 1.The yield that is obtained by 5-chloro-1-indone is 21%.
Fusing point 158-159 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.21(1H，m)，2.49-2.61(3H，m)，2.83-2.96(3H，m)，3.11(1H，m)，5.36(2H，br s)，5.67(1H，dd，J＝4.3Hz，6.6Hz)，6.91(2H，d，J＝8.6Hz)，7.14-7.33(5H，m)。
Reference example 71 5-[4-([1,1 '-biphenyl]-the 3-ylmethoxy) phenyl] methyl]-2, the 4-thiazolidinedione
The 5-[(4-hydroxy phenyl) methyl]-2, in dimethyl sulfoxine (20mL) solution of 4-thiazolidinedione (0.30g, 1.3mmol), add 3-(chloromethyl) biphenyl (0.26g, 1.3mmol) and 60% sodium hydride (0.11g, 2.6mmol), mixture was at room temperature stirred 1 hour, in addition, 50 ℃ of restir 1 hour.In reactant liquor, add water, use ethyl acetate extraction.Behind the washing extracting solution, concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=8: 2), obtain white powder table title chemical compound (1.3g, yield 96%).Fusing point 109-111 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ3.11(1H，dd，J＝9.4Hz，14.1Hz)，3.46(1H，dd，J＝3.9Hz，14.1Hz)，4.80(1H，dd，J＝3.9Hz，9.4Hz)，5.11(2H，s)，6.95(2H，d，J＝8.7Hz)，7.16(2H，d，J＝8.7Hz)，7.30-7.65(9H，m)，7.99(1H，s)。
Reference example 72 5-[[4-[(3-Phenoxyphenyls) methoxyl group] phenyl] methyl]-2, the 4-thiazolidinedione
With the method identical with reference example 71, by 5-(4-hydroxybenzyl)-2,4-thiazolidinedione and 1-(chloromethyl)-3-phenoxy group benzene obtains the table title chemical compound.Yield 23%.
Fusing point 101-102 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ3.10(1H，dd，J＝9.5Hz，14.2Hz)，3.45(1H，dd，J＝3.8Hz，14.2Hz)，4.50(1H，dd，J＝3.8Hz，9.5Hz)，5.01(2H，s)，6.89-7.19(10H，m)，7.31-7.36(3H，m)，8.25(1H，s)。
Reference example 73 4-[(5-chloro-2,3-dihydro-1H-indenes-1-yl) the oxygen base] benzenepropanenitrile
Method with identical with reference example 32 obtains 5-chloro-2 by 5-chloro-1-indone, 3-dihydro-1H-indenes-1-alcohol.Its method,, obtain the table title chemical compound with the condensation of 4-hydroxy benzenes propionitrile according to reference example 1.The yield that is obtained by 5-chloro-1-indone is 59%.
Fusing point 97-98 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.24(1H，m)，2.49-2.63(3H，m)，2.85-2.95(3H，m)，3.12(1H，m)，5.69(1H，dd，J＝4.3Hz，6.6Hz)，6.95(2H，d，J＝8.6Hz)，7.18(2H，d，J＝8.6Hz)，7.22-7.34(3H，m)。
Reference example 74 4-[(5-chloro-2,3-dihydro-1H-indenes-1-yl) the oxygen base]-N-(mesyl) hydrocinnamamide
At 4-[(5-chloro-2,3-dihydro-1H-indenes-1-yl) oxygen base] in dichloromethane (10mL) solution of benzenpropanoic acid (0.3g, 0.95mmol), add Methanesulfomide (90mg, 0.95mmol), N, N-dimethyl aminopyridine (0.12g, 0.95mmol) and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (0.17mL, 0.95mmol) at room temperature stirred mixture 15 hours.In reactant liquor, add water, use ethyl acetate extraction.Behind the washing extracting solution, drying under reduced pressure obtains table title chemical compound (0.10g, yield 30%).
Fusing point 140-141 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.22(1H，m)，2.54(1H，m)，2.62(2H，d，J＝7.4Hz)，2.85-2.98(3H，m)，3.10(1H，m)，3.25(3H，s)，5.68(1H，dd，J＝4.3Hz，6.6Hz)，6.93(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.19-7.34(3H，m)，7.67(1H，br s)。
Reference example 75 N-[3-[4-[(5-chloro-2,3-dihydro-1H-indenes-1-yl) the oxygen base] phenyl] propyl group] acetamide
At 4-[(5-chloro-2,3-dihydro-1H-indenes-1-yl) oxygen base] in oxolane (25mL) solution of benzenepropanenitrile (0.50g, 1.7mmol), add lithium aluminium hydride (77mg, 2.0mmol) down ice-cold, under water-bath, stirred 3 hours.In reactant liquor, add water, use ethyl acetate extraction.Behind the washing extracting solution, concentrating under reduced pressure.After being dissolved in the pyridine (20mL), add anhydrous acetic acid (0.18mL, 0.95mmol) to the grease that obtains, mixed liquor was at room temperature stirred 3 hours.In reactant liquor, add water, use ethyl acetate extraction.Behind the washing extracting solution, concentrating under reduced pressure.With the refining residue of silica gel column chromatography (ethyl acetate), obtain table title chemical compound (0.11g, yield 18%).
Fusing point 111-112 ℃ (by the diethyl ether recrystallize).
1H NMR(CDCl 3)δ1.85(2H，m)，1.95(3H，s)，2.24(1H，m)，2.50-2.64(3H，m)，2.90(1H，m)，3.12(1H，m)，3.28(2H，dt，J＝6.6Hz，6.7Hz)，5.40(1H，br s)，5.68(1H，t，J＝4.6Hz)，6.90(2H，d，J＝8.4Hz)，7.11(2H，d，J＝8.4Hz)，7.19-7.34(3H，m)。
Reference example 76 N-[3-[4-[(5-chloro-2,3-dihydro-1H-indenes-1-yl) the oxygen base] phenyl] propyl group] Methanesulfomide
At 4-[(5-chloro-2,3-dihydro-1H-indenes-1-yl) oxygen base] in oxolane (50mL) solution of benzenepropanenitrile (1.0g, 3.4mmol), add lithium aluminium hydride (0.16g, 4.1mmol) down ice-cold, mixture was stirred 1 hour under water-bath.In reactant liquor, add water, use ethyl acetate extraction.Behind the washing extracting solution, concentrating under reduced pressure.After being dissolved in the grease that obtains in the chloroform (20mL), carry out ice-cold.Add triethylamine (0.47mL, 3.4mmol) and mesyl chloride (0.36mL, 3.4mmol) again, mixture was stirred 3 hours down ice-cold.In reactant liquor, add water, use ethyl acetate extraction.Behind the washing extracting solution, concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=7: 3), obtain table title chemical compound (0.15g, yield 11%).
Fusing point 89-90 ℃ (by the diethyl ether recrystallize).
1H NMR(CDCl 3)δ1.89(2H，m)，2.24(1H，m)，2.55(1H，m)，2.66(2H，t，J＝7.4Hz)，2.90(1H，m)，2.94(3H，s)，3.07-3.19(3H，m)，4.29(1H，br)，5.67(1H，dd，J＝4.4Hz，6.5Hz)，6.90(2H，d，J＝8.6Hz)，7.11(2H，d，J＝8.6Hz)，7.19-7.34(3H，m)。
Reference example 77 2,3-dihydro-2,2-dimethyl-1H-1-Indanone
At 1 of 60% sodium hydride (2.7g, 68mmol), slowly add 1-indone (3.0g, 23mmol) in the solution of 2-dimethoxy-ethane (30mL).After mixture at room temperature stirred 10 minutes, (5.7ml 91mmol), at room temperature stirred mixture 1 hour to add the iodate methyl.In reactant liquor, add water, use ethyl acetate extraction.Behind the washing extracting solution, concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane), obtain table title chemical compound (4.0g, yield 99%).
1H NMR(CDCl 3)δ1.24(6H，s)，3.01(2H，s)，7.35-7.44(2H，m)，7.59(1H，dt，J＝1.2Hz，7.6Hz)，7.76(1H，d，J＝7.8Hz)。
Reference example 78[4-([1,1 '-biphenyl]-the 3-ylmethoxy) phenoxy group] methyl acetate
With the method identical, obtain white powder table title chemical compound by (4-hydroxyphenoxy) methyl acetate and [1,1 ' biphenyl]-3-methanol with reference example 1.Yield 42%.
1H NMR(CDCl 3)δ3.80(3H，s)，4.59(2H，s)，5.08(2H，s)，6.86(2H，d，J＝9.2Hz)，6.94(2H，d，J＝9.2Hz)，7.33-7.64(9H，m)。
Reference example 79[4-([1,1 '-biphenyl]-the 3-ylmethoxy) phenoxy group] acetic acid
With the method identical, obtain the table title chemical compound by [4-([1,1 '-biphenyl]-3-ylmethoxy) phenoxy group] methyl acetate with reference example 4.Yield 88%.
Fusing point 132-133 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ4.63(2H，s)，5.08(2H，s)，6.88(2H，d，J＝9.3Hz)，6.95(2H，d，J＝9.3Hz)，7.31-7.64(9H，m)。
Reference example 80 2-[4-([1,1 ' biphenyl]-3-ylmethoxy) phenoxy group]-the 2 Methylpropionic acid ethyl ester
With the method identical, obtain the table title chemical compound by 2-(4-hydroxyphenoxy)-2 Methylpropionic acid ethyl ester and [1,1 '-biphenyl]-3-methanol with reference example 1.Yield 65%.
Oily.
1H NMR(CDCl 3)δ1.27(3H，t，J＝7.1Hz)，1.54(6H，s)，4.24(2H，q，J＝7.1Hz)，5.06(2H，s)，6.86(4H，m)，7.30-7.47(5H，m)，7.53-7.64(4H，m)。
Reference example 81 2-[4-([1,1 '-biphenyl]-the 3-ylmethoxy) phenoxy group]-2 Methylpropionic acid
With the method identical, by 2-[4-([1,1 '-biphenyl]-3-ylmethoxy) phenoxy group with reference example 4]-the 2 Methylpropionic acid ethyl ester obtains the table title chemical compound.Yield 93%.
Fusing point 114-115 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ1.55(6H，s)，5.08(2H，s)，6.92(4H，m)，7.31-7.45(5H，m)，7.54-7.64(4H，m)。
Reference example 82 [the 4-[(3-Phenoxyphenyl) methoxyl group] phenoxy group] methyl acetate
With the method identical, obtain white powder table title chemical compound by (4-hydroxyphenoxy) methyl acetate and (3-Phenoxyphenyl) methanol with reference example 1.Yield 47%.
1H NMR(CDCl 3)δ3.80(3H，s)，4.58(2H，s)，4.98(2H，s)，6.86(4H，m)，6.90-7.18(6H，m)，7.30-7.36(3H，m)。
Reference example 83 [the 4-[(3-Phenoxyphenyl) methoxyl group] phenoxy group] acetic acid
With the method identical, by [4-[(3-Phenoxyphenyl) methoxyl group] phenoxy group with reference example 4] methyl acetate obtains the table title chemical compound.Yield 86%.
Fusing point 115-116 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ4.63(2H，s)，4.98(2H，s)，6.81-7.16(10H，m)，7.31-7.36(3H，m)。
Reference example 84 2-[4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] phenoxy group]-the 2 Methylpropionic acid ethyl ester
With the method identical with reference example 1, by 2-(4-hydroxyphenoxy)-2 Methylpropionic acid ethyl ester and 2,3-dihydro-1H-indenes-1-alcohol obtains the table title chemical compound.Yield 63%.
Oily.
1H NMR(CDCl 3)δ1.29(3H，t，J＝7.1Hz)，1.56(6H，s)，2.20(1H，m)，2.51(1H，m)，2.91(1H，m)，3.13(1H，m)，4.25(2H，q，J＝7.1Hz)，5.67(1H，dd，J＝4.3Hz，6.6Hz)，6.88(4H，s)，7.20-7.31(3H，m)，7.40(1H，d，J＝7.2Hz)。
Reference example 85 2-[4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] phenoxy group]-2 Methylpropionic acid
With the method identical,, 3-dihydro-1H-indenes-1-yl) oxygen base by 2-[4-[(2 with reference example 4] phenoxy group]-the 2 Methylpropionic acid ethyl ester obtains the table title chemical compound.Yield 71%.
Fusing point 107-108 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ1.56(6H，s)，2.22(1H，m)，2.53(1H，m)，2.92(1H，m)，3.14(1H，m)，5.70(1H，dd，J＝4.3Hz，6.6Hz)，6.94(4H，s)，7.21-7.32(3H，m)，7.41(1H，d，J＝7.3Hz)。
Reference example 86 2-methyl-2-[4-[(3-Phenoxyphenyl) methoxyl group] phenoxy group] ethyl propionate
With the method identical, obtain the table title chemical compound by 2-(4-hydroxyphenoxy)-2 Methylpropionic acid ethyl ester and (3-Phenoxyphenyl) methanol with reference example 1.Yield 78%.
Oily.
1H NMR(CDCl 3)δ1.27(3H，t，J＝7.1Hz)，1.54(6H，s)，4.23，(2H，q，J＝7.1Hz)，4.97(2H，s)，6.82(4H，s)，6.89-7.14(6H，m)，7.30-7.36(3H，m)。
Reference example 87 2-methyl-2-[4-[(3-Phenoxyphenyl) methoxyl group] phenoxy group] propanoic acid
With the method identical, by 2-methyl-2-[4-[(3-Phenoxyphenyl with reference example 4) methoxyl group] phenoxy group] ethyl propionate obtains the table title chemical compound.Yield 99%.
Noncrystalline.
1H NMR(CDCl 3)δ1.54(6H，s)，4.99(2H，s)，6.85-7.15(10H，m)，7.31-7.36(3H，m)。
Reference example 88 [4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] phenoxy group] methyl acetate
With the method identical with reference example 1, by 2-(4-hydroxy phenyl)-2 Methylpropionic acid ethyl ester and 2,3-dihydro-1H-indenes-1-alcohol obtains the table title chemical compound.Yield 52%.
Oily.
1H NMR(CDCl 3)δ2.22(1H，m)，2.51(1H，m)，2.90(1H，m)，3.14(1H，m)，3.82(3H，s)，4.61(2H，s)，5.67(1H，dd，J＝4.4Hz，6.6Hz)，6.86-6.96(4H，m)，7.21-7.30(3H，m)，7.40(1H，d，J＝7.3Hz)。
Reference example 89 [4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] phenoxy group] acetic acid
With the method identical, by [4-[(2,3-dihydro-1H-indenes-1-yl) oxygen base] phenoxy group with reference example 4] methyl acetate obtains the table title chemical compound.Yield 48%.
Fusing point 99-100 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.22(1H，m)，2.50(1H，m)，2.94(1H，m)，3.12(1H，m)，4.66(2H，s)，5.68(1H，dd，J＝4.3Hz，6.6Hz)，6.90(2H，d，J＝9.3Hz)，6.95(2H，d，J＝7.2Hz)，7.20-7.30(3H，m)，7.40(1H，d，J＝7.3Hz)。
Reference example 90 3-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] phenylacetic acid (2,3-dihydro-1H-indenes-1-yl) ester
With the method identical with embodiment 105, by (3-hydroxy phenyl) acetic acid and 2,3-dihydro-1H-indenes-1-alcohol obtains the table title chemical compound.Yield 81%.
Oily.
1H NMR(CDCl 3)δ2.03-2.24(2H，m)，2.44-2.59(2H，m)，2.83-2.96(2H，m)，3.05-3.18(2H，m)，3.61(2H，s)，5.71-5.75(1H，m)，6.21-6.24(1H，m)，6.88-6.94(3H，m)，7.18-7.31(7H，m)，7.36-7.43(2H，m)。
Reference example 91 3-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] phenylacetic acid
With the method identical,, 3-dihydro-1H-indenes-1-yl) oxygen base by 3-[(2 with embodiment 106] phenylacetic acid (2,3-dihydro-1H-indenes-1-yl) ester obtains the table title chemical compound.Yield 61%.
Oily.
1H NMR(CDCl 3)δ2.14-2.25(1H，m)，2.49-2.61(1H，m)，2.85-2.95(1H，m)，3.08-3.18(1H，m)，3.62(2H，s)，5.73-5.77(1H，m)，6.87-6.94(3H，m)，7.20-7.30(4H，m)，7.41(1H，d，J＝7.3 Hz)，9.65(1H，br s)。
Reference example 92 2,3-dihydro-1-(3-iodine phenoxy group)-1H-indenes
With the method identical with embodiment 105, by 3-iodophenol and 2,3-dihydro-1H-indenes-1-alcohol obtains the table title chemical compound.Yield 37%.
Oily.
1H NMR(CDCl 3)δ2.18-2.23(1H，m)，2.52-2.57(1H，m)，2.93-2.98(1H，m)，3.10-3.14(1H，m)，5.71-5.75(1H，m)，6.97-7.02(2H，m)，7.22-7.32(4H，m)，7.37-7.40(2H，m)。
Reference example 93 3-(2,3-dihydro-1H-indenes-1-ylmethoxy) ethyl phenylbutyrate
2, two (triphenylphosphine) palladium (28mg, the 0.04mmol) mixture of 3-dihydro-1-(3-iodine phenoxy group)-1H-indenes (1.5g, 4.5mmol), oxolane (8mL), 0.5M bromination 4-ethyoxyl-4-oxygen-butyl zinc oxolane (13mL, 6.5mmol) solution and chlorination stirred 1 hour down at 60 ℃.Heat up in a steamer and desolvate, behind ethyl acetate dilution residue, anhydrous magnesium sulfate drying is used in washing.Heat up in a steamer desolvate after, with the refining residue of silica gel column chromatography (hexane/ethyl acetate=5: 1), obtain table title chemical compound (0.70g, yield 48%).Oily.
1H NMR(CDCl 3)δ1.28(3H，t，J＝7.1Hz)，1.94-2.04(2H，m)，2.18-2.36(3H，m)，2.53-2.67(3H，m)，2.87-2.97(1H，m)，3.09-3.19(1H，m)，4.12(2H，d，J＝7.1Hz)，5.74-5.78(1H，m)，6.79-6.87(2H，m)，7.21-7.30(5H，m)，7.43(1H，d，J＝7.2Hz)。
Reference example 94 3-(2,3-dihydro-1H-indenes-1-ylmethoxy) benzenebutanoic acid
Method with identical with embodiment 106 obtains the table title chemical compound by 3-(2,3-dihydro-1H-indenes-1-ylmethoxy) ethyl phenylbutyrate.Yield 80%.
Oily.
1H NMR(CDCl 3)δ1.93(2H，m)，2.16-2.27(1H，m)，2.39(2H，t，J＝7.5Hz)，2.57-2.62(1H，m)，2.67(2H，t，J＝7.5Hz)，2.87-2.97(1H，m)，3.10-3.20(1H，m)，5.74-5.78(1H，m)，6.79-6.88(3H，m)，7.21-7.31(4H，m)，7.43(1H，d，J＝7.2Hz)，9.76(1H，br s)。
Reference example 95 4-[(4-chloro-2-trifluoromethyl-5-quinolyls) methoxyl group] methyl phenylpropionate
Method with identical with embodiment 105 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 4-chloro-2-trifluoromethyl-5-quinoline methanol.Yield 65%.
Fusing point 111-112 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.61(2H，t，J＝7.5Hz)，2.91(2H，t，J＝7.5Hz)，3.67(3H，s)，5.30(2H，s)，6.95(2H，d，J＝8.6Hz)，7.14(2H，d，J＝8.6Hz)，7.84(1H，s)，7.93-7.97(1H，m)，8.26(1H，d，J＝8.7Hz)，8.35(1H，s)。
Reference example 96 4-(2-trifluoromethyl-4-chloroquinoline base-5-ylmethoxy) benzenpropanoic acid
With the method identical, 4-[(4-chloro-2-trifluoromethyl-5-quinoline with embodiment 106) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 90%.
Fusing point 175-176 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(DMSO-d 6)δ2.47(2H，t，J＝7.5Hz)，2.76(2H，t，J＝7.5Hz)，5.33(2H，s)，6.96-7.02(2H，m)，7.15-7.17(2H，m)，7.42(1H，s)，7.93(1H，d，J＝8.7Hz)，8.07-8.13(1H，m)，8.29(1H，s)，12.08(1H，br s)。
Reference example 97 4-[2-(1-naphthyl) ethyoxyl] methyl phenylpropionate
Method with identical with embodiment 105 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 1-naphthyl ethyl alcohol.Yield 63%.
Fusing point 112-114 ℃ (by ethyl acetate-diisopropyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.58(2H，t，J＝7.5Hz)，2.88(2H，t，J＝7.5Hz)，3.57(2H，t，J＝7.4Hz)，3.66(3H，s)，4.28(2H，t，J＝7.4Hz)，6.82(2H，t，J＝8.6Hz)，7.09(2H，d，J＝8.6Hz)，7.42-7.56(4H，m)，7.75-7.78(1H，m)，7.86-7.89(1H，m)，8.10-8.11(1H，m)。
Reference example 98 4-[2-(1-naphthyl) ethyoxyl] benzenpropanoic acid
With with embodiment 106 with method, by 4-[2-(1-naphthyl) ethyoxyl] methyl phenylpropionate obtains the table title chemical compound.Yield 89%.
Fusing point 111-112 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.64(2H，t，J＝7.5Hz)，2.89(2H，t，J＝7.5Hz)，3.57(2H，t，J＝7.4Hz)，4.28(2H，t，J＝7.4Hz)，6.83(2H，t，J＝8.6Hz)，7.10(2H，d，J＝8.6Hz)，7.42-7.55(4H，m)，7.73-7.78(1H，m)，7.86-7.89(1H，m)，8.10-8.11(1H，m)，9.85(1H，br s)。
Reference example 99 4-hydroxyl-3-priodax methyl ester and 4-hydroxyl-3,5-diiodo-benzene methyl propionate
28% ammonia spirit (10mL) of 4-hydroxy phenylpropionic acid methyl ester (3.0g, 17mmol), at the ice-cold mixture that splashes into iodine (4.7g, 18mmol), potassium iodide (4.6g, 28mmol) and water (10mL) down.Behind the reaction stirred mixture 1.5 hours,, use ethyl acetate extraction with the neutralization of 1 equivalent hydrochloric acid.Clean organic layer with 1% sodium thiosulfate solution and saturated aqueous common salt, use anhydrous magnesium sulfate drying.Solvent heats up in a steamer, and residue is invested in the silica gel column chromatography, obtains 4-hydroxyl-3,5-diiodo-benzene methyl propionate (3.0g, yield 59%) by the eluent of hexane/ethyl acetate=5: 1.
Fusing point 64-66 ℃ (by ethyl acetate-petroleum ether recrystallize).
1H NMR(CDCl 3)δ2.57(2H，t，J＝7.5Hz)，2.81(2H，t，J＝7.5Hz)，3.68(3H，s)，5.63(1H，s)，7.52(2H，s)。
In addition, the eluent by hexane/ethyl acetate=5: 1 obtains 4-hydroxyl-3-priodax methyl ester (1.6g, yield 22%).
Oily.
1H NMR(CDCl 3)δ2.58(2H，t，J＝7.5Hz)，2.84(2H，t，J＝7.5Hz)，3.67(3H，s)，5.81(1H，s)，6.86(1H，d，J＝8.3Hz)，7.03-7.07(1H，m)，7.50(1H，s)。
Reference example 100 2-(4-methoxyphenyl)-7-iodo-5-benzofuran methyl propionate
With 4-hydroxyl-3, the N of 5-diiodo-benzene methyl propionate (0.89g, 2.1mmol), 4-methoxyl group Phenylacetylene. copper (0.63g), dinethylformamide (15mL) solution stirs an evening down at 120 ℃.After solvent heats up in a steamer, dilute residue, washing with ethyl acetate.Behind the anhydrous magnesium sulfate drying organic layer, concentrate.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=6: 1), obtain table title chemical compound (0.67g, yield 74%).
Fusing point 103-104 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.66(2H，t，J＝7.5Hz)，2.99(2H，t，J＝7.5Hz)，3.68(3H，s)，3.87(3H，s)，6.91(1H，s)，6.98(2H，d，J＝8.8Hz)，7.32(1H，s)，7.44(1H，s)，7.81(2H，d，J＝8.8Hz)。
Reference example 101 2-(4-methoxyphenyl)-5-benzofuran methyl propionate
The mixture heated of 2-(4-methoxyphenyl)-7-iodo-5-benzofuran methyl propionate (0.61g, 1.4mmol), zinc (0.92g, 14mmol), oxolane (10mL), methanol (30mL) and 2 equivalent hydrogen chloride methanol solutions (3.0mL) refluxes an evening.Behind the filtering reacting liquid, concentrated filtrate.Behind ethyl acetate dilution residue, anhydrous magnesium sulfate drying is used in washing.After decompression concentrates down,, obtain table title chemical compound (011g, yield 26%) with the refining residue of silica gel column chromatography (hexane/ethyl acetate=6: 1).
Fusing point 74-75 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.68(2H，t，J＝7.5Hz)，3.04(2H，t，J＝7.5Hz)，3.67(3H，s)，3.88(3H，s)，6.88-6.91(1H，m)，6.92(1H，s)，7.10-7.13(1H，m)，7.32-7.44(5H，m)。
Reference example 102 2-(4-methoxyphenyl)-5-benzofuran propanoic acid
Method with identical with embodiment 106 obtains the table title chemical compound by 2-(4-methoxyphenyl)-5-benzofuran methyl propionate.Yield 74%.
Fusing point 211-212 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(DMSO-d 6)δ2.58(2H，t，J＝7.5Hz)，2.91(2H，t，J＝7.5Hz)，3.82(3H，s)，7.06(2H，d，J＝8.9Hz)，7.12-7.16(1H，m)，7.21(1H，s)，7.44-7.50(2H，m)，7.84(2H，d，J＝8.8Hz)，12.08(1H，br s)。
Reference example 103 2-(3-methoxyphenyl)-5-benzofuran methyl propionate
Method with identical with reference example 100 obtains the table title chemical compound by 4-hydroxyl-3-priodax methyl ester and 3-methoxyl group Phenylacetylene. copper.Yield 19%.
Fusing point 74-75 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.68(2H，t，J＝7.5Hz)，3.04(2H，t，J＝7.5Hz)，3.67(3H，s)，3.88(3H，s)，6.88-6.91(1H，m)，6.91(1H，s)，7.10-7.13(1H，m)，7.32-7.44(5H，m)。
Reference example 104 2-(3-methoxyphenyl)-5-benzofuran propanoic acid
Method with identical with embodiment 106 obtains the table title chemical compound by 2-(3-methoxyphenyl)-5-benzofuran methyl propionate.Yield 83%.
Fusing point 134-135 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(DMSO-d 6)δ2.58(2H，t，J＝7.5Hz)，2.92(2H，t，J＝7.5Hz)，3.85(3H，s)，6.96-7.00(1H，m)，7.17-7.21(1H，m)，7.38-7.54(6H，m)，12.12(1H，br s)。
With reference to 105 4-methoxyl group Phenylacetylene. copper
In the ice-cold mixture of copper sulfate pentahydrate (2.5g, 10mmol), 28% ammonia (10mL), water (100mL) and hydroxy amine hydrochloric acid salt (1.4g, 20mmol), add ethanol (60mL) solution of 4-methoxyl group Phenylacetylene. (1.3g, 10mmol), stirred the mixture 5 minutes.Behind the filtering precipitate, water, ethanol and diethyl ether are cleaned, and decompression is dry down, obtains yellow powder shape table title chemical compound (1.8g, yield 92%). 1H-NMR(DMSO-d 6)δ3.77(3H，s)，6.93(2H，d，J＝8.8Hz)，7.40(2H，d，J＝8.8Hz)。
Reference example 106 3-methoxyl group Phenylacetylene. copper
Method with identical with reference example 105 obtains yellow powder shape table title chemical compound by 3-methoxyl group Phenylacetylene..Yield 90%.
1H-NMR(DMSO-d 6)δ3.76(3H，s)，6.97-7.07(3H，m)，7.30(1H，t，J＝8.1Hz)。
Reference example 107 4-[[3-(3-furyl) phenyl] methoxyl group] methyl phenylpropionate
Method with identical with embodiment 22 obtains the table title chemical compound by 3-furan boric acid.Yield 83%.Oily.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.66(3H，s)，5.06(2H，s)，6.71(1H，dd，J＝1.8Hz，0.7Hz)，6.92(2H，d，J＝8.7Hz)，7.12(2H，t，J＝8.7Hz)，7.31-7.48(4H，m)，7.54(1H，s)，7.74-7.75(1H，m)。
Reference example 108 4-[[3-(3-furyl) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[3-(3-furyl) phenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 26%.
Fusing point 120-122 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝8.0Hz)，2.91(2H，t，J＝8.0Hz)，5.06(2H，s)，6.70-6.71(1H，m)，6.92(2H，t，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.30-7.48(4H，m)，7.54(1H，s)，7.74(1H，s)。
Reference example 109 4-[[3-(1H-pyrroles-1-yl) phenyl] methoxyl group] methyl phenylpropionate
The 4-[(3-bromophenyl) methoxyl group] methyl phenylpropionate (0.80g, 2.3mmol), pyrroles (0.17g, 2.5mmol), three-tert-butyl group phosphine (19mg, 0.092mmol), cesium carbonate (1.3g, 3.9mmol) be dissolved in the toluene (25mL), after the argon displacement, add three (two benzal acetone) two palladiums (O) (84mg, 0.092mmol).Reactant liquor heated 18 hours down at 100 ℃ under ar gas environment atmosphere.Behind the cooling reactant liquor, in reactant liquor, add water, use ethyl acetate extraction.The washing extracting solution, dry back concentrates.With the refining residue of silica gel column chromatography (ethyl acetate/hexane=15: 1), obtain yellow powder shape table title chemical compound (56mg, yield 7%).
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.1Hz)，2.90(2H，t，J＝8.1Hz)，3.66(3H，s)，5.08(2H，s)，6.35(2H，t，J＝2.2Hz)，6.91(2H，d，J＝8.6Hz)，7.09-7.15(4H，m)，7.24-7.36(4H，m)。
Reference example 110 4-[[3-(1H-pyrroles-1-yl) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[3-(1H-pyrroles-1-yl) phenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 16%.
Fusing point 120-122 ℃ (by diisopropyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.9Hz)，2.91(2H，t，J＝7.9Hz)，5.08(2H，s)，6.35(2H，t，J＝2.1Hz)，6.91(2H，d，J＝8.6Hz)，7.10(2H，t，J＝2.1Hz)，7.14(2H，d，J＝8.6Hz)，7.26-7.47(4H，m)。
Reference example 111 4-[[3-(2-thiazolyl) phenyl] methoxyl group] methyl phenylpropionate
Method with identical with reference example 61 obtains the table title chemical compound by the 2-bromo thiazole.Yield 38%.
Oily.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.1Hz)，2.90(2H，t，J＝8.1Hz)，3.66(3H，s)，5.10(2H，s)，6.92(2H，d，J＝8.6Hz)，7.12(2H，d，J＝8.6Hz)，7.35(1H，d，J＝3.3Hz)，7.43-7.52(2H，m)，7.88(1H，d，J＝3.3Hz)，7.91(1H，dt，J＝7.2Hz，1.7Hz)，8.05(1H，s)。
Reference example 112 4-[[3-(2-thiazolyl) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[3-(2-thiazolyl) phenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 81%.
Fusing point 126-127 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝8.0Hz)，2.91(2H，t，J＝8.0Hz)，5.10(2H，s)，6.93(2H，d，J＝8.6Hz)，7.14(2H，d，J＝8.6Hz)，7.35(1H，d，J＝3.3Hz)，7.43-7.52(2H，m)，7.88-7.92(2H，m)，8.04(1H，s)。
Reference example 113 4-[[3-(2-pyrazinyl) phenyl] methoxyl group] methyl phenylpropionate
Method with identical with reference example 61 obtains the table title chemical compound by the iodine pyrazine.Yield 54%.
Oily.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.66(3H，s)，5.14(2H，s)，6.93(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.51-7.55(2H，m)，7.95-7.99(1H，m)，8.10(1H，s)，8.53(1H，d，J＝2.5Hz)，8.64-8.67(1H，m)，9.05(1H，d，J＝1.4Hz)。
Reference example 114 4-[[3-(2-pyrazinyl) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[3-(2-pyrazinyl) phenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 62%.
Fusing point 167.0-167.5 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3+DMSO-d 6)δ2.26(2H，t，J＝8.2Hz)，2.90(2H，t，J＝8.2Hz)，5.14(2H，s)，6.92(2H，d，J＝8.6Hz)，7.15(2H，d，J＝8.6Hz)，7.51-7.58(2H，m)，7.94-7.99(1H，m)，8.10(1H，s)，8.53(1H，d，J＝2.5Hz)，8.65(1H，dd，J＝2.4Hz，1.6Hz)，9.05(1H，d，J＝1.5Hz)。
Reference example 115 4-[(5-bromo-2-chlorobenzenes) methoxyl group] methyl phenylpropionate
Method with identical with reference example 1 obtains the table title chemical compound by 3-bromo-2-chlorobenzyl alcohol.Yield 54%.
Oily.
1H NMR(CDCl 3)δ2.61(2H，t，J＝8.1Hz)，2.91(2H，t，J＝8.1Hz)，3.69(3H，s)，5.09(2H，s)，6.91(2H，d，J＝8.6Hz)，7.14(2H，d，J＝8.6Hz)，7.24-7.27(1H，m)，7.38(1H，dd，J＝8.5Hz，2.3Hz)，7.73(1H，d，J＝2.3Hz)。
Reference example 116 4-[(5-bromo-2-chlorphenyls) methoxyl group] benzenpropanoic acid
With the method identical, by 4-[(5-bromo-2-chlorphenyl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 66%.
Yield 81%.
Fusing point 120.0-120.5 ℃ (by ethyl acetate-hexane recrystallize).
1HNMR(CDCl 3)δ2.66(2H，t，J＝7.8Hz)，2.92(2H，t，J＝7.8Hz)，5.09(2H，s)，6.92(2H，d，J＝8.6Hz)，7.16(2H，d，J＝8.6Hz)，7.24-7.27(1H，m)，7.38(1H，dd，J＝8.5 Hz，2.3Hz)，7.73(1H，d，J＝2.3Hz)。
Reference example 117 4-[(3-bromo-4-chlorphenyls) methoxyl group] methyl phenylpropionate
Method with identical with reference example 1 obtains the table title chemical compound by 3-bromo-4-chlorobenzyl alcohol.Yield 65%.
Oily.
1H NMR(CDCl 3)δ2.60(2H，t，J＝7.6Hz)，2.89(2H，t，J＝7.6Hz)，3.66(3H，s)，5.04(2H，s)，6.85-6.89(2H，m)，7.10-7.13(2H，m)，7.35(3H，s)。
Reference example 118 4-[(3-bromo-4-chlorphenyls) methoxyl group] benzenpropanoic acid
With the method identical, by 4-[(3-bromo-4-chlorphenyl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 81%.
Yield 81%.
Fusing point 156-158 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.9Hz)，2.90(2H，t，J＝7.9Hz)，5.00(2H，s)，6.88(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.35(3H，s)。
Reference example 119 4-[[3-[5-(trifluoromethyl)-2-pyridine radicals] phenyl] methoxyl group] methyl phenylpropionate
Method with identical with reference example 61 obtains the table title chemical compound by 2-chloro-5-(trifluoromethyl) pyridine.Yield 41%.
Oily.
1H NMR(CDCl 3)δ2.61(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.66(3H，s)，5.14(2H，s)，6.93(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.50-7.60(2H，m)，7.86(1H，d，J＝8.3Hz)，7.97-8.01(2H，m)，8.11(1H，br s)，8.95(1H，br s)。
Reference example 120 4-[[3-[5-(trifluoromethyl)-2-pyridine radicals] phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[3-[5-(trifluoromethyl)-2-pyridine radicals with reference example 4] phenyl] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.
Yield 32%.
Fusing point 155-156 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.64(2H，t，J＝7.7Hz)，2.90(2H，t，J＝7.7Hz)，5.12(2H，s)，6.92(2H，d，J＝8.4Hz)，7.13(2H，d，J＝8.4Hz)，7.49-7.54(2H，m)，7.85(1H，d，J＝8.3Hz)，7.90-8.00(2H，m)，8.10(1H，s)，8.95(1H，s)。
Reference example 121 4-[[2-methyl-5-[4-(trifluoromethyl) phenyl]-the 3-furyl] methoxyl group] methyl phenylpropionate
With the method identical, by 2-methyl-5-[4-(trifluoromethyl) phenyl with reference example 1]-the 3-furancarbinol obtains the table title chemical compound.Yield 74%.
Oily.
1H NMR(CDCl 3)δ2.40(3H，s)，2.61(2H，t，J＝8.0Hz)，2.91(2H，t，J＝8.0Hz)，3.67(3H，s)，4.85(2H，s)，6.78(1H，s)，6.90(2H，d，J＝8.6Hz)，7.14(2H，d，J＝8.6Hz)，7.60(2H，d，J＝8.4Hz)，7.71(2H，d，J＝8.4Hz)。
Reference example 122 4-[[2-methyl-5-[4-(trifluoromethyl) phenyl]-the 3-furyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[2-methyl-5-[4-(trifluoromethyl) phenyl with reference example 4]-the 3-furyl] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 53%.
Fusing point 182-183 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.40(3H，s)，2.66(2H，t，J＝7.8Hz)，2.92(2H，t，J＝7.8Hz)，4.85(2H，s)，6.78(1H，s)，6.91(2H，d，J＝8.6Hz)，7.15(2H，d，J＝8.6Hz)，7.60(2H，d，J＝8.4Hz)，7.71(2H，d，J＝8.4Hz)。
Reference example 123 4-[[5-(2, the 6-3,5-dimethylphenyl)-2-acetenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[(5-bromo-2-acetenyl with embodiment 22) methoxyl group] methyl phenylpropionate and 2,6-dimethyl benzene ylboronic acid obtains 4-[[5-(2, the 6-dimethyl benzene)-2-acetenyl] methoxyl group] methyl phenylpropionate.Yield 83%.Then, use the method identical, by 4-[[5-(2, the 6-3,5-dimethylphenyl)-2-acetenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 26%.
Fusing point 120-121 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.17(6H，s)，2.65(2H，t，J＝7.7Hz)，2.91(2H，t，J＝7.7Hz)，5.20(2H，s)，6.70(1H，d，J＝3.4Hz)，6.94(2H，d，J＝8.5Hz)，7.08-7.20(6H，m)。
Reference example 124 4-[[3-(2-pyridine radicals oxygen base) phenyl] methoxyl group] benzenpropanoic acid
Method with identical with reference example 1 obtains 4-[[3-(2-pyridine radicals oxygen base) phenyl by 4-hydroxy phenylpropionic acid methyl ester and 3-(2-pyridine radicals oxygen base) benzyl alcohol] methoxyl group] methyl phenylpropionate.Yield 77%.In addition, use the method identical by 4-[[3-(2-pyridine radicals oxygen base) phenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 55%.
Fusing point 146-147 (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3+DMSO-d 6)δ2.57(2H，t，J＝7.5Hz)，2.89(2H，t，J＝7.5Hz)，5.05(2H，s)，6.86-6.92(3H，m)，6.99-7.14(4H，m)，7.21-7.26(2H，m)，7.40(1H，t，J＝7.8Hz)，7.67-7.72(1H，m)，8.19(1H，d，J＝4.3Hz)。
Reference example 125 4-[[4-(bromomethyl) phenyl] methoxyl group] methyl phenylpropionate
α, α '-two bromo-p-dimethylbenzene (11g, 40mmol), 4-hydroxy phenylpropionic acid methyl ester (1.7g, 10mmol), potassium carbonate (1.6g, 12mmol) are dissolved in the acetone (200mL) reflux 8 hours.Behind the cooling reactant liquor, add water in the reactant liquor, with ethyl acetate and tetrahydrofuran extraction.The washing extracting solution, dry back concentrates.With the refining residue of silica gel column chromatography (ethyl acetate/hexane=18: 1), obtain white powder table title chemical compound (0.78g, yield 21%).
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.89(2H，t，J＝8.0Hz)，3.66(3H，s)，4.50(2H，s)，5.03(2H，s)，6.86-6.91(2H，m)，7.11(2H，d，J＝8.6Hz)，7.40(4H，m)。
Reference example 126 3-bromo-4-hydroxy phenylpropionic acid methyl ester
In acetic acid (10mL) solution of 4-hydroxy phenylpropionic acid methyl ester (1.0g, 5.6mmol), add sodium acetate (0.46g, 6.1mmol), in addition for reactant liquor does not generate heat, while under water-bath, cool off the bromine that drips (0.89g, 5.6mmol).Mixture adds water after at room temperature stirring 30 minutes, uses ethyl acetate extraction.Behind the washing extracting solution, concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=9: 1), obtained table title chemical compound (0.68g, yield 47%).
Oily.
1H NMR(CDCl 3)δ2.59(2H，t，J＝7.5Hz)，2.86(2H，t，J＝7.5Hz)，3.67(3H，s)，5.45(1H，s)，6.93(1H，d，J＝8.3Hz)，7.04(1H，dd，J＝1.9Hz，8.3Hz)，7.30(1H，d，J＝1.9Hz)。
Reference example 127 4-(6-benzothiazole ylmethoxy) methyl phenylpropionate
Method with identical with embodiment 105 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 6-benzothiazolyl methanol.Yield 66%.
Fusing point 103-106 ℃ (by ethyl acetate-diisopropyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.60(2H，t，J＝7.5Hz)，2.90(2H，t，J＝7.5Hz)，3.66(3H，s)，5.20(2H，s)，6.92(2H，d，J＝8.7Hz)，7.12(2H，d，J＝8.7Hz)，7.55-7.58(1H，m)，8.05(1H，s)，8.13(1H，d，J＝8.4Hz)，9.00(1H，s)。
Reference example 128 4-(6-benzothiazole ylmethoxy) benzenpropanoic acid
Method with identical with embodiment 105 obtains the table title chemical compound by 4-(6-benzothiazole ylmethoxy) methyl phenylpropionate.Yield 88%.
Fusing point 176-177 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(DMSO-d 6)δ2.48(2H，t，J＝7.5Hz)，2.75(2H，t，J＝7.5Hz)，5.22(2H，s)，6.95(2H，d，J＝8.7Hz)，7.14(2H，d，J＝8.6Hz)，7.59-7.63(1H，m)，8.10(1H，d，J＝8.4Hz)，8.24(1H，s)，9.40(1H，s)，12.08(1H，br s)。
Embodiment 1 4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-1H-indenes-1-yl) oxygen base by 4-[(2 with reference example 4] methyl phenylpropionate obtains the table title chemical compound.Yield 33%.
Fusing point 103-104 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.14-2.38(1H，m)，2.50-2.63(1H，m)，2.67(2H，t，J＝7.4Hz)，2.87-2.96(3H，m)，3.08-3.19(1H，m)，5.73(1H，dd，J＝4.9Hz，6.5Hz)，6.94(2H，d，J＝8.5Hz)，7.15(2H，d，J＝8.5Hz)，7.21-7.33(3H，m)，7.42(1H，d，J＝7.2Hz)。
Embodiment 2 4-[(1,2,3,4-tetrahydronaphthalene-1-yl) the oxygen base] benzenpropanoic acid
With the method identical,, 2,3,4-tetrahydronaphthalene-1-yl) oxygen base by 4-[(1 with reference example 4] methyl phenylpropionate obtains the table title chemical compound.Yield 51%.
Fusing point 69-70 ℃ (by diisopropyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ1.70-1.85(1H，m)，1.98-2.16(3H，m)，2.74-2.89(2H，m)，2.67(2H，t，J＝7.4Hz)，2.93(2H，t，J＝7.4Hz)，5.33(1H，t，J＝4.1Hz)，6.96(2H，d，J＝8.6Hz)，7.14-7.24(5H，m)，7.36-7.39(1H，m)。
Embodiment 3 4-[[2,3-dihydro-5-(phenyl methoxyl group)-1H-indenes-1-yl] the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-5-(phenyl methoxyl group)-1H-indenes-1-yl by 4-[[2 with reference example 4] the oxygen base] methyl phenylpropionate obtains the table title chemical compound.Yield 33%.
Fusing point 99-100 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.15-2.30(1H，m)，2.45-2.60(1H，m)，2.67(2H，t，J＝7.8Hz)，2.82-2.90(1H，m)，2.92(2H，t，J＝7.8Hz)，3.06-3.14(1H，m)，5.07(2H，s)，5.67(1H，dd，J＝6.5，3.6Hz)，6.85-6.93(4H，m)，7.14(2H，d，J＝8.5Hz)，7.30-7.44(6H，m)。
Embodiment 4 4-[[4-[[methyl (4-phenyl-2-thiazolyl) amino] methyl] phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[4-[[methyl (4-phenyl-2-thiazolyl) amino with reference example 4] methyl] phenyl] methoxyl group] the benzenpropanoic acid ethyl ester obtains the table title chemical compound.Yield 60%.
Fusing point 130-131 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.64(2H，t，J＝7.9Hz)，2.90(2H，t，J＝7.9Hz)，3.07(3H，s)，4.78(2H，s)，5.02(2H，s)，6.72(1H，s)，6.89(2H，d，J＝8.6Hz)，7.12(2H，d，J＝8.6Hz)，7.26-7.30(1H，m)，7.34-7.41(6H，m)，7.85-7.88(2H，m)。
Embodiment 5 4-[(4-Phenoxyphenyls) methoxyl group] benzenpropanoic acid
With the method identical, by the 4-[(4-Phenoxyphenyl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 51%.
Fusing point 144-145 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.9Hz)，2.91(2H，t，J＝7.9Hz)，5.00(2H，s)，6.91(2H，d，J＝8.6Hz)，7.00-7.03(4H，m)，7.08-7.15(3H，m)，7.34(2H，t，J＝8.3Hz)，7.39(2H，d，J＝8.6Hz)。
Embodiment 6 4-[[4-(phenyl methoxyl group) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[4-(phenyl methoxyl group) phenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains pulverous table title chemical compound.Yield 11%.
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.9Hz)，2.90(2H，t，J＝7.9Hz)，4.96(2H，s)，5.07(2H，s)，6.90(2H，d，J＝8.6Hz)，6.98(2H，d，J＝8.6Hz)7.12(2H，d，J＝8.6Hz)，7.30-7.50(7H，m)。
Embodiment 7 4-([1,1 '-xenyl]-the 4-ylmethoxy) benzenpropanoic acid
With the method identical, obtain 4-([1,1 '-xenyl]-4-ylmethoxy) methyl phenylpropionate by 4-hydroxy phenylpropionic acid methyl ester and 4-phenylbenzyl bromide with reference example 5.This matter utilization and reference example 4 identical methods are formed the table title chemical compound.The yield that is obtained by 4-hydroxy phenylpropionic acid methyl ester is 11%.
Fusing point 187-189 ℃ (by oxolane-hexane recrystallize).
1H NMR(CDCl 3)δ2.66(2H，t，J＝7.7Hz)，2.91(2H，t，J＝7.7Hz)，5.08(2H，s)，6.93(2H，d，J＝8.4Hz)，7.14(2H，d，J＝8.4Hz)，7.30-7.50(5H，m)，7.50-7.60(4H，m)。
Embodiment 8 4-([1,1 ' xenyl]-3-ylmethoxy) benzenpropanoic acid
With the method identical, obtain the table title chemical compound by 4-([1,1 '-xenyl]-3-ylmethoxy) methyl phenylpropionate with reference example 4.Yield 48%.
Fusing point 125-126 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.9Hz)，2.91(2H，t，J＝7.9Hz)，5.10(2H，s)，6.93(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.30-7.47(5H，m)，7.50-7.61(3H，m)，7.65(1H，s)。
Embodiment 9 4-[(3-Phenoxyphenyls) methoxyl group] benzenpropanoic acid
With the method identical, by the 4-[(3-Phenoxyphenyl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 50%.
Fusing point 94-95 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.64(2H，t，J＝7.9Hz)，2.90(2H，t，J＝7.9Hz)，5.01(2H，s)，6.86-6.90(2H，m)，6.88-6.98(1H，m)，7.00-7.03(2H，m)，7.08-7.17(5H，m)，7.30-7.36(3H，m)。
Embodiment 10 4-([1,1 '-xenyl]-the 2-ylmethoxy) benzenpropanoic acid
With the method identical, obtain the table title chemical compound by 4-([1,1 '-xenyl]-2-ylmethoxy) methyl phenylpropionate with reference example 4.Yield 45%.
Fusing point 103-104 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.63(2H，t，J＝7.9Hz)，2.88(2H，t，J＝7.9Hz)，4.91(2H，s)，6.79(2H，d，J＝8.6Hz)，7.08(2H，d，J＝8.6Hz)，7.33-7.50(8H，m)，7.60-7.70(1H，m)。
Embodiment 11 4-[(2-Phenoxyphenyls) methoxyl group] benzenpropanoic acid
With the method identical, by the 4-[(2-Phenoxyphenyl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 45%.
Fusing point 114-115 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.63(2H，t，J＝7.9Hz)，2.89(2H，t，J＝7.9Hz)，5.13(2H，s)，6.86-6.92(3H，m)，6.95-7.00(2H，m)，7.06-7.12(3H，m)，7.16(1H，dd，J＝7.5Hz，1.0Hz)，7.24-7.36(3H，m)，7.58(1H，dd，J＝7.5Hz，1.4Hz)。
Embodiment 12 4-[(4-benzo acyl group phenyl) methoxyl group] benzenpropanoic acid
With the method identical, by 4-[(4-benzo acyl group phenyl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 84%.
Fusing point 141-142 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.66(2H，t，J＝8.0Hz)，2.92(2H，t，J＝8.0Hz)，5.14(2H，s)，6.92(2H，d，J＝8.6Hz)，7.15(2H，d，J＝8.6Hz)，7.42-7.65(5H，m)，7.79-7.84(4H，m)。
Embodiment 13 4-[[4-(4-chlorobenzene formacyl) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[4-(4-chlorobenzene formacyl) phenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 90%.
Fusing point 177-178 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.66(2H，t，J＝7.9Hz)，2.92(2H，t，J＝7.9Hz)，5.14(2H，s)，6.91(2H，d，J＝8.6Hz)，7.15(2H，d，J＝8.6Hz)，7.46(2H，d，J＝8.5Hz)，7.55(2H，d，J＝8.2Hz)，7.74-7.81(4H，m)。
Embodiment 14 4-[(3-benzoyl phenyl) methoxyl group] benzenpropanoic acid
Method with identical with reference example 43 obtains 4-[(3-benzoyl phenyl by 4-hydroxy phenylpropionic acid methyl ester and 3-(bromomethyl) biphenyl ketone) methoxyl group] methyl phenylpropionate.Then, use the method identical, by 4-[(3-benzoyl phenyl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.The yield that is obtained by 4-hydroxy phenylpropionic acid methyl ester is 73%.
Fusing point 84-85 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝8.0Hz)，2.91(2H，t，J＝8.0Hz)，5.11(2H，s)，6.90(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.45-7.86(9H，m)。
Embodiment 15 4-[[4-(benzoyl-amido) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[4-(benzoyl-amido) phenyl with reference example 38] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 42%.
Fusing point 204-205 ℃ (by oxolane-hexane recrystallize).
1H NMR(CDCl 3+DMSO-d 6)δ2.57(2H，t，J＝8.1Hz)，2.89(2H，t，J＝8.1Hz)，5.02(2H，s)，6.89(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.40-7.60(5H，m)，7.76(2H，d，J＝8.5Hz)，7.96-7.93(2H，m)，9.04(1H，s)。
Embodiment 16 4-[(4-Phenoxyphenyls) methoxyl group] methyl phenylpropionate
Method with identical with reference example 1 obtains white powder table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 4-phenoxy group benzylalcohol.Yield 92%.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.67(3H，s)，5.00(2H，s)，6.90(2H，d，J＝8.5Hz)，6.97-7.03(4H，m)，7.08-7.13(3H，m)，7.34(1H，t，J＝7.8Hz)，7.39(2H，d，J＝8.5Hz)。
Embodiment 17 4-[[4-(phenyl methoxyl group) phenyl] methoxyl group] methyl phenylpropionate
Method with identical with reference example 1 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 4-(benzyloxy) benzylalcohol.Yield 27%.
Oily.
1H NMR(CDCl 3)δ2.59(2H，t，J＝8.0Hz)，2.89(2H，t，J＝8.0Hz)，3.66(3H，s)，4.96(2H，s)，5.07(2H，s)，6.89(2H，d，J＝8.5Hz)，6.98(2H，d，J＝8.5Hz)7.11(2H，d，J＝8.5Hz)，7.26-7.44(7H，m)。
Embodiment 18 4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] methyl phenylpropionate
With the method identical with reference example 1, by 4-hydroxy phenylpropionic acid methyl ester and 2,3-dihydro-1H-indenes-1-alcohol obtains the table title chemical compound.Yield 62%.
Oily.
1H NMR(CDCl 3)δ2.15-2.28(1H，m)，2.51-2.68(3H，m)，2.79-2.95(3H，m)，3.07-3.23(1H，m)，3.69(3H，s)，5.73(1H，dd，J＝4.4Hz，4.8Hz)，6.94(2H，d，J＝8.6Hz)，7.14(2H，d，J＝8.6Hz)，7.22-7.31(3H，m)，7.42(1H，d，J＝7.2Hz)。
Embodiment 19 4-[(1,2,3,4-tetrahydronaphthalene-1-yl) the oxygen base] methyl phenylpropionate
With the method identical with reference example 1, by 4-hydroxy phenylpropionic acid methyl ester and 1,2,3,4-tetrahydrochysene-1-naphthols obtains white powder table title chemical compound.Yield 63%.
1H NMR(CDCl 3)δ1.70-1.75(1H，m)，1.98-2.16(3H，m)，2.62(2H，t，J＝8.2Hz)，2.77-2.87(2H，m)，2.92(2H，t，J＝8.2Hz)，3.68(3H，s)，5.23(1H，t，J＝4.2Hz)，6.95(2H，d，J＝8.6Hz)，7.11-7.16(3H，m)，7.21(2H，dt，J＝2.2 Hz，6.8Hz)7.38-7.36(1H，m)。
Embodiment 20 4-[(3 '-formoxyl-[1,1 '-biphenyl]-the 3-yl) methoxyl group] methyl phenylpropionate
With the method identical, by the 4-[(3-bromophenyl with embodiment 22) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 92%.
Oily.
1H NMR(CDCl 3)δ2.60(2H，t，J＝7.1Hz)，2.90(2H，t，J＝7.1Hz)，3.66(3H，s)，5.11(2H，s)，6.93(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.43-7.53(2H，m)，7.55-7.67(2H，m)，7.69(1H，s)，7.85-7.88(2H，m)，8.11-8.12(1H，m)，10.10(1H，s)。
Embodiment 21 4-[(3 '-formoxyl-[1,1 '-biphenyl]-the 3-yl) methoxyl group] benzenpropanoic acid
With the method identical, by 4-[(3 '-formoxyl-[1,1 '-biphenyl]-3-yl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 83%.
Fusing point 81-82 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.66(2H，t，J＝7.5Hz)，2.91(2H，t，J＝7.5Hz)，5.12(2H，s)，6，93(2H，d，J＝8.4Hz)，7.14(2H，d，8.4Hz)，7.45-7.53(2H，m)，7.57-7.64(2H，m)，7.69(1H，s)，7.87(2H，d，J＝7.6Hz)，8.11(1H，s)，10.09(1H，s)。
Embodiment 22 4-([1,1 '-xenyl]-the 3-ylmethoxy) methyl phenylpropionate
The 4-[(3-bromophenyl) methoxyl group] methyl phenylpropionate (0.60g, 1.7mmol), phenylboric acid (0.25g, 2.1mmol), sodium carbonate (0.55g, 5.2mmol) be dissolved in toluene-methanol-water (5: 1: 1,35mL), after the argon displacement, add tetra-triphenylphosphine palladium (99mg, 0.086mmol).Reactant liquor under ar gas environment atmosphere, one evening of reflux.Behind the cooling reactant liquor, in reactant liquor, add water, use ethyl acetate extraction.The washing extracting solution, dry back concentrates.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=18: 1), obtain white powder table title chemical compound (0.55g, yield 92%).
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.66(3H，s)，5.10(2H，s)，6.92(2H，d，J＝8.5Hz)，7.12(2H，d，J＝8.5Hz)，7.35-7.47(5H，m)，7.54-7.65(4H，m)。
Embodiment 23 4-[(3-Phenoxyphenyls) methoxyl group] methyl phenylpropionate
Method with identical with reference example 1 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 3-phenoxy group benzylalcohol.Yield 66%.
Oily.
1H NMR(CDCl 3)δ2.59(2H，t，J＝8.1Hz)，2.89(2H，t，J＝8.1Hz)，3.66(3H，s)，5.01(2H，s)，6.90-7.20(9H，m)，7.20-7.36(4H，m)。
Embodiment 24 4-([1,1 '-xenyl]-the 2-ylmethoxy) methyl phenylpropionate
Method with identical with reference example 5 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 2-phenylbenzyl bromide.Yield 52%.
Oily.
1H NMR(CDCl 3)δ2.58(2H，t，J＝8.1Hz)，2.87(2H，t，J＝8.1Hz)，3.66(3H，s)，4.91(2H，s)，6.78(2H，d，J＝8.6Hz)，7.06(2H，d，J＝8.6Hz)，7.33-7.40(8H，m)，7.50-7.70(1H，m)。
Embodiment 25 4-[[2,3-dihydro-5-(phenyl methoxyl group)-1H-indenes-1-yl] the oxygen base] methyl phenylpropionate
With the method identical with reference example 1, by 4-hydroxy phenylpropionic acid methyl ester and 2,3-dihydro-5-(phenyl methoxyl group)-1H-indenes-1-alcohol obtains white powder table title chemical compound.Yield 65%.
1H NMR(CDCl 3)δ2.18-2.23(1H，m)，2.45-2.60(1H，m)，2.61(2H，t，J＝8.0Hz)。2.82-2.90(1H，m)，2.91(2H，t，J＝8.0Hz)，3.06-3.20(1H，m)，3.68(3H，s)，5.07(2H，s)，5.67(1H，dd，J＝6.5Hz，3.7Hz)，6.84-6.93(4H，m)，7.13(2H，d，J＝8.5Hz)，7.26-7.44(6H，m)。
Embodiment 26 4-[(2-Phenoxyphenyls) methoxyl group] methyl phenylpropionate
Method with identical with reference example 1 obtains white powder table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 2-phenoxy group benzylalcohol.Yield 93%.
1H NMR(CDCl 3)δ2.59(2H，t，J＝8.1Hz)，2.88(2H，t，J＝8.1Hz)，3.66(3H，s)，5.13(2H，s)，6.89(3H，t，J＝8.6Hz)，6.98(2H，d，J＝8.1Hz)，7.07-7.20(4H，m)，7.25-7.40(3H，m)，7.50-7.60(1H，m)。
Embodiment 27 4-[(4-benzoyl phenyl) methoxyl group] methyl phenylpropionate
N at 4-hydroxy phenylpropionic acid methyl ester (0.65g, 3.6mmol), add 4-(bromomethyl) benzophenone (1.0g, 3.6mmol) and calcium carbonate (0.50g, 3.6mmol) in dinethylformamide (20mL) solution, mixture was at room temperature stirred 15 hours.In reactant liquor, add water, use ethyl acetate extraction.Behind the washing extracting solution, concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=9: 1), obtain Powdered table title chemical compound (1.3g, yield 96%).
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.67(3H，s)，5.17(2H，s)，6.91(2H，d，J＝8.7Hz)，7.13(2H，d，J＝8.7Hz)，7.46-7.60(5H，m)，7.79-7.84(4H，m)。
Embodiment 28 4-[[4-(4-chlorobenzene formacyl) phenyl] methoxyl group] methyl phenylpropionate
With the method identical, obtain Powdered table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and [4-(bromomethyl) phenyl] (4-chlorphenyl) ketone with embodiment 27.Yield 57%.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.67(3H，s)，5.13(2H，s)，6.91(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.46(2H，d，J＝8.5Hz)，7.55(2H，d，J＝7.0Hz)，7.74-7.80(4H，m)。
Embodiment 29 4-[[4-(benzoyl-amido) phenyl] methoxyl group] methyl phenylpropionate
4-[4-(aminophenyl) methoxyl group] add Benzenecarbonyl chloride. (74mg, 0.53mmol) in oxolane (9mL) solution of methyl phenylpropionate (0.13g, 0.44mmol), triethyamino (0.50mL), mixture at room temperature stirred 2 hours.In reactant liquor, add water, use ethyl acetate extraction.The washing extracting solution, dry back concentrates.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=18: 1), obtain table title chemical compound (0.23g, quantitative).
Oily.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.67(3H，s)，5.10(2H，s)，6.90(2H，d，J＝8.6Hz)，7.11(2H，d，J＝8.6Hz)，7.26-7.56(5H，m)，7.66(2H，d，J＝8.5Hz)，7.84-7.89(3H，m)。
Embodiment 30 4-[[4-[[methyl (4-phenyl-2-thiazolyl) amino] methyl] phenyl] methoxyl group] methyl phenylpropionate
With the method identical, by 4-hydroxy phenylpropionic acid methyl ester and 4-[[methyl (4-phenyl-1,3-thiazoles-2-yl) amino with reference example 1] methyl] benzyl alcohol obtains white powder table title chemical compound.Yield 77%.
1H NMR(CDCl 3)δ2.59(2H，t，J＝8.1Hz)，2.89(2H，t，J＝8.1Hz)，3.08(3H，s)，3.66(3H，s)，4.79(2H，s)，5.02(2H，s)，6.72(1H，s)，6.89(2H，d，J＝8.6Hz)，7.11(2H，d，J＝8.6Hz)，7.25-7.30(1H，m)，7.34-7.41(6H，m)，7.86(2H，d，J＝7.1Hz)。
Embodiment 31 4-[(5,6-dihydro-4H-Pentamethylene. [b] thiophene-4-yl) the oxygen base] benzenpropanoic acid
With the method identical with reference example 32, by 5,6-dihydro-4H-Pentamethylene. [b] thiophene-4-ketone obtains 5,6-dihydro-4H-Pentamethylene. [b] thiophene-4-alcohol.With the method identical,, obtain 4-[(5,6-dihydro-4H-Pentamethylene. [b] thiophene-4-yl it and the condensation of 4-hydroxy phenylpropionic acid methyl ester with reference example 1) the oxygen base] methyl phenylpropionate.In addition, use the method identical,, 6-dihydro-4H-Pentamethylene. [b] thiophene-4-yl by 4-[(5 with reference example 4) the oxygen base] methyl phenylpropionate obtains the table title chemical compound.By 5,6-dihydro-4H-Pentamethylene. [b] yield that thiophene-4-ketone obtains is 19%.
Fusing point 87-88 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.53-2.69(3H，m)，2.85-3.01(4H，m)，3.15(1H，m)，5.64(1H，dd，J＝2.0Hz，5.8Hz)，6.88-6.93(3H，m)，7.13(2H，d，J＝8.6Hz)，7.20(1H，d，J＝5.0Hz)。
Embodiment 32 4-[(4,5,6,7-tetrahydro benzo [b] thiophene-4-yl) the oxygen base] methyl phenylpropionate
With the method identical with reference example 32, by 6,7-dihydrobenzo [b] thiophene-4 (5H)-ketone obtains 4,5,6,7-tetrahydro benzo [b] thiophene-4-alcohol.According to the method for reference example 1,, obtain the table title chemical compound it and the condensation of 4-hydroxy phenylpropionic acid methyl ester.By 6, the yield that 7-dihydrobenzo [b] thiophene-4 (5H)-ketone obtains is 72%.Oily.
1H NMR(CDCl 3)δ1.80-2.15(4H，m)，2.61(2H，t，J＝7.4Hz)，2.76(1H，m)，2.78-2.94(3H，m)，3.68(3H，s)，5.33(1H，t，J＝4.4Hz)，6.(3H，m)，7.08-7.15(3H，m)。
Embodiment 33 4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base]-3,5-difluoro methyl phenylpropionate
At (E)-3-[4-[(2,3-dihydro-1H-indenes-1-yl) oxygen base]-3, the 5-difluorophenyl]-add iodine (0.80g, 3.2mmol) in the mixture of 2-methyl propionate (0.52g, 1.6mmol), samarium (1.2g, 7.9mmol), oxolane (3mL) and methanol (7mL), at room temperature, stirring-evening.Add 1 equivalent hydrochloric acid (20mL), stir after 20 minutes, dilute with water is used ethyl acetate extraction.After the washing, use anhydrous sodium sulfate drying, concentrate.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=10: 1), obtain the table title chemical compound.Yield 60%.
Oily.
1H NMR(CDCl 3)δ2.34-2.40(2H，m)，2.61(2H，t，J＝7.5Hz)，2.81-2.91(3H，m)，3.20-3.30(1H，m)，5.61(1H，t，J＝4.4Hz)，6.72-6.78(2H，m)，7.16-7.22(1H，m)，7.29-7.31(2H，m)，7.34(1H，d，J＝7.4Hz)。
Embodiment 34 3,5-two fluoro-4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
With the method identical,, 5-two fluoro-4-[(2,3-dihydro-1H-indenes-1-yl by 3 with reference example 38) the oxygen base] methyl phenylpropionate obtains the table title chemical compound.Yield 75%.
Fusing point 88-89 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.34-2.40(2H，m)，2.67(2H，t，J＝7.5Hz)，2.81-2.92(3H，m)，3.20-3.30(1H，m)，5.62(1H，t，J＝4.4Hz)，6.72-6.80(2H，m)，7.17-7.23(1H，m)，7.29-7.36(3H，m)。
Embodiment 35 4-[[2,3-dihydro-4-(phenyl methoxyl group)-1H-indenes-1-yl] the oxygen base] benzenpropanoic acid
With the method identical with reference example 1, by 4-hydroxy phenylpropionic acid methyl ester and 2,3-dihydro-4-(phenyl methoxyl group)-1H-indenes-1-alcohol obtains 4-[[2,3-dihydro-4-(phenyl methoxyl group)-1H-indenes-1-yl] the oxygen base] methyl phenylpropionate.Oily.Then, use the method identical,, 3-dihydro-4-(phenyl methoxyl group)-1H-indenes-1-yl by 4-[[2 with reference example 4] the oxygen base] methyl phenylpropionate obtains the table title chemical compound.The yield that is obtained by 4-hydroxy phenylpropionic acid methyl ester is 27%.
Fusing point 111-111.5 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.10-2.30(1H，m)，2.50-2.60(1H，m)，2.67(2H，t，J＝7.9Hz)，2.40-3.00(3H，m)，3.09-3.14(1H，m)，5.12(2H，s)，5.74(1H，dd，J＝6.7Hz，4.4Hz)，6.85(1H，d，J＝8.0Hz)，6.94(2H，d，J＝8.6Hz)，7.05(1H，d，J＝7.5Hz)，7.13-7.23(3H，m)，7.29-7.45(5H，m)。
Embodiment 36 4-[[2,3-dihydro-6-(phenyl methoxyl group)-1H-indenes-1-yl] the oxygen base] methyl phenylpropionate
With the method identical with reference example 1, by 4-hydroxy phenylpropionic acid methyl ester and 2,3-dihydro-6-(phenyl methoxyl group)-1H-indenes-1-alcohol obtains the table title chemical compound.Yield 40%.
Oily.
1H NMR(CDCl 3)δ2.10-2.30(1H，m)，2.53-2.55(3H，m)，2.75-2.94(3H，m)，3.01-3.10(1H，m)，3.68(3H，s)，5.01(1H，d，J＝11.7Hz)，5.06(1H，d，J＝11.7Hz)，5.68(1H，dd，J＝6.5Hz，4.9Hz)，6.91-6.96(3H，m)，7.03(1H，d，J＝1.7Hz)，7.08-7.20(3H，m)，7.31-7.43(5H，m)。
Embodiment 37 4-[[2,3-dihydro-6-(phenyl methoxyl group)-1H-indenes-1-yl] the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-6-(phenyl methoxyl group)-1H-indenes-1-yl by 4-[[2 with reference example 4] the oxygen base] methyl phenylpropionate obtains the table title chemical compound.Yield 51%.
Fusing point 106-107 ℃ (by diisopropyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.14-2.25(1H，m)，2.51-2.63(1H，m)，2.67(2H，t，8.0Hz)，2.79-2.95(3H，m)，3.01-3.10(1H，m)，5.01(1H，d，J＝11.8Hz)，5.06(1H，d，J＝11.8Hz)，5.69(1H，t，J＝4.8Hz)，6.92-6.96(3H，m)，7.05(1H，d，J＝7.9Hz)，7.14-7.20(3H，m)，7.20-7.43(5H，m)。
Embodiment 38 (S)-4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] methyl phenylpropionate
4-hydroxy phenylpropionic acid methyl ester (4.1g, 22mmol) is dissolved in the oxolane (50mL), stir down at-30 ℃, in this solution, add (R)-1-indone (98%ee) (3.0g, 22mmol), 1,1 '-(azo dicarbapentaborane) two piperidines (5.66g, 22mmol) and tributylphosphine (5.6mL, 22mmol), stirred 23 hours down at-30 ℃.Add water, use ethyl acetate extraction.Clean organic layer with saturated aqueous common salt, add dried over sodium sulfate.Decompression concentrates down, and is refining with silica gel column chromatography (hexane/ethyl acetate=10: 1) the grease that obtains, and obtains yellow oily table title chemical compound (4.4g, yield 66%).
Embodiment 39 (R)-4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] methyl phenylpropionate.
With the method identical, obtain the table title chemical compound of grease by (S)-1-indone and 4-hydroxy phenylpropionic acid methyl ester with embodiment 38.Yield 70%.
Embodiment 40 (S)-4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
(synthetic method 1)
4-[(2,3-dihydro-1H-indenes-1-yl) oxygen base] benzenpropanoic acid (100mg) high speed liquid chromatography method (post: CHIRALCEL OJ (50mmID * 500mm, Daicel chemical industry system), mobile phase: hexane/ethanol/trifluoroacetic acid=90: 10: 0.1, flow velocity: 80mL/min, column temperature: 50 ℃) branch is obtained table title chemical compound (36mg).The optical activity of this chemical compound is shown as (+).
(synthetic method 2)
(S)-4-[(2,3-dihydro-1H-indenes-1-yl) oxygen base] methyl phenylpropionate (4.4g, 15mmol) is dissolved in the methanol (50mL), adds 1 Equivalent Hydrogen sodium oxide (25mL) aqueous solution, stirring at room 18.5 hours.1 equivalent hydrochloric acid (25mL) is added in the solution, use ethyl acetate extraction.Clean organic layer with saturated aqueous common salt, add dried over sodium sulfate.The crystallization that concentrating under reduced pressure obtains is cleaned with hexane, obtained colourless crystallization (4.2g, 96%ee).Its mixed solvent recrystallize, obtain clear crystal table title chemical compound (2.3g, 99.4%ee, yield 56%) by diisopropyl ether (70mL) and hexane (70mL).In addition, obtain conduct crystal 0.67g (yield 16%, 97%ee), the conduct for the second time table title chemical compound of crystal 0.16g (yield 4%, 92%ee) for the third time.Fusing point 112-113 ℃ (crystal for the first time).
[α] D 23+28.9°(c0.997、CHCl 3)。
IR(KBr)νcm -1：2938，1694，1510，1232，957，829，761。
1HNMR(CDCl 3)δ2.20(1H，m)，2.55(1H，m)，2.67(2H，t，J＝7.6Hz)，2.92(2H，t，J＝7.6Hz)，2.92(1H，m)，3.13(1H，m)，5.73(1H，dd，J＝4.4Hz，6.8Hz)，6.94(2H，dtJ＝2.6Hz，8.4Hz)，7.16(2H，dt，J＝2.6Hz，8.4Hz)，7.23(1H，m)，7.30(2H，m)，7.42(1H，d，J＝7.2Hz)，11.0(1H，br s)。
Embodiment 41 (R)-4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
(synthetic method 1)
4-[(2,3-dihydro-1H-indenes-1-yl) oxygen base] benzenpropanoic acid (100mg) high speed liquid chromatography method (post: CHIRALCEL OJ (50mmID * 500mm, Daicel chemical industry system), mobile phase: hexane/ethanol/trifluoroacetic acid=90: 10: 0.1, flow velocity: 80mL/min, column temperature: 50 ℃) branch is obtained table title chemical compound (38mg).The optical activity of this chemical compound is shown as (-).
(synthetic method 2)
With the method identical,, 3-dihydro-1H-indenes-1-yl) oxygen base by (R)-4-[(2 with embodiment 40] methyl phenylpropionate obtains the table title chemical compound.Yield: the crystal first time (99.0%ee) 39%, crystal (97%ee) 20%, crystal (92%ee) 7% for the third time for the second time.
Fusing point 110-111 ℃ (crystal for the first time)
[α] D 23-28.8°(c 0.997、CHCl 3)。
IR(KBr)νcm -1：2938，1694，1510，1232，957，829，761。
1H NMR(CDCl 3)δ2.20(1H，m)，2.55(1H，m)，2.67(2H，t，J＝7.6Hz)，2.92(2H，t，J＝7.6Hz)，2.92(1H，m)，3.13(1H，m)，5.73(1H，dd，J＝4.4Hz，6.8Hz)，6.94(2H，dtJ＝2.6Hz，8.4Hz)，7.16(2H，dt，J＝2.6Hz，8.4Hz)，7.23(1H，m)，7.30(2H，m)，7.42(1H，d，J＝7.6Hz)，11.0(1H，br s)。
Embodiment 42 4-[(4,5,6,7-tetrahydro benzo [b] thiophene-4-yl) the oxygen base] benzenpropanoic acid
With the method identical,, 5,6,7-tetrahydro benzo [b] thiophene-4-yl) oxygen base by 4-[(4 with reference example 4] methyl phenylpropionate obtains the table title chemical compound.Yield 54%.
Fusing point 87-89 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ1.79-2.17(4H，m)，2.66(2H，t，J＝7.4Hz)，2.76(1H，m)，2.87-2.95(3H，m)，5.33(1H，t，J＝4.4Hz)，6.91-6.96(3H，m)，7.09(1H，d，J＝5.2Hz)，7.14(2H，d，J＝8.6Hz)。
Embodiment 43 4-[(6-bromo-2,3-dihydro-1H-indenes-1-yl) the oxygen base] methyl phenylpropionate
Method with identical with reference example 32 obtains 6-bromo-1-indanol by 6-bromo-1-indone.According to the method same,, obtain the table title chemical compound it and the condensation of 4-hydroxy phenylpropionic acid methyl ester with reference example 1.The yield that is obtained by 6-bromo-1-indone is 84%.
Oily.
1H NMR(CDCl 3)δ2.20(1H，m)，2.51-2.64(3H，m)，2.79-2.94(3H，m)，3.06(1H，m)，3.68(3H，s)，5.68(1H，t，J＝5.0Hz)，6.91(2H，d，J＝8.6Hz)，7.10-7.15(3H，m)，7.40(1H，dd，J＝1.8Hz，8.0Hz)，7.53(1H，d，J＝1.3Hz)。
Embodiment 44 4-[(6-bromo-2,3-dihydro-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-1H-indenes-1-yl) oxygen base by 4-[(6-bromo-2 with reference example 4] methyl phenylpropionate obtains the table title chemical compound.Yield 59%.
Fusing point 108-109 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.20(1H，m)，2.57(1H，m)，2.69(2H，t，J＝8.0Hz)，2.85(1H，m)，2.96(2H，t，J＝8.0Hz)，3.06(1H，m)，5.68(1H，dd，J＝4.9Hz，6.5Hz)，6.92(2H，d，J＝8.6Hz)，7.10-7.19(3H，m)，7.41(1H，dd，J＝1.9Hz，8.1Hz)，7.54(1H，d，J＝1.4Hz)。
Embodiment 45 4-[(2,3-dihydro-6-phenyl-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-1H-indenes-1-yl) oxygen base by 4-[(6-bromo-2 with embodiment 22] methyl phenylpropionate and phenylboric acid obtain the table title chemical compound.Yield 11%.
Fusing point 121-122 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.25(1H，m)，2.60(1H，m)，2.68(2H，t，J＝8.0Hz)，2.90-3.00(3H，m)，3.17(1H，m)，5.78(1H，dd，J＝4.5Hz，6.5Hz)，6.97(2H，d，J＝8.6Hz)，7.16(2H，d，J＝8.6Hz)，7.27-7.63(8H，m)。
Embodiment 46 4-[(2-methyl [1,1 '-biphenyl]-the 3-yl) methoxyl group] methyl phenylpropionate
Method with identical with reference example 1 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 2-methyl-3-xenyl methanol.Yield 51%.
White powder
1H NMR(CDCl 3)δ2.24(3H，s)，2.61(2H，t，J＝8.1Hz)，2.91(2H，t，J＝8.1Hz)，3.67(3H，s)，5.06(2H，s)，6.95(2H，d，J＝8.6Hz)，7.14(2H，d，J＝8.6Hz)，7.22-7.44(8H，m)。
Embodiment 47 4-[(2-methyl [1,1 '-biphenyl]-the 3-yl) methoxyl group] benzenpropanoic acid
With the method identical, by 4-[(2-methyl [1,1 '-biphenyl]-3-yl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 53%.
Fusing point 154-155 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.24(3H，s)，2.66(2H，t，J＝7.9Hz)，2.92(2H，t，J＝7.9Hz)，5.06(2H，s)，6.95(2H，d，J＝8.6Hz)，7.15(2H，d，J＝8.6Hz)，7.24-7.44(8H，m)。
Embodiment 48 4-[(4-bromo-2,3-dihydro-1H-indenes-1-yl) the oxygen base] methyl phenylpropionate
Method with identical with reference example 32 obtains 4-bromo-1-indanol by 4-bromo-1-indone.According to the method same,, obtain the table title chemical compound it and the condensation of 4-hydroxy phenylpropionic acid methyl ester with reference example 1.The yield 31% that obtains by 4-bromo-1-indone.
1H NMR(CDCl 3)δ2.22(1H，m)，2.51-2.64(3H，m)，2.88-2.97(3H，m)，3.12(1H，m)，3.68(3H，s)，5.78(1H，dd，J＝4.6Hz，6.8Hz)，6.91(2H，d，J＝8.6Hz)，7.09-7.16(3H，m)，7.34(1H，d，J＝7.5Hz)，7.46(1H，d，J＝7.8Hz)。
Embodiment 49 4-[(4-bromo-2,3-dihydro-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-1H-indenes-1-yl) oxygen base by 4-[(4-bromo-2 with reference example 4] methyl phenylpropionate obtains the table title chemical compound.Yield 77%.
Fusing point 112-113 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.20(1H，m)，2.57(1H，m)，2.67(2H，t，J＝8.0Hz)，2.87-2.98(3H，m)，3.14(1H，m)，5.78(1H，dd，J＝3.5Hz，6.6Hz)，6.92(2H，d，J＝8.6Hz)，7.09-7.17(3H，m)，7.35(1H，d，J＝7.5Hz)，7.47(1H，d，J＝7.9Hz)。
Embodiment 50 4-([4 '-chloro-1,1 '-xenyl]-the 3-ylmethoxy) methyl phenylpropionate
Method with identical with embodiment 22 obtains oily table title chemical compound by 4-chlorobenzene boric acid.Yield 59%.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.1Hz)，2.90(2H，t，J＝8.1Hz)，3.66(3H，s)，5.09(2H，s)，6.92(2H，d，J＝8.6Hz)，7.12(2H，d，J＝8.6Hz)，7.38-7.54(7H，m)，7.61(1H，br s)。
Embodiment 51 4-([4 '-chloro-1,1 '-xenyl]-the 3-ylmethoxy) benzenpropanoic acid
With the method identical with reference example 4, by 4-([4 '-chloro-1,1 '-xenyl]-the 3-ylmethoxy) methyl phenylpropionate obtains the table title chemical compound.Yield 52%.
Fusing point 147-148 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.9Hz)，2.91(2H，t，J＝7.9Hz)，5.09(2H，s)，6.93(2H，d，J＝8.6Hz)，7.14(2H，d，J＝8.6Hz)，7.39-7.53(7H，m)，7.61(1H，s)。
Embodiment 52 4-[(2,3-dihydro-4-phenyl-1H-indenes-1-yl) the oxygen base] methyl phenylpropionate
With the method identical,, 3-dihydro-1H-indenes-1-yl) oxygen base by 4-[(4-bromo-2 with embodiment 22] methyl phenylpropionate and phenylboric acid obtain the table title chemical compound.Yield 95%.
Oily.
1H NMR(CDCl 3)δ2.20(1H，m)，2.51(1H，m)，2.62(2H，t，J＝7.1Hz)，2.90-3.01(3H，m)，3.19(1H，m)，3.68(3H，s)，5.77(1H，dd，J＝4.6Hz，6.5Hz)，6.96(2H，d，J＝8.6Hz)，7.15(2H，d，J＝8.6Hz)，7.33-7.45(8H，m)。
Embodiment 53 4-[(4-phenyl-2,3-dihydro-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-4-phenyl-1H-indenes-1-yl) oxygen base by 4-[(2 with reference example 4] methyl phenylpropionate obtains the table title chemical compound.Yield 65%.
Fusing point 137-138 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.20(1H，m)，2.52(1H，m)，2.68(2H，t，J＝8.0Hz)，2.91-3.01(3H，m)，3.20(1H，m)，5.78(1H，dd，J＝4.6Hz，6.5Hz)，6.98(2H，d，J＝8.6Hz)，7.17(2H，d，J＝8.6Hz)，7.33-7.47(8H，m)。
Embodiment 54 4-([4 '-Trifluoromethyl-1,1 '-xenyl]-the 3-ylmethoxy) methyl phenylpropionate
Method with identical with embodiment 22 obtains white powder table title chemical compound by the 4-trifluoromethyl phenyl boronic acid.Yield 82%.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.91(2H，t，J＝8.0Hz)，3.66(3H，s)，5.11(2H，s)，6.93(2H，d，J＝8.7Hz)，7.13(2H，d，J＝8.7Hz)，7.47-7.57(3H，m)，7.66-7.70(5H，m)。
Embodiment 55 4-([4 '-Trifluoromethyl-1,1 '-xenyl]-the 3-ylmethoxy) benzenpropanoic acid
With the method identical with reference example 4, by 4-([4 '-Trifluoromethyl-1,1 '-xenyl]-the 3-ylmethoxy) methyl phenylpropionate obtains the table title chemical compound.Yield 53%.
144 ℃ of fusing points (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.9Hz)，2.91(2H，t，J＝7.9Hz)，5.11(2H，s)，6.93(2H，d，J＝8.6Hz)，7.14(2H，d，J＝8.8Hz)，7.47-7.56(3H，m)，7.66-7.09(5H，m)。
Embodiment 56 4-([2 ', 6 '-dimethyl-1,1 '-xenyl]-the 3-ylmethoxy) methyl phenylpropionate
With the method identical with embodiment 22, by 2,6-dimethyl benzene ylboronic acid obtains oily table title chemical compound.Yield 88%.
1H NMR(CDCl 3)δ2.01(6H，s)，2.59(2H，t，J＝8.1Hz)，2.89(2H，t，J＝8.1Hz)，3.66(3H，s)，5.09(2H，s)，6.89(2H，d，J＝8.6Hz)，7.09-7.20(7H，m)，7.38-7.44(2H，m)。
Embodiment 57 4-([2 ', 6 '-dimethyl-1,1 '-xenyl]-the 3-ylmethoxy) benzenpropanoic acid
With the method identical with reference example 4, by 4-([2 ', 6 '-dimethyl-1,1 '-xenyl]-the 3-ylmethoxy) methyl phenylpropionate obtains the table title chemical compound.Yield 51%.
Fusing point 136-137 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.00(6H，s)，2.64(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，5.09(2H，s)，6.90(2H，d，J＝8.6Hz)，7.08-7.25(7H，m)，7.35-7.50(2H，m)。
Embodiment 58 4-[[3-(phenyl methoxyl group) phenyl] methoxyl group] methyl phenylpropionate
Method with identical with reference example 1 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 3-benzyl oxygen base benzylalcohol.Yield 92%.
1H NMR(CDCl 3)δ2.59(2H，t，J＝8.1Hz)，2.89(2H，t，J＝8.1Hz)，3.66(3H，s)，5.01(2H，s)，5.07(2H，s)，6.86-6.94(3H，m)，7.01(1H，d，J＝7.5Hz)，7.07-7.12(3H，m)，7.25-7.45(6H，m)。
Embodiment 59 4-[[3-(phenyl methoxyl group) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[3-(phenyl methoxyl group) phenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 73%.
Fusing point 107-108 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.9Hz)，2.90(2H，t，J＝7.9Hz)，5.01(2H，s)，5.07(2H，s)，6.87-6.94(3H，m)，7.01(1H，d，J＝7.6Hz)，7.06-7.13(3H，m)，7.26-7.45(6H，m)。
Embodiment 60 4-[(2,3-dihydro-2,2-dimethyl-1H-indenes-1-yl) the oxygen base] methyl phenylpropionate
With the method identical with reference example 32, by 2,3-dihydro-2,2-dimethyl-1H-1-Indanone obtains 2,3-dihydro-2,2-dimethyl-1H-indenes-1-alcohol.According to the method same,, obtain the table title chemical compound it and the condensation of 4-hydroxy phenylpropionic acid methyl ester with reference example 1.By 2,3-dihydro-2, the yield that the 2-dimethyl-the 1H-1-Indanone obtains is 60%.
Oily.
1H NMR(CDCl 3)δ1.13(3H，s)，1.23，(3H，s)，2.62(2H，t，J＝7.5Hz)，2.73(1H，d，J＝15.4Hz)，2.86(1H，d，J＝15.4Hz)，2.93(2H，t，J＝7.5Hz)，3.86(3H，s)，5.28(1H，s)，6.98(2H，d，J＝8.6Hz)，7.11-7.27(6H，m)。
Embodiment 61 4-[(2,3-dihydro-2,2-dimethyl-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-2,2-dimethyl-1H-indenes-1-yl by 4-[(2 with reference example 4) the oxygen base] methyl phenylpropionate obtains the table title chemical compound.Yield 46%.Oily.
1H NMR(CDCl 3)δ1.13(3H，s)，1.23，(3H，s)，2.68(2H，t，J＝7.3Hz)，2.73(1H，d，J＝18.9Hz)，2.87(1H，d，J＝18.9Hz)，2.93(2H，t，J＝7.3Hz)，5.28(1H，s)，6.98(2H，d，J＝8.6Hz)，7.00-7.27(6H，m)。
Embodiment 62 4-[(2,3-dihydro-5-methyl isophthalic acid H-indenes-1-yl) the oxygen base] methyl phenylpropionate
With the method identical with reference example 32, by 2,3-dihydro-5-methyl isophthalic acid H-1-Indanone obtains 2,3-dihydro-5-methyl isophthalic acid H-indenes-1-alcohol.According to the identical method of reference example 1,, obtain the table title chemical compound it and the condensation of 4-hydroxy phenylpropionic acid methyl ester.By 2, the yield that the 3-dihydro-5-methyl isophthalic acid H-1-Indanone obtains is 99%.
Oily.
1H NMR(CDCl 3)δ2.21(1H，m)，2.36(3H，s)，2.50(1H，m)，2.61(2H，t，J＝8.2Hz)，2.82-2.91(3H，m)，3.10(1H，m)，3.68(3H，s)，5.69(1H，dd，J＝4.0Hz，6.5Hz)，6.92(2H，d，J＝8.6Hz)，7.05(2H，d，J＝8.6Hz)，7.14-7.16(3H，m)，7.30(1H，d，J＝7.7Hz)。
Embodiment 63 4-[(2,3-dihydro-5-methyl isophthalic acid H-indenes-1-yl) the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-5-methyl isophthalic acid H-indenes-1-yl) oxygen base by 4-[(2 with reference example 4] methyl phenylpropionate obtains the table title chemical compound.Yield 31%.
Fusing point 108-109 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.20(1H，m)，2.36(3H，s)，2.51(1H，m)，2.67(2H，t，J＝8.2Hz)，2.80-2.94(3H，m)，3.14(1H，m)，5.69(1H，dd，J＝4.1Hz，6.4Hz)，6.93(2H，d，J＝8.6Hz)，7.04(2H，d，J＝7.7Hz)，7.1 1-7.16(3H，m)，7.30(1H，d，J＝7.7Hz)。
Embodiment 64 4-[(2,3-dihydro-7-methyl isophthalic acid H-indenes-1-yl) the oxygen base] methyl phenylpropionate
With the method identical with reference example 32, by 2,3-dihydro-7-methyl isophthalic acid H-1-Indanone obtains 2,3-dihydro-7-methyl isophthalic acid H-indenes-1-alcohol.According to the method same,, obtain the table title chemical compound it and the condensation of 4-hydroxy phenylpropionic acid methyl ester with reference example 1.By 2, the yield that the 3-dihydro-7-methyl isophthalic acid H-1-Indanone obtains is 57%.
Oily.
1H NMR(CDCl 3)δ2.21-2.49(2H，m)，2.30(3H，s)，2.62(2H，t，J＝7.4Hz)，2.85-2.97(3H，m)，3.18(1H，m)，3.68(3H，s)，5.74(1H，dd，J＝2.0Hz，6.5Hz)，6.91(2H，d，J＝8.6Hz)，7.06(1H，d，J＝7.3Hz)，7.13-7.23(4H，m)。
Embodiment 65 4-[[4-(4-phenoxy group phenoxy group) phenyl] methoxyl group] methyl phenylpropionate
Method with identical with reference example 33 obtains white powder table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 4-(4-phenoxy group phenoxy group) benzylalcohol.Yield 26%.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.1Hz)，2.90(2H，t，J＝8.1Hz)，3.66(3H，s)，4.99(2H，s)，6.89(2H，d，J＝8.6Hz)，6.99-7.13(11H，m)，7.31-7.40(4H，m)。
Embodiment 66 4-[[4-(4-phenoxy group phenoxy group) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[4-(4-phenoxy group phenoxy group) phenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 81%.
Fusing point 167-168 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝8.0Hz)，2.91(2H，t，J＝8.0Hz)，4.99(2H，s)，6.91(2H，d，J＝8.6Hz)，6.99-7.15(11H，m)，7.31-7.40(4H，m)。
Embodiment 67 4-[[4-[4-(trifluoromethoxy) phenoxy group] phenyl] methoxyl group] methyl phenylpropionate
With the method identical, by 4-[4-(trifluoromethoxy) phenoxy group with reference example 32] benzaldehyde obtains oily 4-[4-(trifluoromethoxy) phenoxy group] benzylalcohol.Use the method identical in addition, by 4-hydroxy phenylpropionic acid methyl ester and 4-[4-(trifluoromethoxy) phenoxy group with reference example 33] benzylalcohol obtains white powder table title chemical compound.By 4-[4-(trifluoromethoxy) phenoxy group] yield that obtains of benzaldehyde is 27%.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.1Hz)，2.90(2H，t，J＝8.1Hz)，3.67(3H，s)，5.01(2H，s)，6.90(2H，d，J＝6.7Hz)，6.92-7.03(4H，m)，7.11-7.20(4H，m)，7.41(2H，d，J＝8.6Hz)。
Embodiment 68 4-[[4-[4-(trifluoromethoxy) phenoxy group] phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[4-[4-(trifluoromethoxy) phenoxy group with reference example 4] phenyl] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 87%.
Fusing point 137-138 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.66(2H，t，J＝8.0Hz)，2.91(2H，t，J＝8.0Hz)，5.01(2H，s)，6.90(2H，d，J＝8.6Hz)，6.99-7.03(4H，m)，7.12-7.20(4H，m)，7.41(2H，d，J＝8.6Hz)。
Embodiment 69 4-[[4-([1,1 '-xenyl]-4-base oxygen base) phenyl] methoxyl group] methyl phenylpropionate
With the method identical, obtain white powder table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 4-([1,1 '-xenyl]-4-base oxygen base) benzylalcohol with reference example 33.Yield 13%.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.67(3H，s)，5.01(2H，s)，6.91(2H，d，J＝8.6Hz)，7.05-7.14(6H，m)，7.30-7.48(5H，m)，7.55-7.58(4H，m)。
Embodiment 70 4-[[4-([1,1 '-xenyl]-4-base oxygen base) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[4-([1, '--xenyl]-4-base oxygen base) phenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 84%.
Fusing point 196-197 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.66(2H，t，J＝7.9Hz)，2.92(2H，t，J＝7.9Hz)，5.01(2H，s)，6.92(2H，d，J＝8.6Hz)，7.05-7.13(6H，m)，7.31-7.48(5H，m)，7.55-7.58(4H，m)。
Embodiment 71 4-[[4-[4-(phenyl methoxyl group) phenoxy group] phenyl] methoxyl group] methyl phenylpropionate
With the method identical, by 4-hydroxy phenylpropionic acid methyl ester and 4-[4-(phenyl methoxyl group) phenoxy group with reference example 33] benzylalcohol obtains white powder table title chemical compound.Yield 24%.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.89(2H，t，J＝8.0Hz)，3.66(3H，s)，4.97(2H，s)，5.05(2H，s)，6.88-6.97(8H，m)，7.11(2H，d，J＝8.6Hz)，7.34-7.47(7H，m)。
Embodiment 72 4-[[4-[4-(phenyl methoxyl group) phenoxy group] phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[4-[4-(phenyl methoxyl group) phenoxy group with reference example 4] phenyl] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 55%.
Fusing point 180-181 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝8.0Hz)，2.91(2H，t，J＝8.0Hz)，4.98(2H，s)，5.05(2H，s)，6.89-6.97(8H，m)，7.13(2H，d，J＝8.6Hz)，7.26-7.45(7H，m)。
Embodiment 73 4-[(2,3-dihydro-5-methoxyl group-1H-indenes-1-yl) the oxygen base] methyl phenylpropionate
Method with identical with reference example 32 obtains 5-methoxyl group-1-indanol by 5-methoxyl group-1-indone.Oily.In addition, use the method identical to obtain white powder table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 5-methoxyl group-1-indanol with reference example 33.By the yield that the 5-methoxyl group-the 1-indone obtains is 14%.
1H NMR(CDCl 3)δ2.19-2.29(1H，m)，2.47-2.58(1H，m)，2.61(2H，t，J＝8.1Hz)，2.82-2.88(1H，m)，2.91(2H，t，J＝8.1Hz)，3.08-3.19(1H，m)，3.68(3H，s)，5.66(1H，dd，J＝3.6Hz，6.5Hz)，6.78-6.82(2H，m)，6.91(2H，d，J＝8.6Hz)，7.12(2H，d，J＝8.6Hz)，7.31(1H，d，J＝8.2Hz)。
Embodiment 74 4-[(2,3-dihydro-5-methoxyl group-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-5-methoxyl group-1H-indenes-1-yl) oxygen base by 4-[(2 with reference example 4] methyl phenylpropionate obtains the table title chemical compound.Yield 67%.
Fusing point 87-88 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.18-2.28(1H，m)，2.46-2.59(1H，m)，2.67(2H，t，J＝8.0Hz)，2.81-2.90(1H，m)，2.92(2H，t，J＝8.0Hz)，3.06-3.17(1H，m)，5.68(1H，dd，J＝3.6Hz，6.5Hz)，6.74-6.82(2H，m)，6.92(2H，d，J＝8.6Hz)，7.14(2H，d，J＝8.6Hz)，7.31(1H，d，J＝8.2Hz)。
Embodiment 75 4-[(5-chloro-2,3-dihydro-1H-indenes-1-yl) the oxygen base] methyl phenylpropionate
Method with identical with reference example 32 obtains 5-chloro-1-indanol by 5-chloro-1-indone.Oily.In addition, use the method identical, obtain white powder table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 5-chloro-1-indanol with reference example 33.The yield that is obtained by 5-bromo-1-indone is 33%.
1H NMR(CDCl 3)δ2.16-2.27(1H，m)，2.49-2.59(1H，m)，2.62(2H，t，J＝8.2Hz)，2.83-2.90(1H，m)，2.91(2H，t，J＝8.2Hz)，3.05-3.17(1H，m)，3.68(3H，s)，5.67(1H，dd，J＝4.3Hz，6.6Hz)，6.91(2H，d，J＝8.6Hz)，7.14(2H，d，J＝8.6Hz)，7.19-7.33(3H，m)。
Embodiment 76 4-[(5-chloro-2,3-dihydro-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-1H-indenes-1-yl) oxygen base by 4-[(5-chloro-2 with reference example 4] methyl phenylpropionate obtains the table title chemical compound.Yield 80%.
Fusing point 136-137 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.17-2.28(1H，m)，2.51-2.62(1H，m)，2.67(2H，t，J＝7.9Hz)，2.85-2.90(1H，m)，2.93(2H，t，J＝7.9Hz)，3.06-3.17(1H，m)，5.67(1H，dd，J＝4.4Hz，6.6Hz)，6.91(2H，d，J＝8.6Hz)，7.14-7.33(5H，m)。
Embodiment 77 4-[(5-fluoro-2,3-dihydro-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
Method with identical with reference example 32 obtains 5-fluoro-1-indanol by 5-fluoro-1-indone.Oily.Use the side identical to obtain 4-[(5-fluoro-2 by 4-hydroxy phenylpropionic acid methyl ester and 5-fluoro-1-indanol, 3-dihydro-1H-indenes-1-yl in addition with reference example 33) the oxygen base] methyl phenylpropionate.Oily.Use the method identical in addition,, 3-dihydro-1H-indenes-1-yl by 4-[(5-fluoro-2 with reference example 4) the oxygen base] methyl phenylpropionate obtains the table title chemical compound.The yield that is obtained by 5-fluoro-1-indone is 40%.
Fusing point 124-125 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.18-2.29(1H，m)，2.50-2.62(1H，m)，2.67(2H，t，J＝8.0Hz)，2.85-2.89(1H，m)，2.93(2H，t，J＝8.0Hz)，3.07-3.18(1H，m)，5.68(1H，dd，J＝4.1Hz，6.5Hz)，6.90-6.98(4H，m)，7.15(2H，d，J＝8.6Hz)，7.33-7.37(1H，m)。
Embodiment 78 4-[(2,3-dihydro-5-methyl isophthalic acid H-indenes-1-yl) the oxygen base] benzenpropanoic acid
Method with identical with reference example 32 obtains 5-methyl isophthalic acid-indanol by 5-methyl isophthalic acid-indone.Oily.In addition, use the method identical, obtain 4-[(2 by 4-hydroxy phenylpropionic acid methyl ester and 5-methyl isophthalic acid-indanol, 3-dihydro-5-methyl isophthalic acid H-indenes-1-yl with reference example 33) the oxygen base] methyl phenylpropionate.Oily.Use the method identical in addition,, 3-dihydro-5-methyl isophthalic acid H-indenes-1-yl by 4-[(2 with reference example 4) the oxygen base] methyl phenylpropionate obtains the table title chemical compound.The yield 29% that obtains by 5-methyl isophthalic acid-indone.Fusing point 74-75 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.13-2.25(1H，m)，2.34(3H，s)，2.49-2.60(1H，m)，2.68(2H，t，J＝8.0Hz)，2.80-2.91(1H，m)，2.92(2H，t，J＝8.0Hz)，3.04-3.13(1H，m)，5.69(1H，dd，J＝4.5Hz，6.5Hz)，6.94(2H，d，J＝8.6Hz)，7.10-7.19(4H，m)，7.24(1H，s)。
Embodiment 79 4-[(2,3-dihydro-6-methoxyl group-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
Method with identical with reference example 32 obtains 6-methoxyl group-1-indanol by 6-methoxyl group-1-indone.Oily.In addition, use the method identical, obtain 4-[(2 by 4-hydroxy phenylpropionic acid methyl ester and 6-methoxyl group-1-indanol, 3-dihydro-6-methoxyl group-1H-indenes-1-yl with reference example 33) the oxygen base] methyl phenylpropionate.Oily.Use the method identical in addition,, 3-dihydro-6-methoxyl group-1H-indenes-1-yl by 4-[(2 with reference example 4) the oxygen base] methyl phenylpropionate obtains the table title chemical compound.By the yield that the 6-methoxyl group-the 1-indone obtains is 41%.
Oily.
1H NMR(CDCl 3)δ2.14-2.25(1H，m)，2.51-2.63(1H，m)，2.67(2H，t，J＝8.0Hz)，2.79-2.88(1H，m)，2.93(2H，t，J＝8.0Hz)，3.01-3.09(1H，m)，3.79(3H，s)，5.69(1H，dd，J＝4.8Hz，6.5Hz)，6.86-6.97(4H，m)，7.13-7.20(3H，m)。
Embodiment 80 4-[(5-bromo-2,3-dihydro-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
Method with identical with reference example 32 obtains 5-bromo-1-indanol by 5-bromo-1-indone.Oily.In addition, use the method identical, obtain 4-[(5-bromo-2 by 4-hydroxy phenylpropionic acid methyl ester and 5-bromo-1-indanol, 3-dihydro-1H-indenes-1-yl with reference example 33) the oxygen base] methyl phenylpropionate.Oily.Use the method identical in addition,, 3-dihydro-1H-indenes-1-yl by 4-[(5-bromo-2 with reference example 4) the oxygen base] methyl phenylpropionate obtains the table title chemical compound.The yield that is obtained by 5-bromo-1-indone is 29%.
Fusing point 133-134 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.15-2.27(1H，m)，2.47-2.59(1H，m)，2.67(2H，t，J＝8.0Hz)，2.83-2.89(1H，m)，2.92(2H，t，J＝8.0Hz)，3.06-3.18(1H，m)，5.66(1H，dd，J＝4.5Hz，6.5Hz)，6.91(2H，d，J＝8.6Hz)，7.15(2H，d，J＝8.6Hz)，7.26(1H，d，J＝8.0Hz)，7.36(1H，d，J＝8.6Hz)，7.44(1H，s)。
Embodiment 81 4-[(2,3-dihydro-5-phenoxy group-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
Method with identical with reference example 32 obtains 5-phenoxy group-1-indanol by 5-phenoxy group-1-indone.Oily.In addition, use the method identical, obtain 4-[(2 by 4-hydroxy phenylpropionic acid methyl ester and 5-phenoxy group-1-indanol, 3-dihydro-5-phenoxy group-1H-indenes-1-yl with reference example 33) the oxygen base] methyl phenylpropionate.Oily.Use the method identical in addition,, 3-dihydro-5-phenoxy group-1H-indenes-1-yl by 4-[(2 with reference example 4) the oxygen base] methyl phenylpropionate obtains the table title chemical compound.By the yield that the 5-phenoxy group-the 1-indone obtains is 19%.
Fusing point 92-93 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.18-2.29(1H，m)，2.50-2.61(1H，m)，2.67(2H，t，J＝8.0Hz)，2.81-2.90(1H，m)，2.90(2H，t，J＝8.0Hz)，3.05-3.18(1H，m)，5.70(1H，dd，J＝3.9Hz，6.5Hz)，6.87-6.90(4H，m)，7.00-7.17(5H，m)，7.29-7.38(3H，m)。
Embodiment 82 4-[(2,3-dihydro-4-methyl isophthalic acid H-indenes-1-yl) the oxygen base] methyl phenylpropionate
Method with identical with reference example 32 obtains 4-methyl isophthalic acid-indanol by 4-methyl isophthalic acid-indone.Oily.In addition, use the method identical, obtain white powder table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 4-methyl isophthalic acid-indanol with reference example 33.The yield that is obtained by 4-methyl isophthalic acid-indone is 4%.
1H NMR(CDCl 3)δ2.15-2.28(1H，m)，2.30(3H，s)，2.48-2.57(1H，m)，2.62(2H，t，J＝8.1Hz)，2.78-2.89(1H，m)，2.91(2H，t，J＝8.1Hz)，2.99-3.09(1H，m)，3.68(3H，s)，5.73(1H，dd，J＝4.1Hz，6.7Hz)，6.93(2H，d，J＝8.6Hz)，7.12-7.19(4H，m)，7.25-7.27(1H，m)。
Embodiment 83 4-[(2,3-dihydro-4-methyl isophthalic acid H-indenes-1-yl) the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-4-methyl isophthalic acid H-indenes-1-yl) oxygen base by 4-[(2 with reference example 4] methyl phenylpropionate obtains the table title chemical compound.Yield 65%.
Fusing point 121-122 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.16-2.27(1H，m)，2.29(3H，s)，2.49-2.61(1H，m)，2.68(2H，t，J＝8.1Hz)，2.79-2.92(1H，m)，2.92(2H，t，J＝8.1Hz)，3.00-3.09(1H，m)，5.73(1H，dd，J＝4.1Hz，6.7Hz)，6.94(2H，d，J＝8.6Hz)，7.11-7.19(4H，m)，7.25-7.27(1H，m)。
Embodiment 84 4-[(2,3-dihydro-5,6-dimethoxy-1H-indenes-1-yl) the oxygen base] methyl phenylpropionate
With the method identical with reference example 32, by 5,6-dimethoxy-1-indone obtains 5,6-dimethoxy-1-indanol.Oily.In addition, use the method identical with reference example 33, by 4-hydroxy phenylpropionic acid methyl ester and 5,6-dimethoxy-1-indanol obtains white powder table title chemical compound.By 5, the yield that the 6-dimethoxy-the 1-indone obtains is 42%.
1H NMR(CDCl 3)δ2.14-2.26(1H，m)，2.49-2.60(1H，m)，2.62(2H，t，J＝8.2Hz)，2.79-2.89(1H，m)，2.91(2H，t，J＝8.2Hz)，3.04-3.14(1H，m)，3.68(3H，s)，3.86(3H，s)，3.89(3H，s)，5.68(1H，dd，J＝3.6Hz，6.6Hz)，6.81(1H，s)，6.91-6.94(3H，m)，7.14(2H，d，J＝8.5Hz)。
Embodiment 85 4-[(2,3-dihydro-5,6-dimethoxy-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-5,6-dimethoxy-1H-indenes-1-yl by 4-[(2 with reference example 4) the oxygen base] methyl phenylpropionate obtains the table title chemical compound.Yield 43%.
Fusing point 90-92 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.16-2.25(1H，m)，2.49-2.61(1H，m)，2.67(2H，t，J＝8.0Hz)，2.80-2.91(1H，m)，2.93(2H，t，J＝8.0Hz)，3.04-3.15(1H，m)，3.89(3H，s)，3.91(3H，s)，5.69(1H，dd，J＝3.7Hz，6.6Hz)，6.80(1H，s)，6.89-6.96(3H，m)，7.15(2H，d，J＝8.6Hz)。
Embodiment 86 4-[(2,3-dihydro-5-(4-aminomethyl phenyl)-1H-indenes-1-yl) the oxygen base] methyl phenylpropionate
Method with identical with reference example 32 obtains 5-(4-aminomethyl phenyl)-1-indanol by 5-(4-aminomethyl phenyl)-1-indone.Oily.In addition, use the method identical, obtain white powder table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 5-(4-aminomethyl phenyl)-1-indanol with reference example 33.By the 5-yield that (4-aminomethyl phenyl)-the 1-indone obtains is 31%.
1H NMR(CDCl 3)δ2.21-2.32(1H，m)，2.40(3H，s)，2.52-2.62(1H，m)，2.63(2H，t，J＝8.0Hz)，2.92(2H，t，J＝8.0Hz)，2.96-3.03(1H，m)，3.15-3.26(1H，m)，3.68(3H，s)，5.76(1H，dd，J＝4.1Hz，6.6Hz)，6.95(2H，d，J＝8.6Hz)，7.15(2H，d，J＝8.6Hz)，7.23-7.26(2H，m)，7.43-7.49(5H，m)。
Embodiment 87 4-[[2,3-dihydro-5-(4-aminomethyl phenyl)-1H-indenes-1-yl] the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-5-(4-aminomethyl phenyl)-1H-indenes-1-yl) oxygen base by 4-[(2 with reference example 4] methyl phenylpropionate obtains the table title chemical compound.Yield 68%.
Fusing point 159-160 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.20-2.31(1H，m)，2.40(3H，s)，2.51-2.62(1H，m)，2.68(2H，t，J＝8.0Hz)，2.94(2H，t，J＝8.0Hz)，2.95-3.00(1H，m)，3.14-3.22(1H，m)，5.76(1H，dd，J＝4.2Hz，6.6Hz)，6.96(2H，d，J＝8.6Hz)，7.16(2H，d，J＝8.6Hz)，7.23-7.26(2H，m)，7.43-7.50(5H，m)。
Embodiment 88 4-[[5-(4-fluorophenyl)-2,3-dihydro-1H-indenes-1-yl] the oxygen base] methyl phenylpropionate
Method with identical with reference example 32 obtains 5-(4-fluorophenyl)-1-indanol by 5-(4-fluorophenyl)-1-indone.Oily.In addition, use the method identical, obtain white powder table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 5-(4-fluorophenyl)-1-indanol with reference example 33.By the 5-yield that (4-fluorophenyl)-the 1-indone obtains is 31%.
1H NMR(CDCl 3)δ2.19-2.31(1H，m)，2.52-2.62(1H，m)，2.63(2H，t，J＝8.0Hz)，2.92(2H，t，J＝8.0Hz)，2.94-3.01(1H，m)，3.14-3.25(1H，m)，3.68(3H，s)，5.76(1H，dd，J＝4.2Hz，6.6Hz)，6.95(2H，d，J＝8.6Hz)，7.09-7.16(4H，m)，7.38-7.55(5H，m)。
Embodiment 89 4-[[5-(4-fluorophenyl)-2,3-dihydro-1H-indenes-1-yl] the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-1H-indenes-1-yl by 4-[[5-(4-fluorophenyl)-2 with reference example 4] the oxygen base] methyl phenylpropionate obtains the table title chemical compound.Yield 86%.
Fusing point 169-170 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.20-2.31(1H，m)，2.53-2.64(1H，m)，2.68(2H，t，J＝8.0Hz)，2.93(2H，t，J＝8.0Hz)，2.95-3.01(1H，m)，3.14-3.25(1H，m)，5.77(1H，dd，J＝4.2Hz，6.6Hz)，6.96(2H，d，J＝8.6Hz)，7.09-7.18(4H，m)，7.39-7.54(5H，m)。
Embodiment 90 4-(dibenzo [b, d] furan-2-ylmethoxy) methyl phenylpropionate
Method with identical with reference example 5 obtains white powder table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 2-(chloromethyl) dibenzo [b, d] furan.Yield 35%.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.1Hz)，2.90(2H，t，J＝8.1Hz)，3.66(3H，s)，5.17(2H，s)，6.94(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.32-7.58(5H，m)，7.95(1H，d，J＝7.8Hz)，8.02(1H，s)。
Embodiment 91 4-(dibenzo [b, d] furan-2-ylmethoxy) benzenpropanoic acid
Method with identical with reference example 4 obtains the table title chemical compound by 4-(dibenzo [b, d] furan-2-ylmethoxy) methyl phenylpropionate.Yield 80%.
Fusing point 175-176 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.66(2H，t，J＝8.0Hz)，2.92(2H，t，J＝8.0Hz)，5.18(2H，s)，6.94(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.32-7.58(5H，m)，7.96(1H，d，J＝7.4Hz)，8.03(1H，s)。
Embodiment 92 4-[(2,3-dihydro-5-phenyl-1H-indenes-1-yl) the oxygen base] methyl phenylpropionate
Method with identical with reference example 32 obtains 5-phenyl-1-indanol by 5-phenyl-1-indone.Oily.In addition, use the method identical, obtain white powder table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 5-phenyl-1-indanol with reference example 33.By the yield that the 5-phenyl-the 1-indone obtains is 50%.
1H NMR(CDCl 3)δ2.20-2.31(1H，m)，2.54-2.70(1H，m)，2.62(2H，t，J＝8.1Hz)，2.92(2H，t，J＝8.1Hz)，2.98-3.04(1H，m)，3.14-3.28(1H，m)，3.68(3H，s)，5.77(1H，dd，J＝4.2Hz，6.6Hz)，6.95(2H，d，J＝8.6Hz)，7.15(2H，d，J＝8.6Hz)，7.32-7.60(8H，m)。
Embodiment 93 4-[(2,3-dihydro-5-phenyl-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-5-phenyl-1H-indenes-1-yl) oxygen base by 4-[(2 with reference example 4] methyl phenylpropionate obtains the table title chemical compound.Yield is 72%.
Fusing point 148-149 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.21-2.32(1H，m)，2.55-2.75(1H，m)，2.69(2H，t，J＝8.0Hz)，2.94(2H，t，J＝8.0Hz)，2.95-3.01(1H，m)，3.16-3.25(1H，m)，5.78(1H，dd，J＝4.2Hz，6.6Hz)，6.97(2H，d，J＝8.6Hz)，7.17(2H，d，J＝8.6Hz)，7.32-7.60(8H，m)。
Embodiment 94 4-[[2,3-dihydro-5-(4-methoxyphenyl)-1H-indenes-1-yl] the oxygen base] methyl phenylpropionate
Method with identical with reference example 32 obtains 5-(4-methoxyphenyl)-1-indanol by 5-(4-methoxyphenyl)-1-indone.Oily.In addition, use the method identical, obtain white powder table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 5-(4-methoxyphenyl)-1-indanol with reference example 33.By the 5-yield that (4-methoxyphenyl)-the 1-indone obtains is 38%.
1H NMR(CDCl 3)δ2.20-2.29(1H，m)，2.49-2.60(1H，m)，2.62(2H，t，J＝7.8Hz)，2.92(2H，t，J＝7.8Hz)，2.93-3.00(1H，m)，3.15-3.23(1H，m)，3.68(3H，s)，3.85(3H，s)，5.75(1H，dd，J＝4.1Hz，6.6Hz)，6.94-6.99(4H，m)，7.14(2H，d，J＝8.6Hz)，7.41-7.53(5H，m)。
Embodiment 95 4-[[2,3-dihydro-5-(4-methoxyphenyl)-1H-indenes-1-yl] the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-5-(4-methoxyphenyl)-1H-indenes-1-yl by 4-[[2 with reference example 4] the oxygen base] methyl phenylpropionate obtains the table title chemical compound.Yield 94%.
Fusing point 151-152 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.19-2.30(1H，m)，2.51-2.65(1H，m)，2.68(2H，t，J＝8.0Hz)，2.94(2H，t，J＝8.0Hz)，2.96-3.00(1H，m)，3.14-3.22(1H，m)，3.85(3H，s)，5.70(1H，dd，J＝4.1Hz，6.6Hz)，6.94-7.00(4H，m)，7.17(2H，d，J＝8.6Hz)，7.41-7.53(5H，m)。
Embodiment 96 4-[[5-(4-chlorphenyl)-2,3-dihydro-1H-indenes-1-yl] the oxygen base] benzenpropanoic acid
Method with identical with reference example 32 obtains 5-(4-chlorphenyl)-1-indanol by 5-(4-chlorphenyl)-1-indone.Oily.In addition, use the method identical, obtain white powder table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 5-(4-chlorphenyl)-1-indanol with reference example 33.Yield by 5-(4-chlorphenyl)-1-indone is 43%.
1H NMR(CDCl 3)δ2.16-2.30(1H，m)，2.50-2.56(1H，m)，2.62(2H，t，J＝8.0Hz)，2.92(2H，t，J＝8.0Hz)，2.94-3.02(1H，m)，3.14-3.23(1H，m)，3.68(3H，s)，5.76(1H，dd，J＝4.3Hz，6.5Hz)，6.94(2H，d，J＝8.6Hz)，7.15(2H，d，J＝8.6Hz)，7.38-7.52(7H，m)。
Embodiment 97 4-[[5-(4-chlorphenyl)-2,3-dihydro-1H-indenes-1-yl] the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-1H-indenes-1-yl by 4-[[5-(4-chlorphenyl)-2 with reference example 4] the oxygen base] methyl phenylpropionate obtains the table title chemical compound.Yield 93%.
Fusing point 165-166 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.18-2.31(1H，m)，2.51-2.63(1H，m)，2.68(2H，t，J＝7.8Hz)，2.93(2H，t，J＝7.8Hz)，2.97-3.02(1H，m)，3.15-3.19(1H，m)，5.77(1H，dd，J＝4.3Hz，6.4Hz)，6.96(2H，d，J＝8.4Hz)，7.17(2H，d，J＝8.4Hz)，7.38-7.55(7H，m)。
Embodiment 98 (+)-4-[(5-chloro-2,3-dihydro-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
4-[(5-chloro-2,3-dihydro-1H-indenes-1-yl) oxygen base] benzenpropanoic acid (50mg) high speed liquid chromatography method (post: CHIRALCEL OJ (50mmID * 500mm, Daicel chemical industry system), mobile phase: hexane/ethanol=4: 1, flow velocity: 70mL/min, column temperature: 35 ℃) branch is obtained table title chemical compound (24mg).[α] D 23+8.2°(c 0.45、CHCl 3)。
Embodiment 99 (-)-4-[(5-chloro-2,3-dihydro-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
4-[(5-chloro-2,3-dihydro-1H-indenes-1-yl) oxygen base] benzenpropanoic acid handle (50mg) high speed liquid chromatography method (post: CHIRALCEL OJ (50mmID * 500mm, Daicel chemical industry system), mobile phase: hexane/ethanol=4: 1, flow velocity: 70mL/min, column temperature: 35 ℃) branch is obtained table title chemical compound (23mg).[α] D 23-6.2°(c 0.53、CHCl 3)。
Embodiment 100 4-(benzo [b] thiene-3-yl-methoxyl group) methyl phenylpropionate
With the method identical, obtain the table title chemical compound by 3-benzo [b] thiophenecarboxaldehyde (3-benzo[b] thiophenecarboxaldehyde) and 4-hydroxy phenylpropionic acid methyl ester with reference example 53.Yield 79%.Oily.
1H NMR(CDCl 3)δ2.67(2H，t，J＝7.4Hz)，2.90(2H，t，J＝7.4Hz)，3.69(3H，s)，5.27(2H，s)，6.96(2H，d，J＝8.6Hz)，7.15(2H，d，J＝8.6Hz)，7.33-7.40(2H，m)，7.48(1H，s)，7.80-7.90(2H，m)。
Embodiment 101 4-(benzo [b] thiene-3-yl-methoxyl group) benzenpropanoic acid
Method with identical with reference example 38 obtains the table title chemical compound by 4-(benzo [b] thiene-3-yl-methoxyl group) methyl phenylpropionate.Yield 86%.
Fusing point 125-126 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.4Hz)，2.90(2H，t，J＝7.4Hz)，5.25(2H，s)，6.95(2H，d，J＝8.6Hz)，7.15(2H，d，J＝8.6Hz)，7.30-7.40(2H，m)，7.45(1H，s)，7.81-7.89(2H，m)。
Embodiment 102 4-(1H-indole-2-ylmethoxy) methyl phenylpropionate
Method with identical with reference example 1 obtains the table title chemical compound by 1H-indole-2-methanol and 4-hydroxy phenylpropionic acid methyl ester.Yield 12%.
Fusing point 156-157 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.59(2H，t，J＝7.4Hz)，2.89(2H，t，J＝7.4Hz)，3.66(3H，s)，5.21(2H，s)，6.52(1H，s)，6.92(2H，d，J＝8.6Hz)，7.08-7.21(4H，m)，7.35(1H，d，J＝7.4Hz)，7.59(1H，d，J＝7.5Hz)，8.33(1H，br s)。
Embodiment 103 4-(1H-indole-2-ylmethoxy) benzenpropanoic acid
Method with identical with reference example 38 obtains the table title chemical compound by 4-(1H-indole-2-ylmethoxy) methyl phenylpropionate.Yield 53%.
Fusing point 131-133 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.4Hz)，2.91(2H，t，J＝7.4Hz)，5.21(2H，s)，6.52(1H，s)，6.91(2H，d，J＝8.6Hz)，7.09-7.22(4H，m)，7.31(1H，d，J＝7.4Hz)，7.57(1H，d，J＝7.5Hz)，8.33(1H，br s)。
Embodiment 104 4-[(2,3-dihydro-7-methyl isophthalic acid H-indenes-1-yl) the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-7-methyl isophthalic acid H-indenes-1-yl) oxygen base by 4-[(2 with reference example 4] methyl phenylpropionate obtains the table title chemical compound.Yield 38%.
Fusing point 128-129 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.27-2.50(2H，m)，2.33(3H，s)，2.67(2H，t，J＝8.0Hz)，2.90(1H，m)，2.92(2H，t，J＝8.0Hz)，3.15(1H，m)，5.74(1H，dd，J＝1.7Hz，3.5Hz)，6.92(2H，d，J＝8.6Hz)，7.06(1H，d，J＝7.3Hz)，7.12-7.23(4H，m)。
Embodiment 105 4-[(3-chlorobenzenes are [b] thiophene-2-yl also) methoxyl group] methyl phenylpropionate
The mixture of 4-hydroxy phenylpropionic acid methyl ester (0.91g, 5.0mmol), 3-chloro-2-benzothiophene methanol (1.0g, 5.0mmol), oxolane (50mL), tributylphosphine (1.3g, 6.5mmol) and azo dicarbapentaborane two piperidines (1.7g, 6.5mmol) is at room temperature stirred-evening.Behind the concentrated reaction mixture, filter.Behind ethyl acetate dilute filtration liquid, washing.Behind the anhydrous magnesium sulfate drying organic layer, under reduced pressure heat up in a steamer and desolvate.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=5: 1), obtain table title chemical compound (1.6g, yield 87%).
Fusing point 97-98 ℃ (by ethyl acetate-diisopropyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.59(2H，t，J＝7.5Hz)，2.89(2H，t，J＝7.5Hz)，3.66(3H，s)，5.36(2H，s)，6.93(2H，d，J＝8.6Hz)，7.12(2H，d，J＝8.6Hz)，7.37-7.48(2H，m)，7.77-7.84(2H，m)。
Embodiment 106 4-[(3-chlorobenzenes are [b] thiophene-2-yl also) methoxyl group] benzenpropanoic acid
4-[(3-chlorobenzene [b] thiophene-2-yl also) methoxyl group] mixture of methyl phenylpropionate (1.5g, 4.0mmol), oxolane (20mL), methanol (5mL), water (2mL) and Lithium hydrate-hydrate (0.34g, 8.0mmol) at room temperature stirs an evening.Reactant liquor is neutralized with 0.5 equivalent hydrochloric acid, use ethyl acetate extraction.Behind the clean organic layer of saturated aqueous common salt, use anhydrous magnesium sulfate drying, under reduced pressure heat up in a steamer and desolvate.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=3: 1), obtain table title chemical compound (1.3g, yield 94%).
Fusing point 136-137 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.5Hz)，2.91(2H，t，J＝7.5Hz)，5.37(2H，s)，6.94(2H，d，J＝8.7Hz)，7.13(2H，d，J＝8.7Hz)，7.38-7.45(2H，m)，7.77-7.83(2H，m)，9.68(1H，br s)。
Embodiment 107 4-[(3-methyl benzo [b] thiophene-2-yls) methoxyl group] methyl phenylpropionate
Method with identical with embodiment 105 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 3-methyl-2-benzo [b] thenyl alcohol.Yield 52%.
Fusing point 149-150 ℃ (by ethyl acetate-diisopropyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.43(3H，s)，2.60(2H，t，J＝7.5Hz)，2.90(2H，t，J＝7.5Hz)，3.66(3H，s)，5.26(2H，s)，6.93(2H，d，J＝8.7Hz)，7.13(2H，d，J＝8.6Hz)，7.31-7.41(2H，m)，7.68-7.71(1H，m)，7.79-7.82(1H，m)。
Embodiment 108 4-[(3-methyl benzo [b] thiophene-2-yls) methoxyl group] benzenpropanoic acid
With the method identical, by 4-[(3-methyl benzo [b] thiophene-2-yl with embodiment 106) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 79%.
Fusing point 155-156 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.42(3H，s)，2.65(2H，t，J＝7.4Hz)，2.91(2H，t，J＝7.4Hz)，5.26(2H，s)，6.94(2H，d，J＝8.7Hz)，7.14(2H，d，J＝8.6Hz)，7.30-7.41(2H，m)，7.68-7.71(1H，m)，7.78-7.82(1H，m)，9.82(1H，br s)。
Embodiment 109 4-(2-benzofuran ylmethoxy) methyl phenylpropionate
Method with identical with embodiment 105 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 2-benzofuran methanol.Yield 81%.
Fusing point 93-94 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.60(2H，t，J＝7.5Hz)，2.90(2H，t，J＝7.5Hz)，3.66(3H，s)，5.14(2H，s)，6.77(1H，s)，6.94(2H，d，J＝8.7Hz)，7.13(2H，d，J＝8.7Hz)，7.20-7.32(2H，m)，7.48-7.57(2H，m)。
Embodiment 110 4-(2-benzofuran ylmethoxy) benzenpropanoic acid
Method with identical with embodiment 106 obtains the table title chemical compound by 4-(2-benzofuran ylmethoxy) methyl phenylpropionate.Yield 79%.
Fusing point 155-156 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.5Hz)，2.91(2H，t，J＝7.5Hz)，5.15(2H，s)，6.77(1H，s)，6.95(2H，d，J＝8.6Hz)，7.14(2H，d，J＝8.6Hz)，7.20-7.32(2H，m)，7.49-7.57(2H，m)，9.67(1H，br s)。
Embodiment 111 4-(benzo [b] thiophene-2-ylmethoxy) methyl phenylpropionate
Method with identical with embodiment 105 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 2-benzo [b] thenyl alcohol.Yield 35%.
Fusing point 154-156 ℃ (by the petroleum ether recrystallize).
1H NMR(CDCl 3)δ2.59(2H，t，J＝7.5Hz)，2.90(2H，t，J＝7.5Hz)，3.66(3H，s)，5.30(2H，s)，6.93(2H，d，J＝8.7Hz)，7.15(2H，d，J＝8.7Hz)，7.27-7.37(3H，m)，7.72-7.80(2H，m)。
Embodiment 112 4-(benzo [b] thiophene-2-ylmethoxy) benzenpropanoic acid
Method with identical with embodiment 106 obtains the table title chemical compound by 4-(benzo [b] thiophene-2-ylmethoxy) methyl phenylpropionate.Yield 81%.
Fusing point 190-191 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.5Hz)，2.91(2H，t，J＝7.5Hz)，5.30(2H，s)，6.93(2H，d，J＝8.7Hz)，7.15(2H，d，J＝8.7Hz)，7.28-7.37(3H，m)，7.73-7.83(2H，m)，9.82(1H，br s)。
Embodiment 113 4-([1,1 '-xenyl]-the 3-ylmethoxy)-3-bromo-hydrocinnamic acid methyl ester
With the method identical, obtain the table title chemical compound by 3-bromo-4-hydroxy phenylpropionic acid methyl ester and [1,1 '-xenyl]-3-methanol with reference example 1.Yield 96%.
Oily.
1H NMR(CDCl 3)δ2.59(2H，t，J＝7.3Hz)，2.87(2H，t，J＝7.3Hz)，3.66(3H，s)，5.19(2H，s)，6.88(1H，d，J＝8.4 Hz)，7.06(1H，dd，J＝1.8Hz，8.4Hz)，7.33-7.37(1H，m)，7.41-7.47(5H，m)，7.52-7.62(3H，m)，7.71(1H，s)。
Embodiment 114 4-([1,1 '-xenyl]-the 3-ylmethoxy)-the 3-bromo-hydrocinnamic acid
Method with identical with reference example 4 obtains the table title chemical compound by 4-([1, the 11-xenyl]-3-ylmethoxy)-3-bromo-hydrocinnamic acid methyl ester.Yield 87%.
Fusing point 83-84 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.64(2H，t，J＝7.4Hz)，2.88(2H，t，J＝7.4Hz)，5.19(2H，s)，6.89(1H，d，J＝8.4Hz)，7.07(1H，dd，J＝2.0Hz，8.4Hz)，7.33-7.38(1H，m)，7.42-7.48(5H，m)，7.53-7.62(3H，m)，7.70(1H，s)。
Embodiment 115 4-(2-[4-morpholinodithio methoxyl group) methyl phenylpropionate
Method with identical with embodiment 105 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 2-[4-morpholinodithio methanol.Yield 91%.
Fusing point ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.59(2H，t，J＝7.5Hz)，2.90(2H，t，J＝7.5Hz)，3.66(3H，s)，5.56(2H，s)，6.96(2H，d，J＝8.7Hz)，7.13(2H，d，J＝8.7Hz)，7.37-7.53(2H，m)，7.89(1H，d，J＝8.0Hz)，8.03(1H，d，J＝8.0Hz)。
Embodiment 116 4-(2-[4-morpholinodithio methoxyl group) benzenpropanoic acid
Method with identical with embodiment 106 obtains the table title chemical compound by 4-(2-[4-morpholinodithio methoxyl group) methyl phenylpropionate.Yield 93%.
Fusing point 158-159 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(DMSO-d 6)δ2.48(2H，t，J＝7.5Hz)，2.75(2H，t，J＝7.5Hz)，5.56(2H，s)，7.01(2H，d，J＝6.8Hz)，7.16(2H，d，J＝6.8Hz)，7.43-7.57(2H，m)，8.01(1H，d，J＝7.7Hz)，8.11(1H，d，J＝7.7Hz)，12.01(1H，br s)。
Embodiment 117 4-[(1-Methyl-1H-indole-2-yl) methoxyl group] methyl phenylpropionate
Method with identical with embodiment 105 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 1-methyl-2-indole-alcohol.Yield 28%.
Fusing point 157-158 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(CDCl 3)δ2.60(2H，t，J＝7.5Hz)，2.90(2H，t，J＝7.5Hz)，3.67(3H，s)，3.80(3H，s)，5.16(2H，s)，6.58(1H，s)，6.93(2H，d，J＝8.6Hz)，7.07-7.15(2H，m)，7.21-7.25(2H，m)，7.31-7.34(1H，m)，7.59(1H，d，J＝7.9Hz)。
Embodiment 118 4-[(1-Methyl-1H-indole-2-yl) methoxyl group] benzenpropanoic acid
With the method identical, by 4-[(1-Methyl-1H-indole-2-yl with embodiment 106) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 21%.
Fusing point 151-152 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(DMSO-d 6)δ2.51(2H，t，J＝7.5Hz)，2.75(2H，t，J＝7.5Hz)，3.32(3H，s)，5.26(2H，s)，6.59(1H，s)，7.00-7.05(3H，m)，7.14-7.19(3H，m)，7.45(1H，d，J＝8.3Hz)，7.53(1H，d，J＝8.3Hz)，12.08(1H，br s)。
Embodiment 119 4-[(6,7,8,9-tetrahydrochysene-5H-benzocyclohepta alkene-5-yl) the oxygen base] methyl phenylpropionate
With the method identical with embodiment 105, by 4-hydroxy phenylpropionic acid methyl ester and 6,7,8,9-tetrahydrochysene-5H-benzocyclohepta alkene-5-ketone obtains the table title chemical compound.Yield 36%.
Oily.
1H NMR(CDCl 3)δ1.43-1.55(1H，m)，1.79-1.21(3H，m)，2.04-2.15(2H，m)，2.57(2H，t，J＝7.5Hz)，2.76-3.00(4H，m)，3.65(3H，s)，5.28(1H，d，J＝9.1Hz)，6.79(2H，d，J＝8.6Hz)，7.05(2H，d，J＝8.6Hz)，7.12-7.16(3H，m)，7.33-7.35(1H，m)。
Embodiment 120 4-[(6,7,8,9-tetrahydrochysene-5H-benzocyclohepta alkene-5-yl) the oxygen base] benzenpropanoic acid
With the method identical,, 7,8,9-tetrahydrochysene-5H-benzocyclohepta alkene-5-yl) oxygen base by 4-[(6 with embodiment 106] methyl phenylpropionate obtains the table title chemical compound.Yield 65%.
Fusing point 129-130 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(DMSO-d 6)δ1.39-1.48(1H，m)，1.67-2.05(5H，m)，2.46(2H，t，J＝7.5Hz)，2.72(2H，t，J＝7.5Hz)，2.81-2.97(2H，m)，5.46(1H，d，J＝8.4Hz)，6.84(2H，d，J＝8.6Hz)，7.07-7.16(5H，m)，7.24-7.30(1H，m)，12.08(1H，br s)。
Embodiment 121 4-[[4-(trifluoromethyl) benzos [b] thiophene-2-yl] methoxyl group] methyl phenylpropionate
Method with identical with embodiment 105 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 4-(trifluoromethyl) benzo [b] thenyl alcohol.Yield 69%.
Fusing point 76-77 ℃ (by the petroleum ether recrystallize).
1H NMR(CDCl 3)δ2.60(2H，t，J＝7.5Hz)，2.90(2H，t，J＝7.5Hz)，3.66(3H，s)，5.34(2H，s)，6.93(2H，d，J＝8.7Hz)，7.14(2H，d，J＝8.7Hz)，7.36-7.41(1H，m)，7.53-7.55(1H，m)，7.65(1H，d，J＝8.3Hz)，7.98(1H，d，J＝8.3Hz)。
Embodiment 122 4-[[4-(trifluoromethyl) benzos [b] thiophene-2-yl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[4-(trifluoromethyl) benzo [b] thiophene-2-yl with embodiment 106] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 82%.
Fusing point 151-152 ℃ (by ethyl acetate-diisopropyl ether recrystallize).
1H NMR(DMSO-d 6)δ2.46(2H，t，J＝7.5Hz)，2.75(2H，t，J＝7.5Hz)，5.50(2H，s)，6.97(2H，d，J＝8.8Hz)，7.15(2H，d，J＝8.8Hz)，7.53(1H，t，J＝7.7Hz)，7.65(1H，s)，7.77(1H，d，J＝7.5Hz)，8.31(1H，d，J＝7.5Hz)，12.08(1H，br s)。
Embodiment 123 4-[(3 '-chloro-[1,1 '-biphenyl]-the 3-yl) methoxyl group] methyl phenylpropionate
With the method identical, by the 4-[(3-bromophenyl with embodiment 22) methoxyl group] methyl phenylpropionate and 3-chlorophenylboronic acid obtain the table title chemical compound.Yield 86%.
Oily.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.66(3H，s)，5.10(2H，s)，6.92(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.30-7.39(2H，m)，7.42-7.54(4H，m)，7.58-7.62(2H，m)。
Embodiment 124 4-[(3 '-chloro-[1,1 '-biphenyl]-the 3-yl) methoxyl group] benzenpropanoic acid
With the method identical, by 4-[(3 '-chloro-[1,1 '-biphenyl]-3-yl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 34%.
Fusing point 109-110 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.8Hz)，2.91(2H，t，J＝7.8Hz)，5.10(2H，s)，6.93(2H，d，J＝8.4Hz)，7.14(2H，d，J＝8.4Hz)，7.31-7.53(6H，m)，7.62(1H，s)，7.58(1H，s)。
Embodiment 125 4-[(2 '-chloro-[1,1 '-biphenyl]-the 3-yl) methoxyl group] methyl phenylpropionate
With the method identical, by the 4-[(3-bromophenyl with embodiment 22) methoxyl group] methyl phenylpropionate and 2-chlorophenylboronic acid obtain the table title chemical compound.Yield 83%.
Oily.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.1Hz)，2.90(2H，t，J＝8.1Hz)，3.66(3H，s)，5.09(2H，s)，6.92(2H，d，J＝8.7Hz)，7.12(2H，d，J＝8.6Hz)，7.27-7.50(8H，m)。
Embodiment 126 4-[(2 '-chloro-[1,1 '-biphenyl]-the 3-yl) methoxyl group] benzenpropanoic acid
With the method identical, by 4-[(2 '-chloro-[1,1 '-biphenyl]-3-yl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 29%.
Fusing point 127-128 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.8Hz)，2.91(2H，t，J＝7.8Hz)，5.10(2H，s)，6.93(2H，d，J＝8.5Hz)，7.13(2H，d，J＝8.5Hz)，7.28-7.50(8H，m)。
Embodiment 127 4-[(3 '-methyl-[1,1 '-biphenyl]-the 3-yl) methoxyl group] methyl phenylpropionate
With the method identical, by the 4-[(3-bromophenyl with embodiment 22) methoxyl group] methyl phenylpropionate and 3-tolyl boric acid obtains the table title chemical compound.Yield 92%.
Oily.
1H NMR(CDCl 3)δ2.42(3H，s)，2.60(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.66(3H，s)，5.60(2H，s)，6.93(2H，d，J＝8.6Hz)，7.10-7.18(3H，m)，7.30-7.47(5H，m)，7.54(1H，dt，J＝7.3Hz，1.7Hz)，7.64(1H，s)。
Embodiment 128 4-[(3 '-methyl-[1,1 '-biphenyl]-the 3-yl) methoxyl group] benzenpropanoic acid
With the method identical, by 4-[(3 '-methyl-[1,1 '-biphenyl]-3-yl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 62%.
Fusing point 102-103 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.42(3H，s)，2.65(2H，t，J＝8.0Hz)，2.91(2H，t，J＝8.0Hz)，5.10(2H，s)，6.93(2H，d，J＝8.6Hz)，7.12-7.18(3H，m)，7.30-7.47(5H，m)，7.54(1H，dt，J＝7.3Hz，1.6Hz)，7.64(1H，s)。
Embodiment 129 4-[(3 '-fluoro-[1,1 '-biphenyl]-the 3-yl) methoxyl group] methyl phenylpropionate
With the method identical, by the 4-[(3-bromophenyl with embodiment 22) methoxyl group] methyl phenylpropionate and 3-fluorophenyl boric acid obtains the table title chemical compound.Yield 89%.
Oily.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.1Hz)，2.90(2H，t，J＝8.1Hz)，3.66(3H，s)，5.10(2H，s)，6.92(2H，d，J＝8.6Hz)，7.01-7.08(1H，m)，7.13(2H，d，J＝8.6Hz)，7.27-7.31(1H，m)，7.36-7.55(5H，m)，7.63(1H，s)。
Embodiment 130 4-[(3 '-fluoro-[1,1 '-biphenyl]-the 3-yl) methoxyl group] benzenpropanoic acid
With the method identical, by 4-[(3 '-fluoro-[1,1 '-biphenyl]-3-yl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 62%.
Fusing point 113-114 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝8.0Hz)，2.91(2H，t，J＝8.0Hz)，5.10(2H，s)，6.93(2H，d，J＝8.6Hz)，7.01-7.07(1H，m)，7.14(2H，d，J＝8.6Hz)，7.27-7.31(1H，m)，7.35-7.55(5H，m)，7.63(1H，m)。
Embodiment 131 4-[(3 '-methoxyl group-[1,1 '-biphenyl]-the 3-yl) methoxyl group] methyl phenylpropionate
With the method identical, by the 4-[(3-bromophenyl with embodiment 22) methoxyl group] methyl phenylpropionate and 3-methoxybenzene ylboronic acid obtain the table title chemical compound.Yield 89%.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.1Hz)，2.90(2H，t，J＝8.1Hz)，3.66(3H，s)，3.87(3H，s)，5.10(2H，s)，6.89-6.94(3H，m)，7.11-7.14(3H，m)，7.17-7.19(1H，m)，7.33-7.47(3H，m)，7.54(1H，dt，J＝7.1Hz，1.7Hz)，7.64(1H，s)。
Embodiment 132 4-[(3 '-methoxyl group-[1,1 '-biphenyl]-the 3-yl) methoxyl group] benzenpropanoic acid
With the method identical, by 4-[(3 '-methoxyl group-[1,1 '-biphenyl]-3-yl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 62%.
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.9Hz)，2.91(2H，t，J＝7.9Hz)，3.86(3H，s)，5.10(2H，s)，6.88-6.95(3H，m)，7.11-7.19(4H，m)，7.33-7.47(3H，m)，7.54(1H，dt，7.1Hz，1.7Hz)，7.64(1H，s)。
Embodiment 133 4-[(3 '-nitro-[1,1 '-biphenyl]-the 3-yl) methoxyl group] methyl phenylpropionate
With the method identical, by the 4-[(3-bromophenyl with embodiment 22) methoxyl group] methyl phenylpropionate and 3-nitrobenzophenone boric acid obtains the table title chemical compound.Yield 74%.
Oily.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.1Hz)，2.90(2H，t，J＝8.1Hz)，3.66(3H，s)，5.12(2H，s)，6.93(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.48-7.65(4H，m)，7.69(1H，s)，7.91-7.94(1H，m)，8.19-8.23(1H，m)，8.46(1H，t，J＝2.0Hz)。
Embodiment 134 4-[(3 '-nitro-[1,1 '-biphenyl]-the 3-yl) methoxyl group] benzenpropanoic acid
With the method identical, by 4-[(3 '-nitro-[1,1 '-biphenyl]-3-yl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 51%.
Fusing point 114-115 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.66(2H，t，J＝7.8Hz)，2.91(2H，t，J＝7.8Hz)，5.12(2H，s)，6.94(2H，d，J＝8.6Hz)，7.15(2H，d，J＝8.6Hz)，7.48-7.64(4H，m)，7.69(1H，s)，7.90-7.94(1H，m)，8.19-8.23(1H，m)，8.46(1H，t，J＝1.9Hz)。
Embodiment 135 4-[[3-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] phenyl] methoxyl group] methyl phenylpropionate
With the method identical,, 3-dihydro-1H-indenes-1-yl) oxygen base by 4-hydroxy phenylpropionic acid methyl ester and 3-[(2 with reference example 1] benzyl alcohol obtains the table title chemical compound.Yield 82%.
Oily.
1H NMR(CDCl 3)δ2.10-2.30(1H，m)，2.50-2.65(3H，m)，2.87-3.00(3H，m)，3.09-3.20(1H，m)，3.66(3H，s)，5.03(2H，s)，5.78(1H，dd，J＝6.6Hz，4.4 Hz)，6.88-6.98(3H，m)，7.02(1H，d，J＝7.6Hz)，7.09-7.13(3H，m)，7.19-7.35(4H，m)，7.42(1H，d，J＝7.3Hz)。
Embodiment 136 4-[[3-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] phenyl] methoxyl group] benzenpropanoic acid
With the method identical,, 3-dihydro-1H-indenes-1-yl) oxygen base by 4-[[3-[(2 with reference example 4] phenyl] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 55%.
Fusing point 119-121 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.15-2.26(1H，m)，2.50-2.59(1H，m)，2.65(2H，t，J＝8.1Hz)，2.90(2H，t，J＝8.1Hz)，2.88-2.97(1H，m)，3.09-3.19(1H，m)，5.03(2H，s)，5.78(1H，dd，J＝6.6 Hz，4.3Hz)，6.88-6.98(3H，m)，7.02(1H，d，J＝7.5Hz)，7.09-7.17(3H，m)，7.20-7.34(4H，m)，7.42(1H，d，J＝7.3Hz)。
Embodiment 137 4-[[3-((E)-2-phenyl vinyl) phenyl] methoxyl group] methyl phenylpropionate
The 4-[(3-bromophenyl) methoxyl group] methyl phenylpropionate (1.0g, 2.9mmol), styrene (0.45g, 4.3mmol), sodium bicarbonate (0.60g, 7.2mmol), tetrabutylammonium chloride (1.6g, 5.7mmol), be dissolved in N, in the dinethylformamide (25mL), after the argon displacement, add acid chloride (19mg, 0.086mmol).Reactant liquor was heated 18 hours down at 100 ℃ under ar gas environment.Behind the cooling reactant liquor, in reactant liquor, add water, use ethyl acetate extraction.The washing extracting solution, dry back concentrates.With the refining residue of silica gel column chromatography (ethyl acetate/hexane=15: 1), obtain white powder table title chemical compound (0.63g, yield 59%).
Fusing point 100-101 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.1Hz)，2.90(2H，t，J＝8.1Hz)，3.66(3H，s)，5.06(2H，s)，6.92(2H，d，J＝8.6Hz)，7.11-7.14(4H，m)，7.24-7.40(5H，m)，7.46-7.58(4H，m)。
Embodiment 138 4-[[3-((E)-2-phenyl vinyl) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[3-((E)-2-phenyl vinyl) phenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 64%.
Fusing point 155-156 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.59(2H，t，J＝7.4Hz)，2.90(2H，t，J＝7.4Hz)，5.06(2H，s)，6.92(2H，d，J＝8.6Hz)，7.13-7.16(4H，m)，7.24-7.40(5H，m)，7.46-7.58(4H，m)。
Embodiment 139 4-[(4-chloro-[1,1 '-biphenyl]-the 3-yl) methoxyl group] methyl phenylpropionate
With the method identical, by 4-[(5-bromo-2-chlorphenyl with embodiment 22) methoxyl group] methyl phenylpropionate and phenylboric acid obtain the table title chemical compound.Yield 89%.
Oily.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.66(3H，s)，5.19(2H，s)，6.95(2H，d，J＝8.7Hz)，7.14(2H，d，J＝8.7Hz)，7.30-7.57(7H，m)，7.79(1H，br s)。
Embodiment 140 4-[(4-chloro-[1,1 '-biphenyl]-the 3-yl) methoxyl group] benzenpropanoic acid
With the method identical, by 4-[(4-chloro-[1,1 '-biphenyl]-3-yl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 62%.
Fusing point 115-116 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝8.0Hz)，2.91(2H，t，J＝8.0Hz)，5.19(2H，s)，6.95(2H，d，J＝8.6Hz)，7.15(2H，d，J＝8.6Hz)，7.32-7.50(5H，m)，7.54-7.57(2H，m)，7.78(1H，br s)。
Embodiment 141 4-[[3-(2-phenylethyl) phenyl] methoxyl group] methyl phenylpropionate
4-[[3-((E)-2-phenyl vinyl) phenyl] methoxyl group] add platinum oxide (0.018g, 0.078mmol) in the methanol (15mL) of methyl phenylpropionate (0.35g, 0.95mmol) and oxolane (25mL) solution, mixture stirring at room 18 hours under hydrogen environment.Behind the elimination catalyst, concentrated filtrate.With the refining residue of silica gel column chromatography (ethyl acetate/hexane=15: 1), obtain table title chemical compound (0.21g, yield 58%).
Oily.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.1Hz)，2.90(2H，t，J＝8.1Hz)，2.93(4H，s)，3.67(3H，s)，5.00(2H，s)，6.90-6.95(2H，m)，7.10-7.30(11H，m)。
Embodiment 142 4-[[3-(2-phenylethyl) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[3-(2-phenylethyl) phenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 63%.
Fusing point 105-106 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝8.1Hz)，2.91(2H，t，J＝8.1Hz)，2.93(4H，s)，5.00(2H，s)，6.91(2H，d，J＝8.6Hz)，7.16-7.32(11H，m)。
Embodiment 143 4-([1,1 '-xenyl]-the 3-ylmethoxy)-3-chlorobenzene methyl propionate
With the method identical, by the 4-[(3-bromophenyl with embodiment 22) methoxyl group]-3-chlorobenzene methyl propionate and phenylboric acid obtain the table title chemical compound.Yield 44%.
Oily.
1H NMR(CDCl 3)δ2.59(2H，t，J＝7.8Hz)，2.87(2H，t，J＝7.8Hz)，3.66(3H，s)，5.19(2H，s)，6.91(1H，d，J＝8.4Hz)，7.02(1H，dd，J＝8.4Hz，2.1Hz)，7.24(1H，d，J＝2.1Hz)，7.33-7.38(1H，m)，7.42-7.49(4H，m)，7.54-7.62(3H，m)，7.68(1H，m)。
Embodiment 144 4-([1,1 '-xenyl]-the 3-ylmethoxy)-3-chlorobenzene propanoic acid
With the method identical, obtain the table title chemical compound by 4-([1,1 '-xenyl]-3-ylmethoxy)-3-chlorobenzene methyl propionate with reference example 4.Yield 54%.
Fusing point 77.0-77.5 ℃ (by diisopropyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.64(2H，t，J＝7.8Hz)，2.88(2H，t，J＝7.8Hz)，5.19(2H，s)，6.92(1H，d，J＝8.4Hz)，7.03(1H，dd，J＝8.4 Hz，2.1Hz)，7.25-7.26(1H，m)，7.32-7.38(1H，m)，7.42-7.48(4H，m)，7.53-7.62(3H，m)，7.68(1H，m)。
Embodiment 145 4-[(2 '-fluoro-[1,1 '-biphenyl]-the 3-yl) methoxyl group] methyl phenylpropionate
With the method identical, by the 4-[(3-bromophenyl with embodiment 22) methoxyl group] methyl phenylpropionate and 2-fluorophenyl boric acid table title chemical compound.Yield 83%.
Oily.
1HNMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.66(3H，s)，5.09(2H，s)，6.92(2H，d，J＝8.6Hz)，7.10-7.24(4H，m)，7.29-7.36(1H，m)，7.42-7.54(4H，m)，7.61(1H，s)。
Embodiment 146 4-[(2 '-fluoro-[1,1 '-biphenyl]-the 3-yl) methoxyl group] benzenpropanoic acid
With the method identical, by 4-[(2 '-fluoro-[1,1 '-biphenyl]-3-yl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 70%.
Fusing point 112-113 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.66(2H，t，J＝7.9Hz)，2.91(2H，t，J＝7.9Hz)，5.10(2H，s)，6.93(2H，d，J＝8.6Hz)，7.12-7.24(4H，m)，7.29-7.36(1H，m)，7.42-7.54(4H，m)，7.61(1H，s)。
Embodiment 147 4-([1,1 '-xenyl]-the 3-ylmethoxy)-2-methylbenzene methyl propionate
With the method identical, obtain the table title chemical compound by 4-hydroxy-2-methyl methyl phenylpropionate and [1,1 '-xenyl]-3-methanol with reference example 1.Yield 80%.
Oily.
1H NMR(CDCl 3)δ2.30(3H，s)，2.56(2H，t，J＝7.5Hz)，2.89(2H，t，J＝7.5Hz)，3.68(3H，s)，5.09(2H，s)，6.75-6.83(2H，m)，7.05(1H，d，J＝8.3Hz)，7.32-7.48(5H，m)，7.53-7.65(4H，m)。
Embodiment 148 4-([1,1 '-xenyl]-the 3-ylmethoxy)-2-methylbenzene propanoic acid
With the method identical, obtain the table title chemical compound by 4-([1,1 '-xenyl]-3-ylmethoxy)-2-methylbenzene methyl propionate with reference example 4.Yield 70%.
Fusing point 103.0-103.5 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.30(3H，s)，2.61(2H，t，J＝8.4Hz)，2.90(2H，t，J＝8.4Hz)，5.09(2H，s)，6.76-6.83(2H，m)，7.07(1H，d，J＝8.3Hz)，7.32-7.48(5H，m)，7.54-7.65(4H，m)。
Embodiment 149 4-[[2,3-dihydro-5-(4-phenyl butoxy)-1H-indenes-1-yl] the oxygen base] methyl phenylpropionate
With the method identical with reference example 1, by 4-hydroxy phenylpropionic acid methyl ester and 2,3-dihydro-5-(4-phenyl butoxy)-1H-indenes-1-alcohol obtains the table title chemical compound.Yield 49%.
Oily.
1H NMR(CDCl 3)δ1.75-1.83(4H，m)，2.16-2.27(1H，m)，2.46-2.71(5H，m)，2.81-2.93(3H，m)，3.06-3.16(1H，m)，3.68(3H，s)，3.95-3.99(2H，m)，5.66(1H，dd，J＝6.5Hz，3.5Hz)，6.75-6.80(2H，m)，6.89-6.93(1H，m)，7.10-7.21(5H，m)，7.26-7.31(4H，m)。
Embodiment 150 4-[[2,3-dihydro-5-(4-phenyl butoxy)-1H-indenes-1-yl] the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-5-(4-phenyl butoxy)-1H-indenes-1-yl by 4-[[2 with reference example 4] the oxygen base] methyl phenylpropionate obtains the table title chemical compound.Yield 70%.
Fusing point 89-90 ℃ (by diisopropyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ1.78-1.83(4H，m)，2.17-2.27(1H，m)，2.46-2.58(1H，m)，2.64-2.71(4H，m)，2.81-2.95(3H，m)，3.06-3.16(1H，m)，3.95-3.99(2H，m)，5.66(1H，dd，J＝6.5Hz，3.5Hz)，6.75-6.79(2H，m)，6.92(2H，d，J＝8.6Hz)，7.17-7.21(5H，m)，7.26-7.31(3H，m)。
Embodiment 151 2-methyl-4-[(3-Phenoxyphenyl) methoxyl group] methyl phenylpropionate
Method with identical with reference example 1 obtains the table title chemical compound by 4-hydroxy-2-methyl-methyl phenylpropionate and 3-phenoxy group benzylalcohol.Yield 76%.
Oily.
1H NMR(CDCl 3)δ2.29(3H，s)，2.55(2H，t，J＝8.4Hz)，2.88(2H，t，J＝8.4Hz)，3.68(3H，s)，4.99(2H，s)，6.70-6.77(2H，m)，6.93-7.17(7H，m)，7.30-7.36(3H，m)。
Embodiment 152 2-methyl-4-[(3-Phenoxyphenyl) methoxyl group] benzenpropanoic acid
With the method identical, by 2-methyl-4-[(3-Phenoxyphenyl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 72%.
Fusing point 82-83 ℃ (by diisopropyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.29(3H，s)，2.60(2H，t，J＝8.4Hz)，2.89(2H，t，J＝8.4Hz)，4.99(2H，s)，6.71-6.78(2H，m)，6.93-7.17(7H，m)，7.31-7.36(3H，m)。
Embodiment 153 3-chloro-4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] methyl phenylpropionate
With the method identical with reference example 1, by 3-chloro-4-hydroxy phenylpropionic acid methyl ester and 2,3-dihydro-1H-indenes-1-alcohol obtains the table title chemical compound.Yield 91%.
Oily.
1H NMR(CDCl 3)δ2.20-2.31(1H，m)，2.50-2.60(1H，m)，2.61(2H，t，J＝7.9Hz)，2.87-2.97(3H，m)，3.13-3.23(1H，m)，3.68(3H，s)，5.71(1H，dd，J＝4.9Hz，6.6Hz)，7.01-7.08(2H，m)，7.22-7.31(4H，m)，7.43(1H，d，J＝7.3Hz)。
Embodiment 154 3-chloro-4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-1H-indenes-1-yl) oxygen base by 3-chloro-4-[(2 with reference example 4] methyl phenylpropionate obtains the table title chemical compound.Yield 56%.
1H NMR(CDCl 3)δ2.20-2.31(1H，m)，2.50-2.61(1H，m)，2.67(2H，t，J＝7.7Hz)，2.86-2.99(3H，m)，3.12-3.22(1H，m)，5.71(1H，dd，J＝5.0Hz，6.5Hz)，7.01-7.09(2H，m)，7.20-7.31(4H，m)，7.43(1H，d，J＝7.3Hz)。
Embodiment 155 4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base]-2-methylbenzene methyl propionate
With the method identical with reference example 1, by 4-hydroxy-2-methyl methyl phenylpropionate and 2,3-dihydro-1H-indenes-1-alcohol obtains the table title chemical compound.Yield 65%.
Oily.
1H NMR(CDCl 3)δ2.10-2.30(1H，m)，2.31(3H，s)，2.50-2.65(3H，m)，2.75-3.00(3H，m)，3.05-3.20(1H，m)，3.69(3H，s)，5.72(1H，dd，J＝4.4Hz，6.6Hz)，6.78-6.81(2H，m)，7.07(1H，d，J＝8.0Hz)，7.21-7.33(3H，m)，7.42(1H，d，J＝7.2Hz)。
Embodiment 156 4-[(2,3-dihydro-1H-indenes-1-yl) the oxygen base]-2-methylbenzene propanoic acid
With the method identical,, 3-dihydro-1H-indenes-1-yl) oxygen base by 4-[(2 with reference example 4]-2-methylbenzene methyl propionate obtains the table title chemical compound.Yield 24%.
Fusing point 79-80 ℃ (by diisopropyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.14-2.25(1H，m)，2.32(3H，m)，2.50-2.66(3H，m)，2.86-2.97(3H，m)，3.09-3.19(1H，m)，5.73(1H，dd，J＝4.5Hz，6.6Hz)，6.79-6.82(2H，m)，7.09(1H，d，J＝7.9Hz)，7.21-7.31(3H，m)，7.42(1H，d，J＝7.2Hz)。
Embodiment 157 4-[[3-(2-phenyl ethoxy) phenyl] methoxyl group] methyl phenylpropionate
Method with identical with reference example 1 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 2-phenylethanol.Yield 58%.
Oily.
1H NMR(CDCl 3)δ2.59(2H，t，J＝7.1Hz)，2.89(2H，t，J＝7.5Hz)，3.09(2H，t，J＝7.1Hz)，3.66(3H，s)，4.18(2H，t，J＝7.1Hz)，4.99(2H，s)，6.83-6.91(3H，m)，6.97-6.99(2H，m)，7.10(2H，d，J＝8.6Hz)，7.21-7.35(6H，m)。
Embodiment 158 4-[[3-(2-phenyl ethoxy) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[3-(2-phenyl ethoxy) phenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 63%.
Fusing point 79-80 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.64(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.09(2H，t，J＝7.1Hz)，4.18(2H，t，J＝7.1Hz)，5.00(2H，s)，6.83-6.92(3H，m)，6.97-7.00(2H，m)，7.12(2H，d，J＝8.6Hz)，7.21-7.35(6H，m)。
Embodiment 159 4-[[2,3-dihydro-5-(2-phenyl ethoxy)-1H-indenes-1-yl] the oxygen base] methyl phenylpropionate
With the method identical with reference example 1, by 4-hydroxy phenylpropionic acid methyl ester and 2,3-dihydro-5-(2-phenyl ethoxy)-1H-indenes-1-alcohol obtains the table title chemical compound.Yield 65%.
Oily.
1H NMR(CDCl 3)δ2.16-2.26(1H，m)，2.46-2.64(3H，m)，2.78-2.93(3H，m)，3.05-3.15(3H，m)，3.67(3H，s)，4.18(2H，t，J＝6.9Hz)，5.66(1H，dd，J＝6.5Hz，3.6Hz)，6.72-6.84(2H，m)，6.95(2H，d，J＝8.6Hz)，7.12(2H，d，J＝8.6Hz)，7.20-7.35(6H，m)。
Embodiment 160 4-[[2,3-dihydro-5-(2-phenyl ethoxy)-1H-indenes-1-yl] the oxygen base] benzenpropanoic acid
With the method identical,, 3-dihydro-5-(2-phenyl ethoxy)-1H-indenes-1-yl by 4-[[2 with reference example 4] the oxygen base] methyl phenylpropionate obtains the table title chemical compound.Yield 52%.
Fusing point 96-97 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.17-2.27(1H，m)，2.46-2.57(1H，m)，2.67(2H，t，J＝8.0Hz)，2.81-2.95(3H，m)，3.05-3.15(3H，m)，4.18(2H，t，J＝7.1Hz)，5.66(1H，dd，J＝6.5Hz，3.6Hz)，6.77-6.81(2H，m)，6.92(2H，d，J＝8.3Hz)，7.14(2H，d，J＝8.6Hz)，7.21-7.35(6H，m)。
Embodiment 161 4-[[3-(3-phenyl propoxyl group) phenyl] methoxyl group] methyl phenylpropionate
Method with identical with reference example 1 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 3-phenyl propanol.Yield 58%.
Oily.
1H NMR(CDCl 3)δ2.05-2.15(2H，m)，2.60(2H，t，J＝8.1Hz)，2.81(2H，t，J＝7.9Hz)，2.89(2H，t，J＝8.1Hz)，3.67(3H，s)，3.97(2H，t，J＝6.2Hz)，5.00(2H，s)，6.82-6.92(3H，m)，6.97-7.00(2H，m)，7.11(2H，d，J＝8.6Hz)，7.17-7.32(6H，m)。
Embodiment 162 4-[[3-(3-phenyl propoxyl group) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[3-(2-phenyl propoxyl group) benzyl with reference example 4] the oxygen base] methyl phenylpropionate obtains the table title chemical compound.Yield 53%.
Fusing point 97-98 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.06-2.15(2H，m)，2.65(2H，t，J＝8.0Hz)，2.81(2H，t，J＝8.0Hz)，2.90(2H，t，J＝7.0Hz)，3.97(2H，t，J＝6.3Hz)，5.00(2H，s)，6.83-6.92(3H，m)，6.99(2H，d，J＝7.4Hz)，7.11-7.31(8H，m)。
Embodiment 163 4-[(2 '-methoxyl group-[1,1 '-biphenyl]-the 3-yl) methoxyl group] methyl phenylpropionate
Method with identical with embodiment 22 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 2-methoxybenzene ylboronic acid.Yield 65%.
Oily.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.89(2H，t，J＝8.0Hz)，3.66(3H，s)，3.79(3H，s)，6.92(2H，d，J＝8.5Hz)，6.97-7.05(2H，m)，7.11(2H，d，J＝8.5Hz)，7.30-7.50(5H，m)，7.58(1H，s)。
Embodiment 164 4-[(2 '-methoxyl group-[1,1 '-biphenyl]-the 3-yl) methoxyl group] benzenpropanoic acid
With the method identical, by 4-[(2 '-methoxyl group-[1,1 '-biphenyl]-3-yl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 69%.
Fusing point 128-129 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.9Hz)，2.91(2H，t，J＝7.9Hz)，3.79(3H，s)，5.08(2H，s)，6.90-7.05(4H，m)，7.13(2H，d，J＝8.6Hz)，7.29-7.50(5H，m)，7.58(1H，s)。
Embodiment 165 4-[(2 '-methyl-[1,1 '-biphenyl]-the 3-yl) methoxyl group] methyl phenylpropionate
Method with identical with embodiment 22 obtains the table title chemical compound by 4-hydroxy phenylpropionic acid methyl ester and 2-aminomethyl phenyl boric acid.Yield 79%.
Oily.
1H NMR(CDCl 3)δ2.25(3H，s)，2.60(2H，t，J＝8.2Hz)，2.90(2H，t，J＝8.2Hz)，3.66(3H，s)，5.08(2H，s)，6.91(2H，d，J＝8.6Hz)，7.12(2H，d，J＝8.6Hz)，7.22-7.30(5H，m)，7.39-7.46(3H，m)。
Embodiment 166 4-[(2 '-methyl-[1,1 '-biphenyl]-the 3-yl) methoxyl group] benzenpropanoic acid
With the method identical, by 4-[(2 '-methyl-[1,1 '-biphenyl]-3-yl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 52%.
Fusing point 135-136 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.25(3H，s)，2.65(2H，t，J＝7.9Hz)，2.91(2H，t，J＝7.9Hz)，5.09(2H，s)，6.92(2H，d，J＝8.5Hz)，7.13(2H，d，J＝8.5Hz)，7.23-7.31(5H，m)，7.39-7.45(3H，m)。
Embodiment 167 4-[(2-chloro-[1,1 '-biphenyl]-the 5-yl) methoxyl group] methyl phenylpropionate
With the method identical, by 4-[(3-bromo-4-chlorphenyl with embodiment 22) methoxyl group] methyl phenylpropionate and phenylboric acid obtain the table title chemical compound.Yield 40%.
Oily.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.1Hz)，2.90(2H，t，J＝8.1Hz)，3.66(3H，s)，5.03(2H，s)，6.89(2H，d，J＝8.5Hz)，7.11(2H，d，J＝8.5Hz)，7.32-7.49(8H，m)。
Embodiment 168 4-[(2-chloro-[1,1 '-biphenyl]-the 5-yl) methoxyl group] benzenpropanoic acid
With the method identical, by 4-[(2-chloro-[1,1 '-biphenyl]-5-yl with reference example 4) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 20%.
Fusing point 116-117 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝7.9Hz)，2.91(2H，t，J＝7.9Hz)，5.04(2H，s)，6.90(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.32-7.49(8H，m)。
Embodiment 169 4-([1,1 '-xenyl]-the 3-ylmethoxy)-2-methoxybenzene ethyl propionate
With the method identical, obtain the table title chemical compound by 4-hydroxyl-2-methoxybenzene ethyl propionate and [1,1 '-xenyl]-3-methanol with reference example 1.Yield 86%.
Oily.
1H NMR(CDCl 3)δ1.23(3H，t，J＝7.2Hz)，2.56(2H，t，J＝8.1Hz)，2.87(2H，t，J＝8.1Hz)，3.79(3H，s)，4.12(2H，q，J＝7.2Hz)，5.09(2H，s)，6.48-6.54(2H，m)，7.05(1H，d，J＝8.2Hz)，7.30-7.49(5H，m)，7.54-7.66(4H，m)。
Embodiment 170 4-([1,1 '-xenyl]-the 3-ylmethoxy)-2-methoxybenzene propanoic acid
With the method identical, obtain the table title chemical compound by 4-([1,1 '-xenyl]-3-ylmethoxy)-2-methoxybenzene ethyl propionate with reference example 4.Yield 71%.
Fusing point 71-73 ℃ (by diisopropyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.63(2H，t，J＝7.9Hz)，2.88(2H，t，J＝7.9Hz)，3.79(3H，s)，5.09(2H，s)，6.49-6.55(2H，m)，7.06(1H，d，J＝8.2Hz)，7.33-7.49(5H，m)，7.55-7.66(4H，m)。
Embodiment 171 4-[[3-[[methyl (4-phenyl-2-thiazolyl) amino] methyl] phenyl] methoxyl group] methyl phenylpropionate
With the method identical, by 4-hydroxy phenylpropionic acid methyl ester and 3-[[methyl (4-phenyl-1,3-thiazoles-2-yl) amino with reference example 1] methyl] benzyl alcohol obtains the table title chemical compound.Yield 85%.
Oily.
1H NMR(CDCl 3)δ2.59(2H，t，J＝8.1Hz)，2.89(2H，t，J＝8.1Hz)，3.07(3H，s)，3.66(3H，s)，4.79(2H，s)，5.02(2H，s)，6.73(1H，s)，6.88(2H，d，J＝8.7Hz)，7.10(2H，d，J＝8.7Hz)，7.24-7.40(7H，m)，7.85-7.88(2H，m)。
Embodiment 172 4-[[3-[[methyl (4-phenyl-2-thiazolyl) amino] methyl] phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[3-[[methyl (4-phenyl-2-thiazolyl) amino with reference example 4] methyl] phenyl] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 65%.
Fusing point 107.0-107.5 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.63(2H，t，J＝7.8Hz)，2.89(2H，t，J＝7.8Hz)，3.06(3H，s)，4.78(2H，s)，5.03(2H，s)，6.72(1H，s)，6.88(2H，d，J＝8.6Hz)，7.10(2H，d，J＝8.6Hz)，7.24-7.39，(7H，m)，7.88-7.84(2H，m)。
Embodiment 173 2-methoxyl group-4-[(3-Phenoxyphenyl) methoxyl group] the benzenpropanoic acid ethyl ester
Method with identical with reference example 1 obtains the table title chemical compound by 2-methoxyl group-4-hydroxy-benzenepropanoic acid ethylester and 3-phenoxy benzenemethanol.Yield 75%.
Oily.
1H NMR(CDCl 3)δ1.23(3H，t，J＝7.1Hz)，2.55(2H，t，J＝8.1Hz)，2.86(2H，t，J＝8.1Hz)，3.78(3H，s)，4.12(2H，q，J＝7.1Hz)，5.00(2H，s)，6.44(1H，dd，J＝8.2Hz，2.4Hz)，6.49(1H，d，J＝2.4Hz)，6.95(1H，dd，J＝7.8Hz，1.8Hz)，6.99-7.04(3H，m)，7.09-7.17(3H，m)，7.30-7.34(3H，m)。
Embodiment 174 2-methoxyl group-4-[(3-Phenoxyphenyl) methoxyl group] benzenpropanoic acid
With the method identical, by 2-methoxyl group-4-[(3-Phenoxyphenyl with reference example 4) methoxyl group] the benzenpropanoic acid ethyl ester obtains the table title chemical compound.Yield 65%.
Fusing point 77.0-77.5 ℃ (by diisopropyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.62(2H，t，J＝8.0Hz)，2.87(2H，t，J＝8.0Hz)，3.77(3H，s)，5.00(2H，s)，6.44(1H，dd，J＝5.9Hz，2.4Hz)，6.50(1H，d，J＝2.4Hz)，6.93-7.17(7H，m)，7.31-7.36(3H，m)。
Embodiment 175 4-([1, the 11-xenyl]-3-ylmethoxy)-2-chlorobenzene methyl propionate
With the method identical, obtain the table title chemical compound by 2-chloro-4-hydroxy phenylpropionic acid methyl ester and [1,1 '-xenyl]-3-methanol with reference example 1.Yield 85%.
Oily.
1H NMR(CDCl 3)δ2.62(2H，t，J＝8.0Hz)，3.00(2H，t，J＝8.0Hz)，3.68(3H，s)，5.09(2H，s)，6.84(1H，dd，J＝8.5Hz，2.6Hz)，7.02(1H，d，J＝2.6Hz)，7.16(1H，d，J＝8.5Hz)，7.33-7.49(5H，m)，7.55-7.64(4H，m)。
Embodiment 176 4-([1,1 '-xenyl]-the 3-ylmethoxy)-2-chlorobenzene propanoic acid
With the method identical, obtain the table title chemical compound by 4-([1,1 '-xenyl]-3-ylmethoxy)-2-chlorobenzene methyl propionate with reference example 4.Yield 46%.
Fusing point 84.0-84.5 ℃ (by diisopropyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ2.67(2H，t，J＝7.8Hz)，3.01(2H，t，J＝7.8Hz)，5.09(2H，s)，6.80-6.86(1H，m)，7.03(1H，d，J＝2.1Hz)，7.17(1H，d，J＝8.5Hz)，7.36-7.46(5H，m)，7.55-7.64(4H，m)。
Embodiment 177 4-[[2 '-(1-methyl ethoxy)-[1,1 '-xenyl]-the 3-yl] methoxyl group] methyl phenylpropionate
Method with identical with embodiment 22 obtains the table title chemical compound by 2-(1-methyl ethoxy) phenylboric acid.Yield 85%.
Oily.
1H NMR(CDCl 3)δ1.22-1.28(6H，m)，2.60(2H，t，J＝8.1Hz)，2.89(2H，t，J＝8.1Hz)，3.60(3H，s)，4.40-4.48(1H，m)，5.07(2H，s)，6.92(2H，d，J＝8.6Hz)，6.97-7.03(2H，m)，7.11(2H，d，J＝8.6Hz)，7.26-7.43(4H，m)，7.51(1H，d，J＝7.2Hz)，7.64(1H，s)。
Embodiment 178 4-[[2 '-(1-methyl ethoxy)-[1,1 '-xenyl]-the 3-yl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[2 '-(1-methyl ethoxy)-[1,1 '-xenyl]-3-yl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 49%.
Fusing point 111.0-111.5 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ1.23(6H，d，J＝6.0Hz)，2.65(2H，t，J＝8.1Hz)，2.91(2H，t，J＝8.1Hz)，4.40-4.48(1H，m)，5.08(2H，s)，6.91-7.04(4H，m)，7.13(2H，d，J＝8.6Hz)，7.25-7.43(4H，m)，7.51(1H，dt，J＝7.1Hz，1.7Hz)，7.64(1H，s)。
Embodiment 179 4-[[2 '-(trifluoromethyl)-[1,1 '-xenyl]-the 3-yl] methoxyl group] methyl phenylpropionate
Method with identical with embodiment 22 obtains the table title chemical compound by 2-(trifluoromethyl) phenylboric acid.Yield 75%.
Oily.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.1Hz)，2.89(2H，t，J＝8.1Hz)，3.66(3H，s)，5.08(2H，s)，6.90(2H，d，J＝8.6Hz)，7.11(2H，d，J＝8.6Hz)，7.27-7.59(7H，m)，7.75(1H，d，J＝7.6Hz)。
Embodiment 180 4-[[2 '-(trifluoromethyl)-[1,1 '-xenyl]-the 3-yl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[2 '-(trifluoromethyl)-[1,1 '-xenyl]-3-yl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 48%.
Fusing point 143-144 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，5.08(2H，s)，6.91(2H，d，J＝8.6Hz)，7.13(2H，d，J＝8.6Hz)，7.26-7.58(7H，m)，7.75(1H，d，J＝7.6Hz)。
Embodiment 181 4-[[2 '-ethyl-[1,1 '-xenyl]-the 3-yl] methoxyl group] methyl phenylpropionate
Method with identical with embodiment 22 obtains the table title chemical compound by 2-ethylphenyl boric acid.Yield 80%.
Oily.
1H NMR(CDCl 3)δ1.08(3H，t，J＝7.5Hz)，2.53-2.62(4H，m)，2.89(2H，t，J＝8.0Hz)，3.66(3H，s)，5.08(2H，s)，6.91(2H，d，J＝8.5Hz)，7.11(2H，d，J＝8.5Hz)，7.21-7.31(5H，m)，7.37-7.42(3H，m)。
Embodiment 182 4-[[2 '-ethyl-[1,1 '-xenyl]-the 3-yl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[2 '-ethyl-[1,1 '-xenyl]-3-yl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 51%.
Fusing point 132.0-132.5 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ1.07(3H，t，J＝7.5Hz)，2.57(2H，q，J＝7.5Hz)，2.65(2H，t，J＝7.9Hz)，2.90(2H，t，J＝7.9Hz)，5.09(2H，s)，6.91(2H，d，J＝8.6Hz)，7.12(2H，d，J＝8.6Hz)，7.18-7.32(5H，m)，7.37-7.45(3H，m)。
Embodiment 183 4-[(2 ', 3 '-dimethyl-[1,1 '-biphenyl]-the 3-yl) methoxyl group] methyl phenylpropionate
With the method identical with embodiment 22, by 2,3-dimethyl benzene ylboronic acid obtains the table title chemical compound.Yield 93%.
Oily.
1H NMR(CDCl 3)δ2.13(3H，s)，2.34(3H，s)，2.60(2H，t，J＝8.0Hz)，2.89(2H，t，J＝8.0Hz)，3.66(3H，s)，5.08(2H，s)，6.90-6.92(2H，m)，7.09-7.16(5H，m)，7.25-7.26(1H，m)，7.36-7.42(3H，m)。
Embodiment 184 4-[(2 ', 3 '-dimethyl-[1,1 '-biphenyl]-the 3-yl) methoxyl group] benzenpropanoic acid
With the method identical with reference example 4, by 4-[(2 ', 3 '-dimethyl-[1,1 '-biphenyl]-3-yl) methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 47%.
Fusing point 146-147 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.13(3H，s)，2.33(3H，s)，2.65(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，5.08(2H，s)，6.90-6.93(2H，m)，7.09-7.16(5H，m)，7.24-7.27(1H，m)，7.36-7.42(3H，m)。
Embodiment 185 4-[[4-[[(4-phenyl-2-thiazolyl) third amino] methyl] phenyl] methoxyl group] methyl phenylpropionate
With the method identical, by 4-hydroxy phenylpropionic acid methyl ester and 4-[[(4-phenyl-2-thiazolyl with reference example 1) third amino] methyl] benzyl alcohol obtains the table title chemical compound.Yield 90%.
Oily.
1H NMR(CDCl 3)δ0.93(3H，t，J＝7.4Hz)，1.65-1.75(2H，m)，2.59(2H，t，J＝8.0Hz)，2.89(2H，t，J＝8.0Hz)，3.40(2H，t，J＝7.7Hz)，3.66(3H，s)，4.79(2H，s)，5.01(2H，s)，6.70(1H，s)，6.89(2H，d，J＝8.6Hz)，7.11(2H，d，J＝8.6Hz)，7.24-7.28(1H，m)，7.34-7.40(6H，m)，7.84-7.87(2H，m)。
Embodiment 186 4-[[4-[[(4-phenyl-2-thiazolyl) third amino] methyl] phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[4-[[(4-phenyl-2-thiazolyl with reference example 4) third amino] methyl] phenyl] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 50%.
Fusing point 110-111 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ0.93(3H，t，J＝7.4Hz)，1.65-1.77(2H，m)，2.64(2H，t，J＝7.3Hz)，2.90(2H，t，J＝7.3Hz)，3.40(2H，t，J＝9.2Hz)，4.79(2H，s)，5.01(2H，s)，6.70(1H，s)，6.89(2H，d，J＝8.4Hz)，7.12(2H，d，J＝8.4Hz)，7.24-7.37(7H，m)，7.84-7.87(2H，m)。
Embodiment 187 4-[[4-[[(4-phenyl-2-thiazolyl) sulfenyl] methyl] phenyl] methoxyl group] methyl phenylpropionate
With the method identical, by 4-hydroxy phenylpropionic acid methyl ester and 4-[[(4-phenyl-2-thiazolyl with reference example 1) sulfenyl] methyl] benzyl alcohol obtains the table title chemical compound.Yield 30%.
Oily.
1H NMR(CDCl 3)δ2.59(2H，t，J＝8.1Hz)，2.89(2H，t，J＝8.1Hz)，3.66(3H，s)，4.52(2H，s)，5.01(2H，s)，6.88(2H，d，J＝8.6Hz)，7.11(2H，d，J＝8.6Hz)，7.31-7.46(8H，m)，7.89-7.92(2H，m)。
Embodiment 188 4-[[4-[[(4-phenyl-2-thiazolyl) sulfenyl] methyl] phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[4-[[(4-phenyl-2-thiazolyl with reference example 4) sulfenyl] methyl] phenyl] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 38%.
Fusing point 156.0-156.5 ℃ (by oxolane-hexane recrystallize).
1H NMR(DMSO-d 6)δ2.38(2H，t，J＝7.7Hz)，2.72(2H，t，J＝7.7Hz)，4.56(2H，s)，5.02(2H，s)，6.87(2H，d，J＝8.5Hz)，7.11(2H，d，J＝8.5Hz)，7.33-7.49(7H，m)，7.94(2H，d，J＝7.3Hz)，8.02(1H，s)。
Embodiment 189 4-[[3-(1-naphthyl) phenyl] methoxyl group] methyl phenylpropionate
Method with identical with embodiment 22 obtains the table title chemical compound by 1-naphthyl boric acid.Yield 93%.Oily.
1H NMR(CDCl 3)δ2.60(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.66(3H，s)，5.14(2H，s)，6.95(2H，t，J＝8.6Hz)，7.13(2H，t，J＝8.6Hz)，7.43-7.54(4H，m)，7.68(1H，dt，J＝7.5Hz，1.5Hz)，7.75(1H，dd，J＝8.5Hz，1.8Hz)，7.78(1H，m)，7.85-7.93(3H，m)，8.05(1H，m)。
Embodiment 190 4-[[3-(1-naphthyl) phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[3-(1-naphthyl) phenyl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 93%.
Fusing point 134-135 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝8.0Hz)，2.91(2H，t，J＝8.0Hz)，5.13(2H，s)，6.95(2H，t，J＝8.6Hz)，7.14(2H，t，J＝8.6Hz)，7.42-7.54(4H，m)，7.66-7.78(3H，m)，7.84-7.93(3H，m)，8.05(1H，m)。
Embodiment 191 4-[[2 '-(1-Methylethyl)-[1,1 '-xenyl]-the 3-yl] methoxyl group] methyl phenylpropionate
Method with identical with reference example 61 obtains the table title chemical compound by 2-iodine isopropylbenzene.Yield 12%.
Oily.
1H NMR(CDCl 3)δ1.13(6H，d，J＝6.9Hz)，2.59(2H，t，J＝7.4Hz)，2.89(2H，t，J＝7.4Hz)，2.97-3.06(1H，m)，3.66(3H，s)，5.09(2H，s)，6.89-6.92(2H，m)，7.10-7.26(5H，m)，7.35-7.42(5H，m)。
Embodiment 192 4-[[2 '-(1-Methylethyl)-[1,1 '-xenyl]-the 3-yl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[2 '-(1-Methylethyl)-[1,1 '-xenyl]-3-yl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 27%.
Fusing point 120-121 ℃ (by diethyl ether-hexane recrystallize).
1H NMR(CDCl 3)δ1.13(6H，d，J＝6.9Hz)，2.65(2H，t，J＝8.0Hz)，2.91(2H，t，J＝8.0Hz)，2.97-3.06(1H，m)，5.09(2H，s)，6.91(2H，d，J＝8.6Hz)，7.11-7.26(5H，m)，7.31-7.45(5H，m)。
Embodiment 193 4-[[4-[[methyl (5-methyl-4-phenyl-2-thiazolyl) amino] methyl] phenyl] methoxyl group] methyl phenylpropionate
With the method identical, by 4-hydroxy phenylpropionic acid methyl ester and 4-[[methyl (5-methyl-4-phenyl-2-thiazolyl) amino with reference example 1] methyl] benzyl alcohol obtains the table title chemical compound.Yield 86%.
Oily.
1H NMR(CDCl 3)δ2.42(3H，s)，2.59(2H，t，J＝8.0Hz)，2.89(2H，t，J＝8.0Hz)，3.02(3H，s)，3.66(3H，s)，4.69(2H，s)，5.02(2H，s)，6.89(2H，d，J＝8.6Hz)，7.11(2H，d，J＝8.6Hz)，7.25-7.41(7H，m)，7.63-7.66(2H，m)。
Embodiment 194 4-[[4-[[methyl (5-methyl-4-phenyl-2-thiazolyl) amino] methyl] phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[4-[[methyl (5-methyl-4-phenyl-2-thiazolyl) amino with reference example 4] methyl] phenyl] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 52%.
Fusing point 113-114 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.41(3H，s)，2.63(2H，t，J＝7.9Hz)，2.89(2H，t，J＝7.9Hz)，3.02(3H，s)，4.68(2H，s)，5.01(2H，s)，6.89(2H，d，J＝8.6Hz)，7.12(2H，d，J＝8.6Hz)，7.25-7.41(7H，m)，7.63-7.66(2H，m)。
Embodiment 195 4-[[4-[(methylbenzene amino) methyl] phenyl] methoxyl group] methyl phenylpropionate
(57mg, 0.53mmol) is dissolved in N methylphenylamine, in the dinethylformamide (5mL), at ice-cold 60% sodium hydride (21mg, 0.53mmol) that adds down.The reactant liquor stirring after 30 minutes, is added 4-[[4-(bromomethyl) phenyl] methoxyl group] methyl phenylpropionate (0.15g, 0.41mmol).After reactant liquor at room temperature stirred 3 hours, in reactant liquor, add water, use ethyl acetate extraction.The washing extracting solution, dry back concentrates.With the refining residue of silica gel column chromatography (ethyl acetate/hexane=18: 1), obtain yellow powder shape table title chemical compound (74mg, yield 45%).
1H NMR(CDCl 3)δ2.59(2H，t，J＝8.1Hz)，2.89(2H，t，J＝8.1Hz)，3.02(3H，s)，3.66(3H，s)，4.54(2H，s)，5.00(2H，s)，6.69-6.76(2H，m)，6.89(2H，d，J＝8.6Hz)，7.11(2H，d，J＝8.6Hz)，7.20-7.26(5H，m)，7.37(2H，d，J＝8.1Hz)。
Embodiment 196 4-[[4-[(methylbenzene amino) methyl] phenyl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[4-[(methylbenzene amino with reference example 4) methyl] phenyl] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 45%.
Fusing point 122-124 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.65(2H，t，J＝8.0Hz)，2.90(2H，t，J＝8.0Hz)，3.01(3H，s)，4.53(2H，s)，5.00(2H，s)，6.69-6.76(3H，m)，6.90(2H，d，J＝8.6Hz)，7.12(2H，d，J＝8.6Hz)，7.18-7.26(4H，m)，7.37(2H，d，J＝8.1Hz)。
Embodiment 197 4-[[3 '-(methylol)-[1,1 '-xenyl]-the 3-yl] methoxyl group] methyl phenylpropionate
With 4-[[3 '-formoxyl-[1; 1 '-xenyl]-the 3-yl] methoxyl group] after the methanol (5mL) of methyl phenylpropionate (0.80g, 2.1mmol) and oxolane (2mL) solution are ice-cold; add sodium borohydride (81mg, 2.1mmol), mixture was stirred 30 minutes down ice-cold.Reactant liquor is added in the 0.2 equivalent hydrochloric acid (11mL), use ethyl acetate extraction.Concentrating under reduced pressure behind the washing extracting solution obtains table title chemical compound 0.80g (quantitative).Oily.
1H NMR(CDCl 3)δ1.81(1H，br s)，2.60(2H，t，J＝7.5Hz)，2.90(2H，t，J＝7.5Hz)，3.66(3H，s)，4.77(2H，d，J＝4.6Hz)，5.10(2H，s)，6.92(2H，d，J＝8.5Hz)，7.12(2H，d，J＝8.5Hz)，7.34-7.48(4H，m)，7.52-7.66(4H，m)。
Embodiment 198 4-[[3 '-(methylol)-[1,1 '-xenyl]-the 3-yl] methoxyl group] benzenpropanoic acid
With the method identical, by 4-[[3 '-(methylol)-[1,1 '-xenyl]-3-yl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.Yield 88%.
Fusing point 99-100 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.64(2H，t，J＝7.6Hz)，2.90(2H，t，J＝7.6Hz)，4.76(2H，s)，5.10(2H，s)，6.92(2H，d，J＝8.5Hz)，7.13(2H，d，J＝8.5Hz)，7.33-7.47(4H，m)，7.51-7.58(3H，m)，7.64(1H，s)。
Embodiment 199 4-[[3 '-[[(3-carboxyl-1-oxygen propyl group) amino] methyl]-[1,1 '-xenyl]-the 3-yl] methoxyl group] methyl phenylpropionate
With the method identical with reference example 1, by 4-[[3 '-(hydroxyl methoxyl group)-[1,1 '-xenyl]-3-yl] methoxyl group] methyl phenylpropionate and 2, the 5-pyrroledione obtains 4-[[3 '-[(2,5-dioxy base-1-pyrrolidinyl) methyl]-[1,1 '-xenyl]-the 3-yl] methoxyl group] methyl phenylpropionate.In addition, use the method identical, by 4-[[3 '-[(2,5-dioxy base-1-pyrrole radicals) methyl]-[1,1 '-xenyl]-3-yl with reference example 4] methoxyl group] methyl phenylpropionate obtains the table title chemical compound.From 4-[[3 '-methylol-[1,1 '-xenyl]-3-yl] methoxyl group] yield that obtains of methyl phenylpropionate is 62%.
Fusing point 185-188 ℃ (by the ethyl acetate recrystallize).
1H NMR(DMSO-d 6)δ2.41-2.51(6H，m)，2.75(2H，t，J＝7.5Hz)，4.34(2H，d，J＝5.8Hz)，5.14(2H，s)，6.94(2H，d，J＝8.5Hz)，7.14(2H，d，J＝8.5Hz)，7.26(1H，d，J＝7.5Hz)，7.38-7.62(6H，m)，7.72(1H，s)，8.41(1H，t，J＝5.8Hz)，12.06(2H，br s)。
Embodiment 200 3 '-[[4-[2-(methoxycarbonyl) ethyl] phenoxy group] methyl]-[1,1 '-xenyl]-the 3-carboxylic acid
At 4-[(3 '-formoxyl-[1; 1 '-biphenyl]-the 3-yl) methoxyl group] add sulfamic acid (0.15g, 1.3mmol) in the oxolane (5mL) of methyl phenylpropionate (0.48g, 1.3mmol) and water (2mL) solution; in addition, water (1.5mL) solution that adds sodium chlorite (0.17g, 1.5mmol).Mixture at room temperature stirred add water after 15 hours.Use ethyl acetate extraction.Behind the washing extracting solution, concentrating under reduced pressure obtains table title chemical compound 0.50g (quantitative).
Fusing point 180-185 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(CDCl 3)δ2.60(2H，t，J＝7.5Hz)，2.90(2H，t，J＝7.5Hz)，3.66(3H，s)，5.10(2H，s)，6.93(2H，d，J＝8.5Hz)，7.12(2H，d，J＝8.5Hz)，7.42-7.54(3H，m)，7.59(1H，d，J＝7.0Hz)，7.69(1H，s)，7.79(1H，d，J＝7.8Hz)，8.04(1H，d，J＝7.8Hz)，8.32(1H，s)。
Embodiment 201 3 '-[[4-(2-carboxyethyl) phenoxy group] methyl]-[1,1 '-xenyl]-the 3-carboxylic acid
With the method identical with reference example 4, by 3 '-[[4-[2-(methoxycarbonyl) ethyl] phenoxy group] methyl]-[1,1 '-xenyl]-3-carboxylic acid obtains the table title chemical compound.Yield 75%.
Fusing point 178-181 ℃ (by ethyl acetate-hexane recrystallize).
1H NMR(DMSO-d 6)δ2.50(2H，t，J＝7.7Hz)，2.75(2H，t，J＝7.7Hz)，5.17(2H，s)，6.95(2H，d，J＝8.5Hz)，7.14(2H，d，J＝8.5Hz)，7.46-7.54(2H，m)，7.58-7.68(2H，m)，7.77(1H，s)，7.92-8.00(2H，m)，8.20(1H，s)，12.63(2H，br s)。
The setting of the screening technique of embodiment 202 GPR40 agonist and GPR40 antagonist and the benchmark of selecting the agonist candidate
(1) is changed to the setting of the screening technique of the GPR40 agonist of index and GPR40 antagonist with intracellular calcium concentration
In order to set the system of the exploration that is used to carry out GPR40 agonist and GPR40 antagonist, use chemical compound of the present invention, set detection system.
The Chinese hamster ovary celI strain (CHO-hGPR40 No.104) of the expressing human GPR40 that uses the people GPR40 expression vector made at reference example 1, make by known method own is diluted, make it to contain 3 * 10 4The cell of individual/100 μ l is after 100 μ l are injected in the every hole of Black walled 96-well plate (Costar) respectively, at CO 2Cultivation-night in the incubator.Use FLIPR[molecular device (Molecular Device)] measure the change of intracellular calcium concentration.Method is as described below.
Fluo-3AM (DOJIN) 50 μ g are dissolved among the 21 μ l DMSO (DOJIN), after adding 20%pluronic acid (Molecular Probes) mixing of equivalent again, the detection buffer that adds the 10.6ml that contains 105 μ l hyclones [adds (DOJIN) 20ml of 1M HEPES (pH7.4) in HBSS (Invitrogen), after being dissolved in probenecid (Sigma) 710mg among the 1N NaOH 5ml, add above-mentioned HBSS/HEPES solution 5ml again, add the solution 10ml mixed and modulate.] in, modulated fluorochrome solution.Remove the culture medium of Tissue Culture Plate, after horse back injects 100 μ l respectively with the every hole of fluorochrome solution, at CO 2In the incubator, 37 ℃ cultivated 1 hour, make fluorochrome enter cell.Cell after the cultivation is cleaned with above-mentioned detection buffer.To make an addition to diluted chemical compound of the present invention in the cell to each concentration with detecting buffer, inject culture plate respectively.The 12 μ M gamma-Linolenic acid solution (ultimate density during reaction is 3 μ M) of antagonist being measured usefulness inject culture plate respectively, set FLIPR simultaneously.After the preceding disposal more than having implemented, measure the change of having added the intracellular calcium concentration behind the The compounds of this invention with FLIPR, effect is studied to agonist, then adds gamma-Linolenic acid, and antagonism is studied.Because chemical compound of the present invention is an agonist,, but when interpolation only has the chemical compound of antagonism, can observe the gamma-Linolenic acid reactive activity that inhibition was added afterwards so in the experiment of having used The compounds of this invention, the evaluation of antagonist is false.According to having used the reaction beginning after 30 seconds or the consumption response curve that changes of the fluorescence intensity level after 40 seconds, calculated EC 50Value.
(2) result who detects according to FLIPR selects the benchmark of agonist candidate.
What be used to select the agonist candidate is verified the body chemical compound, use in advance DMSO (Wako) with its concentration dilution to 10mM, use with above-mentioned detection buffer dilution back during mensuration.Then, be verified the body chemical compound and use method same as described above with these, expressed Chinese hamster ovary celI strain (CHO-hGPR40 No.104), the end user's histamine H1-receptor expression vector of the people GPR40 that makes by known method own for the people GPR40 expression vector that uses reference example 1 made and expressed the Chinese hamster ovary celI strain (CHO-H1) of people's histamine H1-receptor of making by known method own and the Chinese hamster ovary celI strain of immitation (Mock), measured fluorescence intensity level after 30 seconds or 40 seconds in the reaction beginning.And, calculate fluorescence intensity for the CHO-hGPR40 of 30 μ M gamma-Linolenic acids and be 100% o'clock relative value, this value is more than 50 or 100% with respect to CHO-hGPR40, and the two satisfies the Chinese hamster ovary celI strain of people's histamine H1-receptor and immitation (Mock) and to be verified the body chemical compound below 25%, as people GPR40 specific agonist candidate.
Formulation example 1
(1) the chemical compound 10.0g that obtains by embodiment 1
(2) lactose 60.0g
(3) corn starch 35.0g
(4) gelatin 3.0g
(5) magnesium stearate 2.0g
Chemical compound 10.0g that embodiment 1 is obtained and the mixture of lactose 60.0g and corn starch 35.0g, with 10 weight % aqueous gelatin solution 30mL (gelatin is 3.0g), after the sieve by the 1mm mesh carried out granulating, 40 ℃ dry down after sieve.Resulting granules is mixed, compressed with magnesium stearate 2.0g.With resulting center tablet, carry out sugar-coat with the aqueous suspension of sucrose, titanium dioxide, Talcum and arabic gum and coat.After the tablet that sugar-coat coats is used the Cera Flava glazing, obtained 1000 coating tablet.
Formulation example 2
(1) the chemical compound 10.0g that obtains by embodiment 1
(2) lactose 70.0g
(3) corn starch 50.0g
(4) soluble starch 7.0g
(5) magnesium stearate 3.0g
Chemical compound 10.0g that will obtain by embodiment 1 and magnesium stearate 3.0g with soluble starch aqueous solution 70mL (soluble starch is 7.0g) granulating after, drying, mix with lactose 70.0g and corn starch 50.0g.Compress chemical compound and obtained 1000 tablet.
Experimental example 1 is for reactive affirmation of the fatty acid of the GPR40 that is derived from the people
The CHO-K1 cell strain, short of special record then is to cultivate with Ham ' the s F-12 culture medium (Invitrogen) that contains 10% hyclone (Invitrogen).In the previous day of carrying out transfection, every 10cm 2Inoculation 4.5 * 10 5Individual cell is being adjusted to 5%CO 2The CO of concentration 2Cultivate more than 15 hours down at 37 ℃ in the incubator.With regard to transfection, use lipofectamine [Lipofectamine (Invitrogen)], be that benchmark is operated with the reagent adding method.When incubator uses the 6-well culture plate, following carrying out.At first, prepare 2 1.5ml and hold pipe, to wherein injecting Opti-MEM-I culture medium (Invitrogen) 100 μ l respectively.Then, after wherein adding expression vector 1 μ g in 1 arm, add lipofectamine (Lipofectamine) 6 μ l in another arm, both mix, and room temperature left standstill 20 minutes.After in this solution, adding Opti-MEM-I culture medium 800 μ l, adding in advance the transfection of gained in the CHO-K1 cell of cleaning with the Opti-MEM-I culture medium with mixed liquor, at CO 2Cultivated 6 hours in the incubator.Cell after the cultivation is after PBS (Invitrogen) flushing, with 0.05% trypsin-EDTA solution (Invitrogen) is peeled off, centrifugally operated reclaims.Measure resulting cell number, dilute, make per 200 μ l culture medium contain 5 * 10 4Individual cell is after Black walled 96-well plate (Costar) injects 200 μ l respectively in every hole, at CO 2Cultivate a night in the incubator.Operate with above-mentioned transfection and add various test specimens in the CHO-K1 cell of momentary expressed receptor, with FLIPR[molecular device (Molecular Device)] measured the change of intracellular calcium concentration at this moment.In order to measure the change of intracellular calcium concentration with FLIPR, implemented following preceding disposal.At first, in order in cell, to add fluorochrome Fluo-3AM (DOJIN), perhaps carrying out having made the detection buffer that is used for cleaning cell before the FLIPR mensuration.In HBSS (Invitrogen) 1000ml, add 1M HEPES (pH7.4) (DOJIN) in the solution (hereinafter referred to as HBSS/HEPES solution) that 20ml forms, add 10ml be dissolved in probenecid (Sigma) 710mg among the 1N NaOH 5ml after add the solution that mixes behind the HBSS/HEPES solution 5ml again, with this solution as detecting buffer.Then Fluo-3AM 50 μ g are dissolved among the 21 μ l DMSO (DOJIN), after adding 20%pluronic acid (Molecular Probes) mixing of equivalent again, add and added among the detection buffer 10.6ml of 105 μ l hyclones, modulated fluorochrome solution.Remove the culture medium of the CHO-K1 cell of having implemented the transfection processing, after horse back injects 100 μ l respectively with the every hole of fluorochrome solution, at CO 2Cultivated 1 hour in the incubator, fluorochrome is entered in the cell.Cell after the cultivation is placed in FLIPR after cleaning with above-mentioned detection buffer.In addition, make an addition to the test specimen in the expression of receptor CHO-K1 cell, modulate, be placed in FLIPR simultaneously with the detection buffer.After having implemented above preceding disposal, with the change of the intracellular calcium concentration behind the various test specimens of FLIPR mensuration interpolation.Its result shows, is adding 10 -5M～10 -6M method Buddhist nun acid (farnesoic acid), 5,8,11-eicosatriynoic acid, 5,8,11,14-eicosatetraynoic acid, oleic acid (oleic acid), linoleic acid (linoleic acid), linolenic acid (linolenicacid), arachidonic acid (arachidonic acid), eicosapentaenoic acid (eicosapentaenoic acid, EPA), eicosadienoic acid (eicosadienoic acid), eicosatrienoic acid (eicosatrienoic acid), docosahexenoic acid (docosahexaenoic acid, DHA), 22 carbon alkatrienes (docosatrienoic acid), Adrenic acid. (adrenic acid), during lauric acid (lauric acid) etc., the CHO-K1 cell of expressing the GPR40 receptor carries out special response (rising of intracellular calcium concentration).In the CHO-K1 cell of the expression vector that has only imported control, do not find such response.That is, the endogenous ligand that has shown GPR40 is a fatty acid.
Experimental example 2 expression and distribution
(1) cell and culture medium
NIH-3T3 and B104 cell are bought by ATCC.Mice pancreatic beta cell strain MIN6 uses document (Jun-ichi Miyazaki et al.Endocrinology, Vol.127, No.1, p126-132) Ji Zai cell strain.Each cell is cultured to the DMEM culture medium (Invitrogen society) that contains 10%FCS becomes pre-fusant (preconfluent).
(2) extraction of RNA and cDNA's is synthetic
The cDNA that is used for expression and distribution in the tissue of people and mice uses random primer to carry out reverse transcription reaction by many A+RNA (Clontech society) 1 μ g of the various tissues that are derived from people and mice.Use reverse transcription SuperScript II (GIBCO BRL society), make it reaction, carry out ethanol precipitation, be dissolved in TE 100 μ l according to the interpolation scheme.
From the cDNA of mouse cell, use trypsin Trypsin)-EDTA peels off cell, measured cell number after, extract refining all (total) RNA according to the service manual of RNeasy mini KIT (QIAGEN society).The RNA 1 μ g that extracts according to the service manual of SuperScriptII (Invitrogen society), after synthesizing article one cDNA (first strand cDNA) at random, carries out ethanol precipitation, is dissolved in TE 10 μ l.
(3) use TaqMan's is quantitative
For the cDNA that is derived from tissue (quite 5ng RNA) and be derived from the cDNA (quite 25ngRNA) of cell strain, use to amplify reaction reagent TaqMan (trade mark) Universal PCR Master Mix (AppliedBiosystems Japan Ltd.), GPR40 and detect (sequence: 11～16, Applied Biosystems Japan Ltd.), react after modulating the total load responsive fluid of 15 μ l with TaqMan (trade mark) Probe Kit.The ultimate density of each primer, probe is abideed by service manual.
TaqMan (trade mark) PCR, carry out with ABI PRISM (trade mark) 7900HT sequence detection system (AppliedBiosystems Japan Ltd.), employed temperature cycle is in accordance with the service manual of TaqMan (trade mark) UniversalPCR Master Mix (Applied Biosystems Japan Ltd.).
The quantitative TaqMan that amplifies product resolves, and (Applied BiosystemsJapan Ltd.) carries out with 7900HT SDS software.Be used to calculate and duplicate several inspection amount lines, according to used known cDNA part of the concentration that comprises the amplification sector total length (people GPR40) or plasmid DNA (Plasmid DNA) (mice GPR40) from 10 7Duplicate/hole to 10 2Duplicate/C in 6 of the logarithms in hole TValue makes.
In people's tissue,, confirmed high relatively expression for pancreas, lung, Hippocampus, hypothalamus, spinal cord.In mice,, confirmed high expression for the cell that is derived from pancreatic cancer.
The insulin secretion facilitation of the free fatty in the experimental example 3 mouse islets tumor MIN6 cells
The MIN6 cell, so long as not special record, then use contain 15%FCS (Trace Scientific Ltd.), 55 μ M 2 mercapto ethanols, 100U/ml penicillin, and the DMEM (high glucose, Invitrogen) of 100 μ g/ml streptomycins cultivate.Every hole inoculation 10 in 96 well culture plates 5Individual Min6 cell is being adjusted to 5%CO 2The CO of concentration 2Cultivated 3 days down at 37 ℃ in the incubator.With culture medium be exchanged for contain 10%FCS (Trace Scientific Ltd.), 5.5mM glucose, 100U/ml penicillin, and the RPMI1640 (not containing glucose, Invitrogen) of 100 μ g/ml streptomycins cultivated again 24 hours.After attracting to remove culture medium, add with containing 10%FCS (Trace Scientific Ltd.), 11mM glucose, 100U/ml penicillin, and free fatty-bovine serum albumin (BSA) mixed liquor (4: 1, mol ratio) of having diluted of the RPMI1640 (not containing glucose, Invitrogen) of 100 μ g/ml streptomycins, be adjusted to 5%CO 2The CO of concentration 2React 90 minutes (or 60 minutes) down at 37 ℃ in the incubator.Reacted 96 well culture plates after centrifugal 5 minutes, are reclaimed culture supernatant with 1500rpm.The amount of insulin of secreting in this culture supernatant is measured by radioimmunoassay, RIA (RIA) method of using rat insulin RIA system (Amersham Pharmacia Biotech).Its result shows, when having added Palmic acid (Palmitic acid), gamma-Linolenic acid (γ-linolenic acid) and oleic acid free fatty 300 μ M such as (oleic acid)～1000 μ M, the Min6 cell promotes insulin secretion.That is, shown that free fatty has the effect that promotes the insulin secretion in the mouse islets tumor MIN6 cell.As experimental example 2 is put down in writing, because MIN6 cell-specific and much more very express GPR40, so this reaction can judge that the fatty acid that is added promotes insulin secretion by means of GPR40.
Experimental example 4 is for the receptor function controlling regulating action (agonist effect) of GPR40
The Chinese hamster ovary celI strain (No.104) of expressing human GPR40 is diluted, make it contain 3 * 10 4The cell of individual/100 μ L is after 100 μ L are injected in every hole respectively in Black walled 96-well plate (Costar), at CO 2Cultivate a night in the incubator.Measure the change of intracellular calcium concentration with FLIPR[molecular device (Molecular Device).Method is as described below.Fluo-3AM (DOJIN) 50 μ g are dissolved among the 21 μ L DMSO (DOJIN), after adding 20%pluronic acid (Molecular Probes) mixing of equivalent again, the detection buffer that adds the 10.6mL that has added 105 μ L hyclones [adds (DOJIN) 20mL of 1M HEPES (pH7.4) in HBSS (Invitrogen) 1L, after being dissolved in probenecid (Sigma) 710mg among the 1N NaOH 5mL, add above-mentioned HBSS/HEPES solution 5ml again, add the solution 10mL mixed and modulate.] in, modulated fluorochrome solution.Remove the culture medium of Tissue Culture Plate, after horse back injects 100 μ L respectively with the every hole of fluorochrome solution, at CO 2Cultivated 1 hour in the incubator, fluorochrome is entered in the cell.Cell after the cultivation is cleaned with above-mentioned detection buffer.The chemical compound that makes an addition in the cell is diluted to each concentration with the detection buffer, respectively injection testing sample culture plate.After the preceding disposal more than implementing, measure the change of having added the intracellular calcium concentration behind the chemical compound, the effect of investigation agonist with FLIPR.By the consumption response curve that changes with the fluorescence intensity level of reaction beginning after 30 seconds, calculated EC 50Value.The result is illustrated in the table 1.
[table 1]
Receptor function controlling regulating action for GPR40
Compound number EC 50(μM)
Reference example 2 reference examples 6 reference examples 15 embodiment 2 embodiment 6 embodiment 7 embodiment 10 embodiment 41 0.32 0.46 1.2 0.17 0.16 0.13 0.88 0.055
Acid and gamma-linolenic 2.0
Result by table 1 shows that chemical compound of the present invention has excellent GPR40 receptor function controlling regulating action.
The structure of the expression vector of reference example 129 people GPR40
DNA part (the serial number: 6), obtain of coding people GPR40 by following PCR method.That is,
Few DNA (serial number:, use with 5 '＞CGTCGACCCGGCGGCCCCATGGACCTGCCCCCG＜3 ' expression 11) as the positive-sense strand primer
Few DNA (the serial number: of 5 '＞CATCGATTAGCAGTGGCGTTACTTCTGGGACTT＜3 ' expression 12) as the antisense strand primer, modulation contains 20pmol respectively, 10 * Advantage (registered trade mark), 2 PCR Buffer (CLONTECH), 5 μ l, 50 * dNTP mix (CLONTECH), 1 μ l, 50 * Advantage, 2 PolymeraseMix (CLONTECH), 1 μ l, mixed liquor 50 μ l as people's pancreas eDNA liquid (CLONTECH) 1 μ l of template DNA, use thermal cycle control device (GeneAmp (registered trade mark) PCR system model9700 (Applied Biosystems)), 96 ℃, 1 minute, then 96 ℃, 30 seconds → 61 ℃, 30 seconds → 72 ℃, 35 circulations repeatedly in 120 seconds, again under 72 ℃, carry out 10 minutes lengthening reactions, utilize this program to carry out the PCR reaction.Carry out agarose gel electrophoresis by reaction is finished liquid, obtain single product, clone test kit (Invitrogen) with TA and clone, confirm gene order.About there not being the clone of PCR mistake, carry out double digested with restriction endonuclease SalI (precious wine is made), ClaI (precious wine is made) after, carry out agarose gel electrophoresis, cut out single product.Resulting part (about 1kb) is imported in the pAKKO-111 carrier, and the transfection that is used for Chinese hamster ovary celI is used.
Reference example 130 coding sources are from the clone of the cDNA of the GPR40 of mice spleen and the decision of base sequence thereof
With mouse spleen cDNA (Marathon-ReadyTM cDNA; 13) and primer 2 (serial number: 14) carried out PCR Clontech society) be template, with 2 primers, primer 1 (serial number:.PCR uses Pyrobest DNA polymerase (precious wine is made), carried out after (i) 98 ℃, 1 minute, and (ii) 98 ℃, 10 seconds, 55 ℃, 30 seconds, after 72 ℃, 60 seconds 40 times, (iii) 72 ℃, 2 minutes extension.After the reaction, will amplify the prescription of product, plasmid vector pCR-Blunt (Invitrogen society) will be cloned according to Zero Blunt PCR clone's test kit (Invitrogen society).It is imported among the escherichia coli TOP10 (Invitrogen society), will have being cloned in of plasmid and contain in the LB agar culture medium of kanamycin (kanamycine) and select.Resolve the result of each clone's base sequence, obtained the proteinic cDNA sequence (serial number: 2) of the new G protein conjugation receptor of coding.To contain the aminoacid sequence (serial number: novel receptor protein called after mGPR40 1) of deriving by this cDNA.Naming transformant in addition is escherichia coli (Escherichia coli) TOP10/Zero Blunt-mGPR40.
Reference example 131 coding sources are from the clone of the cDNA of the GPR40 of rat spleen and the decision of base sequence thereof
With Rats Spleen cDNA (Marathon-ReadyTM cDNA; 15) and primer 4 (serial number: 16) carried out PCR Clontech society) be template, with 2 primers, primer 3 (serial number:.PCR uses Advantage 2 Polymerase mix (Clontech), has carried out (i) 96 ℃, 1 minute, and (ii) 96 ℃, 10 seconds, 72 ℃, 2 minutes 5 times, (iii) 96 ℃, 10 seconds, after 70 ℃, 2 minutes 25 times, 72 ℃, 5 minutes extension.After the reaction, will amplify the prescription of product, plasmid vector pCR2.1 TOPO (Invitrogen society) will be cloned according to TOPO TA clone's test kit (Cloning Kit) (Invitrogen society).Its is imported in e. coli jm109 (precious wine is made), will have being cloned in of plasmid and contain in the LB agar culture medium of ampicillin (ampicilin) and select.Resolve the result of each clone's base sequence, obtained the proteinic cDNA sequence (serial number: 4) of the new G protein conjugation receptor of coding.To contain the aminoacid sequence (serial number: novel receptor protein called after rGPR40 3) of deriving by this cDNA.Naming transformant in addition is escherichia coli (Escherichia coli) JM109/pCR/2.1-rGPR40.
Reference example 132 coding sources are from the clone of the cDNA of the GPR40 of macaque and the decision of base sequence thereof
17) and primer 2 (serial number: 18) carried out PCR with macaque DNA is template, with primer 1 (serial number:.PCR uses Pyrobest DNA Polymerase (TAKARA), has carried out (i) 95 ℃, 1 minute, and (ii) 95 ℃, 10 seconds, 58 ℃, 20 seconds, after 72 ℃, 1 minute 30 seconds 40 times, 72 ℃, 7 minutes extension.19) and primer 4 (serial number: 20) carry out nested (nested) PCR after the reaction, will amplify product and be diluted to 1/50, as template, with primer 3 (serial number:.After the reaction, will amplify product and press the prescription clone of TOPO TA clone test kit (Cloning Kit) (Invitrogen society) and be plasmid vector pCR2.1 TOPO (Invitrogen society).Its is imported in e. coli jm109 (precious wine is made), will have being cloned in of plasmid and contain in the LB agar culture medium of ampicillin (ampicilin) and select.Resolve the result of each clone's base sequence, obtained the proteinic cDNA sequence (serial number: 8) of the new G protein conjugation receptor of coding.To contain the aminoacid sequence (serial number: novel receptor protein called after monkey GPR40 7) of deriving by this cDNA.Naming transformant in addition is escherichia coli (Escherichia coli) JM109/pCR/2.1-monkey GPR40.
Reference example 133 coding sources are from the clone of the cDNA of the GPR40 of hamster and the decision of base sequence thereof
21) and primer 2 (serial number: 22) carried out PCR with hamster cell strain HIT-T15cDNA is template, with primer 1 (serial number:.PCR uses Klentaq DNA Polymerase (CLONTECH), has carried out (i) 95 ℃, 2 minutes, and (ii) 98 ℃, 10 seconds, 63 ℃, 20 seconds, after 72 ℃, 1 minute 35 times, 72 ℃, 7 minutes extension.After the reaction, will amplify product and press the prescription clone of TOPO TA clone test kit (Cloning Kit) (Invitrogen society) and be plasmid vector pCR2.1 TOPO (Invitrogen society).Its is imported in e. coli jm109 (precious wine is made), will have being cloned in of plasmid and contain in the LB agar culture medium of ampicillin (ampicilin) and select.Resolve the result of each clone's base sequence, obtained the proteinic cDNA sequence (serial number: 10) of the new G protein conjugation receptor of coding.To contain the aminoacid sequence (serial number: novel protein called after hamstarGPR40 9) of deriving by this cDNA.In addition, the name transformant is escherichia coli (Escherichia coli) JM109/pTA hamstarGPR40.
Experimental example 5 is by the expression inhibiting of the mice GPR40-GFP fused protein that imports special siRNA carry out in the sequence of mice GPR40
The mice GPR40 that will be made by known method own is with the fused protein expression Chinese hamster ovary celI of GFP, with 3 * 10 4/ hole (well) is seeded in 96 well culture plates, cultivates 1 day.With HVJ Envelope VECTORKIT GenomONE TM(the former industry of stone) cultivated 1 day after pressing siRNA (Dharmacon society) (concentration of 2.86pmol/0.5 μ l or the 8.57pmol/1.5 μ l) transfered cell of the various sequences that the report (Nature411 (6836), 494-498 (2001)) of Elbasir etc. makes again.The detection of the expression of mice GPR40-GFP is undertaken by enzyme immunoassay (EIA) as follows.After discarding culture supernatant and using HBSS (Invitrogen) to clean, fix 5 minutes, with PBS (the precious wine is made) sealing that contains 2%BSA with 0.01% glutaraldehyde (with the pure medicine of light).Add the anti-GFP monoclonal antibody 3E6 diluted 500 times (NIPPON GENE CO., at room temperature hatch 2 hours after LTD.) after, add through cleaning and having diluted 500 times the anti-mouse IgG antibody of HRP marking (ICG), at room temperature hatched 2 hours.After cleaning, add TMB micropore peroxidase substrate (microwellperoxydase substrate) (Funakoshi), hatch after 30 minutes, add sulphuric acid, chromogenic reaction is stopped, having measured absorbance with 450nm.Consequently, express Chinese hamster ovary celI for mice GPR40-GFP, (positive-sense strand is a serial number to m40i103 by adding the special siRNA of mice GPR40: 23,24), (positive-sense strand is a serial number to m40i256: 25 antisense strand is a serial number:, antisense strand is a serial number: 26), confirmed expression low of GPR40-GFP.Hence one can see that: m40i103, m40i256 suppress mice GPR40 specifically to express.
Experimental example 6 is by the insulin secretion of various fatty acids promotions from MIN6
The mice pancreatic beta cell strain MIN6 that will cultivate in flask after peeling off with the PBS of EDTA that contains 2.5mM, is spread on 96 well culture plates and cultivated 2 days.Culture medium, the culture medium of interpolation 15% hyclone (Thermo Trace society), 5.5 μ M 2 mercapto ethanols (Invitrogen society), 20mMHEPES pH7.3,100U/ml penicillin, 100 μ g/ml streptomycins in the Eagle culture medium of the Dulbecco improvement of using at the glucose that contains 4.5g/l (Dulbecco ' s Modified Eagle Medium) (DMEM, Invitrogen society).With the Krebs-Ringer bicarbonate buffer that has changed cell (Krebs-Ringer bicarbonate buffer) (KRBH, 116mMNaCl, 4.7mM KCl, 1.2mM KH 2PO 4, 1.2mM MgSO 4, 2.5mM CaCl 2, 25mM NaHCO 3, 24mM HEPES pH7.3) carry out cleaning for 2 times after, at 37 ℃ of 5%CO 2Preincubation is 30 minutes under the condition.With the cell that is used in after fatty acid that the buffer agent dilution of having added the 22mM glucose among the above-mentioned KRBH modulated makes an addition to preincubation, at 37 ℃ of 5%CO 2Cultivated 90 minutes under the condition.After the cultivation, reclaim the supernatant of cell, freeze to preserve.(Amersham Pharmacia Biotech society) measured the insulin content in the supernatant with commercially available insulin immunoassay kit.Its result, it is active to have confirmed that by the fatty acid-oleic acid that has shown remarkable activity (oleic acid), linoleic acid (linoleicacid), alpha-linolenic acid (α-linolenic acid), gamma-Linolenic acid (γ-linolenic acid), arachidonic acid (arachidonic acid), DHA the insulin secretion of having a mind to rises in the intracellular calcium transfer of having used GPR40 to express Chinese hamster ovary celI detects.On the other hand, GPR40 is not shown that the methyl linoleate (methyl linolate=linoleic methyl) of agonist activity and butanoic acid (Butyricacid) do not show that the insulin secretion rising of having a mind to is active.Because the GPR40 agonist activity is roughly relevant with insulin secretion rising activity, thus proved GPR40 undertaking fatty acid the insulin secretion effect of increasing at least-part.
Experimental example 7 is by means of the insulin secretion of the GPR40 active glucose dependency that rises
Based on the method for experimental example 6, studied the influence of the concentration of glucose when adding fatty acid.The concentration of glucose that adds in KRBH when adding fatty acids changes into 0,5.5,11,22mM studies, the result shows, active because of the insulin secretion rising that oleic acid (oleic acid), linoleic acid (linoleic acid) produce, under the high concentration of glucose condition more than the 11mM, be significant.Therefore, GPR40 is shown the insulin secretion effect of increasing that the fatty acid of agonist activity produces, can expect insulin secretion effect of increasing, blood sugar effect effect under the hyperglycemia condition.
Experimental example 8 siRNA import the insulin secretion that produces because of fatty acid among the MIN6 active depression effect that rises
In experimental example 5, confirmed m40i103, suppressed the expression of mice GPR40 significantly as the special siRNA of GPR40.Based on the method for experimental example 5, the insulin secretion rising activity among the MIN6 Fine born of the same parents that imported m40i103 with HVJ Envelope VECTOR KITGenomONE is studied.Utilize the method for experimental example 6 that the insulin secretion rising activity that fatty acid causes is investigated, the result is, import among the MIN6 at m40i103, the insulin secretion that linoleic acid unconfirmed (linoleic acid), gamma-Linolenic acid (γ-linoleic acid) cause rises active.On the other hand, it is active to have shown that in the MIN6 that has imported as the Scramble II duplex siRNA of random sequence siRNA the insulin secretion that keeps above-mentioned fatty acid rises.By this results verification GPR40 undertaking fatty acid insulin secretion rising mechanism at least-part.
Experimental example 9 is derived from the insulin secretion facilitation of MIN6
The mice pancreatic beta cell strain MIN6 that will cultivate in flask after peeling off with the PBS that contains 2.5mM EDTA, is spread on 96 well culture plates and cultivated 2 days.Culture medium is used Eagle culture medium in the Dulbecco ' of the glucose that contains 4.5g/L s improvement (Dulbecco ' s Modified Eagle Medium) (DMEM, Invitrogen society)] in the culture medium of interpolation 15% hyclone (ThermoTrace society), 5.5 μ M 2 mercapto ethanols (Invitrogen society), 20mMHEPES pH7.3,100U/mL penicillin, 100 μ g/mL streptomycins.With the Krebs-Ringer bicarbonate buffer that has changed cell (Krebs-Ringer bicarbonate buffer) (KRBH, 116mMNaCl, 4.7mM KCl, 1.2mM KH 2PO 4, 1.2mM MgSO 4, 2.5mM CaCl 2, 25mM NaHCO 3, 24mM HEPES pH7.3) carry out cleaning for 2 times after, at 37 ℃, 5%CO 2Preincubation is 30 minutes under the condition.Dilute in the cell after synthetic chemical compound makes an addition to preincubation, being used in the buffer agent that has added the 22mM glucose among the above-mentioned KRBH at 37 ℃, 5%CO 2Cultivated 90 minutes under the condition.After the cultivation, reclaim the supernatant of cell, freeze to preserve.(Amersham Pharmacia Biotech society) measured the insulin content in the supernatant with commercially available insulin immunoassay kit.Its result, as shown in Figure 1, it is active to have confirmed that by the chemical compound interpolation of embodiment 41 insulin secretion of having a mind to rises.
Experimental example 10 is the insulin secretion facilitation and the blood glucose reduction effect of (in vivo) in vivo
After male SD rat (CLEA Japan Inc, 7 week ages) gone on a hunger strike 1 day, press blood glucose value and body weight and divide into groups 1 group 6.0.5% methylcellulose suspension of the chemical compound of embodiment 41 is given by the consumption oral administration of 30mg/kg, throws to per os after 30 minutes to add load glucose (2g/kg).For control group, only throw and give 0.5% methylcellulose, carry out sugar equally and add load.Before sugar adds load, sugar adds and carries on a shoulder pole after 7,30 and 60 minutes, takes blood plasma, measured blood glucose value and insulin concentration.The mensuration of blood glucose value is used Hitachi's automatic analysing apparatus 7070, the mensuration use radioimmunoassay system of insulin ([ 125L] Sionoria insulin, Shionogi).Its result, compare with matched group, in the chemical compound of embodiment 41 is thrown to group, sugar adds the blood glucose ascensional range of load after the 30 minutes (Fig. 2 that is effectively suppressed, the Williams calibrating, p＜=0.025), sugar adds the insulin ascensional range of load after 7 minutes and effectively increases (Fig. 3, the Williams calibrating, p＜=0.025).Show that by this result the chemical compound of embodiment 41 demonstrates insulin secretion facilitation and blood glucose decline effect to rat.
Reference example 134 (2E)-3-(2-fluoro-4-methoxyphenyl) ethyl acrylate
Identical with reference example 27, obtain the table title chemical compound of colorless oil by 2-fluoro-4-methoxybenzaldehyde, yield is 97%.
1H NMR(CDCl 3)δ1.33(3H，t，J＝7.1Hz)，3.83(3H，s)，4.26(2H，q，J＝7.1Hz)，6.41(1H，d，J＝16.2Hz)，6.61-6.73(2H，m)，7.45(1H，t，J＝8.6Hz)，7.75(1H，d，J＝16.2Hz)。
Reference example 135 3-(2-fluoro-4-methoxyphenyl) ethyl propionate
Identical with reference example 43, obtain the table title chemical compound of colorless oil by (2E)-3-(2-fluoro-4-methoxyphenyl) ethyl acrylate and platinum oxide, yield is 84%.
1H NMR(CDCl 3)δ1.23(3H，t，J＝7.2Hz)，2.58(2H，t，J＝7.6Hz)，2.90(2H，t，J＝7.6Hz)，3.77(3H，s)，4.12(2H，q，J＝7.2Hz)，6.57-6.63(2H，m)，7.07-7.13(1H，m)。
Reference example 136 3-(2-fluoro-4-hydroxy phenyl) ethyl propionate
Identical with reference example 36, obtain the table title chemical compound of colorless oil by 3-(2-fluoro-4-methoxyphenyl) ethyl propionate and 1-octyl mercaptan, yield is 83%.
1H NMR(CDCl 3)δ1.23(3H，t，J＝7.2Hz)，2.58(2H，t，J＝8.1Hz)，2.89(2H，t，J＝8.1Hz)，4.12(2H，q，J＝7.2Hz)，6.51-6.56(2H，m)，7.01-7.06(1H，m)。
Reference example 137 (2E)-3-(2-chloro-4-hydroxy phenyl) acrylic acid methyl ester.
Identical with reference example 34, obtain the table title chemical compound of colorless oil by 4-bromo-3-chlorophenol, yield is 17%.
1H NMR(CDCl 3)δ3.83(3H，s)，5.99(1H，br s)，6.33(1H，d，J＝16.1Hz)，6.79(1H，dd，J＝8.6，2.4Hz)，6.94(1H，d，J＝2.4Hz)，7.53(1H，d，J＝8.6Hz)，8.05(1H，d，J＝16.1Hz)。
Reference example 138 3-(2-chloro-4-hydroxy phenyl) methyl propionate
Identical with reference example 43, obtain the table title chemical compound of colorless oil by (2E)-3-(2-chloro-4-hydroxy phenyl) acrylic acid methyl ester. and platinum oxide, yield is 44%.
1H NMR(CDCl 3)δ2.62(2H，t，J＝7.9Hz)，2.99(2H，t，J＝7.9Hz)，3.68(3H，s)，4.95(1H，s)，6.67(1H，dd，J＝8.3，2.6Hz)，6.87(1H，d，J＝2.6Hz)，7.10(1H，d，J＝8.3Hz)。
Reference example 139 4-phenyl-N-propyl group-1,3-thiazoles-2-amine
2-chloro-acetophenone (4.45g, 28.8mmol) and N-propyl group thiourea (3.40g, add in ethanol 28.8mmol) (50mL) solution sodium acetate (3.07g, 37.4mmol), reflux 1.5 hours.In reactant liquor, add entry, leach crystal.The coarse crystallization that obtains recrystallize in diethyl ether-hexane obtains the table title chemical compound (5.64g, 92%) of colourless crystallization.
1H NMR(CDCl 3)δ1.00(3H，t，J＝7.2Hz)，1.60-1.78(2H，m)，3.19-3.29(2H，m)，5.38(1H，br s)，6.70(1H，s)，7.25-7.41(3H，m)，7.77-7.81(2H，m)。
Reference example 140 N, 5-dimethyl-4-phenyl-1,3-thiazoles-2-amine
Identical with reference example 139, obtain the table title chemical compound of colourless crystallization by 2-bromo-1-phenylpropyl alcohol alkane-1-ketone and N-methylthiourea, yield is 57%.
1H NMR(CDCl 3)δ2.40(s，3H)，2.85(d，J＝3.3Hz，3H)，5.79(br s，1H)，7.26-7.31(m，1H)，7.36-7.41(m，2H)，7.56-7.58(m，2H)。
Reference example 141 4,5-dimethyl-N-propyl group-1,3-thiazoles-2-amine
Identical with reference example 139, obtain the table title chemical compound of yellow crystal by 3-n-butyl bromide-2-ketone and N-propyl group thiourea, yield is 19%.
1H NMR(CDCl 3)δ0.97(3H，t，J＝7.0Hz)，1.58-1.70(2H，m)，2.10(3H，s)，2.18(3H，s)，3.15(2H，t，J＝7.0Hz)，4.89-5.07(1H，m)。
Reference example 142 5-methyl-4-phenyl-N-propyl group-1,3-thiazoles-2-amine
Identical with reference example 139, obtain the table title chemical compound of yellow crystal by 2-bromo-1-phenylpropyl alcohol alkane-1-ketone and N-propyl group thiourea, yield is 23%.
1H NMR(CDCl 3)δ0.97(3H，t，J＝7.4Hz)，1.57-1.70(2H，m)，2.40(3H，s)，3.17(2H，q，J＝7.4Hz)，5.23(1H，br s)，7.25-7.31(1H，m)，7.36-7.41(2H，m)，7.55-7.59(2H，m)。
Reference example 143 4-[[methyl (4-phenyl-1,3-thiazoles-2-yl) amino] methyl] essence of Niobe
At N-methyl-4-phenyl-1,3-thiazoles-2-amine (1.67g, N 8.8mmol), in the solution of dinethylformamide (25ml), (350mg 8.8mmol) stirs after 30 minutes the sodium hydride of adding 60%, adding 4-(bromomethyl) essence of Niobe (2.1g, 9.2mmol).After this mixture at room temperature stirs 1.5 hours, in reactant liquor, add entry, use ethyl acetate extraction.Extracting solution is through washing, concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=3: 1), obtain the table title chemical compound (2.6g, yield 86%) of yellow oily.
1H NMR(CDCl 3)δ3.08(s，3H)，3.90(s.3H)，4.85(s.2H)，6.75(s，1H)，7.27-7.43(m，5H)，7.86(dd，J＝8.4，1.4Hz，2H)，8.02(d，J＝8.4Hz，2H)。
Reference example 144 [4-[[methyl (4-phenyl-1,3-thiazoles-2-yl) amino] methyl] phenyl] methanol
Under ice-cooled, at 4-[[methyl (4-phenyl-1,3-thiazoles-2-yl) amino] methyl] essence of Niobe (2.06g, and the diisobutylaluminium hydride hexane solution of adding 0.9M in oxolane 6.1mmol) (30mL) solution (30mL, 27mmol).After reactant liquor at room temperature stirred 2 hours, (8.7g 27mmol) at room temperature stirred 1 hour to add sal glauberi.Behind the elimination insoluble matter, concentrated filtrate with the refining residue of silica gel column chromatography (hexane/ethyl acetate=1: 1), obtains the table title chemical compound (1.9g, yield are 98%) of white powder.
1H NMR(CDCl 3)δ3.07(s，3H)，4.67(d，J＝5.8Hz，2H)，4.77(s，2H)，6.72(s，1H)，7.23-7.42(m，7H)，7.83-7.89(m，2H)。
Reference example 145 4-[[ethyls (4-phenyl-1,3-thiazoles-2-yl) amino] methyl] essence of Niobe
Identical with reference example 143, obtain the table title chemical compound of yellow oily by N-ethyl-4-phenyl-1,3-thiazoles-2-amine, yield is 60%.
1H NMR(CDCl 3)δ1.24(t，J＝7.2Hz，3H)，3.52(q，J＝7.2Hz，2H)，3.91(s，3H)，4.83(s，2H)，6.72(s，1H)，7.24-7.44(m，5H)，7.82-7.86(m，2H)，7.98--8.02(m，2H)。
Reference example 146 [4-[[ethyl (4-phenyl-1,3-thiazoles-2-yl) amino] methyl] phenyl] methanol
Identical with reference example 144, by 4-[[ethyl (4-phenyl-1,3-thiazoles-2-yl) amino] methyl] essence of Niobe obtains the table title chemical compound of colorless oil, and yield is 69%.
1H NMR(CDCl 3)δ1.23(t，J＝7.1Hz，3H)，3.51(q，J＝7.1Hz，2H)，4.69(d，J＝4.8Hz，2H)，4.76(s，2H)，6.71(s，1H)，7.24-7.39(m，7H)，7.83-7.87(m，2H)。
Reference example 147 4-[[(4-phenyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] essence of Niobe
Identical with reference example 143, obtain the table title chemical compound of colorless oil by 4-phenyl-N-propyl group-1,3-thiazoles-2-amine, yield is 75%.
1H NMR(CDCl 3)δ0.93(t，J＝7.7Hz，3H)，1.64-1.74(m，2H)，3.40(t，J＝7.7Hz，2H)，3.91(s，3H)，4.85(s，2H)，6.72(s，1H)，7.23-7.42(m，5H)，7.82-7.85(m，2H)，7.99-8.01(m，2H)。
Reference example 148 [4-[[(4-phenyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] phenyl] methanol
Identical with reference example 144, by 4-[[(4-phenyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] essence of Niobe obtains the table title chemical compound of colorless oil, and yield is 67%.
1H NMR(CDCl 3)δ0.93(t，J＝7.4Hz，3H)，1.62(t，J＝5.8Hz，1H)，1.64-1.74(m，2H)，3.40(t，J＝7.7Hz，2H)，4.69(d，J＝5.8Hz，2H)，4.79(s，2H)，6.70(s，1H)，7.24-7.39(m，7H)，7.84-7.87(m，2H)。
Reference example 149 4-[[methyl (5-methyl-4-phenyl-1,3-thiazoles-2-yl) amino] methyl] essence of Niobe
Identical with reference example 143, by N, 5-dimethyl-4-phenyl-1,3-thiazoles-2-amine obtains the table title chemical compound of yellow powder shape, and yield is 96%.
1H NMR(CDCl 3)δ2.42(s，3H)，3.03(s，3H)，3.91(s，3H)，4.75(s，2H)，7.26-7.31(m，1H)，7.36-7.41(m，4H)，7.62-7.65(m，2H)，8.01(d，J＝8.3Hz，2H)。
Reference example 150 [4-[[methyl (5-methyl-4-phenyl-1,3-thiazoles-2-yl) amino] methyl] phenyl] methanol
Identical with reference example 144, by 4-[[methyl (5-methyl-4-phenyl-1,3-thiazoles-2-yl) amino] methyl] essence of Niobe obtains the table title chemical compound of white powder, and yield is 92%.
1H NMR(CDCl 3)δ2.42(s，3H)，3.02(s，3H)，4.68(s，4H)，7.26-7.41(m，7H)，7.64(d，J＝7.5 Hz，2H)。
Reference example 151 4-[[(5-methyl-4-phenyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] essence of Niobe
Identical with reference example 143, obtain the table title chemical compound of yellow oily by 5-methyl-4-phenyl-N-propyl group-1,3-thiazoles-2-amine, yield is 79%.
1H NMR(CDCl 3)δ0.92(t，J＝7.4Hz，3H)，1.66-1.72(m，2H)，2.41(s，3H)，3.32-3.37(m，2H)，3.91(s，3H)，4.77(s，2H)，7.26-7.41(m，5H)，7.61-7.63(m，2H)，7.98-8.01(m，2H)。
Reference example 152 [4-[[(5-methyl-4-phenyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] phenyl] methanol
Identical with reference example 144, by 4-[[(5-methyl-4-phenyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] essence of Niobe obtains the table title chemical compound of colorless oil, and yield is 78%.
1H NMR(CDCl 3)δ0.91(t，J＝7.4Hz，3H)，1.57-1.72(m，2H)，2.41(s，3H)，3.32-3.37(m，2H)，4.68(d，J＝5.8Hz，2H)，4.70(s，2H)，7.24-7.41(m，7H)，7.63-7.65(m，2H)。
Reference example 153 3-[[methyl (4-phenyl-1,3-thiazoles-2-yl) amino] methyl] essence of Niobe
Identical with reference example 143, obtain the table title chemical compound of colorless oil by N-methyl-4-phenyl-1,3-thiazoles-2-amine and 3-(bromomethyl) essence of Niobe, yield is 72%.
1H NMR(CDCl 3)δ3.08(s，3H)，3.91(s，3H)，4.83(s，2H)，6.74(s，1H)，7.25-7.44(m，4H)，7.58(d，J＝7.7Hz，1H)，7.85-7.88(m，2H)，7.96-7.98(m，1H)，8.03(s，1H)。
Reference example 154 [3-[[methyl (4-phenyl-1,3-thiazoles-2-yl) amino] methyl] phenyl] methanol
Identical with reference example 144, by 3-[[methyl (4-phenyl-1,3-thiazoles-2-yl) amino] methyl] essence of Niobe obtains the table title chemical compound of colorless oil, and yield is 95%.
1H NMR(CDCl 3)δ3.09(s，3H)，4.69(d，J＝5.8Hz，2H)，4.78(s，2H)，6.73(s，1H)，7.24-7.40(m，7H)，7.85-7.88(m，2H)。
Reference example 155 4-[[(4-phenyl-1,3-thiazoles-2-yl) sulfenyl] methyl] essence of Niobe
Identical with reference example 143, obtain the table title chemical compound of white powder by 4-phenyl-1,3-thiazoles-2-mercaptan and 4-(bromomethyl) essence of Niobe, yield is 79%.
1H NMR(CDCl 3)δ3.90(s，3H)，4.54(s，2H)，7.31-7.45(m，4H)，7.49(d，J＝8.3Hz，2H)，7.86-7.90(m，2H)，7.96-8.00(m，2H)。
Reference example 156 [4-[[(4-phenyl-1,3-thiazoles-2-yl) sulfenyl] methyl] phenyl] methanol
Identical with reference example 144, by 4-[[(4-phenyl-1,3-thiazoles-2-yl) sulfenyl] methyl] essence of Niobe obtains the table title chemical compound of white powder, and yield is 85%.
1H NMR(CDCl 3)δ1.67(t，J＝5.4Hz，1H)，4.51(s，2H)，4.67(d，J＝5.3Hz，2H)，7.26-7.44(m，8H)，7.89(d，J＝8.1Hz，2H)。
Reference example 157 N-(4,5-dihydro-naphtho [1,2-d] [1,3] thiazol-2-yl) propionic acid amide.
Ice-cooled down, to 4,5-dihydro-naphtho [1,2-d] [1,3] thiazole-2-amine (1.50g, add in pyridine 7.4mmol) (20mL) solution propionyl chloride (1.03g, 11mmol) after, at room temperature stirred 2 hours.In reactant liquor, add water, use ethyl acetate extraction.After solution with water after extracting washed, concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=3: 1), obtain the table title chemical compound (1.75g, yield are 91%) of powder.
1H NMR(CDCl 3)δ1.14(t，J＝7.5Hz，3H)，2.33(q，J＝7.5Hz，2H)，2.96-3.09(m，4H)，7.18-7.28(m，3H)，7.71(d，J＝7.5Hz，1H)。
Reference example 158 N-propyl group-4,5-dihydro-naphtho [1,2-d] [1,3] thiazole-2-amine
Under ice-cooled, (1.70g, (749mg 20mmol), at room temperature stirred 3 hours to add lithium aluminium hydride in oxolane 6.6mmol) (30mL) solution at N-(4,5-dihydro-naphtho [1,2-d] [1,3] thiazol-2-yl) propionic acid amide..(9.6g 30mmol), at room temperature stirred 1 hour to add sal glauberi.Behind the elimination insoluble matter, concentrated filtrate with the refining residue of silica gel column chromatography (hexane/ethyl acetate=4: 1), obtains the table title chemical compound (1.32g, yield are 82%) of yellow powder shape.
1H NMR(CDCl 3)δ0.99(t，J＝7.5Hz，3H)，1.62-1.76(m，2H)，2.83-2.88(m，2H)，2.99-3.04(m，2H)，3.20-3.26(m，2H)，5.26(s，1H)，7.10-7.26(m，3H)，7.70(d，J＝7.9Hz，1H)。
Reference example 159 4-[[4,5-dihydro-naphtho [1,2-d] [1,3] thiazol-2-yl (propyl group) amino] methyl] essence of Niobe
Identical with reference example 143, by N-propyl group-4,5-dihydro-naphtho [1,2-d] [1,3] thiazole-2-amine obtains buttery table title chemical compound, and yield is 78%.
1H NMR(CDCl 3)δ0.93(t，J＝7.5Hz，3H)，1.63-1.73(m，2H)，2.82-2.88(m，2H)，3.02(t，J＝7.8Hz，2H)，3.38(t，J＝7.8Hz，2H)，3.90(s，3H)，4.81(s，2H)，7.09-7.26(m，4H)，7.41(d，J＝8.1Hz，2H)，7.99(d，J＝8.1Hz，2H)。
Reference example 160 [4-[[4,5-dihydro-naphtho [1,2-d] [1,3] thiazol-2-yl (propyl group) amino] methyl] phenyl] methanol
, by 4-[[4,5-dihydro-naphtho [1,2-d] [1,3] thiazol-2-yl (propyl group) amino identical with reference example 144] methyl] essence of Niobe obtains the table title chemical compound of colorless oil, and yield is 63%.
1H NMR(CDCl 3)δ0.93(t，J＝7.4Hz，3H)，1.63-1.73(m，2H)，2.82-2.87(m，2H)，2.99-3.04(m，2H)，3.35-3.40(m，2H)，4.68(d，J＝5.1Hz，2H)，4.75(s，2H)，7.09-7.40(m，7H)，7.78(d，J＝7.5Hz，1H)。
Reference example 161 4-[[(4,5 dimethyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] essence of Niobe
Identical with reference example 143, by 4,5-dimethyl-N-propyl group-1,3-thiazoles-2-amine obtains the table title chemical compound of yellow oily, and yield is 68%.
1H NMR(CDCl 3)δ0.88(t，J＝7.4Hz，3H)，1.56-1.66(m，2H)，2.12(d，J＝0.8Hz，3H)，2.18(d，J＝0.8Hz，3H)，3.25-3.30(m，2H)，3.90(s，3H)，4.71(s，2H)，7.33(d，J＝8.5Hz，2H)，7.96-8.00(m，2H)。
Reference example 162 [4-[[(4,5-dimethyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] phenyl] methanol
, by 4-[[(4,5-dimethyl-1,3-thiazoles-2-yl identical) (propyl group) amino with reference example 144] methyl] essence of Niobe obtains the table title chemical compound of colorless oil, and yield is 63%.
1H NMR(CDCl 3)δ0.87(t，J＝7.4Hz，3H)，1.56-1.66(m，2H)，2.13(s，3H)，2.18(s，3H)，3.25-3.30(m，2H)，4.64(s，2H)，4.67(s，2H)，7.24-7.33(m，4H)。
Reference example 163 (2 ', 6 '-dimethyl diphenyl-4-yl) methanol
Toluene-methanol-water (5: 1: 1,210mL) in dissolving (4-bromobenzene) methanol (5.00g, 32mmol), (2, the 6-3,5-dimethylphenyl) boric acid (5.77g, 39mmol), sodium carbonate (10.2g, 96mmol), with add after the argon replaces tetra-triphenylphosphine palladium (1.85g, 1.6mmol).Reactant liquor one evening of reflux under ar gas environment atmosphere.After the reactant liquor cooling, in reactant liquor, add entry, use ethyl acetate extraction.The washing extracting solution, dry back concentrates.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=7: 3), obtain the table title chemical compound (4.44g, yield 65%) of white powder.
1H NMR(CDCl 3)δ1.69(1H，t，J＝6.0Hz)，2.03(6H，s)，4.76(2H，d，J＝6.0Hz)，7.09-7.19(5H，m)，7.43(2H，d，J＝8.1Hz)。
Reference example 164 3-(4-((3-phenoxy benzyl) oxygen) phenyl) propionitrile
Identical with reference example 31, the table title chemical compound of the faint yellow oily that obtains by 3-phenoxy group benzylalcohol and 3-(4-hydroxy phenyl) propionitrile, yield is 95%.MS 330.1(MH+)。
Reference example 165 (1Z)-N-hydroxyl-3-(4-((3-phenoxy benzyl) oxygen) phenyl) propionyl imines amide
With hydroxylamine hydrochloride (1.05g, 15.1mmol), triethylamine (3.0ml, after dimethyl sulfoxide 21.5mmol) (30ml) suspension at room temperature stirs 30 minutes, add 3-(4-((3-phenoxy benzyl) oxygen) phenyl) propionitrile (0.5g, 1.52mmol).This kind mixture after stirring 18 hours under 70 ℃, is used the ethyl acetate dilute reaction solution, after water, sodium-chloride water solution are cleaned successively, use dried over mgso, concentrating under reduced pressure.The crystallization that obtains obtains the table title chemical compound (0.49g, 89%) of colourless acicular crystal with ethyl acetate-oxolane recrystallize.
MS 363.1(MH +)。
Reference example 166 1-(tert-butoxycarbonyl)-3-methylol-1H-indole
(2.5g, in anhydrous tetrahydrofuran solution 9.08mmol) (40ml), under ice-cooled, (14ml 21mmol), stirred 2 hours to add 1.5M-diisobutyl aluminium hydride toluene solution 1-(tert-butoxycarbonyl)-1H-indole-3-carboxylic acid methyl ester.In reaction solution, add aqueous citric acid solution, successively with ethyl acetate extraction, clean with sodium-chloride water solution after, use dried over mgso, concentrating under reduced pressure obtains the table title chemical compound (2.3g, yield 100%) of faint yellow oily.
1H-NMR(CDCl 3)δ1.67(9H，s)，4.84(2H，d，J＝6.0Hz)，7.14-7.38(3H，m)，7.58(1H，s)，7.64(1H，d，J＝7.5Hz)，8.13(1H，br d，J＝8.1Hz)。
Reference example 167 2-methylol-3-methoxymethoxy-1 benzothiophene
Identical with reference example 166, obtain the table title chemical compound of faint yellow oily by 3-methoxymethoxy-1-benzothiophene-2-carboxylate methyl ester, yield is 91%.
1H-NMR(CDCl 3)δ2.72(1H，t，J＝6.6Hz)，3.68(3H，s)，4.80(2H，d，J＝6.6Hz)，5.11(2H，s)，7.30-7.43(2H，m)，7.66-7.82(2H，m)。
Reference example 168 2-methylol-3-(2-first benzyloxy)-1-benzothiophene
Identical with reference example 166, obtain the table title chemical compound of faint yellow oily by 3-(2-first benzyloxy)-1-benzothiophene-2-carboxylate methyl ester, yield is 58%.
1H-NMR(CDCl 3)δ2.42(3H，s)，4.50(2H，d，J＝5.2Hz)，5.17(2H，s)，7.10-7.82(8H，m)。
Reference example 169 (2 ', 6 '-dimethyl-6-methoxyl biphenyl-3-yl) methanol
Identical with reference example 199 described later with reference example 200, obtain the table title chemical compound of colorless oil, yield is 76%.
1H-NMR(CDCl 3)δ2.01(6H，s)，3.74(3H，s)，4.65(2H，d，J＝5.2Hz)，6.97(1H，d，J＝8.4Hz)，7.03(1H，d，J＝2.2Hz)，7.06-7.24(3H，m)，7.35(1H，dd，J＝2.6 & 8.4Hz)。
Reference example 170 (2 ', 6 '-dimethyl-4-methoxyl biphenyl-3-yl) methanol
Identical with reference example 199 described later with reference example 200, obtain the table title chemical compound of colorless oil, yield is 82%.
1H-NMR(CDCl 3)δ2.03(6H，s)，2.37(1H，t，J＝6.6Hz)，3.92(3H，s)，4.71(2H，d，J＝6.6Hz)，6.94(1H，d，J＝8.8Hz)，7.02-7.22(5H，m)。
Reference example 171 (2E)-3-(4-benzyloxy-2,6-Dimethoxyphenyl) ethyl acrylate
At 4-hydroxyl-2,6-dimethoxy benzaldehyde (1.0g, 5.49mmol), benzylalcohol (0.65g, 6.01mmol) and tributylphosphine (1.5g, 7.41mmol) oxolane (120ml) solution in, add 1,1 '-(azo dicarbapentaborane) two piperidines (1.8g slightly at every turn, 7.13mmol), at room temperature stirred 18 hours.In reactant liquor, add diethyl ether (120ml), the insoluble matter that elimination is separated out, concentrating under reduced pressure filtrate.Residue is joined silica gel column chromatography (ethyl acetate: hexane=2: 3～1: 1), obtain 4-benzyloxy-2, the faint yellow crystallization of 6-dimethoxy benzaldehyde (1.2g).On the other hand, with the diethyl phosphonyl ethyl acetate (1.1g, 4.91mml) and 60% sodium hydride (0.17g, oxolane 4.25mmol) (40ml) solution stirred 10 minutes down ice-cooled.Add 4-benzyloxy-2 in this solution, 6-dimethoxy benzaldehyde (1.2g) stirred 5 hours after being warmed up to room temperature.With ethyl acetate diluting reaction solution, by the cleaning of aqueous citric acid solution, water and sodium-chloride water solution, use dried over mgso, concentrating under reduced pressure successively.The residue that obtains is cleaned with diethyl ether-hexane, obtains the table title chemical compound (1.2g) of colourless crystallization, and yield is 64%.MS 343.1(MH+)。
Reference example 172 (2E)-3-(4-hydroxyl-2,6-Dimethoxyphenyl) ethyl propionate
With 3-(4-benzyloxy-2,6-Dimethoxyphenyl) ethyl acrylate (1.2g, 3.50mmol) and the mixed solution of the ethanol (30ml) of 10% palladium-carbon (0.40g) and oxolane (30ml) under hydrogen environment atmosphere, at room temperature stirred 18 hours.The elimination catalyst concentrates filtrate decompression, obtains the table title chemical compound (800mg) of colourless crystallization, and yield is 90%.
MS 255.1(MH +)。
Reference example 173 3-(2,6-two fluoro-4-methoxyphenyls) ethyl propionate
With the diethyl phosphonyl ethyl acetate (2.34g, 10.4mml) and 60% sodium hydride (0.38g, oxolane 9.50mmol) (40ml) solution stirred 10 minutes down ice-cooled.Add 2 in this solution, (1.5g 8.71mmol), is warmed up to after the room temperature and stirred 4 hours 6-two fluoro-4-methoxybenzaldehydes.With ethyl acetate diluting reaction solution, after cleaning with aqueous citric acid solution, water, sodium-chloride water solution successively, use dried over mgso, concentrating under reduced pressure.With the residue that obtains by silica gel column chromatography (ethyl acetate: hexane=1: 10～1: 5) then identical with reference example 172, carry out catalytic reduction reaction, obtain the table title chemical compound (1.17g) of colorless oil, yield is 52%.MS 245.0(MH+)。
Reference example 174 3-(2,6-two fluoro-4-hydroxy phenyls) ethyl propionate
With 3-(2,6-two fluoro-4-methoxyphenyls) ethyl propionate (1.17g, 4.79mmol), aluminum chloride (1.9g, 14.2mmol), 1-octyl mercaptan (1.7ml, dichloromethane solution 9.80mmol) (20ml) from ice-cold down to stirring at room 4 hours.Reactant liquor is injected in the frozen water restir 1 hour.With this mixed liquor of dichloromethane extraction, after cleaning with sodium-chloride water solution, use dried over mgso, concentrating under reduced pressure.The residue that obtains is passed through silica gel column chromatography, and (ethyl acetate: hexane=1: 10～1: 5), obtain the table title chemical compound (1.0g) of colorless oil, yield is 91%.MS 230.9(MH+)。
Reference example 175 (6-benzyloxy-2 ', 6 '-dimethyl-biphenyl-3-yl) methanol
Identical with reference example 199 described later with reference example 200, obtain the table title chemical compound of colorless oil, yield is 37%.
1H-NMR(CDCl 3)δ1.56(1H，t，J＝5.6Hz)，2.04(6H，s)，4.65(2H，d，J＝5.6Hz)，5.03(2H，s)，6.96-7.44(11H，m)。
Reference example 176 (2, the 6-3,5-dimethylphenyl) [4-(1,3 two oxa-, penta ring-2-yl) phenyl] methanol
Magnesium (1.20g) is joined rapid mixing stirring in the oxolane (50mL), add iodine (10mg) simultaneously, at room temperature splash into 2-(4-bromophenyl)-1,3 two oxa-penta ring (10.0g).After splashing into end, at room temperature, reaction mixture was stirred 1 hour, under 0 ℃, splash into 2, oxolane (20mL) solution of 6-dimethylbenzaldehyde (5.0g).After splashing into end, make reactant mixture get back to room temperature, stirred 1 hour, reactant mixture is injected in the aqueous ammonium chloride solution, use ethyl acetate extraction.Concentrate ethyl acetate layer, with the refining residue of silica gel column chromatography.Launch by ethyl acetate-hexane (volumetric ratio was by 1: 9 to 7: 3 alternation), obtain the table title chemical compound (9.10g, yield 73%) of yellow oily.
1H NMR(300MHz，Chloroform-D)δ：2.14-2.23(1H，m)，2.26(6H，s)，3.97-4.19(4H，m)，5.79(1H，s)，6.35(1H，d，J＝4.1Hz)，7.03(2H，d，J＝7.5Hz)，7.05-7.2(1H，m)，7.29(2H，d，J＝7.7Hz)，7.35-7.45(2H，m)。
Reference example 177 (2, the 6-3,5-dimethylphenyl) [3-(1,3-two oxa-s penta ring-2-yl) phenyl] methanol
Identical with reference example 176, obtain the table title chemical compound thing of yellow oily, yield is 74%.
1H NMR(300MHz，Chloroform-D)δ：2.17(1H，d，J＝4.3Hz)，2.27(6H，s)，3.87-4.23(4H，m)，5.77(1H，s)，6.25-6.4(1H，m)，7.0-7.55(7H，m)。
Reference example 178 [4-(2, the 6-dimethyl benzyl) phenyl] methanol
With (2, the 6-3,5-dimethylphenyl) [4-(1,3-two oxa-s penta ring-2-yl) phenyl] methanol (7.10g) ,-mixture of chlorine trimethyl silane (10.8g), sodium iodide (15.0g), acetonitrile (50mL) stirred 1 hour down at 50 ℃.Reactant mixture is injected water, use ethyl acetate extraction.In 10% sodium bicarbonate aqueous solution and saturated aqueous common salt, clean ethyl acetate layer successively, with concentrating behind the anhydrous magnesium sulfate drying.With the refining residue of silica gel column chromatography.Launch by ethyl acetate-hexane (volumetric ratio is alternation from 1: 9 to 7: 3), obtain the faint yellow crystallization of 4-(2, the 6-dimethyl benzyl) benzaldehyde.
1H NMR(300MHz，Chloroform-D)δ：2.23(6H，s)，4.13(2H，s)，7.05-7.2(5H，m)，7.76(2H，d，J＝8.3 Hz)，9.95(1H，s)。
This chemical compound (3.70g) is dissolved in oxolane (50mL),, stir, add lithium aluminium hydride (1.0g) 0 ℃ of cooling down.Mix stirring down after 1 hour at 0 ℃, add sal glauberi (5.0g), after reactant mixture returns to room temperature, stirred 30 minutes.By removing by filter insoluble matter, concentrate resulting organic layer, obtain faint yellow crystalline table title chemical compound (3.43g, yield 61%).
1H NMR(300MHz，Chloroform-D)δ：1.54(1H，t，J＝6Hz)，2.23(6H，s)，4.05(2H，s)，4.64(2H，d，J＝6Hz)，7.00(2H，d，J＝7.9Hz)，7.05-7.15(3H，m)，7.24(2H，d，J＝8.1Hz)
Reference example 179 [3-(2, the 6-dimethyl benzyl) phenyl] methanol
Identical with reference example 178, synthesized the table title chemical compound of yellow oily by (2, the 6-3,5-dimethylphenyl) [3-(1,3 two oxa-, penta ring-2-yl) phenyl] methanol, yield is 52%.
1H NMR(300MHz，Chloroform-D)δ：2.24(6H，s)，4.06(2H，s)，4.62(2H，s)，6.8-7.4(7H，m)。
Reference example 180 3-(4-{[4-(chloromethyl) benzyl] the oxygen base } phenyl) methyl propionate
4-(chloromethyl) benzylalcohol (4.68g), 3-(4-hydroxy phenyl) methyl propionate (5.40g), triphenylphosphine (9.20g) are dissolved in the mixed solvent of toluene-oxolane (60-30mL), 0 ℃ of cooling down, while mix stir splash into the diethylazodicarboxylate (40% toluene solution, 15.2g).Splashing into end of a period, making reactant mixture return to room temperature and stirred 1 hour.Reactant mixture is concentrated, use the silica gel column chromatography refinement residue.Launch by ethyl acetate-hexane (volumetric ratio is alternation from 1: 19 to 1: 1), obtain the table title chemical compound (5.19g, yield 54%) of colourless crystallization.
1H NMR(300MHz，Chloroform-D)δ：2.59(2H，t，J＝7.7Hz)，2.89(2H，t，J＝7.7Hz)，3.66(3H，s)，4.59(2H，s)，5.04(2H，s)，6.89(2H，d，J＝8.7Hz)，7.11(2H，d，J＝8.7Hz)，7.35-7.45(4H，m)。
Reference example 181 N-isobutyl group-4-phenyl-1,3-thiazoles-2-amine
With 2-bromo-1-Propiophenone (4.0g), N-isobutyl group thiourea (2.60g), N, the mixture of dinethylformamide (15mL) at room temperature stirred 1 hour.Reactant mixture is injected in the saturated sodium bicarbonate aqueous solution, uses ethyl acetate extraction.After concentrating ethyl acetate layer, with the refining residue of silica gel column chromatography.Launch by ethyl acetate-hexane (volumetric ratio is alternation from 1: 9 to 2: 1), obtain the table title chemical compound (3.30g, 71%) of yellow oily.
1H NMR(300MHz，Chloroform-D)δ：1.01(6H，d，J＝6.6Hz)，1.89-2.04(1H，m)，3.05-3.15(2H，m)，5.26(1H，broads)，6.69(1H，s)，7.25-7.3(1H，m)，7.3-7.4(2H，m)，7.75-7.85(2H，m)。
Identical with reference example 181, synthetic chemical compound below with reference to routine 182-184.
Reference example 182 N-isopropyl-4-phenyl-1,3-thiazoles-2-amine
Obtain yellow oil, yield is 80%.
1H NMR(300MHz，Chloroform-D)δ：1.31(6H，d，J＝6.3Hz)，3.65-3.80(1H，m)，4.95-5.05(1H，m)，6.69(1H，s)，7.2-7.4(3H，m)，7.7-7.8(2H，m)
Reference example 183 N-hexyl-4-phenyl-1,3-thiazoles-2-amine
Obtain yellow oil, yield is 94%.
1H NMR(300MHz，Chloroform-D)δ：0.8-1.0(3H，m)，1.1-1.5(6H，m)，1.5-1.8(2H，m)，3.2-3.4(2H，m)，5.20(1H，broads)，6.70(1H，s)，7.15-7.5(3H，m)，7.7-7.8(2H，m)
Reference example 184 N-(3-methyl butyl)-4-phenyl-1,3-thiazoles-2-amine
Obtain yellow oil, yield is 91%.
1H NMR(300MHz，Chloroform-D)δ：0.96(6H，d，J＝6.6Hz)，1.40-1.65(2H，m)，1.65-1.8(1H，m)，3.2-3.4(2H，m)，5.13(1H，broads)，6.70(1H，s)，7.2-8.05(5H，m)
Reference example 185 N-propyl group-4-[4-(trifluoromethyl) phenyl]-1,3-thiazoles-2-amine hydrobromate
With 2-bromo-1-[4-(trifluoromethyl) phenyl] mixture heated of ethyl ketone (5.34g), N-propyl group thiourea (2.60g), ethanol (50mL) back of refluxing stirred 1 hour.After the reactant mixture cooling, with the isopropyl ether dilution, the solids that elimination is separated out is cleaned after drying with isopropyl ether, obtains the table title chemical compound (5.11g, yield 70%) of colourless crystallization.
1H NMR(300MHz，DMSO-D6)δ：0.96(3H，t，J＝7.4Hz)，1.45-1.8(2H，m)，3.31(2H，t，J＝7.0Hz)，7.30(1H，s)，7.75(2H，d，J＝8.5Hz)，8.00(2H，d，J＝8.5Hz)
Identical with reference example 185, synthetic chemical compound below with reference to example 186 and reference example 187.
Reference example 186 4-(4-chlorphenyl)-N-propyl group-1,3-thiazoles-2-amine hydrobromate
Obtain colourless crystallization, yield is 71%.
1H NMR(300MHz，DMSO-D6)δ：0.95(3H，t，J＝7.4Hz)，1.4-1.8(2H，m)，3.30(2H，t，J＝7.1Hz)，7.15(1H，s)，7.48(2H，d，J＝8.5Hz)，7.66-7.96(2H，m)。
Reference example 187 4-(3-methoxyphenyl)-N-propyl group-1,3-thiazoles-2-amine hydrobromate
Obtain faint yellow crystallization, yield is 71%.
1H NMR(300MHz，DMSO-D6)δ：0.95(3H，t，J＝7.4Hz)，1.45-1.7(2H，m)，3.32(2H，t，J＝7.1Hz)，3.81(3H，s)，6.85-7.0(1H，m)，7.1-7.2(1H，m)，7.25-7.4(3H，m)。
Reference example 188 N-propyl group-5-phenyl-1,3-thiazoles-2-amine
Under 0 ℃, in dichloromethane (10mL) solution of hyacinthin (1.20g), splash into bromine (1.60g), go back up to after the room temperature and stirred 1 hour.Reactant mixture is injected in the sodium sulfite aqueous solution, uses ethyl acetate extraction.Concentrate ethyl acetate layer, in residue, add N-propyl group thiourea (1.18g), ethanol (30mL), reflux, stirring 1 hour.The concentration response thing is injected in the sodium bicarbonate aqueous solution, uses ethyl acetate extraction.Concentrate ethyl acetate layer, with the refining residue of silica gel column chromatography.Launch by ethyl acetate-hexane (volumetric ratio is alternation from 1: 9 to 2: 1), obtain the table title chemical compound (120mg, yield 5%) of colourless crystallization.
1H NMR(300MHz，Chloroform-D)δ：1.02(3H，t，J＝7.4Hz)，1.6-1.85(2H，m)，3.28(2H，t，J＝6.7Hz)，5.30(1H，broads)，7.20(1H，t，J＝7.3Hz)，7.25-7.4(3H，m)，7.4-7.45(2H，m)
Reference example 189 3-(3-methylphenoxy) benzaldehyde
At 170 ℃, under nitrogen environment atmosphere, with 3-bromobenzaldehyde (7.01g, 37.9mmol), metacresol (4.51g, 41.7mmol), copper oxide (II) (4.53g, 56.9mmol), potassium carbonate (7.86g, 56.9mmol), the mixture of pyridine (50mL) and quinoline (25mL) stirred 24 hours.After the reactant mixture cooling, pyridine is removed in decompression.Add ethyl acetate in residue, behind the elimination insoluble matter, filtrate is cleaned with 1M hydrochloric acid, saturated aqueous common salt, uses anhydrous sodium sulfate drying, and decompression removes down and desolvates.With the refining residue of silica gel column chromatography (hexane～10% ethyl acetate/hexane), obtain the buttery table title chemical compound of Sandy (5.80g, 72%).
MS：m/z 213(MH +)。
Reference example 190 [3-(3-methylphenoxy) phenyl] methanol
1, dissolve in the mixed liquor of 2-dimethoxy-ethane (30mL) and oxolane (30mL) 3-(3-methylphenoxy) benzaldehyde (5.80g, 27.3mmol), ice-cooled down, add sodium borohydride (0.567g, 15.0mmol) after, equality of temperature stirred 4 hours.In reactant liquor, add dilute hydrochloric acid, use ethyl acetate extraction.Extracting solution is cleaned with saturated aqueous common salt, behind anhydrous magnesium sulfate drying, and concentrating under reduced pressure.With the refining residue of silica gel column chromatography (20%～60% ethyl acetate/hexane), obtain faint yellow oily table title chemical compound (4.83g, yield 83%).
1H NMR(CDCl 3)δ1.66(t，J＝6.0Hz，1H)，2.33(s，3H)，4.67(d，J＝6.0Hz，2H)，6.79-6.83(m，2H)，6.90-6.94(m，2H)，7.01(s，1H)，7.09(d，J＝7.5Hz，1H)，7.19-7.34(m，2H)。
Reference example 191 3-(4-methylphenoxy) benzaldehyde
Identical with reference example 189, obtain the table title chemical compound of yellow oily by 3-bromobenzaldehyde and paracresol, yield is 83%.
MS：m/z 213(MH +)。
Reference example 192 [3-(4-methylphenoxy) phenyl] methanol
Identical with reference example 190, obtain the table title chemical compound of colorless oil by 3-(4-methylphenoxy) benzaldehyde, yield is 86%.
1H NMR(CDCl 3)δ1.62(t，J＝6.1Hz，1H)，2.34(s，3H)，4.66(d，J＝6.1Hz，2H)，6.88-6.94(m，3H)，6.98(s，1H)，7.06(d，J＝7.7Hz，1H)，7.14(d，J＝8.7Hz，2H)，7.30(t，J＝7.7Hz，1H)。
Reference example 193 (3-bromophenyl) (phenyl) ketone
Under ice-cooled, (9.50g, in benzene 43.3mmol) (30mL) solution, (6.93g 52.0mmol), adopts the form of each a small amount of adding, is warmed up to 50 ℃ and stirs 2 hours to add aluminum chloride (III) to the 3-bromo-benzoyl chloride.Reactant mixture is injected in the frozen water, uses ethyl acetate extraction.Extracting solution is cleaned with saturated aqueous common salt, uses dried over mgso, and decompression removes down and desolvates.With the refining residue of silica gel column chromatography (hexane～5% ethyl acetate/hexane), obtain the crystalline table title chemical compound of pale red (10.7g, yield 95%).
MS：m/z 261(MH +)。
Reference example 194 1-bromo-3-(1-phenyl vinyl) benzene
Under ice-cooled, (13.3g, add tert-butoxy potassium in oxolane 33.3mmol) (80mL) suspension slightly (3.37g, 30.0mmol), under nitrogen environment atmosphere, equality of temperature stirred 4 hours at every turn to the methyl triphenyl phosphonium iodide.(5.22g, oxolane 20.0mmol) (20mL) solution stirred 2 hours under ice-cold condition afterwards to splash into (3-bromophenyl) (phenyl) ketone in the reactant liquor.Add entry in reactant liquor, with cleaning with saturated aqueous common salt behind the ethyl acetate extraction, after dried over mgso, decompression removes down and desolvates.With the refining residue of silica gel column chromatography (hexane～10% ethyl acetate/hexane), obtain colorless oil table title chemical compound (5.18g, yield 92%).
MS：m/z 259(MH +)。
Reference example 195 3-(1-phenyl vinyl) benzaldehyde
Under nitrogen environment atmosphere, with 1-bromo-3-(1-phenyl vinyl) benzene (1.00g, oxolane 3.86mmol) (5mL) solution be-78 ℃ of stirrings, splash into 1.6M n-BuLi/hexane solution (3mL, 4.8mmol).After 1 hour, add N, (0.372mL 4.80mmol), was stirring 2 hours with relaxing the bowels with purgatives of warm nature dinethylformamide.In reactant liquor, add aqueous ammonium chloride solution, use ethyl acetate extraction.Extracting solution is cleaned with saturated aqueous common salt, behind anhydrous magnesium sulfate drying, and concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane～20% ethyl acetate/hexane), obtain the table title chemical compound (0.626g, yield 78%) of colorless oil.
MS：m/z 209(MH +)。
Reference example 196 [3-(1-phenyl vinyl) phenyl] methanol
Identical with reference example 190, obtain the table title chemical compound of colorless oil by 3-(1-phenyl vinyl) benzaldehyde, yield is 84%.
1H NMR(CDCl 3)δ1.68(t，J＝5.3Hz，1H)，4.69(d，J＝5.3Hz，2H)，5.47(s，2H)，7.24-7.34(m，9H)。
Reference example 197 3-(2-methyl isophthalic acid-naphthyl) benzaldehyde
With 1-bromo-2-methyl naphthalene (3.32g; 15.0mmol), (3-formoxyl phenyl) boric acid (2.13g; 15.0mmol) be dissolved in the mixed solution of 1M aqueous sodium carbonate (30mL), ethanol (15mL) and toluene (30mL); after argon replaces; adding tetrakis triphenylphosphine palladium (0) (0.867g, 0.750mmol).Reactant liquor stirred 24 hours at 80 ℃ under ar gas environment atmosphere.After the reactant liquor cooling, water and ethyl acetate dilution are with kieselguhr elimination insoluble matter.With the organic layer of the clean filtrate of saturated aqueous common salt, behind anhydrous magnesium sulfate drying, concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane～20% ethyl acetate/hexane), obtain the table title chemical compound (2.39g, yield 65%) of faint yellow oily.
MS：m/z 247(MH +)。
Reference example 198 [3-(2-methyl isophthalic acid-naphthyl) phenyl] methanol
Identical with reference example 190, obtain colourless toughness oily table title chemical compound by 3-(2-methyl isophthalic acid-naphthyl) benzaldehyde, yield is 81%.
1H NMR(CDCl 3)δ1.74(t，J＝5.3Hz，1H)，2.24(s，3H)，4.78(d，J＝5.3Hz，2H)，7.20-7.53(m，8H)，7.77-7.85(m，2H)。
Reference example 199 2 ', 6 '-dimethyl diphenyl-3-formaldehyde (carbaldehyde)
With 3-bromobenzaldehyde (18.5g, 100mmol), 2,6-dimethyl benzene ylboronic acid (21.0g, 140mmol) be dissolved in the mixed liquor of 1M aqueous sodium carbonate (200mL), ethanol (100mL) and toluene (200mL), after argon replaces, adding tetrakis triphenylphosphine palladium (0) (5.78g, 5.00mmol).Reactant liquor stirred 20 hours at 80 ℃ under ar gas environment atmosphere, and after the reactant liquor cooling, water and ethyl acetate dilution are with kieselguhr elimination insoluble matter.With the organic layer of the clean filtrate of saturated aqueous common salt, behind anhydrous magnesium sulfate drying, concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane～10% ethyl acetate/hexane), obtain the table title chemical compound (20.4g, yield 97%) of colorless oil.
MS：m/z 211(MH +)。
Reference example 200 (2 ', 6 '-dimethyl diphenyl-3-yl) methanol
With 2 ', 6 '-dimethyl diphenyl-3-formaldehyde (carbaldehyde) (18.5g, 88.0mmol) 1, dissolve in the mixed liquor of 2-dimethoxy-ethane (100mL) and oxolane (100mL), under ice-cooled, and the adding sodium borohydride (1.66g, 44.0mmol), stirred 3 hours with relaxing the bowels with purgatives of warm nature, at room temperature stirred again 3 hours.In reactant liquor, add dilute hydrochloric acid, use ethyl acetate extraction.Clean extracting solution with saturated aqueous common salt, behind anhydrous magnesium sulfate drying, concentrating under reduced pressure.With the refining residue of silica gel column chromatography (10%～50% ethyl acetate/hexane), obtain the table title chemical compound (15.6g, yield 83%) of colorless oil.
1H NMR(CDCl 3)δ1.66(t，J＝5.9Hz，1H)，2.03(s，6H)，4.74(d，J＝5.9Hz，2H)，7.07-7.19(m，5H)，7.35(d，J＝7.5Hz，1H)，7.43(t，J＝7.5Hz，1H)。
Reference example 201 [3-(2, the 6-dimethyl phenoxy) phenyl] methanol
With 3-bromobenzaldehyde (6.1g, 32.7mmol), 2,6-xylenol (4.0g, 32.7mmol), copper oxide (II) (4.4g, 55.6mmol), potassium carbonate (9.0g, 65.4mmol), the mixture of pyridine (40mL) and meta-xylene (20mL) under nitrogen environment atmosphere, stirred 16 hours at 140 ℃.With the reactant mixture cooling, remove by filter insoluble matter, concentrating under reduced pressure filtrate.Residue comes separatory with ethyl acetate and water, cleans organic layer with saturated aqueous common salt, uses anhydrous sodium sulfate drying, and decompression concentrates down, obtains thick 3-(2, the 6-dimethyl phenoxy) benzaldehyde (containing byproduct of reaction).
This chemical compound is dissolved in methanol (74mL), ice-cooled add down sodium borohydride (0.62g, 16.4mmol) after, stirring 2 hours with relaxing the bowels with purgatives of warm nature.Behind the concentration of reaction solution, dilute residue, with concentrating under reduced pressure after 1 regulation hydrochloric acid and the saturated aqueous common salt cleaning, drying with ethyl acetate.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=4/1～2/1), obtain the table title chemical compound (1.7g, yield 23%) of yellow crystal.
1H NMR(CDCl 3)δ：1.60(1H，t，J＝6.0Hz)，2.12(6H，s)，4.64(2H，d，J＝6.0Hz)，6.65(1H，dd，J＝2.7，8.1Hz)，6.80(1H，s)，6.97(1H，d，J＝7.5Hz)，7.02-7.13(3H，m)，7.22(1H，d，J＝7.5Hz)。
Reference example 202 4-(benzyloxy) benzaldehyde
4-hydroxy phenyl formaldehyde (28.2g, 231mmol), potassium carbonate (47.9g, 347mmol), potassium iodide (3.84g, 23.1mmol) and N, in the mixture of dinethylformamide (280mL), under stirring at room, (27.5mL 231mmol), stirred 24 hours with relaxing the bowels with purgatives of warm nature to add benzyl bromide a-bromotoluene.Reactant liquor dilutes with ethyl acetate, and with after 1 regulation hydrochloric acid and the saturated aqueous common salt cleaning, drying, concentrating under reduced pressure obtains the crystalline table title chemical compound of the shallow colour of camel's hair (48g, yield 98%) successively.
1H NMR(CDCl 3)δ：5.16(2H，s)，7.08(2H，d，J＝8.7Hz)，7.31-7.48(5H，m)，7.84(2H，d，J＝8.7Hz)，9.89(1H，s)。
Reference example 203 (2E)-3-[4-(benzyloxy) phenyl] tert-butyl acrylate
Under 0 ℃, ((2.45g 61.2mmol), stirred 15 minutes with relaxing the bowels with purgatives of warm nature Yi Bian add 60% sodium hydride for 13.8g, oxolane 51.8mmol) (100mL) solution Yi Bian stir the diethyl phosphonyl tert-butyl acetate.Then, under 0 ℃, stir on one side, (10g, tetrahydrofuran solution 47.1mmol) (138mL) at room temperature stirred 3 hours to splash into 4-(benzyloxy) benzaldehyde to this mixture on one side.After reactant liquor concentrated, dilute residue with ethyl acetate, aqueous potassium hydrogen sulfate with 5% and saturated aqueous common salt are clean.Behind the dried over mgso ethyl acetate layer, concentrating under reduced pressure obtains the table title chemical compound (13.7g, yield are 94%) of colourless crystallization.
1H NMR(CDCl 3)δ：1.53(9H，s)，5.09(2H，s)，6.24(1H，d，J＝15.9Hz)，6.96(2H，d，J＝9.0Hz)，7.32-7.49(7H，m)，7.54(1H，d，J＝15.9Hz)。
Reference example 204 3-(4-hydroxy phenyl) the propanoic acid tert-butyl ester
(2E)-and 3-[4-(benzyloxy) phenyl] (13.3g 42.8mmol), the mixture of 10%Pd carbon (1.3g), ethanol (100mL) and oxolane (30mL), stirred 2 hours under hydrogen environment atmosphere tert-butyl acrylate.Remove by filter catalyst, concentrating under reduced pressure filtrate obtains the table title chemical compound (7.5g, yield 79%) of colourless crystallization.
1H NMR(CDCl 3)δ：1.41(9H，s)，2.50(2H，t，J＝7.8Hz)，2.83(2H，t，J＝7.8Hz)，6.74(2H，d，J＝8.7Hz)，7.06(2H，d，J＝8.7Hz)。
Reference example 205 3-[4-[(3-bromobenzyls) oxygen] phenyl] the propanoic acid tert-butyl ester
Under 0 ℃, (5.5g, (1.09g 27.2mmol), stirred 15 minutes with relaxing the bowels with purgatives of warm nature the sodium hydride of stirring adding 60% among N 24.7mmol), dinethylformamide solution (100mL) to 3-(4-hydroxy phenyl) the propanoic acid tert-butyl ester.Then, under 0 ℃, stirring in this mixture and to add the 3-bromo benzyl bromo (6.55g 25.91mmol), at room temperature stirred 12 hours.Reactant liquor dilutes with ethyl acetate, and water and saturated aqueous common salt are cleaned, and with behind the dried over mgso ethyl acetate layer, and concentrating under reduced pressure obtains the table title chemical compound (7.5g, yield 78%) of colourless powder.
1H NMR(CDCl 3)δ：1.41(9H，s)，2.50(2H，t，J＝7.8Hz)，2.85(2H，t，J＝7.8Hz)，5.01(2H，s)，6.87(2H，d，J＝8.7Hz)，7.12(2H，d，J＝8.7Hz)，7.24(1H，m)，7.34(1H，d，J＝7.5Hz)，7.44(1H，m)，7.59(1H，s)。
Reference example 206 2 ', 6 '-diethyl biphenyl base-3-formaldehyde (carbaldehyde)
With 1; 3-diethyl-2-bromobenzene (3.87g; 18.2mmol), 3-formylphenylboronic acid (3.0g; 20.0mmol), tetra-triphenylphosphine palladium (0.84g; 0.73mmol), sodium carbonate (5.79g; 54.6mmol), the mixture of water (20mL), ethanol (20mL) and toluene (200mL), one evening of reflux under ar gas environment atmosphere.The cooling reactant liquor, and with ethyl acetate dilution, wash, after the drying, concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane～hexane/ethyl acetate=5/1), obtain the table title chemical compound (3.48g, yield 81%) of yellow oily.
1H NMR(CDCl 3)δ：1.01(6H，t，J＝7.5Hz)，2.30(4H，q，J＝7.5Hz)，7.16(2H，d，J＝7.5Hz)，7.31(1H，m)，7.47(1H，dt，J＝1.5，7.5Hz)，7.60(1H，d，J＝7.5Hz)，7.71(1H，t，J＝1.5Hz)，7.89(1H，dt，J＝1.5，7.5Hz)，10.06(1H，s)。
Reference example 207 (2 ', 6 '-diethyl biphenyl-3-yl) methanol
2 ', (3.48g, in the mixed solution of methanol 14.6mmol) (35mL) and oxolane (35mL), under ice-cooled, (0.28g 7.3mmol), stirred 1 hour with relaxing the bowels with purgatives of warm nature 6 '-diethyl biphenyl-3-formaldehyde to add sodium borohydride.With the pH value to 3 of 1 regulation hydrochloric acid conditioned reaction liquid, with the ethyl acetate dilution, water and saturated aqueous common salt cleaning, drying (magnesium sulfate) back concentrating under reduced pressure successively again.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=10/1～2/1), obtain the table title chemical compound (2.82g, yield 80%) of colorless oil.
1H NMR(CDCl 3)δ：1.02(6H，t，J＝7.5Hz)，1.68(1H，t，J＝5.7Hz)，2.31(4H，q，J＝7.5Hz)，4.74(2H，d，J＝5.7Hz)，7.08-7.21(4H，m)，7.27(1H，m)，7.33-7.46(2H，m)。
Reference example 208 2 ', 6 '-DfBP-3-formaldehyde (carbaldehyde)
Identical with reference example 206, by 1,3-two fluoro-2-bromobenzenes and the buttery table title chemical compound of 3-formylphenylboronic acid synthesizing colourless (3.0g, yield 93%).
1H NMR(CDCl 3)δ：6.97-7.09(2H，m)，7.34(1H，m)，7.64(1H，t，J＝7.5Hz)，7.75(1H，m)，7.93(1H，dt，J＝1.5，7.5Hz)，7.99(1H，m)，10.08(1H，s)。
Reference example 209 (2 ', 6 '-DfBP-3-yl) methanol
Identical with reference example 207, by 2 ', the crystalline table title chemical compound of 6 '-DfBP-3-formaldehyde synthesizing colourless, yield is 90%.
1H NMR(CDCl 3)δ：1.72(1H，br)，4.76(2H，s)，6.92-7.04(2H，m)，7.29(1H，m)，7.35-7.51(4H，m)。
Reference example 210 3-anilino-essence of Niobe
With 3-methyl-bromobenzoate (5.87g, 27.3mmol), aniline (3.73mL, 41.0mmol), cesium carbonate (12.5g, 38.2mmol), three (benzylideneacetones), two palladiums (O) (1.0g, 1.09mmol), rac-2,2 '-two (diphenyl phosphine)-1,1 '-dinaphthalene (1.02g, 1.64mmol) and the mixture of toluene (60mL), under nitrogen environment atmosphere, stirred 16 hours at 80 ℃.After the reactant liquor cooling, water and saturated aqueous common salt are cleaned, after dried over mgso, and concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=10/1～4/1), obtain faint yellow crystalline table title chemical compound (2.13g, yield 34%).
1H NMR(CDCl 3)δ：3.90(3H，s)，5.79(1H，s)，6.98(1H，t，J＝7.5Hz)，7.09(2H，d，J＝7.5Hz)，7.21-7.36(4H，m)，7.57(1H，dt，J＝1.5，7.5Hz)，7.72(1H，t，J＝1.8Hz)。
Reference example 211 (3-anilino-phenyl) methanol
Under 0 ℃, ((0.36g 9.37mmol), stirred 2 hours with relaxing the bowels with purgatives of warm nature to stir the adding lithium aluminium hydride among the 2.13g, tetrahydrofuran solution 9.37mmol) (22mL) to 3-anilino-essence of Niobe.(9.1g 28.1mmol), at room temperature stirred 5 hours slowly to add sal glauberi in reactant mixture.Remove by filter insoluble matter, filtrate decompression is concentrated.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=10/1～4/1), obtain the table title chemical compound (1.12g, yield are 60%) of colorless oil.
1H NMR(CDCl 3)δ：1.61(1H，t，J＝5.4Hz)，4.65(2H，d，J＝3.6Hz)，5.73(1H，s)，6.88-7.04(3H，m)，7.05-7.13(3H，m)，7.22-7.33(3H，m)。
Reference example 212 5-(2-(4-((3-phenoxy benzyl) oxygen) phenyl) ethyl)-1H-tetrazolium
Under 110 ℃, with 3-(4-((3-phenoxy benzyl) oxygen) phenyl) propionitrile (0.5g, 1.52mmol), sodium azide (0.49g, 7.54mmol), ammonium chloride (0.41g, N 7.66mmol), dinethylformamide (20ml) solution stirring 28 hours.Use the ethyl acetate dilute reaction solution, clean with citric acid, water, sodium-chloride water solution successively, use dried over mgso, concentrating under reduced pressure.The residue that obtains is by silica gel column chromatography (ethyl acetate: hexane=2: 3～2: 1), with the grease crystallization that obtains, obtain table title chemical compound (0.24g, yield are 43%) with ethyl acetate-oxolane.
MS 373.1(MH +)。
Reference example 213 3-(2-(4-((3-phenoxy benzyl) oxygen) phenyl) ethyl)-1,2,4-oxadiazole-5 (4H)-ketone
With (1Z)-N-hydroxyl-3-(4-((3-phenoxy benzyl) oxygen) phenyl) propionyl imines amide (0.50g, 1.38mmol), (0.56g, oxolane 3.45mmol) (20ml) solution at room temperature stirred 5 hours carbonyl dimidazoles.Use the ethyl acetate dilute reaction solution, clean with aqueous citric acid solution, water, sodium-chloride water solution successively, with concentrating under reduced pressure after the dried over mgso.The residue that obtains is by silica gel column chromatography (ethyl acetate: hexane=1: 1～ethyl acetate: methanol=10: 1), obtain faint yellow crystallization (0.165g).Then, this crystallization is dissolved in the diox (6ml), stirred 1 hour down at 110 ℃.Use the ethyl acetate dilute reaction solution, clean with aqueous citric acid solution, water, sodium-chloride water solution successively, with concentrating under reduced pressure after the dried over mgso.The residue that obtains is by silica gel column chromatography (ethyl acetate: hexane=1: 1), with ethyl acetate-hexane recrystallize, obtain the colourless prism (94mg, yield 74%) of table title chemical compound.
MS 389.2(MH +)。
Reference example 214 4-(2-{4-[(3-phenoxy benzyl) oxygen] phenyl } ethyl)-3H-1,2,3,5-Evil thiadiazoles 2-oxide
With (1Z)-N-hydroxyl-3-(4-((3-phenoxy benzyl) oxygen) phenyl) propionyl imines amide (0.50g, 1.38mmol) and thionyl chloride (0.105ml, dimethyl acetylamide 1.44mmol) (20ml) solution at room temperature stirred 5 hours.With ethyl acetate diluting reaction solution, water, sodium-chloride water solution are cleaned successively, with concentrating under reduced pressure after the dried over mgso.The residue that obtains is passed through silica gel column chromatography (ethyl acetate: hexane=1: 2～2: 3), obtain the table title chemical compound (75mg, yield 13%) of faint yellow oily.
MS 409.1(MH +)。
Reference example 215 4-isopropyl-N-(3-methyl butyl)-1,3-thiazoles-2-amine
Methanol (30ml) solution of 3-methyl-2-butanone (2.64g) is cooled to-30 ℃, adds bromine (4.8g), mix and stir, be warmed up to room temperature.Add N-(3-methyl butyl) thiourea (2.92g), sodium acetate (2.40g) in the colourless solution that obtains, reflux stirred 2 hours.Concentrated reaction mixture is with washing after the ethyl acetate dilution.Concentrate ethyl acetate layer, with the refining residue of silica gel column chromatography.Launch by ethyl acetate-hexane (volumetric ratio is alternation from 1: 9 to 2: 1), obtain the table title chemical compound (0.90g, yield 21%) of yellow oily.
1H NMR(300MHz，Chloroform-D)δ：0.94(6H，d，J＝6.6Hz)，1.23(6H，d，J＝6.8Hz)，1.45-1.8(3H，m)，2.75-2.9(1H，m)，3.1-3.25(2H，m)，5.0-5.25(1H，m)，6.05(1H，d，J＝0.9Hz)。
Reference example 216 2 '-formoxyl-6 '-methyl biphenyl-3-carboxylate methyl ester
With 2-bromo-3-tolyl aldehyde (0.30g, 1.51mmol), three (two benzal acetone) two palladiums (O) (0.055g, 0.060mmol), 2-(dicyclohexyl phosphino-) biphenyl (0.032g, 0.091mmol), tripotassium phosphate (0.64g, 3.0mmol), 3-(methoxycarbonyl phenyl) boric acid (0.35g, 1.96mmol) and the mixture of toluene (6mL) under ar gas environment atmosphere, stirred 17 hours at 90 ℃.Behind the cooling reactant liquor, use the ethyl acetate dilute reaction solution, (anhydrous sodium sulfate) concentrating under reduced pressure after water and the saturated aqueous common salt cleaning, drying.With the refining residue of silica gel column chromatography (hexane～hexane/ethyl acetate=4/1), obtain yellow oily table title chemical compound (0.25g, yield 65%).
1H NMR(CDCl 3)δ：2.12(3H，s)，3.93(3H，s)，7.39-7.48(2H，m)，7.50-7.60(2H，m)，7.87(1H，dd，J＝0.9，7.8Hz)，7.95(1H，t，J＝1.5Hz)，8.12(1H，dt，J＝1.5，7.8Hz)，9.68(1H，s)。
Reference example 217 2 '-methyl-6 '-propyl group xenyl-3-carboxylate methyl ester
(1.55g, in the oxolane suspension (21mL) 4.13mmol), (0.14g, 3.58mmol), equality of temperature stirred 20 minutes at room temperature to stir the adding sodium hydride at the ethyl triphenyl phosphonium bromide.(0.70g, tetrahydrofuran solution 2.75mmol) (20mL) stirred 3 hours down at 70 ℃ add 2 '-formoxyl-6 '-methyl biphenyl-3-carboxylate methyl ester in this solution.Behind the cooling reactant liquor, use the ethyl acetate dilute reaction solution, with concentrating under reduced pressure after the saturated aqueous common salt cleaning, drying.Then, with the residue that obtains, 10% Pd carbon (0.1g) and the mixture of methanol (14mL), under hydrogen environment atmosphere, stirred 2 hours.Remove by filter catalyst, concentrating under reduced pressure filtrate.With the refining residue of silica gel column chromatography (hexane～hexane/ethyl acetate=4/1), obtain the table title chemical compound (0.63g, yield 85%) of colorless oil.
1H NMR(CDCl 3)δ：0.75(3H，t，J＝7.2Hz)，1.33-1.50(2H，m)，1.98(3H，s)，2.23-2.32(2H，m)，3.92(3H，s)，7.08-7.16(2H，m)，7.22(1H，t，J＝7.5Hz)，7.36(1H，m)，7.50(1H，t，J＝7.5Hz)，7.86(1H，t，J＝1.5Hz)，8.03(1H，m)。
Reference example 218 (2 '-methyl-6 '-propyl group biphenyl-3-yl) methanol
(0.63g in tetrahydrofuran solution 2.35mmol) (6.3mL), under 0 ℃, adds lithium aluminium hydride (0.089g, 2.35mmol), equality of temperature stirred 2 hours while stir to 2 '-methyl-6 '-propyl group xenyl-3-carboxylate methyl ester.(1.5g 4.7mmol), at room temperature stirred 5 hours slowly to add sal glauberi in reactant mixture.Remove by filter insoluble matter, concentrating under reduced pressure filtrate.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=10/1～2/1), obtain the table title chemical compound (0.50g, yield are 88%) of colorless oil.
1H NMR(CDCl 3)δ：0.77(3H，t，J＝7.5Hz)，1.36-1.51(2H，m)，1.65(1H，t，J＝5.4Hz)，2.00(3H，s)，2.25-2.34(2H，m)，4.74(2H，d，J＝5.4Hz)，7.06-7.16(4H，m)，7.20(1H，t，J＝7.5Hz)，7.35(1H，m)，7.42(1H，t，J＝7.5Hz)。
Reference example 219 2 '-isobutyl group-6 '-methyl biphenyl-3-carboxylate methyl ester
Identical with reference example 217, by 2 '-formoxyl-6 '-methyl biphenyl-3-carboxylate methyl ester and the buttery table title chemical compound of isopropyl triphenyl phosphonium iodide synthesizing colourless, yield is 45%.
1H NMR(CDCl 3)δ：0.68-0.74(6H，m)，1.61(1H，m)，1.98(3H，s)，2.20(2H，d，J＝7.5Hz)，3.91(3H，s)，7.05-7.12(2H，m)，7.19(1H，t，J＝7.5Hz)，7.33(1H，m)，7.48(1H，t，J＝7.5Hz)，7.83(1H，t，J＝1.8Hz)，8.01(1H，m)。
Reference example 220 (2 '-isobutyl group-6 '-methyl biphenyl-3-yl) methanol
Identical with reference example 218, by the buttery table title chemical compound of 2 '-isobutyl group-6 '-methyl biphenyl-3-carboxylate methyl ester synthesizing colourless, yield is 90%.
1H NMR(CDCl 3)δ：0.69-0.76(6H，m)，1.58-1.72(2H，m)，2.00(3H，s)，2.22(2H，d，J＝7.2Hz)，4.74(2H，d，J＝4.2Hz)，7.04-7.15(4H，m)，7.19(1H，t，J＝7.2Hz)，7.34(1H，m)，7.41(1H，t，J＝7.2Hz)。
Reference example 221 2 '-ethyl-6 '-methyl biphenyl-3-carboxylate methyl ester
Identical with reference example 217, by 2 '-formoxyl-6 '-methyl biphenyl-3-carboxylate methyl ester and the buttery table title chemical compound of first base three phenyl phosphonium bromide synthesizing colourless, yield is 82%.
1H NMR(CDCl 3)δ：1.01(3H，t，J＝7.5Hz)，1.99(3H，s)，2.32(2H，q，J＝7.5Hz)，3.92(3H，s)，7.08-7.18(2H，m)，7.24(1H，t，J＝7.5Hz)，7.37(1H，m)，7.50(1H，t，J＝7.5Hz)，7.87(1H，m)，8.03(1H，m)。
Reference example 222 (2 '-ethyl-6 '-methyl biphenyl-3-yl) methanol
Identical with reference example 218, by the buttery table title chemical compound of 2 '-ethyl-6 '-methyl biphenyl-3-carboxylate methyl ester synthesizing colourless, yield is 91%.
1H NMR(CDCl 3)δ：1.02(3H，t，J＝7.5Hz)，1.67(1H，t，J＝6.0Hz)，2.00(3H，s)，2.34(2H，q，J＝7.5Hz)，4.74(2H，d，J＝6.0Hz)，7.07-7.17(4H，m)，7.22(1H，t，J＝7.5Hz)，7.36(1H，m)，7.42(1H，t，J＝7.5Hz)。
Reference example 223 (2,2 ', 6 '-trimethyl biphenyl-3-yl) methanol
Identical with reference example 199 with reference example 200, obtain the table title chemical compound of colorless oil, yield is 19%.
1H-NMR(CDCl 3)δ1.94(6H，s)，1.97(3H，s)，4.69(2H，d，J＝6.0Hz)，7.01(1H，s)，7.06-7.32(5H，m)。
Embodiment 202A 3-[4-[(2 ', 6 '-dimethyl diphenyl-3-yl) methoxyl group]-the 2-aminomethyl phenyl] methyl propionate
Identical with reference example 31, obtain buttery table title chemical compound by 3-(4-hydroxy-2-methyl phenyl) methyl propionate and (2 ', 6 '-dimethyl diphenyl-3-yl) methanol, yield is 67%.
1H NMR(CDCl 3)δ2.01(s，6H)，2.28(s，3H)，2.52-2.57(m，2H)，2.85-2.90(m，2H)，3.67(s，3H)，5.08(s，2H)，6.70-6.79(m，2H)，7.02-7.20(m，6H)，7.37-7.46(m，2H)。
Embodiment 203 3-[4-[(2 ', 6 '-dimethyl diphenyl-3-yl) methoxyl group]-the 2-aminomethyl phenyl] propanoic acid
, by 3-[4-[(2 ', 6 '-dimethyl diphenyl-3-yl identical) methoxyl group with reference example 38]-the 2-aminomethyl phenyl] methyl propionate obtains the table title chemical compound of colourless crystallization, and yield is 56%.
1H NMR(CDCl 3)δ2.01(s，6H)，2.28(s，3H)，2.60(t，J＝7.8 Hz，2H)，2.89(t，J＝7.8 Hz，2H)，5.08(s，2H)，6.73-6.80(m，2H)，7.04-7.20(m，6H)，7.38-7.46(m，2H)。
Embodiment 204 3-[4-[(2 ', 6 '-dimethyl diphenyl-3-yl) methoxyl group]-the 2-fluorophenyl] ethyl propionate
Identical with reference example 31, obtain buttery table title chemical compound by 3-(2-fluoro-4-hydroxy phenyl) ethyl propionate and (2 ', 6 '-dimethyl diphenyl-3-yl) methanol, yield is 56%.
1H NMR(CDCl 3)δ1.23(t，J＝7.2Hz，3H)，2.00(s，6H)，2.57(t，J＝7.7Hz，2H)，2.90(t，J＝7.7Hz，2H)，4.12(q，J＝7.2Hz，2H)，5.07(s，2H)，6.63-6.70(m，2H)，7.06-7.19(m，6H)，7.37-7.47(m，2H)。
Embodiment 205 3-[4-[(2 ', 6 '-dimethyl diphenyl-3-yl) methoxyl group]-the 2-fluorophenyl] propanoic acid
, by 3-[4-[(2 ', 6 '-dimethyl diphenyl-3-yl identical) methoxyl group with reference example 38]-the 2-fluorophenyl] ethyl propionate obtains the table title chemical compound of colourless crystallization, and yield is 52%.
1H NMR(CDCl 3)δ2.00(s，6H)，2.63(t，J＝7.6Hz，2H)2.90(t，J＝7.6Hz，2H)，5.06(s，2H)，6.63-6.70(m，2H)，7.06-7.18(m，6H)，7.36-7.46(m，2H)。
Embodiment 206 3-[4-[(2 ', 6 '-dimethyl diphenyl-3-yl) methoxyl group]-the 2-methoxyphenyl] ethyl propionate
Identical with reference example 31, obtain buttery table title chemical compound by 3-(4-hydroxyl-2-methoxyphenyl) ethyl propionate and (2 ', 6 '-dimethyl diphenyl-3-yl) methanol, yield is 24%.
1H NMR(CDCl 3)δ1.23(t，J＝7.2Hz，3H)，2.01(s，6H)，2.55(t，J＝7.7Hz，2H)，2.86(t，J＝7.7Hz，2H)，3.77(s，3H)，4.12(q，J＝7.2Hz，2H)，5.08(s，2H)，6.45-6.51(m，2H)，7.02(d，J＝8.1Hz，1H)，7.09-7.14(m，5H)，7.39-7.47(m，2H)。
Embodiment 207 3-[4-[(2 ', 6 '-dimethyl diphenyl-3-yl) methoxyl group]-the 2-methoxyphenyl] propanoic acid
, by 3-[4-[(2 ', 6 '-dimethyl diphenyl-3-yl identical) methoxyl group with reference example 38]-the 2-methoxyphenyl] ethyl propionate obtains the table title chemical compound of colorless oil, and yield is 69%.
1H NMR(CDCl 3)δ2.01(s，6H)，2.62(t，J＝7.6Hz，2H)，2.87(t，J＝7.6Hz，2H)，3.77(s，3H)，5.08(s，2H)，6.45-6.52(m，2H)，7.02-7.21(m，6H)，7.38-7.47(m，2H)。
Embodiment 208 3-[2-chloro-4-[(2 ', 6 '-dimethyl diphenyl-3-yl) methoxyl group] phenyl] methyl propionate
Identical with reference example 31, obtain the table title chemical compound of colorless oil by 3-(2-chloro-4-hydroxy phenyl) methyl propionate and (2 ', 6 '-dimethyl diphenyl-3-yl) methanol, yield is 69%.
1H NMR(CDCl 3)δ2.01(6H，s)，2.61(2H，t，J＝7.7Hz)，2.98(2H，t，J＝7.7Hz)，3.67(3H，s)，5.08(2H，s)，6.81(1H，dd，J＝8.5，2.6Hz)，6.98(1H，d，J＝2.6Hz)，7.07-7.20(6H，m)，7.35-7.47(2H，m)。
Embodiment 209 3-[2-chloro-4-[(2 ', 6 '-dimethyl diphenyl-3-yl) methoxyl group] phenyl] propanoic acid
, by 3-[2-chloro-4-[(2 ', 6 '-dimethyl diphenyl-3-yl identical) methoxyl group with reference example 38] phenyl] methyl propionate obtains the table title chemical compound of colorless oil, and yield is 85%.
1H NMR(CDCl 3)δ2.01(6H，s)，2.66(2H，t，J＝7.7Hz)，2.99(2H，t，J＝7.7Hz)，5.08(2H，s)，6.80-6.83(1H，m)，6.96-7.01(1H，m)，7.09-7.18(6H，m)，7.37-7.47(2H，m)。
Embodiment 210 3-[4-[(2 ', 6 '-dimethyl diphenyl-4-yl) methoxyl group] phenyl] methyl propionate
Identical with reference example 31, obtain the table title chemical compound of colorless oil by 3-(4-hydroxy phenyl) methyl propionate and (2 ', 6 '-dimethyl diphenyl-4-yl) methanol, yield is 56%.
1H NMR(CDCl 3)δ2.04(6H，s)，2.62(2H，t，J＝7.7Hz)，2.91(2H，t，J＝7.7Hz)，3.67(3H，s)，5.08(2H，s)，6.95(2H，d，J＝8.7Hz)，7.07-7.20(7H，m)，7.49(2H，d，J＝8.1Hz)。
Embodiment 211 3-[4-[(2 ', 6 '-dimethyl diphenyl-4-yl) methoxyl group] phenyl] propanoic acid
, by 3-[4-[(2 ', 6 '-dimethyl diphenyl-4-yl identical) methoxyl group with reference example 38] phenyl] methyl propionate obtains the table title chemical compound of colourless crystallization, and yield is 52%.
1H NMR(CDCl 3)δ2.04(6H，s)，2.67(2H，t，J＝7.6Hz)，2.93(2H，t，J＝7.6Hz)，5.08(2H，s)，6.96(2H，d，J＝8.7Hz)，7.07-7.20(7H，m)，7.49(2H，d，J＝8.1Hz)。
Embodiment 212 3-[4-[(2 ', 6 '-dimethyl diphenyl-4-yl) methoxyl group]-the 2-fluorophenyl] ethyl propionate
Identical with reference example 31, obtain the table title chemical compound of colorless oil by 3-(2-fluoro-4-hydroxy phenyl) ethyl propionate and (2 ', 6 '-dimethyl diphenyl-4-yl) methanol, yield is 37%.
1H NMR(CDCl 3)δ1.24(3H，t，J＝7.1Hz)，2.03(6H，s)，2.60(2H，t，J＝7.6Hz)，2.92(2H，t，J＝7.6Hz)，4.13(2H，q，J＝7.1Hz)，5.07(2H，s)，6.64-6.80(2H，m)，7.07-7.22(6H，m)，7.47(2H，d，J＝7.9Hz)。
Embodiment 213 3-[4-[(2 ', 6 '-dimethyl diphenyl-4-yl) methoxyl group]-the 2-fluorophenyl] propanoic acid
, by 3-[4-[(2 ', 6 '-dimethyl diphenyl-4-yl identical) methoxyl group with reference example 38]-the 2-fluorophenyl] ethyl propionate obtains the table title chemical compound of colourless crystallization, and yield is 33%.
1H NMR(CDCl 3)δ2.03(6H，s)，2.67(2H，t，J＝7.6Hz)，2.94(2H，t，J＝7.6Hz)，5.07(2H，s)，6.68-6.79(2H，m)，7.07-7.21(6H，m)，7.48(2H，d，J＝8.1Hz)。
Embodiment 214 3-[4-[(2-benzyl benzyls) oxygen] phenyl] methyl propionate
Identical with reference example 5, obtain buttery table title chemical compound by 1-benzyl-2-(bromomethyl) benzene and 3-(4-hydroxy phenyl) methyl propionate, yield is 16%.
1H NMR(CDCl 3)δ2.59(t，J＝7.8 Hz，2H)，2.89(t，J＝7.8Hz，2H)，3.66(s，3H)，4.09(s，2H)，4.95(s，2H)，6.81(d，J＝8.1Hz，2H)，7.07-7.29(m，10H)，7.46-7.43(m，1H)。
Embodiment 215 3-[4-[(2-benzyl benzyls) oxygen] phenyl] propanoic acid
Identical with reference example 38, by 3-[4-[(2-benzyl benzyl) oxygen] phenyl] methyl propionate obtains the table title chemical compound of colourless crystallization, and yield is 52%.
1H NMR(CDCl 3)2.64(t，J＝7.7Hz，2H)，2.90(t，J＝7.7Hz，2H)，4.09(s，2H)，4.95(s，2H)，6.78-6.83(m，2H)，7.08-7.32(m，10H)，7.40-7.46(m，1H)。
Embodiment 216 3-[4-[[4-[[ethyls (4-phenyl-1,3-thiazoles-2-yl) amino] methyl] benzyl] oxygen] phenyl] methyl propionate
Identical with reference example 31, by 3-(4-hydroxy phenyl) methyl propionate and [4-[[ethyl (4-phenyl-1,3-thiazoles-2-yl) amino] methyl] phenyl] methanol obtains buttery table title chemical compound, and yield is 60%.
1H NMR(CDCl 3)δ1.21-1.28(m，3H)，2.59(t，J＝7.7Hz，2H)，2.89(t，J＝7.7Hz，2H)，3.51(q，J＝7.2Hz，2H)，3.66(s，3H)，4.77(s，2H)，5.02(s，2H)，6.71(s，1H)，6.88-6.91(m，2H)，7.08-7.12(m，2H)，7.24-7.41(m，7H)，7.83-7.77(m，2H)。
Embodiment 217 3-[4-[[4-[[ethyls (4-phenyl-1,3-thiazoles-2-yl) amino] methyl] benzyl] oxygen] phenyl] propanoic acid
Identical with reference example 38, by 3-[4-[[4-[[ethyl (4-phenyl-1,3-thiazoles-2-yl) amino] methyl] benzyl] oxygen] phenyl] methyl propionate obtains the table title chemical compound of colourless crystallization, and yield is 63%.
MS：m/z 473.1(M+1) +。
Embodiment 218 3-[2-methyl-4-[[4-[[(4-phenyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] benzyl] oxygen] phenyl] methyl propionate
Identical with reference example 31, by 3-(4-hydroxy-2-methyl phenyl) methyl propionate and [4-[[(4-phenyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] phenyl] methanol obtains buttery table title chemical compound, and yield is 58%.
1H NMR(CDCl 3)δ0.95(t，J＝7.5Hz，3H)1.60-1.75(m，2H)，2.29(s，3H)，2.55(t，J＝8.4Hz，2H)，2.88(t，J＝8.4Hz，2H)，3.39-3.44(m，2H)3.68(s，3H)，4.80(s，2H)，5.00(s，2H)，6.69-6.78(m，3H)，7.04(d，J＝8.4Hz，1H)，7.26-7.39(m，7H)，7.84-7.87(m，2H)。
Embodiment 219 3-[2-methyl-4-[[4-[[(4-phenyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] benzyl] oxygen] phenyl] propanoic acid
Identical with reference example 38, by 3-[2-methyl-4-[[4-[[(4-phenyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] benzyl] oxygen] phenyl] methyl propionate obtains the table title chemical compound of colourless crystallization, and yield is 57%.
MS：m/z 501.1(M+1) +。
Embodiment 220 3-[4-[[4-[[(5-methyl-4-phenyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] benzyl] oxygen] phenyl] methyl propionate
Identical with reference example 31, by 3-(4-hydroxy phenyl) methyl propionate and [4-[[(5-methyl-4-phenyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] phenyl] methanol obtains buttery table title chemical compound, and yield is 32%.
1H NMR(CDCl 3)δ0.91(t，J＝7.4Hz，3H)，1.60-1.72(m，2H)，2.41(s，3H)，2.59(t，J＝7.7Hz，2H)，2.89(t，J＝7.7Hz，2H)，3.32-3.37(m，2H)，3.66(s，3H)，4.71(s，2H)，5.02(s，2H)，6.88-6.92(m，2H)，7.10-7.13(m，2H)7.25-7.40(m，7H)，7.62-7.65(m，2H)。
Embodiment 221 3-[4-[[4-[[(5-methyl-4-phenyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] benzyl] oxygen] phenyl] propanoic acid
Identical with reference example 38, by 3-[4-[[4-[[(5-methyl-4-phenyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] benzyl] oxygen] phenyl] methyl propionate obtains the table title chemical compound of colourless crystallization, and yield is 59%.
MS：m/z 501.1(M+1) +。
Embodiment 222 3-[4-[[4-[[4,5-dihydro-naphtho [1,2-d] [1,3] thiazol-2-yl (propyl group) amino] methyl] benzyl] oxygen] phenyl] methyl propionate
Identical with reference example 31, by 3-(4-hydroxy phenyl) methyl propionate and [4-[[4,5-dihydro-naphtho [1,2-d] [1,3] thiazol-2-yl (propyl group) amino] methyl] phenyl] methanol obtains buttery table title chemical compound, and yield is 34%.
1HNMR(CDCl 3)δ0.93(t，J＝7.4Hz，3H)1.66-1.74(m，2H)，2.59(t，J＝7.7Hz，2H)，2.82-2.91(m，4H)，3.02(t，J＝7.7Hz，2H)，3.35-3.40(m，2H)，3.66(s，3H)，4.76(s，2H)，5.02(s，2H)，6.88-6.92(m，2H)，7.09-7.40(m，9H)，7.78(d，J＝7.5Hz，1H)。
Embodiment 223 3-[4-[[4-[[4,5-dihydro-naphtho [1,2-d] [1,3] thiazol-2-yl (propyl group) amino] methyl] benzyl] oxygen] phenyl] propanoic acid
, by 3-[4-[[4-[[4,5-dihydro-naphtho [1,2-d] [1,3] thiazol-2-yl (propyl group) amino identical with reference example 38] methyl] benzyl] oxygen] phenyl] methyl propionate obtains the table title chemical compound of colourless crystallization, and yield is 34%.
MS：m/z 513.1(M+1) +。
Embodiment 224 3-[2-fluoro-4-[[4-[[(4-phenyl-1,3-thiazoles-2-yls) (propyl group) amino] methyl] benzyl] oxygen] phenyl] ethyl propionate
Identical with reference example 31, by 3-(2-fluoro-4-hydroxy phenyl) ethyl propionate and [4-[[(4-phenyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] phenyl] methanol obtains buttery table title chemical compound, and yield is 32%.
1H NMR(CDCl 3)δ0.93(t，J＝7.2Hz，3H)，1.26(t，J＝7.2Hz，3H)，1.65-1.75(m，2H)，2.58(t，J＝7.6Hz，2H)，2.90(t，J＝7.6Hz，2H)，3.40(t，J＝7.8Hz，2H)，4.12(q，J＝7.2Hz，2H)，4.80(m，2H)，5.00(s，2H)，6.63-6.70(m，3H)，7.06-7.12(m，1H)，7.24-7.29(m，1H)，7.34-7.41(m，6H)，7.84-7.87(m，2H)。
Embodiment 225 3-[2-fluoro-4-[[4-[[(4-phenyl-1,3-thiazoles-2-yls) (propyl group) amino] methyl] benzyl] oxygen] phenyl] propanoic acid
Identical with reference example 38, by 3-[2-fluoro-4-[[4-[[(4-phenyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] benzyl] oxygen] phenyl] ethyl propionate obtains the table title chemical compound of colourless crystallization, and yield is 29%.
MS：m/z 505.0(M+1) +。
Embodiment 226 3-[4-[[4-[[(4,5-dimethyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] benzyl] oxygen] phenyl] methyl propionate
Identical with reference example 31, by [4-[[(4,5-dimethyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] phenyl] methanol obtains buttery table title chemical compound, and yield is 56%.
1H NMR(CDCl 3)0.88(t，J＝7.4Hz，3H)，1.58-1.67(m，2H)，2.13(s，3H)，2.18(s，3H)，2.59(t，J＝8.4Hz，2H)，2.89(t，J＝8.4Hz，2H)，3.25-3.30(m，2H)，3.66(s，3H)，4.65(s，2H)，5.01(s，2H)，6.87-6.90(m，2H)，7.09-7.12(m，2H)，7.26-7.27(m，2H)，7.35-7.38(m，2H)。
Embodiment 227 3-[4-[[4-[[(4,5-dimethyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl] benzyl] oxygen] phenyl] propanoic acid
, by 3-[4-[[4-[[(4,5-dimethyl-1,3-thiazoles-2-yl identical) (propyl group) amino with reference example 38] methyl] benzyl] oxygen] phenyl] methyl propionate obtains the table title chemical compound of colourless crystallization, and yield is 51%.
MS：m/z 513.1(M+1) +。
Embodiment 228 3-[4-[[4-[[(4-phenyl-1,3-thiazoles-2-yl) amino] methyl] benzyl] oxygen] phenyl] methyl propionate
To 4-phenyl-1; 3-thiazole-2-amine (0.25g; 1.4mmol), 3-[4-[(4-formoxyl benzyl) oxygen] phenyl] methyl propionate (0.58g; 2.0mmol) and acetic acid (0.25g; 4.2mmol) 1, in 2-dichloroethanes (15mL) solution, add triacetic acid base sodium borohydride (0.83g; 3.9mmol), at room temperature stirred the mixture 2 days.Reactant liquor is joined in the sodium bicarbonate aqueous solution, use ethyl acetate extraction.Extracting solution washes the back concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=4: 1), obtain buttery table title chemical compound (0.31g, yield 49%).
1H NMR(CDCl 3)δ2.60(t，J＝7.7Hz，2H)，2.89(t，J＝7.7Hz，2H)，3.66(s，3H)，4.54(d，J＝5.5Hz，2H)，5.04(s，2H)，5.50(br s，1H)，6.71(s，1H)，6.87-6.92(m，2H)，7.09-7.14(m，2H)7.26-7.43(m，7H)，7.78-7.82(m，2H)。
Embodiment 229 3-[4-[[4-[[(4-phenyl-1,3-thiazoles-2-yl) amino] methyl] benzyl] oxygen] phenyl] propanoic acid
Identical with reference example 38, by 3-[4-[[4-[[(4-phenyl-1,3-thiazoles-2-yl) amino] methyl] benzyl] oxygen] phenyl] methyl propionate obtains the table title chemical compound of colourless crystallization, and yield is 69%.
MS：m/z 445.1(M+1) +。
Embodiment 230 3-[4-[(2 '-methyl-6 '-propyl group biphenyl-3-yl) methoxyl group] phenyl] propanoic acid
Under 0 ℃, to 3-(4-hydroxy phenyl) methyl propionate (0.21g, 1.14mmol), (2 '-methyl-6 '-propyl group biphenyl-3-yl) methanol (0.25g, 1.04mmol) and tributylphosphine (0.39mL, 1.56mmol) oxolane (6mL) solution in, stir to add 1,1 '-(azo dicarbapentaborane) two piperidines (0.39g, 1.56mmol), stirred 16 hours under the room temperature.Add diethyl ether in reactant liquor, remove by filter insoluble matter, concentrating under reduced pressure filtrate with refining residue in the silica gel column chromatography (hexane～hexane/ethyl acetate=4/1), obtains colorless oil.Then, this product is dissolved in the mixed solution of methanol (4.0mL) and oxolane (6.0mL), stir under the room temperature and add 1 regulation sodium hydrate aqueous solution (2.28mL), stirred 1 hour under the room temperature.Reactant liquor is regulated pH to 3 with 1 regulation hydrochloric acid, uses ethyl acetate extraction, and water and saturated aqueous common salt are cleaned organic layer, dry back (anhydrous magnesium sulfate) concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=4/1～1/2), obtain the table title chemical compound (0.24g, yield 59%) of colourless crystallization.MS(APCI-)：387(M-H)。
Embodiment 231 3-[4-[(2 '-isobutyl group-6 '-methyl biphenyl-3-yl) methoxyl group] phenyl] propanoic acid
Identical with reference example 230, by 3-(4-hydroxy phenyl) methyl propionate and the buttery table title chemical compound of (2 '-isobutyl group-6 '-methyl biphenyl-3-yl) methanol synthesizing colourless, yield is 58%.MS(APCI-)：401(M-H)。
Embodiment 232 3-[4-[(2 '-ethyl-6 '-methyl biphenyl-3-yl) methoxyl group] phenyl] propanoic acid
Identical with reference example 230, by 3-(4-hydroxy phenyl) methyl propionate and the crystalline table title chemical compound of (2 '-ethyl-6 '-methyl biphenyl-3-yl) methanol synthesizing colourless, yield is 57%.MS(APCI-)：373(M-H)。
Embodiment 233 3-(4-((1-(tert-butoxycarbonyl)-1H-indol-3-yl) methoxyl group) phenyl) methyl propionate
Identical with reference example 31, obtain the table title chemical compound of faint yellow oily by 1-(tert-butoxycarbonyl)-3-methylol-1H-indole and 3-(4-hydroxy phenyl) methyl propionate, yield is 74%.
1H-NMR(CDCl 3)δ1.67(9H，s)，2.61(2H，t，J＝8.0Hz)，2.91(2H，t，J＝8.0Hz)，3.67(3H，s)，5.17(2H，s)，6.94(2H，d，J＝8.8Hz)，7.13(2H，d，J＝8.8Hz)，7.20-7.70(4H，m)，8.14(1H，d，J＝8.0Hz)。
Embodiment 234 3-(4-((1-(tert-butoxycarbonyl)-1H-indol-3-yl) methoxyl group) phenyl) propanoic acid
Identical with reference example 4, obtain the crystalline table title chemical compound of Sandy by 3-(4-((1-(tert-butoxycarbonyl)-1H-indol-3-yl) methoxyl group) phenyl) methyl propionate, yield is 11%.
1H-NMR(CDCl 3)δ1.67(9H，s)，2.66(2H，t，J＝7.8Hz)，2.92(2H，t，J＝7.8Hz)，5.18(2H，s)，6.95(2H，d，J＝8.8Hz)，7.15(2H，d，J＝8.8Hz)，7.20-7.40(2H，m)，7.60-7.68(2H，m)，8.14(1H，d，J＝8.4Hz)。
Embodiment 235 3-(4-((3-(methoxymethoxy)-1-benzothiophene-2-yl) methoxyl group) phenyl) methyl propionate
Identical with reference example 31, obtain the buttery table title chemical compound of Sandy by 2-methylol-3-methoxymethoxy-1-benzothiophene and 3-(4-hydroxy phenyl) methyl propionate, yield is 50%.
1H-NMR(CDCl 3)δ2.59(2H，t，J＝7.8Hz)，2.89(2H，t，J＝7.8Hz)，3.63(3H，s)，3.66(3H，s)，5.19(2H，s)，5.30(2H，s)，6.95(2H，d，J＝8.4Hz)，7.12(2H，d，J＝8.4Hz)，7.34-7.42(2H，m)，7.72-7.80(2H，m)。
Embodiment 236 3-(4-((3-(methoxymethoxy)-1-benzothiophene-2-yl) methoxyl group) phenyl) propanoic acid
Identical with reference example 4, obtain the table title chemical compound of faint yellow acicular crystal by 3-(4-((3-(methoxymethoxy)-1-benzothiophene-2-yl) methoxyl group) phenyl) methyl propionate, yield is 74%.
1H-NMR(CDCl 3)δ2.64(2H，t，J＝7.6Hz)，2.90(2H，t，J＝7.6Hz)，3.63(3H，s)，5.19(2H，s)，5.30(2H，s)，6.95(2H，d，J＝8.8Hz)，7.13(2H，d，J＝8.8Hz)，7.32-7.42(2H，m)，7.72-7.80(2H，m)。
Embodiment 237 3-(4-((3-(2-methyl benzyloxy)-1-benzothiophene-2-yl) methoxyl group) phenyl) methyl propionate
Identical with reference example 31, obtain the table title chemical compound of faint yellow oily by 2-methylol-3-(2-methyl benzyloxy)-1-benzothiophene and 3-(4-hydroxy phenyl) methyl propionate, yield is 32%.
1H-NMR(CDCl 3)δ2.39(3H，s)，2.57(2H，t，J＝7.4Hz)，2.88(2H，t，J＝7.4Hz)，3.65(3H，s)，4.92(2H，s)，5.17(2H，s)，6.83(2H，d，J＝8.6Hz)，7.08(2H，d，J＝8.6Hz)，7.14-7.80(8H，m)。
Embodiment 238 3-(4-((3-(2-methyl benzyloxy)-1-benzothiophene-2-yl) methoxyl group) phenyl) propanoic acid
Identical with reference example 4, obtain the table title chemical compound of colourless prism by 3-(4-((3-(2-methyl benzyloxy)-1-benzothiophene-2-yl) methoxyl group) phenyl) methyl propionate, yield is 75%.
1H-NMR(CDCl 3)δ2.40(3H，s)，2.63(2H，t，J＝7.4Hz)，2.89(2H，t，J＝7.4Hz)，4.92(2H，s)，5.17(2H，s)，6.84(2H，d，J＝8.6Hz)，7.10(2H，d，J＝8.6Hz)，7.16-7.80(8H，m)。
Embodiment 239 3-(4-((2,2 ', 6 '-trimethyl biphenyl-3-yl) methoxyl group) phenyl) methyl propionate
Identical with reference example 31, obtain the table title chemical compound of colorless oil by (2,2 ', 6 '-trimethyl biphenyl-3-yl) methanol and 3-(4-hydroxy phenyl) methyl propionate, yield is 78%.
1H-NMR(CDCl 3)δ1.93(6H，s)，1.97(3H，s)，2.58(2H，t，J＝7.8Hz)，2.88(2H，t，J＝7.8Hz)，3.66(3H，s)，5.04(2H，s)，6.88(2H，d，J＝8.4Hz)，7.06-7.34(8H，m)。
Embodiment 240 3-(4-((2,2 ', 6 '-trimethyl biphenyl-3-yl) methoxyl group) phenyl) propanoic acid
Identical with reference example 4, obtain the brilliant table title chemical compound of colourless needle-like by 3-(4-((2,2 ', 6 '-trimethyl biphenyl-3-yl) methoxyl group) phenyl) methyl propionate, yield is 98%.
1H-NMR(CDCl 3)δ1.92(6H，s)，1.96(3H，s)，2.63(2H，t，J＝7.4Hz)，2.89(2H，t，J＝7.4Hz)，5.04(2H，s)，6.88(2H，d，J＝8.4Hz)，7.05-7.34(8H，m)。
Embodiment 241 3-(4-((6-methoxyl group-2 ', 6 '-dimethyl-biphenyl-3-yl) methoxyl group) phenyl) methyl propionate
Identical with reference example 31, obtain the table title chemical compound of faint yellow oily by (6-methoxyl group-2 ', 6 '-dimethyl-biphenyl-3-yl) methanol and 3-(4-hydroxy phenyl) methyl propionate, yield is 32%.
1H-NMR(CDCl 3)δ1.99(6H，s)，2.58(2H，t，J＝7.8Hz)，2.89(2H，t，J＝7.8Hz)，3.66(3H，s)，3.74(3H，s)，5.00(2H，s)，6.88(2H，d，J＝8.8Hz)，6.98(1H，d，J＝8.4Hz)，7.06-7.22(6H，m)，7.40(1H，dd，J＝2.2 & 8.0Hz)。
Embodiment 242 3-(4-((6-methoxyl group-2 ', 6 '-dimethyl-biphenyl-3-yl) methoxyl group) phenyl) propanoic acid
Identical with reference example 4, obtain colourless prism table title chemical compound by 3-(4-((6-methoxyl group-2 ', 6 '-dimethyl-biphenyl-3-yl) methoxyl group) phenyl) methyl propionate, yield is 94%.
1H-NMR(CDCl 3)δ2.00(6H，s)，2.64(2H，t，J＝7.8Hz)，2.90(2H，t，J＝7.8Hz)，3.74(3H，s)，5.00(2H，s)，6.85-7.44(10H，m)。
Embodiment 243 3-(4-((2 ', 6 '-dimethyl-4-methoxyl biphenyl-3-yl) methoxyl group) phenyl) methyl propionate
Identical with reference example 31, obtain the table title chemical compound of colorless oil by (2 ', 6 '-dimethyl-4-methoxyl biphenyl-3-yl) methanol and 3-(4-hydroxy phenyl) methyl propionate, yield is 87%.
1H-NMR(CDCl 3)δ1.99(6H，s)，2.58(2H，t，J＝8.0Hz)，2.88(2H，t，J＝8.0Hz)，3.66(3H，s)，3.91(3H，s)，5.14(2H，s)，6.04-7.25(10H，m)。
Embodiment 244 3-(4-((2 ', 6 '-dimethyl-4-methoxyl biphenyl-3-yl) methoxyl group) phenyl) propanoic acid
Identical with reference example 4, obtain the table title chemical compound of colourless prism by 3-(4-((2 ', 6 '-dimethyl-4-methoxyl biphenyl-3-yl) methoxyl group) phenyl) methyl propionate, yield is 91%.
1H-NMR(CDCl 3)δ1.99(6H，s)，2.63(2H，t，7.8Hz)，2.89(2H，t，J＝J＝7.8Hz)，3.91(2H，s)，.5.14(2H，s)，6.85-7.24(10H，m)。
Embodiment 245 (2,6-dimethoxy-4 '-((3-phenoxy benzyl) oxygen) phenyl) ethyl propionate
Identical with reference example 31, obtain the table title chemical compound of colorless oil by 3-phenoxy group benzylalcohol and 3-(4-hydroxyl-2,6-Dimethoxyphenyl) ethyl propionate, yield is 87%.
1H-NMR(CDCl 3)δ1.25(3H，t，J＝7.2Hz)，2.40-2.48(2H，m)，2.84-2.94(2H，m)，3.75(6H，s)，4.12(2H，q，J＝7.2Hz)，5.01(2H，s)，6.16(2H，s)，6.94-7.38(9H，m)。
Embodiment 246 (2,6-trimethoxy-4-((3-phenoxy benzyl) oxygen) phenyl) propanoic acid
Identical with reference example 4, obtain the table title chemical compound of colourless needle-like crystalline substance by (2,6-dimethoxy-4 '-((3-phenoxy benzyl) oxygen) phenyl) ethyl propionate, yield is 78%.
1H-NMR(CDCl 3)δ2.43-2.58(2H，m)，2.86-2.98(2H，m)，3.76(6H，s)，5.01(2H，s)，6.17(2H，s)，6.94-7.40(9H，m)。
Embodiment 247 3-(2,6-two fluoro-4-((2 ', 6 '-dimethyl diphenyl-3-yl) methoxyl group) phenyl) ethyl propionate
Identical with reference example 31, obtain the table title chemical compound of colorless oil by (2 ', 6 '-dimethyl diphenyl-3-yl) methanol and 3-(2,6-two fluoro-4-hydroxy phenyls) ethyl propionate, yield is 89%.
1H-NMR(CDCl 3)δ1.24(3H，t，J＝7.0Hz)，2.01(6H，s)，2.54(2H，t，J＝7.6Hz)，2.91(2H，t，J＝7.6Hz)，4.12(2H，q，J＝7.0Hz)，5.05(2H，s)，6.49(2H，d，J＝9.4Hz)，7.06-7.50(7H，m)。
Embodiment 248 3-(2,6-two fluoro-4-((2 ', 6 '-dimethyl diphenyl-3-yl) methoxyl group) phenyl) propanoic acid
Identical with reference example 4, obtain the table title chemical compound of colourless needle-like crystalline substance by 3-(2,6-two fluoro-4-((2 ', 6 '-dimethyl diphenyl-3-yl) methoxyl group) phenyl) ethyl propionate, yield is 95%.
1H-NMR(CDCl 3)δ2.01(6H，s)，2.61(2H，t，J＝7.8Hz)，2.93(2H，t，J＝7.8Hz)，5.06(2H，s)，6.50(2H，d，J＝9.6Hz)，7.08-7.48(7H，m)。
Embodiment 249 3-[4-[[3-(2, the 6-dimethyl benzyl) benzyl] oxygen] phenyl] methyl propionate
At room temperature, to 3-(4-hydroxy phenyl) methyl propionate (180mg), 3-(2, the 6-dimethyl benzyl) splashes into diethylazodicarboxylate (40% toluene solution 500mg) in toluene (2mL) solution of benzylalcohol (226mg) and triphenylphosphine (286mg), and at room temperature stirred one hour.With silica gel column chromatography refining reaction mixture.By with launching ethyl acetate-hexane (volumetric ratio is alternation from 1: 9 to 3: 2), obtain the table title chemical compound (125mg, yield are 32%) of faint yellow oily.
1H NMR(300MHz，Chloroform-D)δ：2.23(6H，s)2.60(2H，t，J＝7.8Hz)2.89(2H，t，J＝7.8Hz)3.67(3H，s)4.06(2H，s)4.96(2H，s)6.8-6.95(3H，m)7.0-7.1(6H，m)7.2-7.3(2H，m)。
Identical with embodiment 249, synthesize the chemical compound of following examples 250 and 251.
Embodiment 250 3-[4-[[4-(2, the 6-dimethyl benzyl) benzyl] oxygen] phenyl] methyl propionate yield 95%, faint yellow oily thing.
1H NMR(300MHz，Chloroform-D)δ：2.24(6H，s)，2.59(2H，t，J＝7.8Hz)，2.89(2H，t，J＝7.8Hz)，3.66(3H，s)，4.06(2H，s)，4.97(2H，s)，6.8-6.95(2H，m)，7.02(2H，d，J＝7.9Hz)，7.05-7.15(5H，m)，7.29(2H，d，J＝7.9Hz)。
Embodiment 251 3-[4-[(3-benzyl benzyls) oxygen] phenyl] methyl propionate
Yield 62%, faint yellow oily thing.
1H NMR(300MHz，Chloroform-D)δ：2.60(2H，t，J＝7.8Hz)2.89(2H，t，J＝7.8Hz)3.66(3H，s)4.00(2H，s)4.99(2H，s)6.85-6.9(2H，m)7.1-7.3(11H，m)。
Embodiment 252 3-[4-[[3-(2, the 6-dimethyl benzyl) benzyl] oxygen] phenyl] propanoic acid
With 3-[4-[[3-(2, the 6-dimethyl benzyl) benzyl] oxygen] phenyl] mixture of methyl propionate (125mg), 2 regulation sodium hydrate aqueous solutions (3mL), ethanol (10mL) at room temperature stirred 1 hour.Concentrated reaction mixture adds in the mixture of 1 regulation aqueous hydrochloric acid solution (10mL), water (30mL), the solid that leaching is separated out, and water is then cleaned with hexane, obtains the table title chemical compound (99mg, yield are 82%) of colourless crystallization by drying.
MS(APCI-)373(M-H)。
Identical with embodiment 252, synthesize the chemical compound of following examples 253 and 254.
Embodiment 253 3-[4-[[4-(2, the 6-dimethyl benzyl) benzyl] oxygen] phenyl] propanoic acid
Yield is 96%, colourless crystallization.
MS(APCI-)373(M-H)。
Embodiment 254 3-[4-[(3-benzyl benzyls) oxygen] phenyl] propanoic acid
Yield is 96%, colourless crystallization.
MS(APCI-)345(M-H)。
Embodiment 255 3-{4-[(4-{[hexyls (4-phenyl-1,3-thiazoles-2-yl) amino] methyl } benzyl) oxygen] phenyl } methyl propionate
At room temperature, to the N of N-hexyl-4-phenyl-1,3-thiazoles-2-amine (390mg), (60%, oiliness 50mg), stirred 30 minutes under the room temperature to add sodium hydride in dinethylformamide (1.0mL) solution.In reactant mixture, add 3-(4-{[4-(chloromethyl) benzyl] oxygen } phenyl) methyl propionate (318mg), stirred 1 hour under the room temperature.Reactant mixture is injected in the 1 regulation aqueous hydrochloric acid solution, uses ethyl acetate extraction.Concentrate ethyl acetate layer, with the refining residue of silica gel column chromatography.Launch by ethyl acetate-hexane (volumetric ratio is alternation from 1: 19 to 1: 1), obtain the table title chemical compound (260mg, yield 48%) of faint yellow oily.
1H NMR(300MHz，Chloroform-D)δ：0.8-0.9(3H，m)，1.2-1.4(6H，m)，1.6-1.7(2H，m)，2.59(2H，t，J＝7.7Hz)，2.89(2H，t，J＝7.7Hz)，3.35-3.5(2H，m)，3.66(3H，s)，4.78(2H，s)，5.01(2H，s)，6.70(1H，s)，6.89(2H，d，J＝8.7Hz)，7.11(2H，d，J＝8.5Hz)，7.2-7.3(1H，m)，7.3-7.45(6H，m)，7.85(2H，d，J＝7.9Hz)。
Embodiment 256 3-{4-[(4-{[isopropyls (4-phenyl-1,3-thiazoles-2-yl) amino] methyl } benzyl) oxygen] phenyl } methyl propionate
Identical with embodiment 255, the table title chemical compound of synthetic faint yellow oily, yield 72%.
MS(ESI+)501(M+H)。
Embodiment 257 3-{4-[(4-{[isobutyl groups (4-phenyl-1,3-thiazoles-2-yl) amino] methyl } benzyl) oxygen] phenyl } propanoic acid
At room temperature, to the N of N-isobutyl group-4-phenyl-1,3-thiazoles-2-amine (232mg), (60%, oiliness 50mg), at room temperature stirred 30 minutes to add sodium hydride in dinethylformamide (2mL) solution.In reactant mixture, add 3-(4-{[4-(chloromethyl) benzyl] oxygen } phenyl) methyl propionate (318mg), stirred 1 hour under the room temperature.Reactant mixture is injected in the 1 regulation aqueous hydrochloric acid solution, uses ethyl acetate extraction.Concentrate ethyl acetate layer, with the refining residue of silica gel column chromatography.Launch by ethyl acetate-hexane (volumetric ratio is alternation from 1: 19 to 1: 1), obtain yellow oil (322mg).This yellow oil is dissolved in the mixed solvent of methanol (2mL), oxolane (2mL), add 2 regulation sodium hydrate aqueous solutions (2mL), stirred 1 hour under the room temperature.Reactant mixture is injected in the water, after 1 regulation aqueous hydrochloric acid solution furnishing acidity, uses ethyl acetate extraction.Concentrate ethyl acetate layer, get the refining residue of HPLC (gradient circulation A), obtain the table title chemical compound (159mg, yield 31%) of colorless oil with dividing.
MS(ESI+)501(M+H)。
Embodiment 258 3-{4-[(4-{[hexyls (4-phenyl-1,3-thiazoles-2-yl) amino] methyl } benzyl) oxygen] phenyl } propanoic acid
Dissolving 3-{4-[(4-{[hexyl (4-phenyl-1 in the mixed solvent of methanol (2mL), oxolane (2mL), the 3-thiazol-2-yl) amino] methyl } benzyl) oxygen] phenyl } methyl propionate (250mg), add 2 regulation sodium hydrate aqueous solutions (2mL) again, at room temperature mix and stirred 1 hour.Reactant mixture is injected water, be adjusted to acidity with 1 regulation aqueous hydrochloric acid solution after, use ethyl acetate extraction.Behind the dry ethyl acetate layer of Presep Dehydration tube (with the pure medicine of light (strain) system), concentrate and obtain faint yellow crystalline table title chemical compound (220mg, yield 90%).
MS(ESI+)529(M+H)。
Embodiment 259 3-{4-[(4-{[isopropyls (4-phenyl-1,3-thiazoles-2-yl) amino] methyl } benzyl) oxygen] phenyl } propanoic acid
Identical with embodiment 258, by 3-{4-[(4-{[isopropyl (4-phenyl-1,3-thiazoles-2-yl) amino] methyl } benzyl) oxygen] phenyl } the synthetic faint yellow crystalline table title chemical compound of methyl propionate, yield is 63%.
MS(ESI+)487(M+H)。
Embodiment 260 3-[4-(the 4-[(propyl group 4-[4-(trifluoromethyl) phenyl]-1,3-thiazoles-2-yl } amino) methyl] benzyl } oxygen) phenyl] propanoic acid
Under 0 ℃, to N-propyl group-4-[4-(trifluoromethyl) phenyl]-N of 1,3-thiazoles-2-amine hydrobromate (477mg), in dinethylformamide (10mL) solution, (60%, oiliness 104mg), is got back to mix after the room temperature and was stirred 30 minutes to add sodium hydride.At 0 ℃, in reactant mixture, add 3-(4-{[4-(chloromethyl) benzyl] oxygen } phenyl) methyl propionate (318mg), get back to mix after the room temperature and stirred 1 hour.Reactant mixture is injected in the water, uses ethyl acetate extraction.Concentrate ethyl acetate layer, use the silica gel column chromatography refinement residue.Launch by ethyl acetate-hexane (volumetric ratio is alternation from 1: 19 to 1: 1), obtain faint yellow oily thing.This grease of dissolving in methanol (5mL) adds 2 regulation sodium hydrate aqueous solutions (5mL), at room temperature mixes and stirs 3 hours.To be injected in the reactant mixture in the 1 regulation aqueous hydrochloric acid solution, the solids that leaching is separated out, water, isopropyl ether are cleaned after drying successively, obtain the table title chemical compound (230mg, yield are 42%) of colourless crystallization.
MS(ESI+)555(M+H)。
Identical with embodiment 260, the chemical compound of synthetic following examples 261～263.
Embodiment 261 3-{4-[(4-{[[4-(4-chlorphenyl)-1,3-thiazoles-2-yl] (propyl group) amino] methyl } benzyl) oxygen] phenyl } propanoic acid
Yield is 28%, faint yellow crystallization.MS(ESI+)521(M+H)。
Embodiment 262 3-{4-[(4-{[[4-(3-methoxyphenyl)-1,3-thiazoles-2-yl] (propyl group) amino] methyl } benzyl) oxygen] phenyl } propanoic acid
Yield 41%, faint yellow crystallization.MS(ESI+)517(M+H)。
Embodiment 263 3-{4-[(4-{[(5-phenyl-1,3-thiazoles-2-yl) (propyl group) amino] methyl } benzyl) oxygen] phenyl } propanoic acid
Yield 68%, faint yellow crystallization.MS(ESI+)487(M+H)。
Embodiment 264 3-(4-{[3-(3-methylphenoxy) benzyl] oxygen } phenyl) methyl propionate
Under ice-cooled and stirring, to 3-(4-hydroxy phenyl) methyl propionate (0.396g, 2.20mmol), [3-(3-methylphenoxy) phenyl] methanol (0.429g, 2.00mmol) and tributylphosphine (0.747mL, 3.00mmol) toluene (30mL) solution in each a small amount of add 1,1 '-(azo dicarbapentaborane) two piperidines (0.757g, 3.00mmol), after being warmed up to room temperature, stirred 18 hours.In reactant liquor, add hexane (15mL), the insoluble matter that elimination is separated out, concentrating under reduced pressure filtrate.Get the refining residue of HPLC (containing 10～95% acetonitrile/water, 0.1% trifluoroacetic acid) with silica gel column chromatography (hexane～20% ethyl acetate/hexane) and branch, obtain the table title chemical compound (0.414g, yield 55%) of faint yellow oily.
MS：m/z 377(MH +)。
Embodiment 265 3-(4-{[3-(3-methylphenoxy) benzyl] oxygen } phenyl) propanoic acid
(0.380g adds 2M sodium hydrate aqueous solution (1.5mL) in methanol 1.01mmol) (4mL) and oxolane (4mL) mixed solution, at room temperature stirred 24 hours to 3-(4-{[3-(3-methylphenoxy) benzyl] oxygen } phenyl) methyl propionate.In reactant liquor, add entry,, use ethyl acetate extraction with 1M hydrochloric acid furnishing acidity.Extracting solution is cleaned with saturated aqueous common salt, behind anhydrous magnesium sulfate drying, and concentrating under reduced pressure.Residue obtains the table title chemical compound (0.214g, yield 58%) of colourless prism by ethyl acetate-hexane recrystallize.
1H NMR(CDCl 3)δ2.32(s，3H)，2.65(t，J＝7.7Hz，2H)，2.90(t，J＝7.7Hz，2H)，5.01(s，2H)，6.79-6.96(m，6H)，7.06-7.24(m，5H)，7.33(t，J＝7.8Hz，1H)。
MS：m/z 363(MH +)。
Embodiment 266 3-(4-{[3-(4-methylphenoxy) benzyl] oxygen } phenyl) methyl propionate
Identical with embodiment 264, obtain the table title chemical compound of faint yellow oily by 3-(4-hydroxy phenyl) methyl propionate and [3-(4-methylphenoxy) phenyl] methanol, yield is 59%.
MS：m/z 377(MH +)。
Embodiment 267 3-(4-{[3-(4-methylphenoxy) benzyl] oxygen } phenyl) propanoic acid
Identical with embodiment 265, obtain the table title chemical compound of colourless prism by 3-(4-{[3-(4-methylphenoxy) benzyl] oxygen } phenyl) methyl propionate, yield is 58% (with hexane-ethyl acetate recrystallize).
1H NMR(CDCl 3)δ2.32(s，3H)，2.65(t，J＝7.7Hz，2H)，2.90(t，J＝7.7Hz，2H)，5.01(s，2H)，6.79-6.96(m，6H)，7.06-7.24(m，5H)，7.33(t，J＝7.8Hz，1H)。
MS：m/z 363(MH +)。
Embodiment 268 3-(4-{[3-(1-phenyl vinyl) benzyl] oxygen } phenyl) methyl propionate
In ice-cooled following and stirring, to 3-(4-hydroxy phenyl) methyl propionate (0.360g, 2.00mmol), [3-(1-phenyl vinyl) phenyl] methanol (0.421g, 2.00mmol) and tributylphosphine (0.747mL, in toluene 3.00mmol) (30mL) solution, each a small amount of adding 1,1 '-(azo dicarbapentaborane) two piperidines (0.757g, 3.00mmol), under nitrogen environment atmosphere, at room temperature stirred 18 hours.Add hexane (15mL) in reactant liquor, the insoluble matter that elimination is separated out concentrates filtrate decompression.With the refining residue of silica gel column chromatography (hexane～20% ethyl acetate/hexane), obtain the table title chemical compound (0.641g, yield 86%) of colorless oil.
MS：m/z 373(MH +)。
Embodiment 269 3-(4-{[3-(1-phenyl vinyl) benzyl] oxygen } phenyl) propanoic acid
Identical with embodiment 265, obtain the table title chemical compound of colourless tabular crystalline substance by 3-(4-{[3-(1-phenyl vinyl) benzyl] oxygen } phenyl) methyl propionate, yield is 77% (with hexane-ethyl acetate recrystallize).
MS：m/z 359(MH +)。
Embodiment 270 3-(4-{[3-(2-methyl isophthalic acid-naphthyl) benzyl] oxygen } phenyl) methyl propionate
Identical with embodiment 268, obtain the table title chemical compound of colorless oil by 3-(4-hydroxy phenyl) methyl propionate and [3-(2-methyl isophthalic acid-naphthyl) phenyl] methanol, yield is 87%.
1H NMR(CDCl 3)δ2.22(s，3H)，2.59(t，J＝7.8Hz，2H)，2.89(t，J＝7.8Hz，2H)，3.65(s，3H)，5.11(s，2H)，6.90(d，J＝8.5Hz，2H)，7.10(d，J＝8.5Hz，2H)，7.21-7.26(m，1H)，7.28-7.44(m，5H)，7.48-7.54(m，2H)，7.78(d，J＝8.3Hz，1H)，7.83(d，J＝8.1Hz，1H)。
MS：m/z 411(MH +)。
Embodiment 271 3-(4-{[3-(2-methyl isophthalic acid-naphthyl) benzyl] oxygen } phenyl) propanoic acid
(0.648g adds 2M sodium hydrate aqueous solution (2mL) in methanol 1.58mmol) (6mL) and oxolane (6mL) mixed liquor, at room temperature stirred 75 hours to 3-(4-{[3-(2-methyl isophthalic acid-naphthyl) benzyl] oxygen } phenyl) methyl propionate.In reactant liquor, add entry, be adjusted to acidity, use ethyl acetate extraction with 10% aqueous citric acid solution.Extracting solution is cleaned with saturated aqueous common salt, behind anhydrous sodium sulfate drying, and concentrating under reduced pressure.With ethyl acetate-hexane recrystallize residue, obtain the table title chemical compound (0.534g, yield 85%) of colourless needle-like crystalline substance.
1H NMR(CDCl 3)δ2.22(s，3H)，2.64(t，J＝7.8Hz，2H)，2.90(t，J＝7.8Hz，2H)，5.12(s，2H)，6.91(d，J＝8.7Hz，2H)，7.12(d，J＝8.5 Hz，2H)，7.21-7.33(m，3H)，7.37-7.42(m，3H)，7.48-7.55(m，2H)，7.78(d，J＝8.5Hz，1H)，7.83(d，J＝7.9Hz，1H)。
MS：m/z 397(MH +)。
Embodiment 272 3-(4-((2 '-ethoxybiphenyl-3-yl) methoxyl group) phenyl) propanoic acid
With the 3-[4-[(3-bromobenzyl) oxygen] phenyl] methyl propionate (0.30g, 0.86mmol), 2-ethoxybenzene ylboronic acid (0.16g, 0.95mmol), tetra-triphenylphosphine palladium (40mg, 0.034mmol), 2 the regulation wet chemical (0.3mL), ethanol (0.3mL) and toluene (3mL) mixture, under argon surrounding atmosphere environment, one evening of reflux.After the reactant liquor cooling,, and wash dry back concentrating under reduced pressure with the ethyl acetate dilution.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=10/1～2/1), obtain the colorless oil of 3-(4-((2 '-ethoxybiphenyl-3-yl) methoxyl group) phenyl) methyl propionate (0.21g, 63%).
In methanol (4.2mL) solution of this chemical compound, add 1 regulation sodium hydrate aqueous solution (1.3mL), at room temperature stirred 2 hours.Reactant liquor is used ethyl acetate extraction after adjusting pH to 7 with 1 regulation hydrochloric acid, and water and saturated aqueous common salt are cleaned organic layer, dry back concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=3/2～1/4), obtain the table title chemical compound (0.17g, yield 84%) of colourless crystallization.
MS(APCI-)：375(M-H)。
Embodiment 273 3-(4-((2 '-cyanobiphenyl-3-yl) methoxyl group) phenyl) propanoic acid
Identical with embodiment 272, by the 3-[4-[(3-bromobenzyl) oxygen] phenyl] methyl propionate and the crystalline table title chemical compound of 2-cyano-phenyl boric acid synthesizing colourless, yield is 6%.
MS(APCI-)：356(M-H)。
Embodiment 274 3-(4-((2 '-xenol-3-yl) methoxyl group) phenyl) propanoic acid
Identical with embodiment 272, by the 3-[4-[(3-bromobenzyl) oxygen] phenyl] methyl propionate and 2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) the crystalline table title chemical compound of phenol synthesizing colourless, yield is 33%.
MS(APCI-)：347(M-H)。
Embodiment 275 3-(4-((2 '-(methyl sulfenyl) biphenyl-3-yl) methoxyl group) phenyl) propanoic acid
Identical with embodiment 272, by the 3-[4-[(3-bromobenzyl) oxygen] phenyl] methyl propionate and the crystalline table title chemical compound of 2-(methyl sulfenyl) phenylboric acid synthesizing colourless, yield is 39%.
MS(APCI-)：377(M-H)。
Embodiment 276 3-(4-((2 '-(ethoxy carbonyl) biphenyl-3-yl) methoxyl group) phenyl) propanoic acid
Identical with embodiment 272, by the 3-[4-[(3-bromobenzyl) oxygen] phenyl] methyl propionate and the buttery table title chemical compound of 2-ethoxy carbonyl phenylboric acid synthesizing colourless, yield is 12%.
MS(APCI-)：403(M-H)。
Embodiment 277 3-(4-((3-(2, the 6-dimethyl phenoxy) benzyl) oxygen) phenyl) methyl propionate
0 ℃ and stir under, to 3-(4-hydroxy phenyl) methyl propionate (0.25g, 1.39mmol), [3-(2, the 6-dimethyl phenoxy) phenyl] methanol (0.41g, 1.81mmol) and triphenylphosphine (0.47g in oxolane 1.81mmol) (5mL) solution, splashes into diethylazodicarboxylate's toluene (40%, 0.82mL) solution, at room temperature stirred 16 hours.The concentrating under reduced pressure reactant liquor with the refining residue of silica gel column chromatography (hexane～hexane/ethyl acetate=4/1), obtains the table title chemical compound (0.27g, yield 50%) of yellow oily.
1H NMR(CDCl 3)δ：2.11(6H，m)，2.59(2H，t，J＝7.8Hz)，2.89(2H，t，J＝7.8Hz)，3.66(3H，s)，4.97(2H，s)，6.66(1H，dd，J＝2.4，8.1Hz)，6.81-6.91(3H，m)，7.00-7.14(6H，m)，7.24(1H，t，J＝7.8Hz)。
Embodiment 278 3-(4-((3-(2, the 6-dimethyl phenoxy) benzyl) oxygen) phenyl) propanoic acid
(add 1 regulation sodium hydrate aqueous solution (1.2mL) among the 0.24g, methanol solution 0.62mmol) (5.0mL), at room temperature stirred 2 hours to 3-(4-((3-(2, the 6-dimethyl phenoxy) benzyl) oxygen) phenyl) methyl propionate.Behind the concentration of reaction solution, dilute residue, with concentrating under reduced pressure after 1 regulation hydrochloric acid and the water cleaning, drying with ethyl acetate.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=3/2～1/4), obtain the table title chemical compound (0.15g, yield 64%) of colourless crystallization.
MS(APCI-)：375(M-H)。
Embodiment 279 3-(4-((4-(2-methylphenoxy) benzyl) oxygen) phenyl) methyl propionate
Identical with embodiment 277, (identical by 3-(4-hydroxy phenyl) methyl propionate with reference example 201 with [4-(2-methylbenzene methyl) phenyl] methanol, synthetic (still by orthoresol and 4-bromobenzaldehyde, be mixture with byproduct of reaction)) the crystalline table title chemical compound of synthesizing colourless (using HPLC (gradient circulation A) when making with extra care), yield is 56%.
1H NMR(CDCl 3)δ：2.23(3H，s)，2.60(2H，t，J＝7.8Hz)，2.90(2H，t，J＝7.8Hz)，3.67(3H，s)，4.97(2H，s)，6.86-6.95(5H，m)，7.04-7.21(4H，m)，7.23-7.29(1H，m)，7.35(2H，d，J＝8.7Hz)。
Embodiment 280 3-(4-((4-(2-methylphenoxy) benzyl) oxygen) phenyl) propanoic acid
Identical with embodiment 278, by 3-(4-((4-(2-methylphenoxy) benzyl) oxygen) phenyl) the crystalline table title chemical compound of methyl propionate synthesizing colourless, yield is 63%.
MS(APCI-)：361(M-H)。
Embodiment 281 3-(4-((3-(2-methylphenoxy) benzyl) oxygen) phenyl) methyl propionate
Identical with embodiment 277, (identical by 3-(4-hydroxy phenyl) methyl propionate with reference example 201 with [3-(2-methylphenoxy) phenyl] methanol, synthetic (still by orthoresol and 3-bromobenzaldehyde, be mixture with byproduct of reaction)) the buttery table title chemical compound of synthesizing colourless (using HPLC (gradient circulation A) when making with extra care), yield is 28%.
1H NMR(CDCl 3)δ：2.22(3H，s)，2.60(2H，t，J＝7.8Hz)，2.89(2H，t，J＝7.8Hz)，3.67(3H，s)，4.99(2H，s)，6.79-6.94(4H，m)，6.98(1H，s)，7.03-7.21(5H，m)，7.22-7.34(2H，m)。
Embodiment 282 3-(4-((3-(2-methylphenoxy) benzyl) oxygen) phenyl) propanoic acid
Identical with embodiment 278, by 3-(4-((3-(2-methylphenoxy) benzyl) oxygen) phenyl) the crystalline table title chemical compound of methyl propionate synthesizing colourless, yield is 58%.
MS(APCI-)：361(M-H)。
Embodiment 283 3-[4-[(2 '-formyl biphenyl-3-yl) methoxyl group] phenyl] the propanoic acid tert-butyl ester
With the 3-[4-[(3-bromobenzyl) oxygen] phenyl] the propanoic acid tert-butyl ester (3.5g; 8.94mmol), 2-formylphenylboronic acid (1.47g; 9.83mmol), tetra-triphenylphosphine palladium (413mg; 0.36mmol), 2 the regulation wet chemical (7mL), ethanol (7mL) and toluene (70mL) mixture; under ar gas environment atmosphere, stirred 14 hours at 80 ℃.After the reactant liquor cooling, use the ethyl acetate dilute reaction solution, wash, dry concentrating under reduced pressure afterwards.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=10/1～4/1), obtain the table title chemical compound (3.62g, 97%) of colorless oil.
1H NMR(CDCl 3)δ：1.41(9H，s)，2.50(2H，t，J＝7.8Hz)，2.85(2H，t，J＝7.8Hz)，5.11(2H，s)，6.90(2H，d，J＝8.7Hz)，7.13(2H，d，J＝8.7Hz)，7.33(1H，m)，7.42-7.55(5H，m)，7.65(1H，m)，8.03(1H，dd，J＝1.5，7.8Hz)，9.98(1H，s)。
Embodiment 284 3 '-[4-(2-tert-butoxycarbonyl ethyl) phenoxymethyl] diphenyl-2-carboxylic acid
Under 0 ℃; while stirring phenyl to 3-[4-(2 '-formyl biphenyl-3-ylmethoxy)] the propanoic acid tert-butyl ester (1.5g; 3.60mmol), sodium dihydrogen phosphate (0.43g; 3.60mmol), 2-methyl-2-butene (1.72mL; 16.2mmol), add sodium chlorite (1.22g in the mixture of the tert-butyl alcohol (7mL), water (15mL) and oxolane (15mL); 10.8mmol), stirred 2 hours with relaxing the bowels with purgatives of warm nature.Reactant liquor dilutes with ethyl acetate, washes dry (anhydrous magnesium sulfate) back concentrating under reduced pressure.Behind the refining residue of silica gel column chromatography (hexane/ethyl acetate=2/1～1/2), obtain the table title chemical compound (1.12g, 72%) of yellow oily.
1H NMR(CDCl 3)δ：1.40(9H，s)，2.50(2H，t，J＝7.2Hz)，2.84(2H，t，J＝7.2Hz)，5.09(2H，s)，6.88(2H，d，J＝8.7Hz)，7.10(2H，d，J＝8.7Hz)，7.20-7.47(6H，m)，7.56(1H，m)，7.93(1H，m)。
Embodiment 285 3-(4-((2 '-((dimethyl amido) carbonyl) biphenyl-3-yl) methoxyl group) phenyl) propanoic acid
To 3 '-[4-(2-tert-butoxycarbonyl ethyl) phenoxymethyl] diphenyl-2-carboxylic acid (0.24g, 0.56mmol), dimethylaniline (2M tetrahydrofuran solution, 0.42mL, 0.84mmol), I-hydroxybenzotriazole-water and thing (0.13g, 0.84mmol) and N, in the mixture of dinethylformamide (6.0mL), under the stirring at room, (0.16g 0.84mmol), stirred 12 hours with relaxing the bowels with purgatives of warm nature to add 1-ethyl-3-(3-dimethyl amido propyl group) carbonization two imide salt hydrochlorates, reactant liquor dilutes with ethyl acetate, use saturated sodium bicarbonate solution successively, after 5% aqueous potassium hydrogen sulfate and the saturated aqueous common salt cleaning, drying (anhydrous magnesium sulfate), concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=2/1～1/2), obtain 3-(4-((2 '-((dimethyl amido) carbonyl) biphenyl-3-yl) methoxyl group) phenyl) the propanoic acid tert-butyl ester of colorless oil.This chemical compound is dissolved in trifluoroacetic acid (2mL), at room temperature stir 1 hour after, the concentrating under reduced pressure reactant liquor.Get refining residue among the HPLC (gradient circulation A) at branch, obtain the table title chemical compound (58mg, yield 26%) of colourless crystallization.
MS(APCI-)：402(M-H)。
Embodiment 286 3-(4-((2 '-(amino carbonyl) biphenyl-3-yl) methoxyl group) phenyl) propanoic acid
Identical with embodiment 285, by 3 '-[4-(2-tert-butoxycarbonyl ethyl) phenoxymethyl] diphenyl-2-carboxylic acid and the crystalline table title chemical compound of I-hydroxybenzotriazole ammonium salt synthesizing colourless, yield is 66%.
MS(APCI-)：374(M-H)。
Embodiment 287 3 '-((4-(2-carboxy ethyl) phenoxy group) methyl) diphenyl-2-carboxylic acid
Dissolving 3 '-[4-(2-tert-butoxycarbonyl ethyl) phenoxymethyl] (0.15g 0.35mmol), at room temperature stirred 1 hour diphenyl-2-carboxylic acid in trifluoroacetic acid (3mL).Concentration of reaction solution with the refining residue of silica gel column chromatography (hexane/ethyl acetate=1/2～ethyl acetate), obtains the table title chemical compound (21mg, yield are 16%) of colourless powder shape.
MS(APCI-)：375(M-H)。
Embodiment 288 3-(4-((2 ', 6 '-dimethoxy-biphenyl-3-yl) methoxyl group) phenyl) methyl propionate
Identical with embodiment 22, by the 3-[4-[(3-bromobenzyl) oxygen] phenyl] methyl propionate and 2, the buttery table title chemical compound of 6-dimethoxy benzene ylboronic acid synthesizing colourless, yield is 93%.
1H NMR(CDCl 3)δ：2.59(2H，t，J＝7.8Hz)，2.89(2H，t，J＝7.8Hz)，3.66(3H，s)，3.71(6H，s)，5.08(2H，s)，6.65(2H，d，J＝8.4Hz)，6.92(2H，d，J＝8.7Hz)，7.11(2H，d，J＝8.7Hz)，7.23-7.33(2H，m)，7.34-7.45(3H，m)。
Embodiment 289 3-(4-((2 ', 6 '-dimethoxy-biphenyl-3-yl) methoxyl group) phenyl) propanoic acid
Identical with embodiment 278, by 3-(4-((2 ', 6 '-dimethoxy-biphenyl-3-yl) methoxyl group) phenyl) the crystalline table title chemical compound of methyl propionate synthesizing colourless, yield is 86%.
MS(APCI-)：391(M-H)。
Embodiment 290 3-(4-((2 ', 6 '-diethyl biphenyl-3-yl) methoxyl group) phenyl) methyl propionate
Identical with embodiment 277, by 3-(4-hydroxy phenyl) methyl propionate and (2 ', 6 '-diethyl biphenyl-3-yl) buttery table title chemical compound of methanol synthesizing yellow thing, yield 80%.
1H NMR(CDCl 3)δ：0.99(6H，t，J＝7.5Hz)，2.30(4H，q，J＝7.5Hz)，2.59(2H，t，J＝7.8Hz)，2.88(2H，t，J＝7.8Hz)，3.66(3H，s)，5.10(2H，s)，6.88(2H，d，J＝8.4Hz)，7.05-7.20(5H，m)，7.21-7.33(2H，m)，7.38-7.48(2H，m)。
Embodiment 291 3-(4-((2 ', 6 '-diethyl biphenyl-3-yl) methoxyl group) phenyl) propanoic acid
Identical with embodiment 278, by 3-(4-((2 ', 6 '-diethyl biphenyl-3-yl) methoxyl group) phenyl) the crystalline table title chemical compound of methyl propionate synthesizing colourless, yield is 52%.
1H NMR(CDCl 3)δ：0.99(6H，t，J＝7.5Hz)，2.30(4H，q，J＝7.5Hz)，2.64(2H，t，J＝7.8Hz)，2.90(2H，t，J＝7.8Hz)，5.10(2H，s)，6.86-6.93(2H，m)，7.07-7.17(5H，m)，7.21-7.31(2H，m)，7.39-7.46(1H，m)。
MS(APCI-)：387(M-H)。
Embodiment 292 3-(4-((2 ', 6 '-DfBP-3-yl) methoxyl group) phenyl) methyl propionate
Identical with embodiment 277, by 3-(4-hydroxy phenyl) methyl propionate and the buttery table title chemical compound of (2 ', 6 '-DfBP-3-yl) methanol synthesizing colourless, yield is 60%.
1H NMR(CDCl 3)δ：2.60(2H，t，J＝7.8Hz)，2.90(2H，t，J＝7.8Hz)，3.66(3H，s)，5.09(2H，s)，6.88-7.04(4H，m)，7.12(2H，d，J＝8.7Hz)，7.29(1H，m)，7.39-7.56(4H，m)。
Embodiment 293 3-(4-((2 ', 6 '-DfBP-3-yl) methoxyl group) phenyl) propanoic acid
Identical with embodiment 278, by 3-(4-((2 ', 6 '-DfBP-3-yl) methoxyl group) phenyl) the crystalline table title chemical compound of methyl propionate synthesizing colourless, yield is 86%.
1H NMR(CDCl 3)δ：2.65(2H，t，J＝7.8Hz)，2.91(2H，t，J＝7.8Hz)，5.09(2H，s)，6.89-7.04(4H，m)，7.13(2H，d，J＝8.7Hz)，7.29(1H，m)，7.39-7.55(4H，m)。
Embodiment 294 3-(4-((2 ', 6 '-diethyl biphenyl-3-yl) methoxyl group)-2-fluorophenyl) ethyl propionate
Identical with embodiment 277, by 3-(2-fluoro-4-hydroxy phenyl) ethyl propionate and the buttery table title chemical compound of (2 ', 6 '-diethyl biphenyl-3-yl) methanol synthesizing yellow, yield is 80%.
1H NMR(CDCl 3)δ：0.99(6H，t，J＝7.5Hz)，1.23(3H，t，J＝7.2Hz)，2.30(4H，q，J＝7.5Hz)，2.57(2H，t，J＝7.8Hz)，2.89(2H，t，J＝7.8Hz)，4.12(2H，q，J＝7.2Hz)，5.08(2H，s)，6.60-6.71(2H，m)，7.03-7.17(4H，m)，7.19-7.31(2H，m)，7.35-7.48(2H，m)。
Embodiment 295 3-(4-((2 ', 6 '-diethyl biphenyl-3-yl) methoxyl group)-2-fluorophenyl) propanoic acid
Identical with embodiment 278, by 3-(4-((2 ', 6 '-diethyl biphenyl-3-yl) methoxyl group)-2-fluorophenyl) the crystalline table title chemical compound of ethyl propionate synthesizing colourless, yield is 71%.
MS(APCI-)：405(M-H)。
Embodiment 296 3-(4-((2 '-(methylol) biphenyl-3-yl) methoxyl group) phenyl) the propanoic acid tert-butyl ester
In the mixed solution of methanol (6mL) and oxolane (6mL), dissolve 3-(4-(2 '-formyl biphenyl-3-ylmethoxy) phenyl) the propanoic acid tert-butyl ester (0.30g; 0.72mmol); (14mg, 0.36mmol), equality of temperature stirred 2 hours at the ice-cooled sodium borohydride of adding down.After reactant liquor concentrated, dilute residue, stipulate concentrating under reduced pressure after hydrochloric acid and the saturated aqueous common salt cleaning, drying with 1 with ethyl acetate.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=10/1～1/1), obtain the table title chemical compound (0.25g, yield 83%) of colorless oil.
1H NMR(CDCl 3)δ：1.41(9H，s)，2.50(2H，t，J＝7.8Hz)，2.85(2H，t，J＝7.8Hz)，4.56(2H，s)，5.10(2H，s)，6.90(2H，d，J＝8.7Hz)，7.12(2H，d，J＝8.7Hz)，7.23-7.45(7H，m)，7.56(1H，m)。
Embodiment 297 3-(4-((2 '-(methylol) biphenyl-3-yl) methoxyl group) phenyl) propanoic acid
(0.25g 0.60mmol), at room temperature stirred 1 hour the propanoic acid tert-butyl ester dissolving 3-(4-((2 '-(methylol) biphenyl-3-yl) methoxyl group) phenyl) in trifluoroacetic acid (2mL).Concentration of reaction solution is got the refining residue of HPLC (gradient circulation A) with dividing, and obtains the table title chemical compound (10mg, 5%) of colourless crystallization.
MS(APCI-)：361(M-H)。
Embodiment 298 3-[4-[[3-[benzyl (ethyl) amino] benzyl] oxygen] phenyl] propanoic acid
With the 3-[4-[(3-bromobenzyl) oxygen] phenyl] methyl propionate (0.30g, 0.86mmol), benzyl (ethyl) amine (0.20mL, 1.29mmol), cesium carbonate (0.39g, 1.20mmol), three (two benzal acetone) two palladiums (O) (0.031g, 0.034mmol), rac-2,2 '-two (diphenylphosphino)-1,1 '-dinaphthalene (0.032g, 0.052mmol) and the mixture of toluene (6mL), under nitrogen surrounding atmosphere environment, stirred 16 hours at 80 ℃.The cooling reactant liquor, water and saturated aqueous common salt are cleaned, with concentrating under reduced pressure after the dried over mgso.Then, residue is dissolved in the mixed solution of methanol (4mL) and oxolane (6mL), adds 1 regulation sodium hydrate aqueous solution (1.8mL), at room temperature stirred 2 hours.Reactant mixture is regulated pH to 7 with 1 regulation hydrochloric acid, extracts with the ethyl acetate separatory.Water and saturated aqueous common salt are cleaned organic layer, after dried over mgso, and concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=2/1～1/2), obtain the table title chemical compound (42mg, yield 13%) of yellow crystal.
MS(APCI-)：388(M-H)。
Embodiment 299 3-[4-[[3-[ethyl (phenyl) amino] benzyl] oxygen] phenyl] propanoic acid
Identical with embodiment 298, by the 3-[4-[(3-bromobenzyl) oxygen] phenyl] methyl propionate and the synthetic crystalline table title chemical compound of the shallow colour of camel's hair of ethyl (phenyl) amine, yield is 11%.
MS(APCI-)：374(M-H)。
Embodiment 300 3-[4-[[3-(biphenyl-3-base is amino) benzyl] oxygen] phenyl] propanoic acid
Identical with embodiment 298, by the 3-[4-[(3-bromobenzyl) oxygen] phenyl] methyl propionate and biphenyl-crystalline table title chemical compound of 3-base amine synthesizing colourless, yield is 6%.
1H NMR(CDCl 3)δ：2.65(2H，t，J＝7.8Hz)，2.90(2H，t，J＝7.8Hz)，5.00(2H，s)，6.90(2H，d，J＝8.7Hz)，6.98(1H，d，J＝7.5Hz)，7.02-7.20(6H，m)，7.27-7.46(6H，m)，7.53-7.59(2H，m)。
Embodiment 301 3-[4-[(3-anilino-benzyls) oxygen] phenyl] methyl propionate
To (3-anilino-phenyl) methanol (1.12g, 5.62mmol), 3-(4-hydroxy phenyl) methyl propionate (1.22g, 6.75mmol), triphenylphosphine (1.92g, 7.31mmol) and the mixture of oxolane (20mL) in, the toluene solution (40% that under 0 ℃ of stirring, adds the diethylazodicarboxylate, 3.32mL), stirred 14 hours under the room temperature.Concentration of reaction solution with the refining residue of silica gel column chromatography (hexane/ethyl acetate=10/1～2/1), obtains the crystalline table title chemical compound of the shallow colour of camel's hair (1.01g, yield 50%).
1H NMR(CDCl 3)δ：2.60(2H，t，J＝7.8Hz)，2.89(2H，t，J＝7.8Hz)，3.66(3H，s)，4.99(2H，s)，5.74(1H，s)，6.89(2H，d，J＝8.7Hz)，6.92-7.15(7H，m)，7.22-7.30(4H，m)。
Embodiment 302 3-[4-[[3-[phenyl (propyl group) amino] benzyl] oxygen] phenyl] propanoic acid
To 3-[4-[(3-anilino-benzyl) oxygen] phenyl] methyl propionate (0.20g, N 0.58mmol), in dinethylformamide (4mL) solution, 0 ℃ and stir under, (0.035g 0.86mmol), stirred 10 minutes with relaxing the bowels with purgatives of warm nature to add 60% sodium hydride.0 ℃ and stir under, in this mixture, add positive propyl bromo (0.063mL, 0.69mmol) and sodium iodide (0.10g, 0.69mmol), stirring is 16 hours under the room temperature.Use the ethyl acetate dilute reaction solution, and concentrating under reduced pressure after water and the saturated aqueous common salt cleaning, drying.Then, dissolved residue in the mixed solution of methanol (3mL) and oxolane (6mL) adds 1 regulation sodium hydrate aqueous solution (1.5mL), stirs 1 hour under the room temperature.PH value to 3 with 1 regulation hydrochloric acid adjustment reactant mixture extracts with the ethyl acetate separatory, behind the anhydrous magnesium sulfate drying organic layer, and concentrating under reduced pressure.With the refining residue of silica gel column chromatography (hexane/ethyl acetate=4/1～1/2), obtain the table title chemical compound (0.11g, yield 47%) of colourless crystallization.
MS(APCI-)：388(M-H)。
Embodiment 303 3-[4-[[3-[butyl (phenyl) amino] benzyl] oxygen] phenyl] propanoic acid
Identical with embodiment 302, by 3-[4-[(3-anilino-benzyl) oxygen] phenyl] methyl propionate and the crystalline table title chemical compound of n-butyl bromide synthesizing colourless, yield is 57%.
MS(APCI-)：402(M-H)。
Embodiment 304 3-[4-[[3-[benzyl (phenyl) amino] benzyl] oxygen] phenyl] propanoic acid
Identical with embodiment 302, by 3-[4-[(3-anilino-benzyl) oxygen] phenyl] methyl propionate and the crystalline table title chemical compound of benzyl bromide a-bromotoluene synthesizing colourless, yield 74%.
MS(APCI-)：436(M-H)。
Embodiment 305 3-[4-[(3-anilino-benzyls) oxygen] phenyl] propanoic acid
Identical with embodiment 278, by 3-[4-[(3-anilino-benzyl) oxygen] phenyl] the crystalline table title chemical compound of methyl propionate synthesizing colourless, yield is 70%.
MS(APCI-)：346(M-H)。
Embodiment 306 3-[4-[[3-[isobutyl group (phenyl) amino] benzyl] oxygen] phenyl] propanoic acid
Identical with embodiment 302, by 3-[4-[(3-anilino-benzyl) oxygen] phenyl] methyl propionate and the synthetic pulverous table title chemical compound of ficelle of isobutyl bromide, yield is 12%.
MS(APCI-)：402(M-H)。
Embodiment 307 3-(4-((4-((ethyl (3-aminomethyl phenyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
To 3-(4-((4-(chloromethyl) benzyl) oxygen) phenyl) methyl propionate (50mg, 0.16mmol) N, add N-ethyl-meta-aminotoluene (51mg in dinethylformamide (1mL) solution, 0.19mmol) N, dinethylformamide solution (0.5mL), potassium carbonate (33mg, 0.24mmol), stirred 66 hours down at 70 ℃.In reactant liquor, add entry (2mL), extract with dichloromethane (2mL).With the centrifugal enrichment facility concentrating under reduced pressure of GeneVac organic layer.
The product that obtains is dissolved in the methanol (2mL), and (0.32mL 0.32mmol), stirred 18 hours under the room temperature to add 1 regulation sodium hydrate aqueous solution.In reactant liquor, add 1 regulation hydrochloric acid and be adjusted to acidity, extract with dichloromethane (2mL).The organic layer centrifugal enrichment facility concentrating under reduced pressure of GeneVac.Get the refining residue of HPLC (gradient circulation B) with branch, obtain table title chemical compound (21mg, 26%).
MS(ESI+，m/e)404(M+1)。
Chemical compound shown in following embodiment 308～embodiment 338, identical with embodiment 307, (50mg 0.16mmol) synthesizes with corresponding amine by 3-(4-((4-(chloromethyl) benzyl) oxygen) phenyl) methyl propionate.
Embodiment 308 3-(4-((4-((methyl (2-(phenyl sulfonyl) ethyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 43mg.MS(ESI+，m/e)468(M+1)。
Embodiment 309 3-(4-((4-(((3-phenoxy benzyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 40mg.MS(ESI+，m/e)468(M+1)。
Embodiment 310 3-(4-((4-(((4-phenoxy benzyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 37mg.MS(ESI+，m/e)468(M+1)。
Embodiment 311 3-(4-((4-(((4-(2-pyrazine oxygen base) benzyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 13mg.MS(ESI+，m/e)470(M+1)。
Embodiment 312 3-(4-((4-(((2-phenoxy propyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 33mg.MS(ESI+，m/e)420(M+1)。
Embodiment 313 3-(4-((4-(((2, the 2-diphenyl-ethyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 45mg.MS(ESI+，m/e)466(M+1)。
Embodiment 314 3-(4-((4-(((biphenyl-2-ylmethyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 47mg.MS(ESI+，m/e)452(M+1)。
Embodiment 315 3-(4-((4-(((biphenyl-3-ylmethyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 32mg.MS(ESI+，m/e)452(M+1)。
Embodiment 316 3-(4-((4-(((biphenyl-4-ylmethyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 12mg.MS(ESI+，m/e)452(M+1)。
Embodiment 317 3-(4-((4-(((2-phenyl-2-(1-pyrrolidinyl) ethyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 40mg.MS(ESI+，m/e)459(M+1)。
Embodiment 318 3-(4-((4-((methyl (1-phenyl-2-(1-pyrrolidinyl) ethyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 18mg.MS(ESI+，m/e)473(M+1)。
Embodiment 319 3-(4-((4-(((2-cyanoethyl) (phenyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 15mg.MS(ESI+，m/e)415(M+1)。
Embodiment 320 3-(4-((4-((benzyl (phenyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 21mg.MS(ESI+，m/e)452(M+1)。
Embodiment 321 3-(4-((4-((ethyl (2-aminomethyl phenyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 22mg.MS(ESI+，m/e)404(M+1)。
Embodiment 322 3-(4-((4-((butyl (phenyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 39mg.MS(ESI+，m/e)418(M+1)。
Embodiment 323 3-(4-((4-((phenyl (propyl group) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 23mg.MS(ESI+，m/e)404(M+1)。
Embodiment 324 3-(4-((4-((amyl group (phenyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 21mg.MS(ESI+，m/e)432(M+1)。
Embodiment 325 3-(4-((4-((ethyl (2-naphthyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 7mg.MS(ESI+，m/e)440(M+1)。
Embodiment 326 3-(4-((4-((isopropyl (phenyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 6mg.MS(ESI+，m/e)404(M+1)。
Embodiment 327 3-(4-((4-((benzyl (methyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 51mg.MS(ESI+，m/e)390(M+1)。
Embodiment 328 3-(4-((4-(((4-chlorphenyl) (methyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 20mg.MS(ESI+，m/e)410(M+1)。
Embodiment 329 3-(4-((4-(((3-aminomethyl phenyl) (propyl group) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 29mg.MS(ESI+，m/e)418(M+1)。
Embodiment 330 3-(4-((4-((dibenzyl amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 58mg.MS(ESI+，m/e)466(M+1)。
Embodiment 331 3-(4-((4-((benzyl (ethyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 46mg.MS(ESI+，m/e)404(M+1)。
Embodiment 332 3-(4-((4-((benzyl (butyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 63mg.MS(ESI+，m/e)432(M+1)。
Embodiment 333 3-(4-((4-(((4-cyclohexyl phenyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 7mg.MS(ESI+，m/e)444(M+1)。
Embodiment 334 3-(4-((4-(((2-imidazo [1,5-a] pyridin-3-yl ethyl) (phenyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 9mg.MS(ESI+，m/e)506(M+1)。
Embodiment 335 3-(4-((4-(((4-(4-chlorphenyl)-1,3-thiazoles-2-yl) (methyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 18mg.MS(ESI+，m/e)493(M+1)。
Embodiment 336 3-(4-((4-(((4-(4-cyclohexyl phenyl)-1,3-thiazoles-2-yl) (methyl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 2mg.MS(ESI+，m/e)541(M+1)。
Embodiment 337 3-{2-[(4-{[4-(2-carboxyethyl) phenoxy group] methyl } benzyl) (methyl) amino]-4-phenyl-1,3-thiazoles-5-yl } propanoic acid
Receipts amount 10mg.MS(ESI+，m/e)531(M+1)。
Embodiment 338 3-(4-((4-((methyl (4-(5,6,7,8-tetrahydrochysene-2-naphthyl)-1,3-thiazoles-2-yl) amino) methyl) benzyl) oxygen) phenyl) propanoic acid
Receipts amount 6mg.MS(ESI+，m/e)513(M+1)。
Embodiment 339 3-(4-((6-benzyloxy-2 ', 6 '-dimethyl-biphenyl-3-yl) methoxyl group) phenyl) methyl propionate
Identical with reference example 31, obtain the table title chemical compound of colourless prism by (6-benzyloxy-2 ', 6 '-dimethyl-biphenyl-3-yl) methanol and 4-hydroxy phenyl methyl propionate, yield is 55%.
1H-NMR(CDCl 3)δ2.03(6H，s)，2.59(2H，t，J＝7.6Hz)，2.89(2H，t，J＝7.6Hz)，3.66(3H，s)，4.95-5.08(4H，m)，6.88(2H，d，J＝8.8Hz)，6.94-7.42(13H，m)。
Embodiment 340 3-(4-((6-benzyloxy-2 ', 6 '-dimethyl-biphenyl-3-yl) methoxyl group) phenyl) propanoic acid
Identical with reference example 4, obtain the table title chemical compound of colourless prism by 3-(4-((6-benzyloxy-2 ', 6 '-dimethyl-biphenyl-3-yl) methoxyl group) phenyl) ethyl propionate, yield is 69%.
1H-NMR(CDCl 3)δ2.03(6H，s)，2.64(2H，t，J＝7.8Hz)，2.90(2H，t，J＝7.8Hz)，4.97-5.10(4H，m)，6.88(2H，d，J＝8.4Hz)，6.95-7.46(13H，m)。
Embodiment 341 3-{4-[(4-{[(3-methyl butyls) (4-phenyl-1,3-thiazoles-2-yl) amino] methyl } benzyl) oxygen] phenyl } methyl propionate
With N-(3-methyl butyl)-4-phenyl-1,3-thiazoles-2-amine (370mg), sodium hydride (60%, oiliness, 50mg), N, the mixture of dinethylformamide (5mL) at room temperature mixes and stirred 1 hour.In reactant mixture, add 3-(4-{[4-(chloromethyl) benzyl] oxygen } phenyl) methyl propionate (318mg), mix under the room temperature and stirred 1 hour.Reactant mixture is injected water, transfer to acidity with 1 regulation aqueous hydrochloric acid solution after, use ethyl acetate extraction.Behind the dry ethyl acetate layer of Presep Dehydration tube (with the pure medicine of light (strain) system), concentrate, it is refining that residue is got HPLC (gradient circulation A) with branch, obtains the table title chemical compound (250mg, yield 47%) of yellow oily.
MS(ESI+)529(M+H)。
Embodiment 342 3-{4-[(4-{[(3-methyl butyls) (4-phenyl-1,3-thiazoles-2-yl) amino] methyl } benzyl) oxygen] phenyl } propanoic acid
With the 3-{4-[(4-{[(3-methyl butyl) (4-phenyl-1, the 3-thiazol-2-yl) amino] methyl } benzyl) oxygen] phenyl } methyl propionate (240mg) is dissolved in the mixed solvent of methanol (2mL) and oxolane (2mL), add 2 regulation sodium hydrate aqueous solutions (2mL), at room temperature mix and stirred 1 hour.Reactant mixture is injected in the water, be adjusted to acidity with 1 regulation aqueous hydrochloric acid solution after, use ethyl acetate extraction.Behind the dry ethyl acetate layer of Presep Dehydration tube (with the pure medicine of light (strain) system), concentrate, obtain the table title chemical compound (220mg, yield 90%) of faint yellow oily.
MS(ESI+)515(M+H)。
Embodiment 343 3-{4-[(4-{[(4-isopropyl-1,3-thiazoles-2-yl) (3-methyl butyl) amino] methyl } benzyl) oxygen] phenyl } methyl propionate
With 4-isopropyl-N-(3-methyl butyl)-1,3-thiazoles-2-amine (313mg), sodium hydride (60%, oiliness, 50mg), N, the mixture of dinethylformamide (5mL) at room temperature mixes and stirred 1 hour.In reactant mixture, add 3-(4-{[4-(chloromethyl) benzyl] oxygen } phenyl) methyl propionate (318mg), at room temperature mix and stirred 1 hour.Reactant mixture is injected in the water, transfer to acidity with 1 regulation aqueous hydrochloric acid solution after, use ethyl acetate extraction.Behind the dry ethyl acetate layer of Presep Dehydration tube (with the pure medicine of light (strain) system), concentrate, it is refining that residue is got HPLC (gradient circulation A) with branch, obtains the table title chemical compound (150mg, yield 28%) of yellow oily.
MS(ESI+)495(M+H)。
Embodiment 344 3-{4-[(4-{[(4-isopropyl-1,3-thiazoles-2-yl) (3-methyl butyl) amino] methyl } benzyl) oxygen] phenyl } propanoic acid
With 3-{4-[(4-{[(4-isopropyl-1, the 3-thiazol-2-yl) (3-methyl butyl) amino] methyl } benzyl) oxygen] phenyl } methyl propionate (140mg) is dissolved in the mixed solvent of methanol (2mL), oxolane (2mL), add 2 regulation sodium hydrate aqueous solutions (2mL), at room temperature mix and stirred 1 hour.Reactant mixture is injected in the water, be adjusted to acidity with 1 regulation aqueous hydrochloric acid solution after, use ethyl acetate extraction.Behind the dry ethyl acetate layer of Presep Dehydration tube (with the pure medicine of light (strain) system), concentrate, obtain the table title chemical compound (120mg, yield 88%) of faint yellow oily.
MS(ESI+)481(M+H)。
Embodiment 345 3-[4-(4-[1-(4-phenyl-1,3-thiazoles-2-yl) butoxy] and benzyl } oxygen) phenyl] propanoic acid
The mixture of (4-phenyl-1,3-thiazoles-2-yl) methanol (3.82g), activated manganese dioxide (15g), oxolane (30mL) is at room temperature mixed stirring 3 hours.Behind the filter reaction mixture, concentrated filtrate, the resulting grease of dissolving in oxolane (30mL) solution.Under 0 ℃, (2 regulation tetrahydrofuran solutions 10mL), mix and stirred 1 hour to add bromination propyl group magnesium in this solution.Reactant mixture is injected in the 1 regulation aqueous hydrochloric acid solution, uses ethyl acetate extraction.Concentrate ethyl acetate layer, with the refining residue of silica gel column chromatography.Launch with ethyl acetate-hexane (volumetric ratio is alternation from 1: 19 to 1: 1), obtain yellow oil (1.1g).At room temperature, (40%, toluene solution 650mg) at room temperature stirs 1 hour to splash into the diethylazodicarboxylate in toluene (2mL) solution of this yellow oil (233mg), 4-methyl hydroxybenzoate (152mg), triphenylphosphine (399mg).Concentrated reaction mixture is with the refining residue of silica gel column chromatography.Launch with ethyl acetate-hexane (1: 19 to 1: 1 alternation of volumetric ratio), obtain yellow oil.This grease is dissolved in oxolane (10mL) solution, under 0 ℃, in this solution, add lithium aluminium hydride (40mg), get back to after the room temperature and stirred 1 hour.Add sal glauberi (1.0g), remove by filter insoluble matter.Concentrated filtrate adds 3-(4-hydroxy phenyl) methyl propionate (180mg), triphenylphosphine (399mg), toluene (2mL) in residue, at room temperature, splash into diethylazodicarboxylate (40% toluene solution 650mg), at room temperature stirs 1 hour.Concentrated reaction mixture with the refining residue of silica gel column chromatography, launches with ethyl acetate-hexane (volumetric ratio is alternation from 1: 19 to 1: 1), obtains yellow oil.This yellow oil is dissolved in the mixed solvent of methanol (2mL), oxolane (2mL), add 2 regulation sodium hydrate aqueous solutions (2mL), at room temperature mix and stirred 1 hour.Reactant mixture is injected in the water, transfer to acidity with 1 regulation aqueous hydrochloric acid solution after, use ethyl acetate extraction.Behind the dry ethyl acetate layer of Presep Dehydration tube (with the pure medicine of light (strain) system), concentrate, obtain the table title chemical compound (93mg) of colourless crystallization.
MS(ESI+)488(M+H)。
Below, the structural formula of expression embodiment 1～201,202A and 203～345 resulting chemical compounds.
The embodiment structural formula
Figure A20038010826002291
The embodiment structural formula
The embodiment structural formula
Figure A20038010826002311
The embodiment structural formula
Figure A20038010826002321
The embodiment structural formula
Figure A20038010826002331
The embodiment structural formula
Figure A20038010826002341
The embodiment structural formula
Figure A20038010826002351
The embodiment structural formula
Figure A20038010826002361
The embodiment structural formula
The embodiment structural formula
Figure A20038010826002381
The embodiment structural formula
The embodiment structural formula
The embodiment structural formula
The embodiment structural formula
Figure A20038010826002421
The embodiment structural formula
Figure A20038010826002431
The embodiment structural formula
Figure A20038010826002441
The embodiment structural formula
The embodiment structural formula
The embodiment structural formula
Figure A20038010826002471
The embodiment structural formula
The embodiment structural formula
Figure A20038010826002491
The embodiment structural formula
Figure A20038010826002501
The embodiment structural formula
Figure A20038010826002511
The embodiment structural formula
The embodiment structural formula
Figure A20038010826002531
The embodiment structural formula
The embodiment structural formula
Figure A20038010826002551
The embodiment structural formula
The embodiment structural formula
Figure A20038010826002571
The embodiment structural formula
The embodiment structural formula
The embodiment structural formula
Figure A20038010826002601
The embodiment structural formula
The embodiment structural formula
Figure A20038010826002621
The embodiment structural formula
Figure A20038010826002631
The embodiment structural formula
Figure A20038010826002641
The embodiment structural formula
Figure A20038010826002651
The embodiment structural formula
The embodiment structural formula
Figure A20038010826002671
The embodiment structural formula
Figure A20038010826002681
The embodiment structural formula
Figure A20038010826002691
The embodiment structural formula
The embodiment structural formula
The embodiment structural formula
Figure A20038010826002721
The embodiment structural formula
Figure A20038010826002731
The embodiment structural formula
Figure A20038010826002741
The embodiment structural formula
The embodiment structural formula
Figure A20038010826002761
The embodiment structural formula
Figure A20038010826002771
The embodiment structural formula
Figure A20038010826002781
The embodiment structural formula
Figure A20038010826002791
Utilizability on the industry
Chemical compound of the present invention or its prodrug have excellent GPR40 receptor function controlling regulating action, and the prevention, the therapeutic agent that can be used as diabetes etc. use.
And, by with chemical compound of the present invention or its prodrug as acting on behalf of ligand, can screen GPR40 agonist or GPR40 antagonist effectively.
The sequence table text
Serial number: 13
The oligonucleotide primers of the DNA of the amplification coding mGPR40 of design
Serial number: 14
The oligonucleotide primers of the DNA of the amplification coding mGPR40 of design
Serial number: 15
The oligonucleotide primers of the DNA of the amplification coding rGPR40 of design
Serial number: 16
The oligonucleotide primers of the DNA of the amplification coding rGPR40 of design
Serial number: 17
The oligonucleotide primers of the DNA of the amplification coding monkey GPR40 of design
Serial number: 18
The widow of the DNA of the amplification coding monkey GPR40 of design examines former times acid primer
Serial number: 19
The oligonucleotide primers of the DNA of the amplification coding monkey GPR40 of design
Serial number: 20
The oligonucleotide primers of the DNA of the amplification coding monkey GPR40 of design
Serial number: 21
The oligonucleotide primers of the DNA of the amplification coding hamster GPR40 of design
Serial number: 22
The oligonucleotide primers of the DNA of the amplification coding hamster GPR40 of design
Sequence table
＜110〉Takede Chemical Industries Ltd
＜120〉receptor function controlling agent
<130>3119WO0P
<150>JP 2002-324632
<151>2002-11-08
<150>JP 2003-16889
<151>2003-01-27
<150>JP 2003-153986
<151>2003-05-30
<160>26
<210>1
<211>300
<212>PRT
＜213〉mice
<400>1
Met Asp Leu Pro Pro Gln Leu Ser Phe Ala Leu Tyr Val Ser Ala Phe
5 10 15
Ala Leu Gly Phe Pro Leu Asn Leu Leu Ala Ile Arg Gly Ala Val Ser
20 25 30
His Ala Lys Leu Arg Leu Thr Pro Ser Leu Val Tyr Thr Leu His Leu
35 40 45
Gly Cys Ser Asp Leu Leu Leu Ala Ile Thr Leu Pro Leu Lys Ala Val
50 55 60
Glu Ala Leu Ala Ser Gly Ala Trp Pro Leu Pro Leu Pro Phe Cys Pro
65 70 75 80
Val Phe Ala Leu Ala His Phe Ala Pro Leu Tyr Ala Gly Gly Gly Phe
85 90 95
Leu Ala Ala Leu Ser Ala Gly Arg Tyr Leu Gly Ala Ala Phe Pro Phe
100 105 110
Gly Tyr Gln Ala Ile Arg Arg Pro Arg Tyr Ser Trp Gly Val Cys Val
115 120 125
Ala Ile Trp Ala Leu Val Leu Cys His Leu Gly Leu Ala Leu Gly Leu
130 135 140
Glu Thr Ser Gly Ser Trp Leu Asp Asn Ser Thr Ser Ser Leu Gly Ile
145 150 155 160
Asn Ile Pro Val Asn Gly Ser Pro Val Cys Leu Glu Ala Trp Asp Pro
165 170 175
Asp Ser Ala Arg Pro Ala Arg Leu Ser Phe Ser Ile Leu Leu Phe Phe
180 185 190
Leu Pro Leu Val Ile Thr Ala Phe Cys Tyr Val Gly Cys Leu Arg Ala
195 200 205
Leu Val Arg Ser Gly Leu Ser His Lys Arg Lys Leu Arg Ala Ala Trp
210 215 220
Val Ala Gly Gly Ala Leu Leu Thr Leu Leu Leu Cys Leu Gly Pro Tyr
225 230 235 240
Asn Ala Ser Asn Val Ala Ser Phe Ile Asn Pro Asp Leu Gly Gly Ser
245 250 255
Trp Arg Lys Leu Gly Leu Ile Thr Gly Ala Trp Ser Val Val Leu Asn
260 265 270
Pro Leu Val Thr Gly Tyr Leu Gly Thr Gly Pro Gly Arg Gly Thr Ile
275 280 285
Cys Val Thr Arg Thr Gln Arg Gly Thr Ile Gln Lys
290 295 300
<210>2
<211>900
<212>DNA
＜213〉mice
<400>2
atggacctgc ccccacagct ctccttcgct ctctatgtat ctgcctttgc gctgggcttt 60
ccattgaact tgttagccat ccgaggcgca gtgtcccacg ctaaactgcg actcactccc 120
agcttggtct acactctcca tctgggctgc tctgatctcc tactggccat cactctgccc 180
ctgaaggctg tggaggccct ggcttctgga gcctggcccc tgccgctccc cttctgccca 240
gtctttgcct tggcccactt tgctcccctc tacgcaggcg gaggcttcct agctgctctc 300
agcgctggcc gctacctggg ggctgccttc cccttcgggt accaagccat ccggaggccc 360
cgctattcct ggggtgtgtg tgtggctata tgggcccttg tcctctgcca cctggggctg 420
gcccttggct tggagacttc cggaagctgg ctggacaaca gtaccagttc cctgggcatc 480
aacatacccg tgaatggctc cccggtctgc ctggaagcct gggatcccga ctctgcccgc 540
cctgcccgtc tcagtttctc cattctgctc ttctttctgc ccttggtcat cactgccttc 600
tgctatgtgg gctgcctccg ggccctggtg cgctcaggcc tgagccacaa acggaagctc 660
agggcagctt gggtggccgg aggcgctctc ctcacactcc tgctctgcct ggggccctat 720
aatgcctcca atgtggctag tttcataaac ccggacctag gaggctcctg gaggaagttg 780
ggactcatca caggggcctg gagtgtggta ctcaacccac tggtcactgg ctacttggga 840
acaggtcctg gacggggaac aatatgtgtg acgaggactc aaagaggaac aattcagaag 900
<210>3
<211>300
<212>PRT
＜213〉rat
<400>3
Met Asp Leu Pro Pro Gln Leu Ser Phe Ala Leu Tyr Val Ser Ala Phe
5 10 15
Ala Leu Gly Phe Pro Leu Asn Leu Leu Ala Ile Arg Gly Ala Val Ser
20 25 30
His Ala Lys Leu Arg Leu Thr Pro Ser Leu Val Tyr Thr Leu His Leu
35 40 45
Ala Cys Ser Asp Leu Leu Leu Ala Ile Thr Leu Pro Leu Lys Ala Val
50 55 60
Glu Ala Leu Ala Ser Gly Val Trp Pro Leu Pro Leu Pro Phe Cys Pro
65 70 75 80
Val Phe Ala Leu Ala His Phe Ala Pro Leu Tyr Ala Gly Gly Gly Phe
85 90 95
Leu Ala Ala Leu Ser Ala Gly Arg Tyr Leu Gly Ala Ala Phe Pro Phe
100 105 110
Gly Tyr Gln Ala Ile Arg Arg Pro Cys Tyr Ser Trp Gly Val Cys Val
115 120 125
Ala Ile Trp Ala Leu Val Leu Cys His Leu Gly Leu Ala Leu Gly Leu
130 135 140
Glu Ala Pro Arg Gly Trp Val Asp Asn Thr Thr Ser Ser Leu Gly Ile
145 150 155 160
Asn Ile Pro Val Asn Gly Ser Pro Val Cys Leu Glu Ala Trp Asp Pro
165 170 175
Asp Ser Ala Arg Pro Ala Arg Leu Ser Phe Ser Ile Leu Leu Phe Phe
180 185 190
Leu Pro Leu Val Ile Thr Ala Phe Cys Tyr Val Gly Cys Leu Arg Ala
195 200 205
Leu Val His Ser Gly Leu Ser His Lys Arg Lys Leu Arg Ala Ala Trp
210 215 220
Val Ala Gly Gly Ala Leu Leu Thr Leu Leu Leu Cys Leu Gly Pro Tyr
225 230 235 240
Asn Ala Ser Asn Val Ala Ser Phe Ile Asn Pro Asp Leu Glu Gly Ser
245 250 255
Trp Arg Lys Leu Gly Leu Ile Thr Gly Ala Trp Ser Val Val Leu Asn
260 265 270
Pro Leu Val Thr Gly Tyr Leu Gly Thr Gly Pro Gly Gln Gly Thr Ile
275 280 285
Cys Val Thr Arg Thr Pro Arg Gly Thr Ile Gln Lys
290 295 300
<210>4
<211>900
<212>DNA
＜213〉rat
<400>4
atggacctgc ccccacagct ctccttcgct ctctatgtat cagcctttgc actaggcttt 60
ccattgaact tgttagccat ccgaggtgca gtgtcccacg cgaaactgcg actcaccccc 120
agcttggtct acactctcca tttggcctgc tctgacctcc tactggccat caccctgccc 180
ctgaaggctg tggaggccct ggcttctggg gtctggcccc tgccactccc cttctgccca 240
gtctttgcct tggcccactt tgcgcccctc tatgcaggtg gaggcttcct ggctgctctc 300
agtgctggcc gctacctggg agctgccttc ccctttggat accaagccat ccggaggccc 360
tgctattcct ggggtgtgtg tgtggctata tgggcccttg tcctttgcca cctgggactg 420
gctcttggct tggaggctcc cagaggctgg gtggataaca ccaccagttc cctgggcatc 480
aacatacccg tgaatggctc cccggtctgc ctggaagcgt gggatcctga ctctgcccgc 540
cctgcccgac tcagtttctc gattctgctc ttctttctgc ccttggttat cactgctttc 600
tgctatgtgg gctgcctccg ggccctggtg cactcgggcc tgagccacaa acggaagctc 660
agggcagctt gggtggctgg aggagcactt ctcacactcc tgctctgcct ggggccctat 720
aatgettcca atgtggctag tttcataaac ceggacttag aaggctcctg gaggaagttg 780
gggctcatca caggagcctg gagtgtggtg ctcaacccac tggtcactgg ctacttggga 840
acaggtcctg gacaggggac aatatgtgtg accaggactc caagagggac aattcagaag 900
<210>5
<211>300
<212>PRT
＜213〉people
<400>5
Met Asp Leu Pro Pro Gln Leu Ser Phe Gly Leu Tyr Val Ala Ala Phe
5 10 15
Ala Leu Gly Phe Pro Leu Asn Val Leu Ala Ile Arg Gly Ala Thr Ala
20 25 30
His Ala Arg Leu Arg Leu Thr Pro Ser Leu Val Tyr Ala Leu Asn Leu
35 40 45
Gly Cys Ser Asp Leu Leu Leu Thr Val Ser Leu Pro Leu Lys Ala Val
50 55 60
Glu Ala Leu Ala Ser Gly Ala Trp Pro Leu Pro Ala Ser Leu Cys Pro
65 70 75 80
Val Phe Ala Val Ala His Phe Phe Pro Leu Tyr Ala Gly Gly Gly Phe
85 90 95
Leu Ala Ala Leu Ser Ala Gly Arg Tyr Leu Gly Ala Ala Phe Pro Leu
100 105 110
Gly Tyr Gln Ala Phe Arg Arg Pro Cys Tyr Ser Trp Gly Val Cys Ala
115 120 125
Ala Ile Trp Ala Leu Val Leu Cys His Leu Gly Leu Val Phe Gly Leu
130 135 140
Glu Ala Pro Gly Gly Trp Leu Asp His Ser Asn Thr Ser Leu Gly Ile
145 150 155 160
Asn Thr Pro Val Asn Gly Ser Pro Val Cys Leu Glu Ala Trp Asp Pro
165 170 175
Ala Ser Ala Gly Pro Ala Arg Phe Ser Leu Ser Leu Leu Leu Phe Phe
180 185 190
Leu Pro Leu Ala Ile Thr Ala Phe Cys Tyr Val Gly Cys Leu Arg Ala
195 200 205
Leu Ala Arg Ser Gly Leu Thr His Arg Arg Lys Leu Arg Ala Ala Trp
210 215 220
Val Ala Gly Gly Ala Leu Leu Thr Leu Leu Leu Cys Val Gly Pro Tyr
225 230 235 240
Asn Ala Ser Asn Val Ala Ser Phe Leu Tyr Pro Asn Leu Gly Gly Ser
245 250 255
Trp Arg Lys Leu Gly Leu Ile Thr Gly Ala Trp Ser Val Val Leu Asn
260 265 270
Pro Leu Val Thr Gly Tyr Leu Gly Arg Gly Pro Gly Leu Lys Thr Val
275 280 285
Cys Ala Ala Arg Thr Gln Gly Gly Lys Ser Gln Lys
290 295 300
<210>6
<211>900
<212>DNA
＜213〉people
<400>6
atggacctgc ccccgcagct ctccttcggc ctctatgtgg ccgcctttgc gctgggcttc 60
ccgctcaacg tcctggccat ccgaggcgcg acggcccacg cccggctccg tctcacccct 120
agcctggtct acgccctgaa cctgggctgc tccgacctgc tgctgacagt ctctctgccc 180
ctgaaggcgg tggaggcgct agcctccggg gcctggcctc tgccggcctc gctgtgcccc 240
gtcttcgcgg tggcccactt cttcccactc tatgccggcg ggggcttcct ggccgccctg 300
agtgcaggcc gctacctggg agcagccttc cccttgggct accaagcctt ccggaggccg 360
tgctattcct ggggggtgtg cgcggccatc tgggccctcg tcctgtgtca cctgggtctg 420
gtctttgggt tggaggctcc aggaggctgg ctggaccaca gcaacacctc cctgggcatc 480
aacacaccgg tcaacggctc tccggtctgc ctggaggcct gggacccggc ctctgccggc 540
ccggcccgct tcagcctctc tctcctgctc ttttttctgc ccttggccat cacagccttc 600
tgctacgtgg gctgcctccg ggcactggcc cgctccggcc tgacgcacag gcggaagctg 660
cgggccgcct gggtggccgg cggggccctc ctcacgctgc tgctctgcgt aggaccctac 720
aacgcctcca acgtggccag cttcctgtac cccaatctag gaggctcctg gcggaagctg 780
gggctcatca cgggtgcctg gagtgtggtg cttaatccgc tggtgaccgg ttacttggga 840
aggggtcctg gcctgaagac agtgtgtgcg gcaagaacgc aagggggcaa gtcccagaag 900
<210>7
<211>300
<212>PRT
＜213〉monkey
<400>7
Met Asp Leu Pro Pro Gln Leu Ser Phe Ala Leu Tyr Val Ala Ala Phe
5 10 15
Ala Leu Gly Phe Pro Leu Asn Val Leu Ala Ile Arg Gly Ala Arg Ala
20 25 30
His Ala Arg Arg Arg Leu Thr Pro Ser Leu Val Tyr Ala Leu Asn Leu
35 40 45
Gly Cys Ser Asp Leu Leu Leu Thr Val Ser Leu Pro Leu Lys Ala Val
50 55 60
Glu Ala Leu Ala Ser Gly Ala Trp Pro Leu Pro Ala Ser Leu Cys Pro
65 70 75 80
Val Phe Gly Val Ala His Phe Ala Pro Leu Tyr Ala Gly Gly Gly Phe
85 90 95
Leu Ala Ala Leu Ser Ala Gly Arg Tyr Leu Gly Ala Ala Phe Pro Leu
100 105 110
Gly Tyr Gln Ala Phe Arg Arg Pro Cys Tyr Ser Trp Gly Val Cys Ala
115 120 125
Ala Ile Trp Ala Leu Val Leu Cys His Leu Gly Leu Val Phe Val Leu
130 135 140
Glu Ala Pro Gly Gly Trp Leu Asp His Ser Asn Thr Ser Leu Gly Ile
145 150 155 160
Asn Thr Pro Val Asn Gly Ser Pro Val Cys Leu Glu Ala Trp Asp Pro
165 170 175
Ala Ser Ala Gly Pro Ala Arg Phe Ser Leu Ser Leu Leu Leu Phe Phe
180 185 190
Leu Pro Leu Ala Ile Thr Ala Phe Cys Tyr Val Gly Cys Leu Arg Ala
195 200 205
Leu Ala His Ser Gly Leu Thr His Arg Arg Lys Leu Arg Ala Ala Trp
210 215 220
Val Ala Gly Gly Ala Leu Leu Thr Leu Leu Leu Cys Val Gly Pro Tyr
225 230 235 240
Asn Ala Ser Asn Val Ala Ser Phe Leu Asn Pr0 Asn Leu Gly Gly Ser
245 250 255
Trp Arg Lys Leu Gly Leu Ile Thr Gly Ala Trp Ser Val Val Leu Asn
260 265 270
Pro Leu Val Thr Gly Tyr Leu Gly Arg Gly Pro Gly Leu Lys Thr Val
275 280 285
Cys Ala Ala Arg Thr Gln Gly Ser Thr Ser Gln Lys
290 295 300
<210>8
<211>900
<212>DNA
＜213〉monkey
<400>8
atggacctgc ccccgcagct ctcctttgcc ctctatgtgg cggcctttgc gctgggcttc 60
ccgctcaacg tcctggccat ccgaggggcg agggcccacg cccggcgccg tctcaccccc 120
agcctggtct acgccctgaa cctgggctgc tccgacctgt tgctgacagt ctccctgccc 180
ctgaaggcgg tggaggcgct ggcctccggg gcctggcctc tgccggcctc actgtgccct 240
gtcttcgggg tggcccactt tgctccactc tatgccggcg ggggcttcct ggccgccctg 300
agtgcaggcc gctacctggg agcggccttc cccttgggct accaagcctt ccggaggccg 360
tgctattcct ggggggtgtg tgcggccatc tgggccctcg tcctgtgtca cctgggtctg 420
gtctttgtgt tggaggctcc gggaggctgg ctggaccaca gcaacacctc actgggcatc 480
aacacaccgg tcaacggctc tcccgtctgc ctggaggcct gggacccggc ctctgccggc 540
ccggcccgct tcagcctctc tctcctgctt tttttcctgc ccttggccat cacagccttc 600
tgctacgtgg gctgcctccg ggcactggcc cactccggcc tgacccacag gcggaagctg 660
agggccgcct gggtagccgg cggggccctc ctcacgctgc tgctctgcgt aggaccctac 720
aacgcctcca atgtggccag ctttctgaac cccaatctgg gaggctcctg gcggaagctg 780
gggctcatca cgggtgcctg gagtgtggtg ctcaacccgc tggtgaccgg ttacttggga 840
aggggtcctg gcctgaagac agtgtgtgcg gcaagaacgc aagggagcac gtcccagaag 900
<210>9
<211>300
<212>PRT
＜213〉hamster
<400>9
Met Ala Leu Ser Pro Gln Leu Phe Phe Ala Leu Tyr Val Ser Ala Phe
5 10 15
Ala Leu Gly Phe Pro Leu Asn Leu Leu Ala Ile Arg Gly Ala Val Ala
20 25 30
Arg Ala Arg Leu Arg Leu Thr Pro Asn Leu Val Tyr Thr Leu His Leu
35 40 45
Ala Cys Ser Asp Leu Leu Leu Ala Ile Thr Leu Pro Val Lys Ala Val
50 55 60
Glu Ala Leu Ala Ser Gly Ala Trp Pro Leu Pro Leu Pro Leu Cys Pro
65 70 75 80
Val Phe Val Leu Val His Phe Ala Pro Leu Tyr Ala Gly Gly Gly Phe
85 90 95
Leu Ala Ala Leu Ser Ala Gly Arg Tyr Leu Gly Ala Ala Phe Pro Phe
100 105 110
Gly Tyr Gln Ala Val Arg Arg Pro Arg Tyr Ser Trp Gly Val Cys Val
115 120 125
Ala Ile Trp Ala Leu Val Leu Cys His Met Gly Leu Val Leu Gly Leu
130 135 140
Glu Ala Pro Gly Gly Trp Leu Asn Thr Thr Ser Ser Ser Leu Gly Ile
145 150 155 160
Asn Thr Pro Val Asn Gly Ser Pro Val Cys Leu Glu Ala Trp Asp Pro
165 170 175
Asn Ser Ala Arg Pro Ala Arg Leu Ser Phe Ser Ile Leu Leu Phe Phe
180 185 190
Val Pro Leu Val Ile Thr Ala Phe Cys Tyr Val Gly Cys Leu Arg Ala
195 200 205
Leu Ala His Ser Gly Leu Ser His Lys Arg Lys Leu Arg Ala Ala Trp
210 215 220
Ala Ala Gly Gly Ala Phe Leu Thr Leu Leu Leu Cys Leu Gly Pro Tyr
225 230 235 240
Asn Ala Ser Asn Val Ala Ser Phe Val Asn Pro Asp Leu Gly Gly Ser
245 250 255
Trp Arg Lys Leu Gly Leu Ile Thr Gly Ser Trp Ser Val Val Leu Asn
260 265 270
Pro Leu Val Thr Gly Tyr Leu Gly Ala Ser Pro Gly Arg Gly Thr Val
275 280 285
Cys Thr Thr Arg Thr Gln Gly Gly Thr Ile Gln Lys
290 295 300
<210>10
<211>900
<212>DNA
＜213〉hamster
<400>10
atggccctgt ctccccaact cttcttcgcc ctctatgtgt ctgccttcgc gctgggcttc 60
ccgctgaacc tgttggccat ccgaggcgcc gtggcccgtg caaggctgcg gctcaccccc 120
aacctggtct atacactcca cctggcctgc tctgacctgc tcctggccat cacgctaccc 180
gtgaaggccg tggaggccct ggcttctggg gcctggcccc tgccgctccc cttgtgccct 240
gtctttgtct tggtgcactt cgccccactc tatgcgggcg gaggcttcct ggcggctctc 300
agtgctggcc gctacctggg ggctgccttc cccttcgggt accaagccgt tcggcggccc 360
cgctactcct ggggcgtgtg tgtggctata tgggcccttg tcctctgcca catggggctg 420
gtcctcggct tggaggctcc cggaggctgg ctgaacacca ccagcagctc cctgggaatc 480
aacacaccgg tgaatggttc cccggtgtgc ctggaagcct gggatcccaa ctctgcccgg 540
cctgcccgcc tcagtttctc catcctgctc ttcttcgtgc ccctggtcat caccgccttc 600
tgctacgtgg gctgcctgcg ggctctggcc cactcgggcc tgagccacaa acggaagctc 660
agggcagcct gggcggccgg aggggccttt ctcacactcc tgctctgctt ggggccctac 720
aatgcctcca atgtggcgag tttcgtaaac ccggacctgg gaggctcctg gaggaagctg 780
gggctcatca cagggtcctg gagtgtggta ctcaacccgc tggtcaccgg ttacttggga 840
gcaagtcctg gccgagggac agtatgtacg acaaggactc aaggaggaac aattcagaag 900
<210>11
<211>33
<212>DNA
＜213〉artificial sequence
<220>
<400>11
cgtcgacccg gcggccccat ggacctgccc ccg 33
<210>12
<211>33
<212>DNA
＜213〉artificial sequence
<220>
<400>12
catcgattag cagtggcgtt acttctggga ctt 33
<210>13
<211>41
<212>DNA
＜213〉artificial sequence
<220>
＜223〉oligonucleotide primers of the DNA of She Ji amplification coding mGPR40
<400>13
gtcgaccacc atggacctgc ccccacagct ctccttcgct c 41
<210>14
<211>38
<212>DNA
＜213〉artificial sequence
<220>
＜223〉oligonucleotide primers of the DNA of She Ji amplification coding mGPR40
<400>14
actagtctac ttctgaattg ttcctctttg agtcctcg 38
<210>15
<211>41
<212>DNA
＜213〉artificial sequence
<220>
＜223〉oligonucleotide primers of the DNA of She Ji amplification coding rGRP40
<400>15
gtcgaccacc atggacctgc ccccacagct ctccttcgct c 41
<210>16
<211>38
<212>DNA
＜213〉artificial sequence
<220>
＜223〉oligonucleotide primers of the DNA of She Ji amplification coding rGPR40
<400>16
actagtctac ttctgaattg tccctcttgg agtcctgg 38
<210>17
<211>24
<212>DNA
＜213〉artificial sequence
<220>
＜223〉oligonucleotide primers of the DNA of She Ji amplification coding monkey GRP40
<400>17
tttctctgtg ggcctcgttt cctc 24
<210>18
<211>23
<212>DNA
＜213〉artificial sequence
<220>
＜223〉oligonucleotide primers of the DNA of She Ji amplification coding monkey GRP40
<400>18
cgtgctctgg ctcggtgctc ctc 23
<210>19
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉oligonucleotide primers of the DNA of She Ji amplification coding monkey GRP40
<400>19
ggcctcgttt cctccctgat 20
<210>20
<211>24
<212>DNA
＜213〉artificial sequence
<220>
＜223〉oligonucleotide primers of the DNA of She Ji amplification coding monkey GRP40
<400>20
gccctcctgc cccatgctcc ttcc 24
<210>21
<211>33
<212>DNA
＜213〉artificial sequence
<220>
<400>21
gtcgacgacg agaggcaccc actcggcccc atg 33
<210>22
<211>33
<212>DNA
＜213〉artificial sequence
<220>
<400>22
gctagcctac ttctgaattg ttcctccttg agt 33
<210>23
<211>21
<212>RNA
＜213〉artificial sequence
<220>
＜223〉n represents deoxythymidine
<400>23
cgccaguugu gacauucuun n 21
<210>24
<211>21
<212>RNA
＜213〉artificial sequence
<220>
＜223〉n represents deoxythymidine
<400>24
nngcggucaa cacuguaaga a 21
<210>25
<211>21
<212>RNA
＜213〉artificial sequence
<220>
＜223〉n represents deoxythymidine
<400>25
cuuguuagcc auccgaggcn n 21
<210>26
<211>21
<212>RNA
＜213〉artificial sequence
<220>
＜223〉n represents deoxythymidine
<400>26
nngaacaatc ggtaggctcc g 21

Claims (38)

1. a GPR40 receptor function controlling agent is characterized in that: comprise the chemical compound that contains aromatic rings and can emit cationic base.
2. regulator as claimed in claim 1 is characterized in that: comprise the carboxylic acid or derivatives thereof that contains aromatic rings.
3. regulator as claimed in claim 1 is characterized in that: comprise the carboxylic acid or derivatives thereof that contains 2 above aromatic rings.
4. regulator as claimed in claim 1 is characterized in that: contain compound or its salt or its prodrug of useful formula (I ') expression,
Figure A2003801082600002C1
In the formula, the ring P represent to have substituent aromatic rings, the ring Q represent except
Can also have substituent aromatic rings in addition, X and Y represent base at interval respectively,
Figure A2003801082600002C3
Expression can be emitted cationic base.
5. regulator as claimed in claim 2 is characterized in that: contain compound or its salt or its prodrug of useful formula (I) expression,
Figure A2003801082600002C4
In the formula, ring P represents to have substituent aromatic rings, and ring Q represents can also have substituent aromatic rings except the-Y-COOH, and X and Y represent base at interval respectively, and-Y-COOH represents to be replaced in the optional position of encircling on the Q.
6. regulator as claimed in claim 1 is characterized in that:
Can emit cationic base is: (1) can emit cationic quinary heterocyclic radical, (2) carboxyl, (3) sulfonic group, (4) can use C 1-4C can be used in the mono-substituted sulfamoyl of alkyl, (5) phosphonate group, (6) 1-4The mono-substituted carbamoyl of alkyl, (7) C 2-7Alkyl sulphonyl thiocarbamoyl or (8) trifluoro acute pyogenic infection of nails sulfonic acid amides base (NHSO 2CF 3).
7. regulator as claimed in claim 1 is characterized in that:
Can emit cationic base is:
Figure A2003801082600003C1
Or
Figure A2003801082600003C3
8. regulator as claimed in claim 1 is characterized in that: be insulin secretion regulator, Hypoylycemic agents or pancreatic beta cell protective agent.
9. regulator as claimed in claim 1 is characterized in that: be diabetes, anti-sugared dysfunction, ketoacidosis, acidosis, diabetic neuropathy, diabetic nephritis, the diabetic retinopathy, hyperlipidemia, sexual dysfunction, dermatosis, arthritis, bone reduces disease, arteriosclerosis, thrombotic disease, dyspepsia, the mnemonic learning obstacle, fat, hypoglycemia, hypertension, edema, the insulin resistance syndrome, unstable diabetes, lipoatrophy, insulin allergy disease, insulinoma, fat toxicity, the prevention of hyperinsulinemia or cancer, therapeutic agent.
10. compound or its salt with formula (I-1) expression,
In the formula, ring A represents to have substituent phenyl ring, and ring R represents to have substituent phenylene, and Xa represents the interval base beyond the alkylidene, and it is 0 to 4 carbochain that p and q represent to have substituent carbon number respectively, and Ra represents hydrogen atom or substituent group.
11. the prodrug of compound or its salt as claimed in claim 10.
12. chemical compound as claimed in claim 10 is characterized in that:
Partial structural formula
Figure A2003801082600004C1
Be
Figure A2003801082600004C2
Or
Figure A2003801082600004C3
The substituent group that ring A can have is: (1) halogen atom, (2) C 1-6Alkyl, (3) C 1-6Halogen atom, C can be used in alkoxyl, (4) 1-6Alkyl or C 1-6The C that alkoxyl replaces 6-14Aryl, (5) C 6-14Aryloxy group or (6) C 7-16Aralkoxy,
The substituent group that ring R can have is halogen atom or C 1-6Alkyl,
Ra is a hydrogen atom,
The interval base of representing with Xa is an oxygen atom.
13. the compound or its salt with formula (I-2) expression,
Figure A2003801082600004C4
In the formula, ring S 1Expression has the substituent phenyl ring that has phenyl ring, and ring R represents to have substituent phenylene, and Ra represents hydrogen atom or substituent group,
But except (i) 2-ethyoxyl-4-[[2-[(5-methyl-2-phenyl-4-oxazolyl) methoxyl group] phenyl] methoxyl group] benzenpropanoic acid, (ii) 2-ethyoxyl-4-[[3-[(5-methyl-2-phenyl-4-oxazolyl) methoxyl group] phenyl] methoxyl group] benzenpropanoic acid, (iii) 2-ethyoxyl-4-[[4-[(5-methyl-2-phenyl-4-oxazolyl) methoxyl group] phenyl] methoxyl group] benzenpropanoic acid, (iv) 4-[[4-[(5-methyl-2-phenyl-4-oxazolyl) methoxyl group] phenyl] methoxyl group] benzenpropanoic acid.
14. the prodrug of compound or its salt as claimed in claim 13.
15. chemical compound as claimed in claim 13 is characterized in that:
Substituent group with phenyl ring is to use formula: R 11-E 2The substituent group of-expression, R 11Expression can have substituent phenyl, indanyl or naphthyl, E respectively 2Expression key or basic at interval, and use E 2The interval base of expression is-(CH 2) m 1-W 1-(CH 2) m 2-, m 1And m 2Represent 0 to 3 integer respectively, W 1Expression-O-,-N (R 2)-,-S-,-CO-or-CO-N (R 3)-, R 2And R 3Represent hydrogen atom or C respectively 1-6Alkyl.
16. chemical compound as claimed in claim 13 is characterized in that: with formula (I-2A) expression,
In the formula, R 11aExpression has 1 to 2 substituent phenyl; Ea represents key, oxygen atom or can substituted methylene; Ring S 1aExpression can further have substituent phenyl ring, and described substituent group is selected from can substituted C 1-6Alkyl, can substituted C 1-6Alkoxyl and halogen atom; R 16And R 17Can be identical or different, expression hydrogen atom, halogen atom, C 1-6Alkyl or C 1-6Alkoxyl.
17. chemical compound as claimed in claim 16 is characterized in that:
R 11aBe to have that be selected from can substituted C 1-6Alkyl, can substituted C 1-62 substituent phenyl in alkoxyl and the halogen atom; Ea is key, oxygen atom or methylene; R 16And R 17Identical or different, be hydrogen atom or halogen atom.
18. chemical compound as claimed in claim 17 is characterized in that: Ea is a key.
19. chemical compound as claimed in claim 17 is characterized in that: R 16Be hydrogen atom and R 17It is fluorine atom.
20. chemical compound as claimed in claim 16 is characterized in that:
Partial structural formula
Figure A2003801082600006C1
Be
Figure A2003801082600006C2
21. chemical compound as claimed in claim 20 is characterized in that: R 11aBe to have that be selected from can substituted C 1-6Alkyl, can substituted C 1-62 substituent phenyl in alkoxyl and the halogen atom; Ea is a key; Ring S 1aBe not have further substituent phenyl ring.
22. chemical compound as claimed in claim 13 is characterized in that:
Substituent group with phenyl ring is to use formula: R 11-E 2The substituent group of-expression, R 11Expression can have substituent phenyl, indanyl or naphthyl, E respectively 2Expression key or basic at interval, ring S 1Can further use C 1-6Alkyl replaces, R 11Can with E 2With ring S 1The common ring that forms.
23. chemical compound as claimed in claim 22 is characterized in that:
R 11Be to have substituent phenyl or indanyl respectively, described substituent group be selected from halogen atom, nitro, carboxyl, can be by halogenated C 1-6Alkyl, hydroxyl-C 1-6Alkyl, carboxyl-C 1-6Alkyl-carbonylamino-C 1-6Alkyl, can be by halogenated C 1-6Alkoxyl, C 6-14Aryl, C 6-14Aryloxy group and C 7-16Aralkoxy,
E 2Be key ,-O-,-CH 2-O-,-CO-,-CONH-,-N (CH 3) CH 2-,-S-CH 2-or-C=C-,
Ring S 1Can further use C 1-6Alkyl replaces,
R 11With E 2With ring S 1The common ring that forms is
The substituent group that ring R can have is C 1-6Alkyl, Ra are hydrogen atoms.
24. with the compound or its salt of formula (I-3) expression,
In the formula, ring M represents to have substituent phenyl ring, and ring N represents to have substituent five-ring heterocycles, and ring E represents to have substituent phenylene, and Ra represents hydrogen atom or substituent group,
But except 4-(1H-benzotriazole-1-ylmethoxy) benzenpropanoic acid and 4-(1H-indol-3-yl methoxyl group) benzenpropanoic acid.
25. the prodrug of compound or its salt as claimed in claim 24.
26. chemical compound as claimed in claim 24 is characterized in that:
Partial structural formula
Figure A2003801082600007C2
Be can have respectively the halogen atom of being selected from, can substituted C 1-6Alkyl, can substituted C 1-6Alkoxyl, C 1-6Alkoxyl-carboxyl and can substituted C 7-16Substituent in the aralkoxy
Figure A2003801082600007C3
Or
27. chemical compound as claimed in claim 24 is characterized in that:
Partial structural formula
Be to have the halogen atom of being selected from and can substituted C respectively 1-6Substituent in the alkyl
Figure A2003801082600007C6
Or
Figure A2003801082600007C7
Ring E does not have the phenylene that replaces, and Ra is a hydrogen atom.
28. the compound or its salt with formula (I-4) expression,
Figure A2003801082600008C1
In the formula, ring S 2Expression can have substituent phenyl ring, and ring R represents to have substituent phenylene, E 1Expression key or basic at interval, R 13Expression can have substituent thiazolyl, and Ra represents hydrogen atom or substituent group.
29. the prodrug of compound or its salt as claimed in claim 28.
30. chemical compound as claimed in claim 28 is characterized in that:
Ring S 2Be phenyl ring, ring R does not have the phenylene that replaces, R 13Be to have the C of being selected from 6-14Aryl and C 1-6Substituent thiazolyl in the alkyl, E 1Be-N (R 14)-(CH 2) m 2-or-S-(CH 2) m 2-, R 14Expression hydrogen atom or C 1-6Alkyl, m 2The integer of expression 0 to 3, Ra is a hydrogen atom.
31. chemical compound as claimed in claim 28 is characterized in that: R 13Be to have substituent 2-thiazolyl.
32. chemical compound as claimed in claim 28 is characterized in that: with formula (I-4A) expression,
Figure A2003801082600008C2
In the formula, E 1aExpression-N (R 14)-CH 2-,-CH (R 22)-O-or-CH (R 22) CH 2-, R 14And R 22Expression hydrogen atom or C 1-6Alkyl; R 18And R 19Identical or different, expression hydrogen atom, halogen atom, C 1-6Alkyl or C 1-6Alkoxyl; R 20And R 21Identical or different, the expression hydrogen atom, can substituted C 6-14Aryl or can substituted C 1-6Alkyl, or R 20And R 21In conjunction with and form ring.
33. chemical compound as claimed in claim 32 is characterized in that: E 1aBe-N (R 14)-CH 2-, R 14Expression hydrogen atom or C 1-6Alkyl; R 18And R 19Identical or different, be hydrogen atom or halogen atom.
34. medicine that contains claim 10,13,24 or 28 described compound or its salts or its prodrug.
35. a GPR40 receptor function controlling control method is characterized in that: the aromatic rings that contains of effective dose is thrown to mammal with the chemical compound that can emit cationic base.
36. contain aromatic rings and the application of the chemical compound that can emit cationic base in making the GPR40 receptor function controlling agent.
37. the screening technique of the ligand at GPR40, agonist or antagonist is characterized in that: use GPR40 or its partial peptide or its salt and contain aromatic rings and the chemical compound that can emit cationic base.
38. the screening with medicament box of the ligand at GPR40, agonist or antagonist is characterized in that: comprise GPR40 or its partial peptide or its salt and contain aromatic rings and the chemical compound that can emit cationic base.
CN 200380108260 2002-11-08 2003-11-06 Receptor function controlling agent Pending CN1735408A (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
JP324632/2002 2002-11-08
JP2002324632 2002-11-08
JP16889/2003 2003-01-27
JP153986/2003 2003-05-30

Publications (1)

Publication Number Publication Date
CN1735408A true CN1735408A (en) 2006-02-15

Family

ID=36077479

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 200380108260 Pending CN1735408A (en) 2002-11-08 2003-11-06 Receptor function controlling agent

Country Status (1)

Country Link
CN (1) CN1735408A (en)

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101426775B (en) * 2006-04-24 2012-10-31 安斯泰来制药株式会社 Oxadiazolidinedione compound
CN103228622A (en) * 2010-07-23 2013-07-31 康内克斯生命科学私人有限公司 Agonists of gpr40
CN103980235A (en) * 2008-12-18 2014-08-13 赛马拜制药公司 GPR120 receptor agonists and uses thereof
CN104109115A (en) * 2013-04-16 2014-10-22 中国科学院上海药物研究所 Phenylpropionic acid compounds chained by nitrogen-containing heterocyclic rings, pharmaceutical composition, preparation method, and application thereof
CN104193731A (en) * 2014-08-27 2014-12-10 广东东阳光药业有限公司 Novel urea-substituted biphenyl compounds as well as composition and application thereof
CN104321319A (en) * 2012-03-26 2015-01-28 勃林格殷格翰国际有限公司 New indanyloxydihydrobenzofuranylacetic acid derivatives and their use as GPR40 receptor agonists
CN104507921A (en) * 2013-07-02 2015-04-08 四川海思科制药有限公司 Benzocyclobutene derivative and preparation method and pharmaceutical application thereof
CN105143181A (en) * 2013-07-26 2015-12-09 四川海思科制药有限公司 Triadic fused cyclic carboxylic acids derivatives, preparation method therefor and pharmaceutical use thereof
CN105209448A (en) * 2013-02-28 2015-12-30 Sk化学公司 Tricyclic compound and use thereof
CN106061943A (en) * 2014-03-07 2016-10-26 詹森药业有限公司 Bicyclic pyrrole derivatives useful as agonists of GPR120
CN107162913A (en) * 2017-06-29 2017-09-15 中国药科大学 The new deuterated phenylpropionic acid derivative of one class, its preparation method and its purposes as medicine
WO2017202276A1 (en) * 2016-05-23 2017-11-30 中国医学科学院药物研究所 Phenylate derivative, preparation method therefor, and pharmaceutical composition and uses thereof
CN107556252A (en) * 2016-06-30 2018-01-09 中国科学院上海药物研究所 Phenylpropionic acid compound, its pharmaceutical composition, preparation method and the purposes that a kind of loop chain containing pyrazine connects
CN108003074A (en) * 2017-12-21 2018-05-08 四川大学华西医院 Biphenyl carboxylic acid compound and preparation method and application thereof
CN109475756A (en) * 2016-02-17 2019-03-15 儿童医疗中心有限公司 FFA1 (GPR40) generates the treatment target of disease or illness as neural blood vessel
CN109666027A (en) * 2017-10-17 2019-04-23 中国科学院上海药物研究所 GPR40 agonist compound of a kind of amide structure and application thereof
CN110092774A (en) * 2018-01-29 2019-08-06 中国科学院上海药物研究所 Fragrant propionic acid analog derivative, and its preparation method and application
CN110092745A (en) * 2018-01-29 2019-08-06 广州丹康医药生物有限公司 A kind of compound and its application containing aromatic ring
CN114163408A (en) * 2020-09-10 2022-03-11 上海爱博医药科技有限公司 Benzo-oxygen-containing heterocyclic compound and medical application thereof
CN114163426A (en) * 2020-09-10 2022-03-11 上海爱博医药科技有限公司 Benzo-oxygen-containing heterocyclic compound and medical application thereof
CN115572223A (en) * 2022-10-17 2023-01-06 聊城大学 Phenylpropionic acid derivative and application thereof

Cited By (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101426775B (en) * 2006-04-24 2012-10-31 安斯泰来制药株式会社 Oxadiazolidinedione compound
CN103980235A (en) * 2008-12-18 2014-08-13 赛马拜制药公司 GPR120 receptor agonists and uses thereof
CN103228622A (en) * 2010-07-23 2013-07-31 康内克斯生命科学私人有限公司 Agonists of gpr40
CN103228622B (en) * 2010-07-23 2016-01-20 康内克斯生命科学私人有限公司 The agonist of GPR40
CN104321319A (en) * 2012-03-26 2015-01-28 勃林格殷格翰国际有限公司 New indanyloxydihydrobenzofuranylacetic acid derivatives and their use as GPR40 receptor agonists
CN105209448A (en) * 2013-02-28 2015-12-30 Sk化学公司 Tricyclic compound and use thereof
CN105209448B (en) * 2013-02-28 2018-09-14 株式会社蒂奥姆生物 Tricyclic compound and application thereof
CN104109115B (en) * 2013-04-16 2016-11-23 中国科学院上海药物研究所 Phenylpropionic acid compound, its pharmaceutical composition, preparation method and the purposes of a kind of nitrogen heterocyclic ring link
WO2014169817A1 (en) * 2013-04-16 2014-10-23 中国科学院上海药物研究所 Phenylalanine compound having nitrogen heterocyclic link, pharmaceutical composition thereof, preparation method therefor, and use thereof
CN104109115A (en) * 2013-04-16 2014-10-22 中国科学院上海药物研究所 Phenylpropionic acid compounds chained by nitrogen-containing heterocyclic rings, pharmaceutical composition, preparation method, and application thereof
CN104507921A (en) * 2013-07-02 2015-04-08 四川海思科制药有限公司 Benzocyclobutene derivative and preparation method and pharmaceutical application thereof
CN104507921B (en) * 2013-07-02 2017-02-22 四川海思科制药有限公司 Benzocyclobutene derivative and preparation method and pharmaceutical application thereof
CN105143181A (en) * 2013-07-26 2015-12-09 四川海思科制药有限公司 Triadic fused cyclic carboxylic acids derivatives, preparation method therefor and pharmaceutical use thereof
CN105143181B (en) * 2013-07-26 2017-12-26 四川海思科制药有限公司 Ternary and ring carboxylic acid derivative, its preparation method and its application in medicine
CN106061943A (en) * 2014-03-07 2016-10-26 詹森药业有限公司 Bicyclic pyrrole derivatives useful as agonists of GPR120
CN106061943B (en) * 2014-03-07 2019-11-05 詹森药业有限公司 It can be used as the bicyclic pyrrole derivatives of the agonist of GPR120
CN104193731A (en) * 2014-08-27 2014-12-10 广东东阳光药业有限公司 Novel urea-substituted biphenyl compounds as well as composition and application thereof
US11583528B2 (en) 2016-02-17 2023-02-21 Children's Medical Center Corporation FFA1 (GPR40) as a therapeutic target for neural angiogenesis diseases or disorders
CN109475756A (en) * 2016-02-17 2019-03-15 儿童医疗中心有限公司 FFA1 (GPR40) generates the treatment target of disease or illness as neural blood vessel
CN109311792A (en) * 2016-05-23 2019-02-05 中国医学科学院药物研究所 Phenylate analog derivative and its preparation method and pharmaceutical composition and purposes
US10941129B2 (en) 2016-05-23 2021-03-09 Institute Of Materia Medica, Chinese Academy Of Medical Sciences Benzyl phenyl ether derivative, preparation method therefor, and pharmaceutical composition and uses thereof
US10975049B2 (en) 2016-05-23 2021-04-13 Institute Of Materia Medica, Chinese Academy Of Medical Sciences Nicotinyl alcohol ether derivative, preparation method therefor, and pharmaceutical composition and uses thereof
RU2744975C2 (en) * 2016-05-23 2021-03-17 Инститьют Оф Материя Медика, Чайниз Экедеми Оф Медикал Сайенсез Phenylate derivative, production, pharmaceutical composition and use
CN109311792B (en) * 2016-05-23 2022-10-21 中国医学科学院药物研究所 Phenylether derivative, preparation method thereof, pharmaceutical composition and application thereof
US10882833B2 (en) 2016-05-23 2021-01-05 Institute Of Materia Medica, Chinese Academy Of Medical Sciences Phenylate derivative, preparation method therefor, and pharmaceutical composition and uses thereof
US10815208B2 (en) 2016-05-23 2020-10-27 Institute Of Materia Medica, Chinese Academy Of Medical Sciences Method for preparing 2-hydroxyl-4-(2, 3-disubstituted benzyloxy)-5-substituted benzaldehyde derivative
WO2017202276A1 (en) * 2016-05-23 2017-11-30 中国医学科学院药物研究所 Phenylate derivative, preparation method therefor, and pharmaceutical composition and uses thereof
CN107556252A (en) * 2016-06-30 2018-01-09 中国科学院上海药物研究所 Phenylpropionic acid compound, its pharmaceutical composition, preparation method and the purposes that a kind of loop chain containing pyrazine connects
CN107162913A (en) * 2017-06-29 2017-09-15 中国药科大学 The new deuterated phenylpropionic acid derivative of one class, its preparation method and its purposes as medicine
CN107162913B (en) * 2017-06-29 2021-04-30 中国药科大学 Novel deuterated phenylpropionic acid derivative, preparation method thereof and application thereof as medicine
CN109666027A (en) * 2017-10-17 2019-04-23 中国科学院上海药物研究所 GPR40 agonist compound of a kind of amide structure and application thereof
CN108003074A (en) * 2017-12-21 2018-05-08 四川大学华西医院 Biphenyl carboxylic acid compound and preparation method and application thereof
CN108003074B (en) * 2017-12-21 2019-07-05 四川大学华西医院 Biphenyl carboxylic acid compound and preparation method and application thereof
CN110092745A (en) * 2018-01-29 2019-08-06 广州丹康医药生物有限公司 A kind of compound and its application containing aromatic ring
CN110092774B (en) * 2018-01-29 2022-04-08 中国科学院上海药物研究所 Aromatic propionic acid derivative, preparation method and application thereof
CN110092745B (en) * 2018-01-29 2022-12-30 广州丹康医药生物有限公司 Compound containing aromatic ring and application thereof
CN110092774A (en) * 2018-01-29 2019-08-06 中国科学院上海药物研究所 Fragrant propionic acid analog derivative, and its preparation method and application
CN114163426A (en) * 2020-09-10 2022-03-11 上海爱博医药科技有限公司 Benzo-oxygen-containing heterocyclic compound and medical application thereof
WO2022053012A1 (en) * 2020-09-10 2022-03-17 上海爱博医药科技有限公司 Benzo oxygen-containing heterocyclic compounds and medical applications thereof
CN114163408A (en) * 2020-09-10 2022-03-11 上海爱博医药科技有限公司 Benzo-oxygen-containing heterocyclic compound and medical application thereof
CN114163426B (en) * 2020-09-10 2024-03-19 上海爱博医药科技有限公司 Benzo oxygen-containing heterocyclic compound and medical application thereof
CN114163408B (en) * 2020-09-10 2024-03-19 上海爱博医药科技有限公司 Benzo oxygen-containing heterocyclic compound and medical application thereof
CN115572223A (en) * 2022-10-17 2023-01-06 聊城大学 Phenylpropionic acid derivative and application thereof

Similar Documents

Publication Publication Date Title
CN1735408A (en) Receptor function controlling agent
US7960369B2 (en) Receptor function regulator
US8008525B2 (en) Receptor function regulating agent
CN1166658C (en) 4,5-diaryl-3(i(2H))-furanone derivatives as cyclooxygenase-2 inhibitors
CN1060171C (en) Substituted biphenyl isoxazole sulfonamides
CN1578659A (en) Modulators of peroxisome proliferator activated receptors (ppar)
CN1308310C (en) Nitrogenous aromatic ring compounds
CN1205185C (en) Nitrogenous cyclic compounds and pharmaceutical compositions containing the same
CN1946666A (en) Compounds, pharmaceutical compositions and methods for use in treating metabolic disorders
CN1747936A (en) Substituted azole derivatives as therapeutic agents
CN1922151A (en) Substituted azole derivatives, compositions, and methods of use
CN1946391A (en) Combinations comprising alpha-2-delta ligands
CN1585751A (en) Quinoline compound
JP2005015461A (en) Receptor function regulator
CN1356977A (en) Glucagon antagonists/inverse agonists
CN102812003A (en) Pyrrolidine Or Thiazolidine Carboxylic Acid Derivatives, Pharmaceutical Composition And Methods For Use In Treating Metabolic Disordersas As Agonists Of G- Protein Coupled Receptor 43 (GPR43)
CN1658854A (en) Immunity-related protein kinase inhibitors
CN1623537A (en) Biaryl sulfonamides and its using method
CN1751037A (en) Sulfonamide derivatives as PPAR modulators
CN1867551A (en) Phenyl or pyridyl amide compounds as prostaglandin E2 antagonists
CN1658872A (en) Antiallergic
CN1681498A (en) Diaryl ethers as opioid receptor antagonist
CN1345303A (en) Oxamic acids and derivatives as thyroid receptor ligands
CN1200119A (en) (Methylsulfonyl) phenyl-2-(5H)-furanones as cox-2 inhibitors
CN1902171A (en) Benzylether amine compounds useful as CCR-5 antagonists

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication