CN1733807A - A kind of fusion rotein and encoding gene and application with growth facilitation action - Google Patents
A kind of fusion rotein and encoding gene and application with growth facilitation action Download PDFInfo
- Publication number
- CN1733807A CN1733807A CNA2005100934286A CN200510093428A CN1733807A CN 1733807 A CN1733807 A CN 1733807A CN A2005100934286 A CNA2005100934286 A CN A2005100934286A CN 200510093428 A CN200510093428 A CN 200510093428A CN 1733807 A CN1733807 A CN 1733807A
- Authority
- CN
- China
- Prior art keywords
- fusion rotein
- sequence
- ghrh
- seq
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a kind of fusion rotein and encoding gene and application that promotes the body accretion that have.Its objective is provides a kind of fusion rotein and encoding gene and its application in preparation children and adult's growth hormone deficiency curative drug that promotes the body accretion that have.This fusion rotein is the protein with one of following amino acid residue sequences: 1) the SEQ ID № in the sequence table: 1; 2) with SEQ ID № in the sequence table: 1 amino acid residue sequence is through replacement, disappearance or the interpolation of one to ten amino-acid residue and have the protein of growth facilitation action.Fusion rotein HSA-GHRH provided by the present invention has significant growth facilitation action, and has the expression amount height, easy purifying, and with short production cycle, industrial scale is big, the advantage that cost is low.The present invention has bigger practical significance and wide application prospect in medical science and field of biological pharmacy.
Description
Technical field
The present invention relates to fusion rotein and encoding gene thereof and application, particularly relate to a kind of fusion rotein and encoding gene and its application in preparation children and adult's growth hormone deficiency curative drug that promotes the body accretion that have.
Background technology
(human growth hormone is a kind of polypeptide that comprises 191 amino-acid residues hGH), by Anterior pituitary emiocytosis to human growth hormone.It has the body growth of promotion, keeps the effect of muscle matrix and length, and has synalbumin and its anabolic effect of promotion.Hypophysis secretion tethelin (hGH) is mainly by two kinds of hypothalamus excretory peptide hormone regulation and control: a kind of is growth hormone releasing hormone (growth hormone releasinghormnone, GHRH or GRH), it induces hGH to discharge, another kind is SRIH (somatostatin, SS), it suppresses hGH release, and promptly the former is the excitability hormone of hGH, and the latter is the inhibition hormone.Discover in early days, damage rat MBH can cause the GH hyposecretion, thereby cause cessation of growth cessation, phase counterstimulus ventromedial nucleus and arcuate nucleus can cause that obvious GH discharges, infer that this position may contain short GH excretory somatotropin releasing factor (growth hormone releasing factor, GHRF or GRF).1980, Frohman is separated to the GHRF that secretion has hormesis to GH from acromegaly patient pancreatic neoplasm, and its extract of partial purification (Frohman LA, Szabo M, Berelowitz M, Stachura ME.Partial purification andcharacterization of a peptide with growth hormone-releasing activity fromextrapituitary tumors in patients with acromegaly.J Clin Invest, 1980,65 (1): 43-54; Frohman LA, Downs TR, Chomceynski P, et al.Growthhormone-releasing hormone:structure, gene expression and molecularheterogeneity.Acta Pediatr Scand, 1990,367 (suppl): 81-86).To nineteen eighty-two, Guillemin and Vale do further tumor tissues in two laboratories and research and analyse, obtained to have the GH release action, respectively by 44 amino-acid residues and 40 two peptide species that amino-acid residue constitutes, and measured their aminoacid sequence, with this two peptide species difference called after GHRH-44 and GHRH-40 (Guillemin R, Brazeau P, Bohlen P, Esch F, Ling N, Wehrenberg WB.Growth hormone-releasing factor froma human pancreatic tumor that caused acromegaly.Science, 1982 Nov 5,218 (4572): 585-587; Brazeau P, Ling N, Bohlen P, Esch F, Ying SY, GuilleminR.Growth hormone releasing factor, somatocrinin, releases pituitary growthhormone in vitro.Proc Natl Acad Sci USA, 1982,79 (24): 7909-7913).After finding the GHRH of pancreas soon, the researchist is separated to GHRH again from people's hypothalamus, wherein 2nd/3rd, GHRH-44,1st/3rd, GHRH-40, both are generated through different translation post-treatment approach by preceding GHRH original molecule (being prepro-GHRH), they are very high at hypothalamic content, have the ability that similar stimulation GH discharges.Present most scholar believes: due to the synthetic or hyposecretion of the special big polyphyly hypothalamus of the cause of disease GHRH that sends out property GH deficiency disease, but not the hypophysis pathology causes.Many research reports are pointed out: the special property sent out GH lacks among the patient of sexual dwarfism, and stimulation responds the case of 40%-80% to GHRH; GRF european union center report in 1985: 70% primary GH deficiency disease case responds to the GHRH excitation experiment.The above-mentioned fact shows that most of GH deficiency disease cases can adopt the GHRH treatment.From GHRH in 1985 be applied to clinical since, applied bioengineering technology synthetic GHRH treatment GH deficiency disease and to obtain the report of satisfactory result comparatively existing a lot.Compare with GH, GHRH is applied to the clinical following advantage that has: (1) meets physiological conditions, with the GHRH treatment, can increase the hypophysis reactivity for a long time; (2) because there is the protectiveness Feedback mechanism in hypophysis, can avoid the danger of excessive administration; (3) continue medication and to strengthen endogenous GH and discharge, and be the pulsed granting.In addition because GH may cause some side effects, as immune response etc., so people wish to find and have the secreting active material of single-minded short GH, improving endogenous GH level, thereby avoid the use of exogenous growth hormone.
Yet the transformation period of GHRH is shorter, has only frequent administration could obtain gratifying curative effect, as often adopt injection every day application method once in clinical study.But so frequent application method add long treatment cycle make patient difficulty bear.Therefore press for the GHRH that develops long action time.
Human serum albumin (HSA) is a kind of stable and albumen that the transformation period is long in the body.Studies show that many protein drugs and this albumin is crosslinked or merge after the transformation period of pharmaceutical protein is prolonged, thereby the medication number of times is reduced.HGS (Human Genome Sciences) company has invented albumin fusion growth hormone (Albutropin) at present, albumin merges granulocyte colony-stimulating factor (Albugranin) and albumin fused interferon products such as (Albuferon), and priority has entered I/II phase clinical study, result of study shows that the said products has the transformation period in the long body, and higher security reaches curative effect preferably.
Summary of the invention
The purpose of this invention is to provide a kind of fusion rotein and encoding gene thereof that promotes the body accretion that have.
Fusion rotein with growth facilitation action provided by the present invention, called after HSA-GHRH is the protein with one of following amino acid residue sequences:
1) the SEQ ID № in the sequence table: 1;
2) with SEQ ID № in the sequence table: 1 amino acid residue sequence is through replacement, disappearance or the interpolation of one to ten amino-acid residue and have the protein of growth facilitation action;
SEQ ID № in the sequence table: 1 is made up of 640 amino-acid residues, from amino (N) end 1-585 position is the amino acid residue sequence of HSA, from aminoterminal 597-640 position is the amino acid residue sequence of GHRH, is the connection peptides sequence from aminoterminal 586-596 position.
The above-mentioned gene (HSA-GHRH) with fusion rotein of growth facilitation action of encoding also belongs to protection scope of the present invention, and it is one of following nucleotide sequence:
1) SEQ ID № in the sequence table: 2 dna sequence dna;
2) SEQ ID № in the code sequence tabulation: 1 dna sequence dna;
3) SEQ ID № in the sequence table: 2 from the 5 ' dna sequence dna of holding the 1756th to the 1788th bit base to lack, shorten, prolong or suddenly change;
4) under the rigorous condition of height can with the SEQ ID № in the sequence table: the nucleotide sequence of the 2 dna sequence dnas hybridization that limit.
The rigorous condition of described height for hybridization back with contain 0.1 * SSPE (or 0.1 * SSC), the solution of 0.1%SDS washes film under 65 ℃.
SEQ ID № in the sequence table: 2 by 1920 based compositions, its encoding sequence is from 5 ' end the 1st to the 1920th bit base, coding has SEQ ID № in the sequence table: the protein of 1 amino acid residue sequence, from 5 ' end the 1st to the 1755th bit base is the encoding sequence of HSA, from 5 ' end the 1789th to the 1920th bit base is the encoding sequence of GHRH, is the encoding sequence of connection peptides from 5 ' end the 1756th to the 1788th bit base.
Contain expression carrier of the present invention, transgenic cell line and host bacterium and all belong to protection scope of the present invention.
Increase arbitrary segmental primer in the above-mentioned fusion rotein encoding gene to also within protection scope of the present invention.
Another object of the present invention provides a kind of above-mentioned method with fusion rotein of growth facilitation action of expressing.
The above-mentioned fusion rotein method with growth facilitation action of expression provided by the present invention is to import host cell with containing above-mentioned recombinant expression vector with fusion rotein encoding gene of growth facilitation action, expresses the fusion rotein that obtains having growth facilitation action.
Described host can be yeast, intestinal bacteria, mammalian cell, insect cell or Bacillus subtilus etc., is preferably yeast.
Described yeast is preferably pichia pastoris (Pichia pastoris).Wherein, described pichia pastoris is preferably pichia pastoris GS115, KM71 (available from American I nvitrogen company) or SMD1168 (available from American I nvitrogen company).
Described intestinal bacteria can be E.coli JM109, E.coli HB101 or E.coli Top10 etc.
The carrier that sets out that is used for making up described recombinant yeast expression vector can be at the expression vector of above-mentioned host's expression alien gene, as pPIC9 (its physical map as shown in Figure 1), pPIC3, pHIL-D1, pA0804, pA0815, pPSC3K or the pPIC9K etc. that can express in pichia pastoris (Pichia pastoris) for any one.
With pPIC9 is that the set out recombinant yeast expression vector of vector construction is HSA-GHRH/pPIC9.
When described host is pichia pastoris, need to carry out abduction delivering with methyl alcohol, the final concentration of methyl alcohol can be 0.3-0.7%, is preferably 0.5%.
Above-mentioned recombinant expression vector all can make up according to ordinary method.
Cultivation contains the substratum and the culture condition of the host cell of the fusion rotein encoding gene with growth facilitation action of the present invention, all can be substratum and the culture condition of cultivating the host that sets out.
The present invention also provides the curative drug of a kind of children and adult's growth hormone deficiency.
The medicine of treatment children provided by the present invention and adult's growth hormone deficiency, its activeconstituents are the above-mentioned short fusion rotein that increases antiobesity action that has.
When needing, in said medicine, can also add one or more pharmaceutically acceptable carriers.Described carrier comprises thinner, vehicle, weighting agent, tackiness agent, wetting agent, disintegrating agent, absorption enhancer, tensio-active agent, absorption carrier of pharmaceutical field routine etc.
Medicine of the present invention can be made various ways such as injection liquid, tablet, pulvis, granula, capsule, oral liquid.The medicine of above-mentioned various formulations all can be according to the ordinary method preparation of pharmaceutical field.
The consumption of said medicine is generally fusion rotein/kg body weight that 1-50 μ g has growth facilitation action, is administered once every 7-14 days, and be 3 to 12 months the course of treatment.
Fusion rotein HSA-GHRH provided by the present invention has significant growth facilitation action, and has the expression amount height, easy purifying, and with short production cycle, industrial scale is big, and the advantage that cost is low is expected to the curative drug that is prepared into children and is grown up growth hormone deficiency.The present invention has bigger practical significance and wide application prospect in medical science and field of biological pharmacy.
Description of drawings
Fig. 1 is the physical map of carrier pPIC9
Fig. 2 is the 1% agarose gel electrophoresis detected result of the GHRH of pcr amplification
Fig. 3 is the 1% agarose gel electrophoresis detected result of the HSA-GHRH of pcr amplification
Fig. 4 cuts qualification result for the enzyme of recombinant yeast expression vector HSA-GHRH/pPIC9
Fig. 5 expresses the high-expression clone The selection result of engineering bacteria for HSA-GHRH
Fig. 6 is the 10%SDS-PAGE electrophoresis qualification result of different induction time HSA-GHRH expressing quantities
Fig. 7 is the 10%SDS-PAGE electrophoresis detection result of HSA-GHRH expression product
Fig. 8 determines the 10%SDS-PAGE electrophoretogram of HSA-GHRH expressing quantity for external standard method
Fig. 9 is the purified proteic 10%SDS-PAGE electrophoresis detection of HSA-GHRH result
Figure 10 is that the proteic mouse activity in vivo of HSA-GHRH is measured effect
Figure 11 is a long-lasting mensuration effect in the proteic mouse body of HSA-GHRH
Embodiment
Method therefor is ordinary method if no special instructions among the following embodiment.The per-cent of all substances content is mass percent.
Main agents:
1, DNA restriction enzyme, T
4Enzyme such as dna ligase, polysaccharase reagent is available from GIBCO-BRL, Pharmacia, Bio-Labs and magnificent biotechnology company limited.
2, pcr amplification test kit is available from Sweden Pharmacia company.
3, dna sequence analysis test kit is available from U.S. USB company.
4, casein hydrolysate is available from German MERK company.
5, Bacto-yeast extract is available from U.S. Difco company.
6, the preparation of used some solution of yeast protoplast transformation method
(1) SED:1M sorbyl alcohol, 25mM EDTA, 50mM DTT, pH8.0.
(2) SCE:9.1g sorbyl alcohol, 1.47g Trisodium Citrate, 0.168g EDTA, pH5.8.
(3) CaS:1M sorbyl alcohol, 10mM CaCl
2
(4) SOS:1M sorbyl alcohol, 0.3 * YPD, 10mM CaCl
2
(5)CaT：20mM?Tris-HCl，pH7.5，20mM?CaCl
2。
(6)PEG：20％?PEG-3350，10mM?CaCl
2，10mM?Tris-HCl(pH7.4)。
(7) 1M PBS damping fluid: 132mL 1M K
2HPO
4, 868mL 1M KH
2PO
4, pH6.0.
7, BMGY liquid nutrient medium: 1% yeast extract, 2% Tryptones, 1.34%YNB, 4 * 10
-5The % vitamin H, 1% glycerine, 100mM potassium phosphate buffer (pH6.0).
8, BMMY liquid nutrient medium: 1% yeast extract, 2% Tryptones, 1.34%YNB, 4 * 10
-5The % vitamin H, 0.5% methyl alcohol, 100mM potassium phosphate buffer (pH6.0).
The acquisition of embodiment 1, antigen-4 fusion protein gene HSA-GHRH
According to the nucleotide sequence of human serum albumin gene (HSA) and GHRH protein gene (GHRH) design primer, with the method for PCR increase respectively human serum albumin gene and GHRH protein gene, primer sequence is as follows:
Primer 1:5 '-GGGAATTCCTATTACAATCTAGCTCTAGCACCTCT-3 ';
Primer 2: 5 '-GTGGTGGTGGTTCCGGTGGTGGTGGTGGTTCTTACGCTGACGCTATCTTCACTAAC-3 ';
Primer 3:5 '-ACGCTGACGCTATCTTCACTAACTCCTACCGTAAGGTTTTGGGTCAATTGTCCGCT AGAAAGTTGTTGCAAGACATCATG-3 ';
Primer 4:5 '-CAATCTAGCTCTAGCACCTCTCTCTTGGTTGGACTCACCTTGTTGTCTGGACATGA TGTCTTGCAACAACTTTCTAGGGGA-3 '.
One, the amplification of GHRH gene
With primer 3 and primer 4 is the template primer of holding concurrently, and splices the full length sequence of GHRH gene with the method for PCR, and 50 μ l PCR reaction systems are: 10 * PCR damping fluid, 5 μ l, dNTP 1.5 μ l, Pfu enzyme 0.5 μ l, primer 3 and primer 4 each 2 μ l, ddH
2O 39 μ l.The PCR reaction conditions is: earlier 94 ℃ 5 minutes, 94 ℃ 30 seconds, 60 ℃ 30 seconds, 72 ℃ 40 seconds, carry out 30 circulations altogether; Then 72 ℃ 10 minutes, 4 ℃ 10 minutes.
Be template with above-mentioned amplified production again, under the guiding of primer 1 and primer 2, pcr amplification GHRH gene, 50 μ l PCR reaction systems are: 10 * PCR damping fluid, 5 μ l, dNTP 1.5 μ l, Pfu enzyme 0.5 μ l, template 1 μ l, each 2 μ l of primer 1 and primer 2, ddH
2O 38 μ l.The PCR reaction conditions is: earlier 94 ℃ 5 minutes, again 94 ℃ 30 seconds, 60 ℃ 30 seconds, 72 ℃ 40 seconds, carry out 30 circulations altogether; Then 72 ℃ 10 minutes, 4 ℃ 10 minutes.After reaction finishes, pcr amplification product is carried out 1% sepharose detect, detected result is (swimming lane 1 and swimming lane 2 are the GHRH gene of pcr amplification, and swimming lane M is the DL2000 molecular weight standard) as shown in Figure 2, amplified the band of 132bp, with GHRH gene big or small consistent of expection.
Two, the acquisition of HSA gene
The preparation method of HSA gene is 99102794.9 patent of invention " human serum albumin changes structure gene, expression vector and host thereof " with reference to the patent No. of authorizing on March 19th, 2003.
Three, the acquisition of human serum albumin and human growth hormone releasing hormone antigen-4 fusion protein gene HSA-GHRH
The HSA gene that GHRH gene that obtains with step 1 and step 2 obtain is a template, at primer 1 and HSA upstream primer (with reference to patent of invention " human serum albumin changes structure gene, expression vector and host thereof ", the patent No. is 99102794.) guiding under, utilize the pcr amplification test kit to amplify the HSA-GHRH antigen-4 fusion protein gene, the PCR reaction system is: 10 * PCR damping fluid, 5 μ l, dNTP 1.5 μ l, Pfu enzyme 0.5 μ l, GHRH template 1 μ l, HSA template 1 μ l, HAS upstream primer and primer 1 each 2 μ l, ddH
2O 37 μ l.The PCR reaction conditions is: earlier 94 ℃ 5 minutes, 94 ℃ 4 minutes, 60 ℃ 30 seconds, 72 ℃ 40 seconds, carry out 30 circulations altogether; Then 72 ℃ 10 minutes, 4 ℃ 10 minutes.After reaction finishes, pcr amplification product is carried out 1% sepharose detect, detected result is (swimming lane 1 is the HSA-GHRH gene of pcr amplification, and swimming lane M is the DL2000 molecular weight standard) as shown in Figure 3, amplified the band of 1920bp, with HSA-GHRH gene big or small consistent of expection.The HSA-GHRH gene of pcr amplification is cut the back and used T through the Yeast expression carrier pPIC9 (the carrier physical map as shown in Figure 1) of same enzyme double digestion with restriction enzyme BamHI and EcoRI enzyme
4Dna ligase connects, the HSA-GHRH gene clone is gone among the pPIC9, obtain the recombinant expression vector of HSA-GHRH gene, it is carried out enzyme with restriction enzyme BamHI and EcoRI cut evaluation, enzyme is cut product carry out the detection of 1% agarose gel electrophoresis, (swimming lane 1-5 is that enzyme is cut product to detected result as shown in Figure 4, swimming lane M is the DL2000 molecular weight standard), obtained the endonuclease bamhi of 1920bp, conform to expected results, obtained inserting the recombinant yeast expression vector of the correct HSA-GHRH gene in site, called after HSA-GHRH/pPIC9.With the dna sequence analysis test kit this recombinant vectors is checked order, sequencing result shows that the HSA-GHRH gene has the nucleotide sequence of sequence SEQ ID NO:2 in the sequence table, SEQ ID № in the sequence table: 2 by 1920 based compositions, its encoding sequence is from 5 ' end the 1st to the 1920th bit base, coding has SEQ ID № in the sequence table: the protein of 1 amino acid residue sequence, from 5 ' end the 1st to the 1755th bit base is the encoding sequence of HSA, from 5 ' end the 1789th to the 1920th bit base is the encoding sequence of GHRH, is the encoding sequence of connection peptides from 5 ' end the 1756th to the 1788th bit base.
One, human serum albumin and the expression of human growth hormone releasing hormone antigen-4 fusion protein gene HSA-GHRH in pichia pastoris phaff
1, the screening of high expression level transformant
The recombinant yeast expression vector HSA-GHRH/pPIC9 of the HSA-GHRH that embodiment 1 is made up transforms pichia pastoris phaff GS115 his4 (Mut+his-) NRRLY-15851 with yeast protoplast transformation method, concrete grammar is: the about 10 μ g of linearizing HSA-GHRH/pPIC9 plasmid DNA are joined in the 100 μ l pichia spp GS115 protoplastiss, and room temperature was placed ten minutes.Add the fresh 40%PEG/CaT solution of 1.0mL again, incubated at room is 10 minutes after gentle the mixing.750g is careful exhaustion PEG/CaT solution after centrifugal 10 minutes, with 150 μ l SOS nutrient solution re-suspended cells.Room temperature is placed the Sorbitol Solution USP that adds 850 μ l 1M after 20 minutes, is coated on MD flat board (1.34%YNB, 4 * 10
-5The % vitamin H, 2% glucose, 1.5% agar powder) on, through the screening of Histidine auxotrophy, obtain transformant.24 transformants of picking are inoculated in the 4mL BMGY liquid nutrient medium at random, add final concentration every 12 hours and are 0.5% methyl alcohol and carry out abduction delivering, shake training 36-48 hour under 30 ℃, 100rpm.Cultivate and finish the centrifugal 10min of back 5000rpm, respectively get 100 μ L supernatant liquors, vacuum is drained, different samples are carried out the 15%SDS-PAGE electrophoresis respectively to be detected, (swimming lane 1-10 is different monoclonal expression products to detected result as shown in Figure 5, swimming lane M is albumen Marker), swimming lane 3,4,6,7 is the high-expression clone product, the molecular weight size of expression product is about 70KD, with conform to expected results, the high-expression clone that these are screened is protected bacterium with 15% glycerine low temperature respectively then, slant culture is used for the engineering bacteria that HSA-GHRH expresses, called after HSA-GHRH/pPIC9 (GS115).
2, the expression of HSA-GHRH in pichia pastoris phaff
Single bacterium colony of the engineering bacteria that the expression amount of picking embodiment 1 screening is high (has the negative contrast of yeast GS115 of pPIC9 empty carrier with conversion, this bacterium called after pPIC9 (GS115)) is inoculated in respectively in the 4mL BMGY liquid nutrient medium, shakes training 12-24 hour at 30 ℃, 100rpm.Getting 1mL yeast engineering bacteria culture fluid transfers in 50mL BMGY substratum, continue to shake training 18-24 hour under the same conditions, connecing the bacterium amount by 4% again inserts the 40mL seed in the 1000mL BMGY liquid nutrient medium, at 30 ℃, continue to shake training 24-30 hour under the 100rpm, with the centrifugal 5min of nutrient solution 5000rpm, abandon supernatant, then the engineering bacteria HSA-GHRH/pPIC9 (GS115) that collects is used 200mL BMMY abduction delivering substratum suspension thalline, at 30 ℃, shake training 3-4 days under the 100rpm, added methyl alcohol (adding to final concentration with 100% methyl alcohol is 0.5%) every 24 hours.The cultivation initial stage was got one time sample every 12 hours, after 48 hours, got one time sample every 6 hours.After measured, cultivate end back pichia pastoris phaff engineering bacteria bacterium liquid OD
600Optical density value reached 18-20, every liter of dry cell weight is the 100-300 gram, shows that the foreign protein great majority that HSA-GHRH expresses are secreted in the liquid nutrient medium.With fermention medium centrifugal 20min under 4 ℃, 10000rpm, abandon thalline, acquisition contains the supernatant liquor of a large amount of antigen-4 fusion protein gene HSA-GHRH expression products, the sample that different times is got carries out the evaluation of 10%SDS-PAGE electrophoresis, (swimming lane M is albumen Marker to the electrophoresis qualification result as shown in Figure 6, the other branch of all the other swimming lanes is represented the product after 0,12,24,36,48,54,60,66,72 hour behind the abduction delivering), abduction delivering 72 hours, the expression amount of HSA-GHRH is higher, shows that HSA-GHRH has obtained expression in pichia pastoris phaff.Product to abduction delivering is further identified with 10%SDS-PAGE, the negative contrast of transformant of empty carrier is arranged with conversion, (swimming lane 3,4,5 and 6 is for to be respectively 36,48,60,72 hours supernatant of abduction delivering with HSA-GHRH/pPIC9 (GS115) as shown in Figure 7 for the result, swimming lane 1 and 2 negative contrast pPIC9 (GS115)), swimming lane M is the molecular weight of albumen standard, and arrow shows the purpose band).Use the external standard method expressing quantity, the result as shown in Figure 8 (swimming lane 100,50,40,30,20,10,5,2.5 respectively indicated concentration be 100,50,40,30,20,10,5, the protein liquid of 2.5mg/L), show that the Expression of Fusion Protein amount is about 50mg/L in the sample.
3, the separation and purification of HSA-GHRH fusion rotein
With the culture supernatant molecular weight cut-off in the step 2 is that the ultrafiltration pipe of 30KD concentrates, with 0.1mol/L phosphate buffered saline buffer (pH8.0) balance Sephadex G-75 molecular sieve, obtain final product, the used damping fluid of gel-filtration is PBS and 0.1%Tween80, the albumen of purifying is carried out the 10%SDS-PAGE electrophoresis detection, (swimming lane 1 is the supernatant through fermentation culture to detected result as shown in Figure 9, swimming lane 2 is albumen Marker, swimming lane 3 is the ultrafiltration and concentration sample, swimming lane 4 is the gel-filtration purification of samples), detected result shows that the purity of purified back HSA-GHRH fusion rotein reaches more than 90%, it is checked order, and sequencing result shows and has obtained the correct high purity fusion rotein HSA-GHRH of amino acid residue sequence.
1, the mouse activity in vivo of fusion rotein HSA-GHRH detects
Get 20 of the male mouse of kunming of 3 week ages ablactation, be divided into 4 groups at random, 5 every group, one group is control group, and other 3 groups is the administration group.The HSA-GHRH fusion rotein that administration group every subcutaneous injection 0.2mL every day step 2 obtains, every group of injection volume is respectively 20,2,0.2 μ g; Control group every subcutaneous injection 0.2mL every day PBS.Write down body weight every day, two weeks of successive administration.Experimental result as shown in figure 10, every day, dosage was that the group gaining effect of 0.2 μ g is the most obvious, compared average daily gain per-cent with control group and exceeded 46%.
2, long-lasting detection in the mouse body of fusion rotein HSA-GHRH
Get 20 of the male mouse of kunming of weaning ages in 3 weeks, be divided into 4 groups at random, 5 every group, one group is control group, and other 3 groups is the administration group.The administration group is every subcutaneous injection 0.2mL weekly, and every group of injection volume is respectively 20,2,0.2 μ g, and control group is every subcutaneous injection 0.2mL PBS weekly.Write down body weight every day, two weeks of successive administration.Experimental result as shown in figure 11, dosage is that the group weightening finish of 20 μ g is the most remarkable weekly, compares average daily gain per-cent with control group and will exceed 34%.
Sequence table
<160>2
<210>1
<211>640
<212>PRT
＜213〉artificial sequence
<220>
<223>
<400>1
Asp?Ala?His?Lys?Ser?Glu?Val?Ala?His?Arg?Phe?Lys?Asp?Leu?Gly?Glu?Glu
1 5 10 15
Asn?Phe?Lys?Ala?Leu?Val?Leu?Ile?Ala?Phe?Ala?Gln?Tyr?Leu?Gln?Gln?Cys
20 25 30
Pro?Phe?Glu?Asp?His?Val?Lys?Leu?Val?Asn?Glu?Val?Thr?Glu?Phe?Ala?Lys
35 40 45 50
Thr?Cys?Val?Ala?Asp?Glu?Ser?Ala?Glu?Asn?Cys?Asp?Lys?Ser?Leu?His?Thr
55 60 65
Leu?Phe?Gly?Asp?Lys?Leu?Cys?Thr?Val?Ala?Thr?Leu?Arg?Glu?Thr?Tyr?Gly
70 75 80 85
Glu?Met?Ala?Asp?Cys?Cys?Ala?Lys?Gln?Glu?Pro?Glu?Arg?Asn?Glu?Cys?Phe
90 95 100
Leu?Gln?His?Lys?Asp?Asp?Asn?Pro?Asn?Leu?Pro?Arg?Leu?Val?Arg?Pro?Glu
101 105 110
Val?Asp?Val?Met?Cys?Thr?Ala?Phe?His?Asp?Asn?Glu?Glu?Thr?Phe?Leu?Lys
115 120 125 130
Lys?Tyr?Leu?Tyr?Glu?lle?Ala?Arg?Arg?His?Pro?Tyr?Phe?Tyr?Ala?Pro
135 140 145
Glu?Leu?Leu?Phe?Phe?Ala?Lys?Arg?Tyr?Lys?Ala?Ala?Phe?Thr?Glu?Cys
150 155 160
Cys?Gln?Ala?Ala?Asp?Lys?Ala?Ala?Cys?Leu?Leu?Pro?Lys?Leu?Asp?Glu
165 170 175
Leu?Arg?Asp?Glu?Gly?Lys?Ala?Ser?Ser?Ala?Lys?Gln?Arg?Leu?Lys?Cys
180 185 190 195
Ala?Ser?Leu?Gln?Lys?Phe?Gly?Glu?Arg?Ala?Phe?Lys?Ala?Trp?Ala?Val
200 205 210
Ala?Arg?Leu?Ser?Gln?Arg?Phe?Pro?Lys?Ala?Glu?Phe?Ala?Glu?Val?Ser
215 220 225
Lys?Leu?Val?Thr?Asp?Leu?Thr?Lys?Val?His?Thr?Glu?Cys?Cys?His?Gly
230 235 240
Asp?Leu?Leu?Glu?Cys?Ala?Asp?Asp?Arg?Ala?Asp?Leu?Ala?Lys?Tyr?Ile
245 250 255
Cys?Glu?Asn?Gln?Asp?Ser?Ile?Ser?Ser?Lys?Leu?Lys?Glu?Cys?Cys?Glu
260 265 270 275
Lys?Pro?Leu?Leu?Glu?Lys?Ser?His?Cys?Ile?Ala?Glu?Val?Glu?Asn?Asp
280 285 290
Glu?Met?Pro?Ala?Asp?Leu?Pro?Ser?Leu?Ala?Ala?Asp?Phe?Val?Glu?Ser
295 300 305
Lys?Asp?Val?Cys?Lys?Asn?Tyr?Ala?Glu?Ala?Lys?Asp?Val?Phe?Leu?Gly
310 315 320
Met?Phe?Leu?Tyr?Glu?Tyr?Ala?Arg?Arg?His?Pro?Asp?Tyr?Ser?Val?Val
325 330 335
Leu?Leu?Leu?Arg?Leu?Ala?Lys?Thr?Tyr?Glu?Thr?Thr?Leu?Glu?Lys?Cys
340 345 350 355
Cys?Ala?Ala?Ala?Asp?Pro?His?Glu?Cys?Tyr?Ala?Lys?Val?Phe?Asp?Glu
360 365 370
Phe?Lys?Pro?Leu?Val?Glu?Glu?Pro?Gln?Asn?Leu?Ile?Lys?Gln?Asn?Cys
375 380 385
Glu?Leu?Phe?Glu?Gln?Leu?Gly?Glu?Tyr?Lys?Phe?Gln?Asn?Ala?Leu?Leu
395 400 405
Val?Arg?Tyr?Thr?Lys?Lys?Val?Pro?Gln?Val?Ser?Thr?Pro?Thr?Leu?Val
410 415 420
Glu?Val?Ser?Arg?Asn?Leu?Gly?Lys?Val?Gly?Ser?Lys?Cys?Cys?Lys?His
425 430 435 440
Pro?Glu?Ala?Lys?Arg?Met?Pro?Cys?Ala?Glu?Asp?Tyr?Leu?Ser?Val?Val
445 450 455
Leu?Asn?Gln?Leu?Cys?Val?Leu?His?Glu?Lys?Thr?Pro?Val?Ser?Asp?Arg
460 465 470
Val?Thr?Lys?Cys?Cys?Thr?Glu?Ser?Leu?Val?Asn?Arg?Arg?Pro?Cys?Phe
475 480 485
Ser?Ala?Leu?Glu?Val?Asp?Glu?Thr?Tyr?Val?Pro?Lys?Glu?Phe?Asn?Ala
490 495 500
Glu?Thr?Phe?Thr?Phe?His?Ala?Asp?Ile?Cys?Thr?Leu?Ser?Glu?Lys?Glu
505 510 515 520
Arg?Gln?Ile?Lys?Lys?Gln?Thr?Ala?Leu?Val?Glu?Leu?Val?Lys?His?Lys
525 530 535
Pro?Lys?Ala?Thr?Lys?Glu?Gln?Leu?Lys?Ala?Val?Met?Asp?Asp?Phe?Ala
540 545 550
Ala?Phe?Val?Glu?Lys?Cys?Cys?Lys?Ala?Asp?Asp?Lys?Glu?Thr?Cys?Phe
555 560 565
Ala?Glu?Glu?Gly?Lys?Lys?Leu?Val?Ala?Ala?Ser?Gln?Ala?Ala?Leu?Gly
570 575 580
Leu?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Gly?Ser?Tyr?Ala?Asp?Ala
585 590 595 600
Ile?Phe?Thr?Asn?Ser?Tyr?Arg?Lys?Val?Leu?Gly?Gln?Leu?Ser?Ala?Arg
605 610 615
Lys?Leu?leu?Gln?Asp?Ile?Met?Ser?Arg?Gln?Gln?Gly?Glu?Ser?Asn?Gln
620 625 630
Glu?Arg?Gly?Ala?Arg?Ala?Arg?Leu
635 640
<210>2
<211>1920
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>2
gacgctcaca?agtctgaagt?tgctcacaga?ttcaaggact?tgggtgaaga?aaacttcaag 60
gctttggttt?tgattgcttt?cgctcaatac?ttgcaacaat?gtccattcga?agaccacgtt 120
aagttggtta?acgaagttac?tgaatttgct?aagacttgtg?ttgctgacga?atctgctgaa 180
aactgtgaca?agtctttgca?cactttgttc?gtgacaagtt?gtgtactgt tgctactttg 240
agagaaactt?acggtgaaat?ggctgactgt?tgtgctaagc?aagaaccaga?aagaaacgaa 300
agtttcttgc?aacacaagga?cgacaaccca?aacttgccaa?gattggttag?accagaagtc 360
gacgttatgt?gtactgcttt?ccacgacaac?gaagaaactt?tcttgaagaa?gtacttgtac 420
gaaattgcta?gaagacaccc?atacttctac?gctccagaat?tgttgttctt?cgctaagaga 480
tacaaggctg?ctttcactga?atgttgtcaa?gctgctgaca?aggctgcttg?tttgttgcca 540
aagttggacg?aattgagaga?cgaaggtaag?gcttcttctg?ctaagcaaag?attgaagtgt 600
gcttctttgc?aaaagttcgg?tgaaagagct?ttcaaagctt?gggctgttgc?tagattgtct 660
caaagattcc?caaaggctga?atttgctgaa?gtttctaagt?tggttactga?cttgactaag 720
gttcacactg?aatgttgtca?cggtgacttg?ttggaatgtg?ctgacgacag?agctgacttg 780
gctaagtaca?tttgtgaaaa?ccaagactct?atttcttcta?agttgaagga?atgttgtgaa 840
aagccattgt?tggaaaagtc?tcactgtatt?gctgaagttg?aaaacgacga?aatgccagct 900
gacttgccat?ctttggctgc?tgacttcgtt?gaatctaagg?acgtttgtaa?gaactacgct 960
gaagctaagg?acgttttctt?gggtatgttc?ttgtacgaat?acgctagaag?acacccagac?1020
tactctgttg?ttttgttgtt?gagattggct?aagacttacg?aaactacttt?ggaaaagtgt?1080
tgtgcggccg?ctgacccaca?cgaatgttac?gctaaggttt?tcgacgaatt?taagccattg?1140
gttgaagaac?cacaaaactt?gattaagcaa?aactgtgaat?tgttcgaaca?attgggtgaa?1200
tacaagttcc?aaaacgcttt?gttggttaga?tacactaaga?aggttccaca?agtttctact?1260
ccaactttgg?ttgaagtttc?tagaaacttg?ggtaaggttg?gttctaagtg?ttgtaagcac?1320
ccagaagcta?agagaatgcc?atgtgctgaa?gactacttgt?ctgttgtttt?gaaccaattg?1380
tgtgttttgc?acgaaaagac?tccagtttct?gacagagtta?ctaagtgttg?tactgaatct 1440
ttggttaaca?gaagaccatg?tttctctgct?ttggaagttg?acgaaactta?cgttccaaag 1500
gaatttaacc?ctgaaacttt?cactttccac?gctgacattt?gtactttgtc?tgaaaaggaa 1560
agacaaatta?agaagcaaac?tgctttggtt?gaattggtta?agcacaagcc?aaaggctact 1620
aaggaacaat?tgaaggctgt?tatggacgac?ttcgctgctt?tcgttgaaaa?gtgttgtaag 1680
gctgacgaca?aggaaacttg?tttcgctgaa?gaaggtaaga?agttggttgc?tgcttctcaa 1740
gctgctttgg?gtttgggtgg?tggtggttcc?ggtggtggtg?gtggttctta?cgctgacgct 1800
atcttcacta?actcctaccg?taaggttttg?ggtcaattgt?ccgctagaaa?gttgttgcaa 1860
gacatcatgt?ccagacaaca?aggtgagtcc?aaccaagaga?gaggtgctag?agctagattg 1920
Claims (10)
1, the fusion rotein that has growth facilitation action is the protein with one of following amino acid residue sequences:
1) the SEQ ID № in the sequence table: 1;
2) with SEQ ID № in the sequence table: 1 amino acid residue sequence is through replacement, disappearance or the interpolation of one to ten amino-acid residue and have the protein of growth facilitation action.
2, fusion rotein according to claim 1 is characterized in that: described fusion rotein has SEQ ID № in the sequence table: 1 amino acid residue sequence.
3, the described gene with fusion rotein of growth facilitation action of coding claim 1 is one of following nucleotide sequence:
1) SEQ ID № in the sequence table: 2 dna sequence dna;
2) SEQ ID № in the code sequence tabulation: 1 dna sequence dna;
3) SEQ ID № in the sequence table: 2 from the 5 ' dna sequence dna of holding the 1756th to the 1788th bit base to lack, shorten, prolong or suddenly change;
4) under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 2 dna sequence dnas hybridization that limit.
4, gene according to claim 3 is characterized in that: described gene has SEQ ID № in the sequence table: 2 dna sequence dna.
5, contain the described expression carrier of claim 3, transgenic cell line and host bacterium.
6, a kind of described method of claim 1 of expressing with fusion rotein of growth facilitation action, be to contain the described recombinant expression vector of claim 3 to import host cell, express the fusion rotein that obtains having growth facilitation action with fusion rotein encoding gene of growth facilitation action.
7, method according to claim 6 is characterized in that: described host is yeast, intestinal bacteria, mammalian cell, insect cell or Bacillus subtilus; Described yeast is pichia pastoris GS115, KM71 or SMD1168; Described intestinal bacteria are E.coli JM109, E.coli HB101 or E.coli Top10.
8, method according to claim 6 is characterized in that: the carrier that sets out that is used to make up described recombinant yeast expression vector is pPIC9, pPIC3, pHIL-D1, pA0804, pA0815, pPSC3K or pPIC9K; With pPIC9 is that the set out recombinant yeast expression vector of vector construction is HSA-GHRH/pPIC9.
9, method according to claim 6 is characterized in that: when described host is pichia pastoris, need carry out abduction delivering with methyl alcohol, the final concentration of methyl alcohol is 0.3-0.7%.
10, the described application of fusion rotein in the curative drug of preparation children and adult's growth hormone deficiency of claim 1 with growth facilitation action.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100934286A CN1313494C (en) | 2005-08-29 | 2005-08-29 | Fusion protein possessing growth facilitation action and its coding gene and uses |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100934286A CN1313494C (en) | 2005-08-29 | 2005-08-29 | Fusion protein possessing growth facilitation action and its coding gene and uses |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1733807A true CN1733807A (en) | 2006-02-15 |
| CN1313494C CN1313494C (en) | 2007-05-02 |
Family
ID=36076448
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100934286A Expired - Fee Related CN1313494C (en) | 2005-08-29 | 2005-08-29 | Fusion protein possessing growth facilitation action and its coding gene and uses |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1313494C (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107949638A (en) * | 2015-09-08 | 2018-04-20 | Jcr制药股份有限公司 | New human serum albumins mutant |
| CN109851674A (en) * | 2018-10-26 | 2019-06-07 | 天津林达生物科技有限公司 | A kind of recombination human serum albumin/growth hormone fusion protein for treating children short stature prepares purification process |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1103373C (en) * | 1999-03-04 | 2003-03-19 | 上海贸基生物工程科技有限公司 | Chemical synthesis, expression and recombinant protein production for human serum albumin reformed gene |
| CN101200503B (en) * | 2001-08-10 | 2010-07-07 | 中国人民解放军军事医学科学院生物工程研究所 | Fusion protein for seralbumin and interferon |
| CN1405182A (en) * | 2001-08-10 | 2003-03-26 | 中国人民解放军军事医学科学院生物工程研究所 | Serum albumin and granulocyte colony stimulating factor fusion protein |
| CN100417419C (en) * | 2001-10-26 | 2008-09-10 | 贝勒医学院 | Composition and method to alter lean body mass and bone properties in a subject |
| CN100379762C (en) * | 2003-12-08 | 2008-04-09 | 中国人民解放军军事医学科学院生物工程研究所 | Interfusion protein between human serum albumin and interleukin, and encoding genes |
-
2005
- 2005-08-29 CN CNB2005100934286A patent/CN1313494C/en not_active Expired - Fee Related
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107949638A (en) * | 2015-09-08 | 2018-04-20 | Jcr制药股份有限公司 | New human serum albumins mutant |
| US11046751B2 (en) | 2015-09-08 | 2021-06-29 | Jcr Pharmaceuticals Co., Ltd. | Human serum albumin mutant |
| CN107949638B (en) * | 2015-09-08 | 2022-05-13 | Jcr制药股份有限公司 | Novel human serum albumin mutants |
| US11634474B2 (en) | 2015-09-08 | 2023-04-25 | Jcr Pharmaceuticals Co., Ltd. | Human serum albumin mutant |
| CN109851674A (en) * | 2018-10-26 | 2019-06-07 | 天津林达生物科技有限公司 | A kind of recombination human serum albumin/growth hormone fusion protein for treating children short stature prepares purification process |
| CN109851674B (en) * | 2018-10-26 | 2022-02-15 | 天津林达生物科技有限公司 | Preparation and purification method of recombinant human serum albumin/growth hormone fusion protein for treating children's dwarf syndrome |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1313494C (en) | 2007-05-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1187086C (en) | Hybrid with interferon-'alpha' and immunoglobulin Fc linkes through non-immunogenic peptide | |
| CN1219796C (en) | Hybrid interferon compositions and method of use | |
| CN1491233A (en) | Long lasting growth hormone releasing factor derivatives | |
| CN1037711A (en) | Peptide class with T cell helper activity | |
| CN1192689A (en) | Appetite regulating compositions | |
| CN1276797A (en) | Low-toxicity human interferon-alpha analog | |
| CN1362968A (en) | Novel peptides | |
| CN1277614A (en) | Mammaglobin a secreted mammary-specific breast cancer protein | |
| CN1226899A (en) | Synthetic IL-10 analogues | |
| CN101035806A (en) | Amylin family polypeptide-6 (AFP-6) analogs and methods of making and using them | |
| CN1568369A (en) | Hybrid interferon/interferon Tau proteins, compositions and methods of use | |
| CN1735428A (en) | Chaperonin 10 immunosuppression | |
| CN1313494C (en) | Fusion protein possessing growth facilitation action and its coding gene and uses | |
| CN1231259C (en) | Generation of human insulin | |
| CN1269840C (en) | Human interferon analogue with long-lasting biological effects | |
| CN1917898A (en) | Biologically active substance of a vasoactive intestinal peptide for treating interstitial lung infections | |
| CN1220702C (en) | Insulinotropic peptide and its use | |
| CN1217023A (en) | Canine OB protein compositions and method for recombinant prodn. | |
| CN1649897A (en) | FALP proteins | |
| CN1192751A (en) | Monocype chemotactic protein-4 | |
| CN1816353A (en) | Medicinal composition for preventing or treating Th1 type immunological disease | |
| CN1194986A (en) | Anti-obesity proteins | |
| CN1634978A (en) | SARS virus HLA-A2 limited epitope polypeptide and uses thereof | |
| CN88102023A (en) | Porcine growth hormone analogs | |
| CN1289527C (en) | Horny cell growth factor mutant with high bioactivity and its preparation process and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20070502 Termination date: 20150829 |
|
| EXPY | Termination of patent right or utility model |