CN1720994A - Treatment of refractory human tumors with epidermal growth factor receptor antagonists - Google Patents
Treatment of refractory human tumors with epidermal growth factor receptor antagonists Download PDFInfo
- Publication number
- CN1720994A CN1720994A CN 200510055865 CN200510055865A CN1720994A CN 1720994 A CN1720994 A CN 1720994A CN 200510055865 CN200510055865 CN 200510055865 CN 200510055865 A CN200510055865 A CN 200510055865A CN 1720994 A CN1720994 A CN 1720994A
- Authority
- CN
- China
- Prior art keywords
- egfr
- antibody
- tumor
- treatment
- people
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
A method of inhibiting the growth of refractory tumors that are stimulated by a ligand of epidermal growth factor in human patients, comprising treating the human patients with an effective amount of an epidermal growth factor receptor antagonist.
Description
The application is to be the Chinese patent application 00810321.6 on May 1st, 2000 dividing an application of " using treatment of refractory human tumors with epidermal growth factor receptor antagonists " applying date.
Background of invention
In the U.S., cancer is to be only second to cardiopathic second largest main dead factor.Treat the new therapy of this mortality disease and obtained major progress.A lot of progress are because pair cell comprises the propagation of normal cell and cancerous cell understanding better have been arranged.
Normocellular propagation is to control by strict its growth factor receptors that activates of part separately.The example of this receptoroid is a growth factor receptor tyrosine kinase.
Cancerous cell also is to breed under the activation of growth factor receptors, but has lost the strictness control of normal propagation.This out of control may be to cause by several factors, such as the overexpression of somatomedin and/or the overexpression of growth factor receptors, and activate by the spontaneity of the biochemical route of somatomedin regulation and control.
Some receptors that participate in tumorigenesis are EGF-R ELISA (EGFR), derive from hematoblastic growth factor receptors (PDGFR), insulin like growth factor receptor (IGFR), trk C (NGFR) and fibroblast growth factor receptor (FGF).
The member of epidermal growth factor (EGF) receptor family is very important growth factor receptor tyrosine kinase, and they are relevant with the tumorigenesis of epidermis cell.First member of this family who has found is the glycoprotein of the about 165kD of performance molecular weight.This glycoprotein by Mendelsohn etc. at United States Patent (USP) 4,943, describe in 533, be known EGF-R ELISA (EGFR), be also referred to as human epidermal growth factor acceptor-1 (HER1).
Overexpression EGFR all in the plan epidermoma cell of a lot of types.EGF and α transforming growth factor (TGF-α) are two known EGFR parts.The tumor of expressing the EGF receptor comprises glioblastoma, also has pulmonary carcinoma, mastocarcinoma, incidence cancer and bladder cancer.Overexpression and/or the propagation of EGF receptor on tumor cell membrane is to interrelate with bad prognosis.
Traditional treatment of cancer comprises chemotherapy and radiotherapy.The example of some chemotherapeutants comprises doxorubicin, cisplatin and paclitaxel.Radiation both can be outside light beam, also can be the intravital radioactive source of implant patient, i.e. brachytherapy.
For instance, United States Patent (USP) 4,943 has been described one in 533 and has been 225 mouse monoclonal antibody, and it is attached on the EGF receptor.This patent transfers the University of California, and the franchise of permission ImClone Systems Incorprated company.255 antibody capables are suppressed in the isolated culture tumor system growth of expressing EGFR, when these tumors as xenotransplantation during the athymism Mus, 255 antibody also can suppress its live body growth.Referring to Cancer Res. such as Masui,
44, 5592-5598 (1986).
The shortcoming of using mouse monoclonal antibody on human therapy is because Mus Ig sequence is arranged, and therefore has the probability of people to anti-mouse antibody (HAMA) reaction.The constant region of end user's antibody substitutes the constant region of Mus (or other non-human mammal) antibody fully, and this shortcoming is minimized.Usually the constant region of the constant region sequence replacing murine antibody of personnel selection antibody is called chimericization.
Framework variable region by end user's antibody substitutes the framework variable region of murine antibody also can realize chimericization very effectively.The framework variable region is the region of variability rather than the hypervariable region of antibody.The hypervariable region also is considered to complementary determining region (CDRs).
Usually the human sequence is replaced constant region and the framework variable region calls humanization.Because more Mus sequence is replaced by the human sequence, humanized antibody just has less immunogenicity (promptly causing less HAMA reaction).Unfortunately, cost and workload have been increased along with more murine antibody zone is replaced by the human sequence.
Replace the activity that non-human constant region does not resemble influences antibody the expection with human constant region.For instance, reports such as Prewett, in Mus, the mosaic type of anti--RGFR 255 monoclonal antibodies of discussing with the front has suppressed the increase of tumor very perfect tumor of prostate heteroplastic transplantation.This mosaic type is called c255.Referring to Journal of Immunotherapy
19, 419-427 (1997).
The another kind of method that reduces antibody mediated immunity originality is to use antibody fragment.For instance, in the paper of Aboud-Pirak etc., Journal of the National CancerInstitute 80,1605-1611 (1998) has compared a kind of 108.4 anti--EGF receptor antibody and antitumous effect of antibody fragment of crying.The tumor pattern is based on the KB cell, and heteroplastic transplantation is in the athymism Mus.The KB cell derives from human mouth and intends epidermal carcinoma, and it expresses high-caliber EGF receptor.
Discovery antibody such as Aboud-Pirak and bivalent F (ab ')
2Fragment can both delay the growth of vivo tumor, yet F (ab ')
2Segmental effect is less.Though unit price Fab fragment is invariable in conjunction with the ability of relevant cell receptor, it can not delay tumor growth.
People have attempted improving treatment for cancer in conjunction with foregoing few techniques.For instance, Basega etc. is at Journal of the National Cancer Institute
85, reported the antitumous effect that chemotherapeutant doxorubicin and anti-EGFR monoclonal antibodies are united among the 1327-1333 (1993).
Other trial be attempt by the radiation with accessory drugs unite increase cancerous cell to the radiation sensitivity.For instance, Bonnen is at United States Patent (USP) 4,846, and report in 782 when radiation combines with interferon, has increased the sensitivity of human cancer to radiating.Reports such as Snelling, anti-EGFR monoclonal antibodies iodine-125 radioactive label, radiation combines with this antibody, in phase ii clinical trial, the astrocytoma in radiation therapy patient anaplasty site, effect has a bit to be improved.Referring to Hybridoma
14, 111-114 (1995).
Similarly, reports such as Balaban before radiation treatment, give an anti-EGFR-antibodies that is LA22 earlier, and anti-EGFR monoclonal antibodies can make the people squamous cell carcinoma of heteroplastic transplantation in Mus that radiation is become responsive.Referring to Biochimica et Biophysica Acta
1314, 147-156 (1996).Saleh etc. also report, when strengthening radiotherapy, use anti-EGFR monoclonal antibodies, and the stripped tumor with in the Mus has obtained control preferably.Saleh etc. reach a conclusion: " further research ... may cause new drug combination formula RT/Mab therapy." referring to theProceedings of the American Association for Cancer Research
37, the summary of the 4179th in 612 (1996).
Although the therapy of beat cancer has been described in the front, the neither one therapy is the tumor that specificity ground directly is difficult to treat at traditional chemotherapy and radiotherapy.The intractable tumor causes developing rapidly of disease, often follows bad prognosis.At present almost there is not any progress aspect the human tumor that is difficult to treat at the treatment traditional remedies.
In sum, need improving one's methods of a treatment intractable human tumor.
Summary of the invention
Obviously, for have the people of general knowledge in this area, this target and other target can reach by setting up a kind of method that suppresses the intractable tumor growth, and this class intractable tumor can be stimulated by EGF-R ELISA (EGFR) in patient.This method comprises the EGFR/HER1 antagonist treatment patient who uses effective dose.
In another embodiment, method of the present invention comprises that the EGFR/HER1 antagonist that uses effective dose and chemotherapeutant are united and treats patient.
In a further embodiment, method of the present invention comprises that the EGFR/HER1 antagonist that uses effective dose and radiation are united and treats patient.
Detailed Description Of The Invention
The invention provides a kind of improving one's methods of intractable tumor for the treatment of, particularly obstinate malignant tumor, its patient suffers from refractory cancers.
The intractable tumor
The intractable tumor comprises these tumors, the tumor of the tumor of only anti-chemotherapeutant treatment, only anti-radiocurable tumor, or anti-chemotherapeutant and radiation therapeutic alliance, or the tumor of chemotherapy, radiotherapy and chemistry and radiation therapeutic alliance failure.In this manual, the intractable tumor also comprises these tumors, though showing, they can be suppressed by chemotherapeutant and/or radiotherapy, and after therapy discontinued, as long as five years, 10 years sometimes or the back tumor that recurs of longer time.
According to the present invention, treatment intractable tumor type is any intractable tumor that can be stimulated by the EGFR part.Some stimulate the example of EGFR part to comprise EGF and TGF-α.
Receptor EGFR family comprises EGFR, is also referred to as HER1 in the literature.In this manual, EGFR refers to the special member of Receptor EGFR family, is called EGFR/HER1.
The treatable refractory tumor of the present invention is interior living tumor, is inherent to patient.These tumors are than outside, the human tumor of heteroplastic transplantation in animal refractory more.Example is referring to Prewett etc., Journal of Immunotherapy
19, 419-427 (1997).
The example of some intractable tumors comprises cancer, glioma, sarcoma, adenocarcinoma, sarcoadenoma and adenoma.All sites at human body on this class tumor epithelial cell can both take place, and comprises each organ.For instance, tumor may reside in breast, heart, lung, small intestinal, colon, spleen, kidney, bladder, incidence, ovary, prostate, brain, pancreas, skin, bone, bone marrow, blood, thymus, uterus, testis, the cervix uteri regulating liver-QI.
Tumor may express EGFR on the normal level or on varying level overexpression EGFR, for example be 10100 or 1000 times of normal level at least.The tumor of some overexpression EGFR comprises the squamous cell carcinoma of breast, lung, colon, kidney, bladder, incidence, particularly incidence, ovary, prostate and brain.
The EGFR/HER1 antagonist
In the present invention, the intractable tumor can be by a kind of EGFR/HER1 antagonist treatment.For the present invention, the EGFR/HER1 antagonist is any material, and it can suppress the stimulation of EGFR/HER1 part to EGFR/HER1.Suppress the growth that this stimulation has just suppressed to express the EGFR/HER1 cell.
Suppress patient's intractable growth of tumor fully, just stop or weaken the development (that is growth,, infecting potential, transfer and or recurrence) of cancer.EGFR antagonist of the present invention is cytostatics or suppresses the intractable growth of tumor.Select excellent ground, EGFR antagonist be dissolved cell or destroy tumor.
Resemble the present invention and begin describedly, do not hint out special inhibition mechanism.Yet the EGFR tyrosine kinase is activated by the phosphorylation process usually.Correspondingly, in the present invention, phosphorylation assay is useful on the effective antagonist of prediction.Some useful EGFR tyrosine kinase activity assay methods by Panek etc. at Journal of Pharmcology and ExperimentalTherapeutics
283, 1433-1444 (1997) and Batley etc. are at Life Sciences
62, 143-150 has described in (1998).These assay methods are hereby incorporated by.
The EGFR/HER1 antagonist comprises biomolecule or micromolecule.Biomolecule comprises that all molecular weight are greater than 450 lipid, monosaccharide aggressiveness, aminoacid and nucleotide.For instance, such biomolecule comprises oligosaccharide and polysaccharide; Oligopeptide, polypeptide, peptide and protein; Oligonucleotide and polynucleotide.For instance, oligonucleotide and polynucleotide comprise DNA and RNA.
Biomolecule further comprises the derivant of above-mentioned any molecule.For instance, the derivant of biomolecule comprises oligopeptide, polypeptide, peptide and proteinic lipid derivant and glycosylated derivative.The derivant of biomolecule also comprises the lipid derivant of oligosaccharide and polysaccharide, for example, and liopopolysaccharides.The most typically, biomolecule is the function equivalent of antibody or antibody.
The function equivalent of antibody has binding characteristic that is comparable to antibody and the growth that suppresses the EGFR express cell.For instance, these function equivalents comprise chimeric, humanized and single-chain antibody and fragment thereof.
The function equivalent of antibody also comprises polypeptide, and the variable region or the hypervariable region of its aminoacid sequence and antibody of the present invention are substantially the same.An aminoacid sequence is substantially the same with another sequence, but by one or more replacements, interpolation and/or deletion, makes this sequence be different from alleged another sequence, and this aminoacid sequence is considered to one and is equal to sequence.Preferably, be lower than 50%, more preferably, be lower than 25%, still more preferably be lower than 10% amino acid residue number and from protein sequence, be substituted, add or delete.
The preferably chimericization or humanized antibody of the function equivalent of antibody.The antibody of chimericization comprises non-human antibody's the variable region and the constant region of people's antibody.Humanized antibody comprises non-human antibody's hypervariable region (CDRs).The variable region is not the hypervariable region, and for example the variable region of humanized antibody and constant region are the framework variable region and the constant regions of people's antibody.
For the present invention, suitable non-human antibody variable region and hypervariable region derive from the antibody that any non-human animal produces, and this non-human animal is used for the manufacture order clonal antibody.For instance, except the people, the suitable animal example comprises rabbit, rat, mice, horse, goat or primates.Mice is preferred.
Function equivalent also comprises the fragment of antibody, and it has identical with whole antibody or is comparable to the binding characteristic of whole antibody.Suitable antibody fragment comprises any fragment, and it comprises enough hypermutations (promptly complementary decision) district's part, combination specifically and affine fully EGFR tyrosine kinase, thus suppress to express the cell growth of this receptoroid.
For instance, this class fragment contains one or two Fab fragment or F (ab ') 2 fragments.Be less than in 6 segmental function fragments are also included within although contain, for example 3,4 or 5 CDRs, preferably antibody fragment contains all 6 complementary determining regions of whole antibody.
Preferred fragment is a single-chain antibody, or the Fv fragment.Single-chain antibody is a polypeptide, comprises the variable region of heavy chain of antibody at least, and the variable region of it and light chain is connected, and is with or without interconnective joint.Like this, the Fv fragment comprises the binding site of whole antibody.These chains can be to produce in antibacterial or eukaryotic cell.
Antibody and function equivalent can be the members of any immune globulin Bai nationality, for example, and IgG, IgM, IgA, IgD or IgE and subtribe member thereof.Preferred antibody is the member of IgG1 subtribe.Function equivalent also can be the equivalent of above-mentioned family and subtribe combination.
By the method for knowing in this area, prepare antibody with the receptor of expecting.Receptor both can be commercial existing by buying, and also can adopt the method for knowing to separate and obtain.For instance, the method for separation and purification EGFR finds in the United States Patent (USP) 5,646,153 of Spada, starts from the 41st section 55 row.Separation of describing in the Spada patent and purification EGFR method are hereby incorporated by.
The preparation monoclonal antibody method comprises immunologic method, by Kohler and Milstein at Nature
256Described in the 495-597 (1975), and Campbel (1989) describes in " monoclonal antibody technique; the preparation and the feature thereof of Rodents and people's hybridoma ", this article income is published (1985) by Elsevier scientific publication merchant in Amsterdam in Biochemistry and Molecular Biology experimental technique 13 volumes that Burdon etc. writes.By Huse etc. at Science
246, the method for the recombinant DNA described in the 1275-1281 (1989) also is suitable for.
In brief, for the manufacture order clonal antibody,, randomly strengthen host animal then to antigenic reactivity with foregoing receptor or receptor fragments inoculation host animal.Obtain useful monoclonal antibody, receptor fragments must comprise that enough amino acid residues limit the epi-position of detected molecule.Be difficult to immunogenicly if fragment is too short, it may be mixed in on the carrier molecule so.Some suitable carriers molecules comprise keyhole limpet hemocyanin and bovine serum albumin.Mixture can prepare with method as known in the art.A kind of method is that the cysteine residues of segmental cysteine residues and carrier molecule is combined.
Strengthen the last time gathering the spleen of inoculation animal in several days behind the antigen reactivity.The suspension of splenocyte and a tumor cell are merged, in cultivation, separate, grow and keep the hybridoma of this antibody of expression.
Useful monoclonal antibody and growth factor receptor tyrosine kinase also can be purchased, as the Upstate Biotechnology in California, and Santa Cruz Biotechnology ofSanta Cruz; Kentuckian Transduction Laboratories of Lexington; Minnesotan R﹠amp; The DakoCorporation of Carpinteria in D Systems Inc of Minneapolis and California.
The method for preparing chimericization and humanized antibody also is known in the field.For instance, the method for preparing chimericization antibody comprises Boss (Celltech) and the method for Cabilly (Genentech) described in United States Patent (USP).Respectively referring to United States Patent (USP) 4,816,397 and 4,816,567.For instance, the method for preparing humanized antibody is described in the United States Patent (USP) 5,225,539 of Winter.
The humanization method for optimizing of antibody is called CDR-and transplants (CDR-grafting).In CDR-transplanted, the direct antigen binding domain of murine antibody, complementary determining region or CDRs were transplanted to the people variable region, produced " reconstruct people " variable region.These complete humanized variable regions are connected to human constant region, have just produced complete complete humanized antibody.
In order to prepare and the fine bonded full humanized antibody of antigen energy, careful design reconstruct people variable region is good.Should careful selection to be implanted into the people variable region of CDRs, and must change the several amino acid residue at the critical sites in the framework region (FRs) of people variable region usually.
For instance, the reconstruct people variable region FRs that is included in selected people's variable region of light chain has the variation of 10 amino acid residues nearly and at the FRs of selected people's variable region of heavy chain the nearly variation of 12 amino acid residues is arranged.The DNA sequence of these reconstruct people's light chain and heavy chain variable region gene is connected on the DNA sequence of coding people's light chain and weight chain constant area gene, preferably is respectively γ 1 and κ.Express the humanized antibody of reconstruct then in mammalian cell, it is comparable to corresponding murine antibody and chimeric antibody to the affinity of target spot.
The method of selecting to replace the method for humanized antibody residue and replacing is known in this area.For instance, referring to following article, Nature such as Co
351, 501-502 (1992); Proc.Natl.Acad.Sci. such as Queen
86, Int.J.Cancer such as 10029-1003 (1989) and Rodrigues,
Supplementary issue 7, 45-50 (1992).The another kind of method for preparing humanization and novel 255 anti-EGFR monoclonal antibodies has been described at the PCT patent WO 96/40210 of Goldstein etc.This method can be used to the antibody of humanization and anti-other growth factor receptor tyrosine kinase of novelization.
The method for preparing single-chain antibody also is known in this area.Some suitable examples comprise that Wels etc. is at European patent 502 812 and Int.J.Cancer
60, the method for having described among the 137-144 (1995).
Other method for preparing foregoing function equivalent: PCT application WO 93/21319 is disclosed in following patent, european patent application 239 400, PCT applies for WO 89/09622, european patent application 338 745, United States Patent (USP) 5,658,570, United States Patent (USP) 5,693,780 and European patent application EP 332 424.
Preferred EGFR antibody is chimericization, humanized single-chain antibody, derives from one and is 255 murine antibody, and this antibody is at United States Patent (USP) 4,943, description in 533.This patent transfers the University of California, and is the franchise of ImClone Systems Incorporated company.
The growth of the tumor cell that the EGFR/HER1 of 255 antibody capables inhibition isolated culture expresses also can suppress the growth of the tumor cell of the heteroplastic transplantation EGPR/HER1 that live body is cultivated in athymism Mus expression.Referring to Cancer Res. such as Masui
44, 5592-5598 (1986).A more up-to-date therapeutic advance is, 255 with doxorubicin or cisplatin associating, the treatment of several people's heteroplastic transplantation model of having set up in mice is shown synergism.J.Natl.Cancer Inst. such as Basalga
85, 1327-1333 (1993).
In one embodiment of the invention, the patient who suffers from intractable incidence squamous cytoma, with the antagonist of a kind of EGFR/HER1 (chimeric anti-EGFR monoclonal antibodies, C255) and cisplatin unite and treat, the EGFR/HER1 antagonist has suppressed the intractable growth of tumor.Yet only with radiotherapy, only all failed with chemotherapy or radiation and these patients of chemotherapy therapeutic alliance.
Derive from murine antibody 225 chimericization, humanized single-chain antibody can use 255 Antibody Preparation, it can obtain from ATCC.Another kind method prepares different fragments chimericization, humanized strand 255 antibody, is at Int.J.Cancer according to Wels etc.
60, the sequence that is provided among the 137-144 (1995) is synthesized.225 antibody (c225) of chimericization can prepare according to method described above.Humanized 225 antibody can prepare according to the PCT method described in WO 96/40201 embodiment 4 of applying for, are hereby incorporated by.Strand 225 antibody (Fv225) can be according to Wels etc. at Int.J.Cancer
60, method described in the 137-144 (1995) and the method described in the european patent application 502 812 prepare.
Light chain and heavy chain hypermutation (CDR) region sequence duplicate as follows.Aminoacid sequence is below nucleotide sequence.
Heavy chain hypervariable region (VH):
AACTATGGTGTACAC(SEQ ID 1)
N Y G V H(SEQ ID 2)
CDR2
GTGATATGGAGTGGTGGAAACACAGACTATAATACACCTTTCACATCC
(SEQ ID 3)
V I W S G G N T D Y N T P F T S(SEQ ID 4)
CDR3
GCCCTCACCTACTATGATTACGAGTTTGCTTAC(SEQ ID 5)
A L T Y Y D Y E F A Y(SEQ ID 6)
Light chain hypervariable region (VL)
CDR1
AGGGCCAGTCAGAGTATTGGCACAAACATACAC(SEQ ID 7)
R A S Q S I G T N I H(SEQ ID 8)
CDR2
GCTTCTGAGTCTATCTCT(SEQ ID 9)
A S E S I S(SEQ ID 10)
CDR3
CAACAAAATAATAACTGGCCAACCACG(SEQ ID 11)
Q Q N N N W P T T(SEQ ID 12)
Except the biomolecule that discussed the front, useful in the present invention antagonist also can be a micromolecule.In this manual, not that any molecule of biomolecule is considered to micromolecule.Some micromolecular examples include organic compounds, organo-metallic compound, organic and organo-metallic compound salt, sugar, aminoacid and nucleotide.Micromolecule further comprises, except their molecular weight is not more than 450, also is considered to the molecule of biomolecule.Micromolecule can be lipid, oligosaccharide, oligopeptide and oligonucleotide and their derivant thereof like this, and its molecule is 450 or is lower than 450.
It is emphasized that micromolecule can have any molecular weight.They only are called as micromolecule, are because they have and typically are lower than 450 molecular weight.Micromolecule comprises chemical compound and the synthetic chemical compound that occurring in nature is found.Preferably, micromolecule suppresses the growth of the intractable tumor cell of expression EGFR/HER1 tyrosine kinase.
It is effective that a lot of micromolecule are described to suppress EGFR.For instance, the United States Patent (USP) 5,656,655 of Spada etc. discloses styryl and has replaced assorted compound aromatic base, suppresses EGFR.Assorted fragrance is basis set to be to have 1 or 2 heteroatomic monocycle or have 1-4 heteroatomic 2 cycle compounds, and this chemical compound is optionally substituted or is polysubstituted.Be disclosed in United States Patent (USP) 5,656,655 chemical compound is hereby incorporated by.
Spada etc. are at United States Patent (USP) 5,646, and the assorted aromatic radical, carbocyclic ring and the assorted carbocyclic compound that disclose two monocycles and/or bicyclo-aromatic radical in 153 suppress EGFR.Be disclosed in United States Patent (USP) 5,646,153 chemical compound is hereby incorporated by.
Bridges etc. are at United States Patent (USP) 5,679, and disclosing the tricyclic pyrimidine chemical compound in 683 suppresses EGFR.From the 3rd hurdle 35 row to the 5th hurdle 6 line descriptions the condensed hetero ring pyrimidine derivatives.The description of these chemical compounds is hereby incorporated by.
Barker is at United States Patent (USP) 5,616, discloses quinazoline derivant in 582 and had the activity that receptor tyrosine kinase suppresses.Be disclosed in United States Patent (USP) 5,616,582 chemical compound is hereby incorporated by.
Fry etc. are at Science
265, a kind of chemical compound that suppresses the EGFR structure that has is disclosed among the 1093-1095 (1994).Its structure is shown in Figure 1, and this chemical compound is hereby incorporated by.
Osherov etc. disclose tyrphostin and have suppressed EGFR/HER1 and HER2.Disclosed chemical compound in people's such as Osherov paper, particularly the chemical compound in table 1, table 2, table 3 and table 4 is hereby incorporated by.
Levitzki etc. are at United States Patent (USP) 5,196, and 446 disclose assorted aromatic radical ethylene alkynes or assorted aromatic radical ethylene alkynes fragrant based compound inhibition EGFR.These chemical compounds are disclosed in United States Patent (USP) 5,196, and 446 the 2nd hurdle 42 row are hereby incorporated by to the 3rd hurdle 40 row.
Panek etc. are at Journal of Pharmacology and ExperimentalTherapeutics
283, the chemical compound of a kind of PD166285 of being accredited as is disclosed among the 1133-1444 (1997), its suppresses EGFR, PDGFR and FGFR receptor family.It is that ((2,3-d) pyrimidin-7-ones has the structure shown in Fig. 1 to 4-(2-diethylamino ethoxy) phenylamino-8-methyl-8 hydrogen-pyridine to 6-(2, the 6-Dichlorobenzene base)-2-, and Fig. 1 is at 1436 pages that PD166285 is decided to be.Chemical compound at Fig. 1 shown in 1436 pages of papers such as Panek is hereby incorporated by.
The administration of EGFR/HER1 antagonist
The present invention includes EGFR/HER1 antagonist to patient's administration effective dose.Can use diverse ways administration EGFR/HER1 antagonist, comprise the non-intestinal and the intestinal approach of system.For instance, by intravenously administrable (as intravenous injection), this is preferred route of administration to EGFR/HER1 antagonist of the present invention easily.During intravenously administrable, can be such according to what those skilled in the art understood, EGFR/HER1 antagonist and a kind of suitable medicine carrier (carrier) or excipient are combined.The EGFR/HER1 antagonist can also be by with the accessory drugs administration, for instance, and such as DCG, immune system stimulant and chemotherapeutant.
If the EGFR/HER1 antagonist is micromolecule or biological medicine, can be by Spada at United States Patent (USP) 5,646, the description that 153 the 57th hurdle 47 walks in the 59th hurdle 67 row comes administration.The micromolecular description of administration is hereby incorporated by.
EGFR/HER1 antagonist of the present invention when measuring administration by effective agent to patient, has suppressed the growth of intractable tumor cell significantly.During administration, effective dose is meant that this dosage can effectively reach the particular result that suppresses the intractable tumor growth.
Preferably, the dosage of EGFR/HER1 antagonist is to suppress tumor growth and the growth of normal structure is not had interferential dosage.Most preferably, the dosage of EGFR/HER1 antagonist is to suppress tumor growth and do not have serious adverse.Some serious adverse comprise bone marrow depression, anemia and infection.
If the EGFR/HER1 antagonist is the function equivalent of antibody and antibody, its optimal dose is determined according to several factors by the doctor, for instance, these factors comprise the strict degree of age, sex, body weight, administration condition, the antibody of administration and the method for administration thereof.Usually, get the serum-concentration that can make saturated polypeptide of target receptor and antibody.For instance, under normal circumstances, it is just enough surpassing about 0.1nM concentration.Again for instance, the dosage of C225 is 100mg/m
2The time, the serum-concentration of about 20nM was kept about 8 days.
Act on a kind of conventional principle, the dosage of antibody can be weekly 10-300mg/m
2If with the antibody fragment of same dose, should be with more frequent number of times administration, so that keep serum levels to be in excess in the concentration of hold-up.
Therapeutic alliance
In a preferred embodiment, the EGFR/HER1 antagonist of effective dose and chemotherapeutant, radiation associating or with the compositions therapeutic alliance intractable tumor of chemotherapeutant and radiation.
Chemotherapeutant or chemotherapeutical example comprise alkylating agent, and for example nitrogen mustard, ethylenimine compound, alkylsulfonate reach other and have the chemical compound of alkanisation, for example nitroso ureas, cisplatin and dacarbazine; Antimetabolite, for example antagonist of folic acid, purine or pyrimidine; Mitotic inhibitor, for example derivant of vincaleucoblastine, podophyllotoxin (podophyllotoxin); Cytotoxic antibiotic and camptothecin derivative.
For instance, camptothecin derivative comprises camptothecine, 7-ethyl-camptothecine, 10-hydroxyl-7-ethyl-camptothecine (SN38), 9-aminocamptothecin, 10, and 11-methylene dioxygen-camptothecine (MDCPT) and Top are for health (topotecan).This class camptothecin derivative also comprises the lactone stabilizer of 7-ethyl-camptothecine, and this dosage form is at United States Patent (USP) 5,604, and open in 233, whole disclosure is hereby incorporated by.
The present invention includes highly lipophilic camptothecin derivatives, for instance, such as 10,11-methylene dioxygen-camptothecine, 9-ethyl-camptothecine, 7-ethyl-10-hydroxyl-camptothecine, 9-methyl-camptothecine, 9-chloro-10,11-methylene dioxygen-camptothecine, 9-chlorine camptothecine, 10-hydroxyl-camptothecine, 9,10-dichloro camptothecine, 10-bromo-camptothecine, 10-chloro-camptothecine, 9-fluoro-camptothecine, 10-methyl-camptothecine, 10-fluoro-camptothecine, 9-methoxyl group-camptothecine, 9-chloro-7-ethyl-camptothecine and 11-fluoro-camptothecine.This class highly lipophilic camptothecin derivatives is at United States Patent (USP) 6,880, and open in 133, whole disclosure is hereby incorporated by.
Water soluble camptothecin derivatives, for instance, comprise water soluble camptothecin analogs, known have: CPT-11,11-hydroxyl-7-alkoxyl-camptothecine, 11-hydroxyl-7-methoxycamptothecine (11,7-HMCPT) with 11-hydroxyl-7-ethyl-camptothecin (11,7-HECPT), 7-dimethylaminomethylene-10,11-methylene dioxygen-20 (R, S)-camptothecine, 7-dimethylaminomethylene-10,11-methylene dioxygen-20 (S)-camptothecine, 7-dimethylaminomethylene-10,11-ethylidine dioxygen-20 (R, S)-camptothecine and 7-morpholino methylene-10,11-ethylidine dioxygen-20 (S)-camptothecine.These water soluble camptothecin derivatives are at United States Patent (USP) 5,559, and open in 235 and 5,468,754, whole disclosure is hereby incorporated by.
Preferred chemotherapeutant or chemotherapy comprise amifostine (ethyol), cisplatin, dacarbazine (DTIC), actinomycin D, chlormethine (nitrogen mustard), chain is estimated, cyclophosphamide, Carmustine (BCNU), Luo Mosiding (CCNU), doxorubicin (adriamycin), doxorubicin fat (doxil), gemcitabine (gemzar), daunorubicin, daunorubicin fat (daunoxome), the third kappa trap, mitomycin, cytarabine, etoposide, methotrexate, 5-fluorouracil, vincaleucoblastine, vincristine, bleomycin, paclitaxel (taxol), many Xi Takesaier (taxotere), aldesleukin, asparaginase, busulfan, carboplatin, cladribine, camptothecine, CPT-11,10-hydroxyl-7-ethyl-camptothecine (SN38), dacarbazine, floxuridine, fludarabine, hydroxyurea, ifosfamide, idarubicin, mesna, interferon-alpha, interferon-, irinotecan, rice holder anthrone, Top is for health, sharp get (leuprurolide) of bright dried meat, megestrol, melphalan, purinethol, plicamycin, mitotane, pegaspargase, pentostatin, group's pool bromine alkane, plicamycin, chain left side star, tamoxifen, teniposide, testolactone, thioguanine, plug is for group, uracil mustard, vinorelbine, chlorambucil and compositions thereof.
The method that multiple administration chemotherapeutant is arranged, comprise whole body through intestinal and non-through the intestinal approach.Preferably, the administration of chemotherapeutant is by intravenously administrable, can be such according to what those skilled in the art understood, chemotherapeutant and a kind of suitable medicine carrier (carrier) or excipient are combined.The dosage of chemotherapeutant depends on a lot of factors well known in the art, as the strict degree of age, sex, body weight, administration condition, the medicine of administration and the method for administration.Usually, get the serum-concentration that can make saturated polypeptide of target receptor and antibody.For instance, cisplatin can conveniently be pressed about 100mg/m
2Dosed administration.Yet, should be emphasized that any without limits specific dosage of the present invention.
In another embodiment, the EGFR/HER1 antagonist of effective dose and radiation associating, treatment intractable tumor.For patient, radioactive source can be outside, also can be inner.When radioactive source externally the time, treatment is called as outer ray irradiation and treats (EBRT).When radioactive source during in inside, treatment is called brachytherapy (BT).
Carry out radiotherapy according to standard technique of knowing and the reference instrument made for this purpose, for example AECL Theratron and Varian Clinac.Radiological dose depends on a lot of factors well known in the art.This class factor comprises the organ of treatment, and the healthy organ on the treatment path may by mistake be adversely affected, and patient is to radiocurable patience and the body region that needs treatment.Typical dosage is 1-100Gy, more particularly 2-80Gy.Some dosage of having reported comprise with 35Gy treats spinal cord, treats kidney, 20Gy treatment liver and 60-80Gy treatment prostate with 15Gy.Yet, should be emphasized that any without limits specific dosage of the present invention.Dosage will according to specific factor, comprise foregoing factor and determine by the treatment doctor under a given condition.
The distance that outer radioactive source and ray enter between patient's the target spot can be arbitrarily, and its expression can be killed target cell, and side effect is minimized, and is a kind of acceptable balance between these two.Typically, outer radioactive source and ray enter distance between patient's the target spot between 70-100cm.
Usually carrying out brachytherapy in the radioactive source implant patient body.Typically, radioactive source is placed on apart from the about 0-3cm of the tissue place of being treated.Known technology comprises between a matter, chamber and surperficial brachytherapy.Radioactive source can be permanent or provisional implantation.Some typical permanent implanted radioactive atoms comprise iodine-125 and radon.The radioactive atom of some typical provisional implantation comprises radium, caesium-137 and iridium-129.Some other radioactive atom that is applied to brachytherapy comprises americium-241 and gold-198.
The radiological dose of brachytherapy can be and the identical dosage of foregoing outer ray irradiation treatment.When determining the dosage of brachytherapy, except the factor that influences radiotherapy dosage noted earlier, also to consider the character of used radioactive atom.
In a preferred embodiment, EGFR/HER1 antagonist and chemotherapeutant or with the two associating of radiation or three's associating, patient's intractable tumor treatment is shown synergism.In other words, when uniting use, strengthened the inhibitory action of EGFR/HER1 antagonist to tumor growth with chemotherapeutant or with radiation or with chemotherapeutant and radiation.For instance, therapeutic alliance demonstrates synergism, and the intractable growth of tumor is bigger than using EGFR/HER1 antagonist, chemotherapeutant or radiation to suppress effect separately.Preferably, when using EGFR/HER1 antagonist, chemotherapeutant or radiotherapy separately, cancer does not obtain the alleviation expected, but when therapeutic alliance, synergism is eased cancer.
The EGFR/HER1 antagonist can before beginning chemotherapeutant or the radiotherapy during or administration afterwards, it also can be its combination in any, promptly before beginning chemotherapeutant and/or the radiotherapy and administration during the treatment, or before beginning chemotherapeutant and/or the radiotherapy and administration after the treatment, or during beginning chemotherapeutant and/or the radiotherapy and administration after the treatment, or begin with before chemotherapeutant and/or the radiotherapy, during the treatment and administration after the treatment.For instance, when the EGFR/HER1 antagonist is a kind of antibody, typically in administration between 1-30 days before beginning radiotherapy and/or the chemotherapeutant treatment, preferably administration between 3-20 days, more preferably administration between 5-12 days.
Embodiment 1. clinical trials
In clinical trial, (chimeric anti-EGFR monoclonal antibodies C225) unites the patient who suffers from the intractable squamous cell carcinoma of the head and neck is treated with cisplatin with the EGFR/HER1 antagonist.Be respectively 100/100,400/250 or 500/250mg/m by the dosage of load/maintenance
2Give patient infusion C225 weekly, simultaneously per 3 weeks are given patient 100mg/m
2Cisplatin.24 hours and preceding 24 hours of infusion for the third time behind baseline, first infusion are gathered tumor sample respectively, estimate tumor EGFR saturation and function.When immunohistochemistry (IHC) is estimated tumor EGFR saturation, detect not combined EGFR as first antibody and mouse-anti IgG as second antibody with M225 (the Mus homologue of C225).When IHC estimated the EGFR function, using had specific antibody to activated EGFR (transduction laboratory), after removing the C225-EGFR complex, and EGFR tyrosine kinase activity in the lysate of mensuration tumor.The result observes the receptor saturation and presents the dose dependent increase, at 500/250mg/m
2On the dosage level, there is receptor saturated greater than 70%.Similarly, at 100/100mg/m
2Dosage the time, observe the EGFR tyrosine kinase activity and significantly descend, 67% patient does not detect activity, the hint function saturation.Side effect is fever, allergy and dermal toxicity, the change of vesicle capsule rash and nail matrix (nail bed) occurs, but is stopping treatment these symptom complete obiterations of back.In 7 valuable patients, physical examination and analysis data show that one of them reacts minimum, 5 partial reactions, 1 complete reaction.This patient of complete reaction cisplatin that has been first administration.Among the patient of 5 partial reactions, 4 have been carried out chemotherapy earlier, and 1 has been carried out radiotherapy earlier.This minimum patient of reaction has carried out radiotherapy earlier.The result is as shown in table 1, and wherein CR represents complete reaction, and PR represents partial reaction, and MR represents minimal reaction.
Table 1
Clinical trial
Patient | The treatment pre-treatment | Combined reaction |
1 | Cisplatin | CR |
2 | Ad p53 | PR |
3 | Cisplatin | PR |
4 | Cisplatin | PR |
5 | Radiotherapy only | PR |
6 | Chemotherapy | PR |
7 | Radiotherapy only | MR |
Embodiment 2. clinical trials
In clinical trial, (chimeric anti-EGFR monoclonal antibodies C225) unites the patient who suffers from the intractable colon cancer is treated with CPT-11 with the EGFR/HER1 antagonist.Combination C225 by load dosage is 400mg/m
2With CPT-11 be 125mg/m
2Give patient infusion weekly.Keeping the combination C225 of dosage is 250mg/m
2With CPT-11 be 69-125mg/m
2, with a week be basic infusion.Impartially, patient shows complete reaction.Dose form is summarized in the following table 2.
Table 2 clinical trial
The C225/CPT weekly dose, mg/m 2 | The C225/CPT-11 actual dose, mg | The C225 infusion time (minute) | The CPT-11 infusion time (minute) |
400/125 | 576/180 | 120 | 90 |
250/125 | 360/180 | 60 | 90 |
250/CPT-11 keeps | 360/0 | 60 | N/A |
250/94 | 360/135 | 50 | 75 |
250/69 | 360/100 | 60 | 85 |
250/69 | 360/100 | 60 | 75 |
Claims (4)
1. the EGF-R ELISA of effective dose (EGFR) antagonist is applied to the people with the purposes in the medicine that suppresses the intractable tumor growth in preparation, and this intractable tumor can not be treated or described treatment is had resistance in described people with antitumor agent.
2. the preparation that is combined in of the EGFR antagonist of effective dose and chemotherapeutant is applied to the people with the purposes in the medicine that suppresses the intractable tumor growth, and this intractable tumor can not be treated or described treatment is had resistance in described people with antitumor agent.
3. the preparation that is combined in of the EGFR antagonist of effective dose and radiation is applied to the people with the purposes in the medicine that suppresses the intractable tumor growth, and this intractable tumor can not be treated or described treatment is had resistance in described people with antitumor agent.
4. each purposes of claim 1-3, wherein the EGFR antagonist comprises little organic molecule.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US31228499A | 1999-05-14 | 1999-05-14 | |
US09/312284 | 1999-05-14 | ||
US09/374028 | 1999-08-13 |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNB008103216A Division CN1200734C (en) | 1999-05-14 | 2000-05-01 | Treatment of refractory human tumors with epidermal growth factor receptor antagonists |
Publications (1)
Publication Number | Publication Date |
---|---|
CN1720994A true CN1720994A (en) | 2006-01-18 |
Family
ID=27804923
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 200510055865 Pending CN1720994A (en) | 1999-05-14 | 2000-05-01 | Treatment of refractory human tumors with epidermal growth factor receptor antagonists |
Country Status (2)
Country | Link |
---|---|
CN (1) | CN1720994A (en) |
ZA (1) | ZA200109347B (en) |
-
2000
- 2000-05-01 CN CN 200510055865 patent/CN1720994A/en active Pending
-
2001
- 2001-11-13 ZA ZA200109347A patent/ZA200109347B/en unknown
Also Published As
Publication number | Publication date |
---|---|
ZA200109347B (en) | 2003-04-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1200734C (en) | Treatment of refractory human tumors with epidermal growth factor receptor antagonists | |
CN1314917A (en) | Treatment of human tumors with radiation and inhibitors of growth factor receptor tyrosine kinase | |
CN104080809B (en) | Anti-cd134 (ox40) antibodies and uses thereof | |
CN1239701C (en) | Humanised antibodies to epidermal growth factor receptor | |
CN101365486B (en) | Combination therapy using anti-EGFR and anti-HER2 antibodies | |
US20090297509A1 (en) | Treatment of human tumors with radiation and inhibitors of growth factor receptor tyrosine kinases | |
CN109983121A (en) | The pseudotyping oncolytic virus of therapeutical peptide delivers | |
CN104105708A (en) | Pdgf receptor beta binding polypeptides | |
CN1639194A (en) | Antibodies against cancer | |
US20030202973A1 (en) | Treatment of refractory human tumors with epidermal growth factor receptor and HER1 mitogenic ligand (EGFRML) antagonists | |
JP2010504743A5 (en) | ||
CN109265547A (en) | A kind of anti-cd 47 antibody and its application | |
CN1445242A (en) | Human resourced monoclone antibody of anti-blood-vessel endothelium growth factor as well as its preparing method and medicine composition | |
CN113980133B (en) | Antibody and application thereof in anti-tumor | |
CN1720994A (en) | Treatment of refractory human tumors with epidermal growth factor receptor antagonists | |
CN1124284C (en) | High-effective broad-spectrum antibody for inhibiting growth and metastasis of tumour | |
CN113956359A (en) | Antibody and application thereof in anti-tumor | |
CN116514966A (en) | anti-DKK 1 antibody, pharmaceutical composition and application thereof | |
AU2004200705A1 (en) | Treatment of human tumors with radiation and inhibitors of growth factor receptor tyrosine kinases | |
CN103492419A (en) | Binding molecules capable of neutralizing the rabies virus, and uses thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20060118 |