CN1720336A - Use of A33 antigens and JAM-IT - Google Patents

Use of A33 antigens and JAM-IT Download PDF

Info

Publication number
CN1720336A
CN1720336A CN 200380105090 CN200380105090A CN1720336A CN 1720336 A CN1720336 A CN 1720336A CN 200380105090 CN200380105090 CN 200380105090 CN 200380105090 A CN200380105090 A CN 200380105090A CN 1720336 A CN1720336 A CN 1720336A
Authority
CN
China
Prior art keywords
antibody
polypeptide
cell
sequence
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 200380105090
Other languages
Chinese (zh)
Inventor
阿维·J·阿什克纳齐
舍曼·方
奥德丽·戈达德
奥斯汀·L·格尼
玛丽·A·内皮尔
丹尼尔·塔马斯
门诺·范洛克伦
威廉·I·伍德
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genentech Inc
Original Assignee
Genentech Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US10/265,542 external-priority patent/US20030171568A1/en
Application filed by Genentech Inc filed Critical Genentech Inc
Publication of CN1720336A publication Critical patent/CN1720336A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/566—Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/564—Immunoassay; Biospecific binding assay; Materials therefor for pre-existing immune complex or autoimmune disease, i.e. systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, rheumatoid factors or complement components C1-C9
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G01N33/57492—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving compounds localized on the membrane of tumor or cancer cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/06—Gastro-intestinal diseases
    • G01N2800/065—Bowel diseases, e.g. Crohn, ulcerative colitis, IBS
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/10—Musculoskeletal or connective tissue disorders
    • G01N2800/101—Diffuse connective tissue disease, e.g. Sjögren, Wegener's granulomatosis
    • G01N2800/102—Arthritis; Rheumatoid arthritis, i.e. inflammation of peripheral joints
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/12—Pulmonary diseases
    • G01N2800/122—Chronic or obstructive airway disorders, e.g. asthma COPD
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/12—Pulmonary diseases
    • G01N2800/127—Bronchitis
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/24—Immunology or allergic disorders

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Oncology (AREA)
  • Biophysics (AREA)
  • Hospice & Palliative Care (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Rehabilitation Therapy (AREA)
  • Rheumatology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The present invention relates to compositions and methods of treating and diagnosing disorders characterized the by the presence of antigens associated with inflammatory diseases and/or cancer.

Description

The purposes of A33 antigen and JAM-IT
Background of invention
Technical field
The present invention relates generally to new DNA of evaluation, separation and reorganization preparation and new polypeptide, the existence of described DNA or polypeptide is associated with inflammatory diseases (inflammation related antigen) and/or cancer, and the invention still further relates to diagnosis and treating with described antigen is the composition and the method for the disease of feature.
Description of related art
Inflammatory response is complicated, it by mastocyte, nerve ending, thrombocyte, white corpuscle and complement activation the local various signals that produce transmit numerator mediated.These signals transmit have in molecules some cause endotheliocyte liner (lining) become more porous and/or even express the selection of working as cell surface molecule, these cell surface molecules are by the recognition reaction identification of specificity sugar and attract white corpuscle.Stronger white corpuscle combination is by 6 integrin-mediated, and endothelium is also passed in this protein mediated white corpuscle motion.Other has signal transmission molecule to play chemotactic attractant (chemoattractant), causes institute's bonded white corpuscle slowly to advance to the source of this attractant.Other signal that produces in the inflammatory response process transmits molecule and enters blood, and stimulation marrow produces more white corpuscle and they is discharged in the blood flow.
Inflammation is caused by antigen that usually described antigen can be in fact any molecule that can start immunne response.Under the normal physiological situation, these antigens are exogenous molecules, but also can be used as the perpetrator by the biological molecule that self produces, just as known taking place in the multiple disease.
Mixed lymphocytes cultivate or mixed leucocyte reaction (MLR) in T-cell proliferation can clear and definite indication compound stimulating immune system ability.In inflammatory response, the white corpuscle of replying can be neutrophil leucocyte, eosinophilic granulocyte, monocyte or lymphocyte.Histological examination to the tissue of getting involved can provide the evidence that immunostimulating is replied or inhibitive ability of immunity is replied.Referring to CurrentProtocols in Immunology, ed.John E.Coligan, 1994, John Wiley and Sons, Inc.
Inflammatory bowel disease (IBD) is the general designation of intestinal tract disease, comprise ulcerative enteritis (UC) and clo engler disease (Crohn ' s disease), these two kinds sick by the different disease in differentiation position, but they have the common characteristic, and have common pathology characteristic probably.The general character of Case definition makes and is difficult to accurately judge that the patient suffers from any disease in these two kinds of diseases on earth; But the type of the damage of each is normally different with the location in these two kinds of diseases.The characteristics of UC damage are the shallow table ulcer of mucous membrane, and it appears near in the colon position of rectum.The characteristics of CD damage are large-scale linear crack (extensivelinear fissures), and it can appear at any position of large intestine, involves stomach, oesophagus and duodenum once in a while.
The traditional treatment of IBD generally comprised use anti-inflammatory agent or immunosuppressor, such as sulfasalazine (sulfasalazine), reflunomide (corticosteroid), Ismipur (mercaptopurine)/azathioprine (azathoprine), or ciclosporin (cyclosporine), all these only can make haunted patient obtain the part alleviation.And when anti-inflammatory/immunosuppressant therapy was failed, one's last shift was exactly colectomy (colectomies).Have 30% CD patient just need undergo surgery in back 1 year in diagnosis approximately, the after this annual ratio that needs to perform the operation increases about 5%.Unfortunately, CD also has high relapse rate, and about 5% patient also needed to accept follow-up operation after 1 year.UC patient except above-mentioned unfavorable, the risk that colorectal cancer takes place also increases greatly.Supposing that this is because repeatedly wheel of epidermis damaged more, is regrowth then, and this constantly increases the danger of tumorigenesis conversion.
Immunoglobulin superfamily a member of recent findings: the connection adhesion molecule ( JUnctional ADhesion MOlecule JAM) has been accredited as and the endotheliocyte of different sources can be connected selectivity with epithelial iuntercellular and concentrates.Martin-Padura，I.et al.，J.Cell Biol. 142(1)：117-27(1998)。JAM is an I type embrane-associated protein, has that two born of the same parents are outer, V-type two sulphur rings in the chain.JAM and A33 antigen height homology (Fig. 1 or Figure 18).Found that anti-JAM monoclonal antibody carries out the migration of spontaneous chemokine induction type and pass through monolayer endothelial cell at the vitro inhibition monocyte.Martin-Padura, document is the same.Recent findings, JAM be expressed in the CRF2-4-that suffers from colitis/-increase in the colon of mouse.CRF 2-4-/-idiopathic colitis by lymphocyte, monocyte and neutrophil leucocyte mediation takes place in (mouse is pounded out by IL-10R subunit).Adenocarcinoma of colon also takes place in a plurality of animals.The result is, very possible polypeptide described herein expression level in such as human diseasess such as other inflammatory diseases of inflammatory bowel disease, enteron aisle and knot rectal adenocarcinomas raises, and perhaps it is expressed and these disease-relateds.
JAM and polypeptide described herein and known colorectal cancer mark of correlation thing A33 antigen have remarkable homology.A33 antigen is expressed in the primary more than 90% or transitivity colorectal carcinoma and normal colonic epithelium.In starting from the cancer of mucous membrane of colon, the case more than 95% has the antigenic even expression of A33 (expressed homogeneously).But A33 antigen fails extensively detecting in multiple other healthy tissues, i.e. organ specificity is tended in its expression.Therefore, A33 antigen may play an important role in the inducing of colorectal cancer.
Colorectal carcinoma is the disease of wide-scale distribution, therefore diagnoses as early as possible and treat to have important medical meaning.The diagnosis of colorectal carcinoma and treatment can be carried out with the monoclonal antibody specific that has fluorescence labels, nuclear-magnetism label or radioactive labels (mAbs).The mAbs of radioactivity gene, toxin and/or medicine institute mark can be used for carrying out original position (in situ) treatment under the situation that lacks patient's description.MAbs also can be used for diagnosing during diagnosis and treatment colorectal carcinoma.For example, when patient's serum A33 antigen levels raises but this level of postoperative when reducing, the expression tumorectomy is successful.On the other hand, postoperative serum A33 antigen levels raises, and represents that then original tumour may form metastasis or new primary tumor occur.
This class monoclonal antibody can be used for lieu of surgery and/or other chemotherapy, perhaps with they associatings.For example, with the mAb of anti-A33 colorectal cancer patients is carried out preceding clinical analysis (preclinicalanalysis) and Position Research can be referring to Welt et al., J.Clin.Oncol. 8: 1894-1906 (1990) and Welt et al., J.Clin.Oncol. 12: 1561-1571 (1994), and U.S.P.4,579,827 and U.S.S.N.424,991 (E.P.199,141) then relate to the therapeutic administration monoclonal antibody, and the latter relates to and uses anti--A33 mAb.
Summary of the invention
The immune correlated disease that one aspect of the invention is chiefly directed to diagnosis and treatment Mammals (comprising the people) useful composition and method when (comprising inflammatory diseases).The present invention is the evaluation that is based in part on the compound (comprising polypeptide and antibody) that the participation mammalian immune is replied.
One aspect of the invention relates to the method for the treatment of inflammation in mammals, comprises the anti-native sequences STIgMA to this administration significant quantity, PRO301, the antagonist of PRO362 or PRO245 polypeptide.
In one embodiment, the STIgMA polypeptide is selected from SEQ ID NOS:2, polypeptide shown in 32,33 and 34.The PRO301 polypeptide comprises sequence SEQ ID NO:1.The PRO362 polypeptide comprises sequence SEQID NO:2.The PRO245 polypeptide comprises sequence SEQ ID NO:9.
In another embodiment, described antagonist is an antibody, and as monoclonal antibody, it can have non--people's complementary determining region (CDR) residue and comprise people's framework region (FR) residue.Described monoclonal antibody can be the composition with pharmaceutically acceptable carrier or mixed with excipients.
In another embodiment, described antagonist is an immunoadhesin, and it comprises STIgMA, PRO301, PRO362 or the PRO245 polypeptide extracellular region sequence that merges with the constant region for immunoglobulin sequence.
In another embodiment, described inflammatory diseases is selected from: inflammatory bowel disease (inflammatory boweldisease); Systemic lupus erythematous (systemic lupus erythematosus); Rheumatoid arthritis (rheumatoid arthritis); Adolescency chronic arthritis (juvenile chronic arthritis); Vertebral arthropathy (spondyloarthropathy); Systemic sclerosis (Systemic sclerosis), for example, scleroderma (scleroderma); The spy for example sends out property inflammation myopathy (idiopathic inflammatory myopathy), dermatomyositis (dermatomyositis), polymyositis (polymyositis); (Sj gren ' ssyndrome) for sjogren syndrome; Systemic vasculitis (systemic vasculitis); Sarcoidosis (sarcoidosis); Autoimmune hemolytic anemia (autoimmune hemolytic anemia) for example, immune pancytopenia (immune pancytopenia), paroxysmal nocturnal hemoglobinuria (paroxysmal nocturalhemoglobinuria); AT (autoimmune thrombocytopenia), for example, idiopathic thrombocytopenic purpura (idiopathic thrombocytopenic purpura), immune-mediated thrombocytopenia (immune-mediated thrombocytopenia); Thyroiditis (thyroiditis), for example, Graves disease (Grave ' s disease), struma lymphomatosa (Hashimoto ' s thyroiditis), adolescency lymphocytic thyroiditis (juvenile lymphocyticthyroiditis), atrophic thyroiditis (atrophic thyroiditis); Diabetes (diabetes mellitus), immune-mediated ephrosis (immune-mediated renal disease), for example, glomerulonephritis (glomerulonephritis), uriniferous tubules interstitial nephritis (tubulointerstitial nephritis); The demyelination of maincenter and peripheral nervous system (demyelinating diseases of the central andperipheral nervous systems) is such as multiple sclerosis (multiple sclerosis), spontaneous polyneuropathy (idiopathic polyneuropathy); Hepatic duct disease (hepatobiliary diseases) such as infectious hepatitis (infectious hepatitis) (having a liking for the hepatitis that liver venereal disease poison (other nonhepatotropic viruses) causes) as first type, B-mode, third type, fourth type and hepatitis E and other are non-; ACAH (autoimmune chronic active hepatitis); Primary biliary cirrhosis (primarybiliary cirrhosis); Granulomatous hepatitis (granulomatous hepatitis); And sclerosing cholangitis (sclerosing cholangitis); Inflammatory and fibrotic lung disease (inflammatory and fibrotic lungdiseases) (for example, cystic fibrosis (cystic fibrosis)); Seitan-susceptibility enteropathy (gluten-sensitive enteropathy); Whipple's disease (Whipple ' s disease); The tetter of autoimmunization or immunity-mediation (autoimmune or immune-mediated skin diseases) comprises bleb dermatosis (bullous skin diseases), erythema multiforme (erythema multiforme) and contact dermatitis (contact dermatitis), psoriasis (psoriasis); Lung's anaphylactic disease (allergic diseases ofthe lung) is such as eosinophilic granulocyte pneumonia (eosinophilic pneumonia), the special property sent out lung fibrosis (idiopathic pulmonary fibrosis) and hypersensitivity pneumonia (hypersensitivity pneumonitis) are transplanted diseases related (transplantation associated diseases) and are comprised transplant rejection (graftrejection) and graft versus host disease (graft-versus host disease).
The present invention provides the method for inflammatory diseases in the treatment Mammals on the other hand, comprises the PRO362 antagonist of administering therapeutic significant quantity.Described inflammatory diseases is preferably selected from rheumatoid arthritis, inflammatory bowel disease, chronic hepatitis (chronic hepatitis), pneumonia (pneumonia), chronic asthma (chronicasthma) and bronchitis (bronchitis).
The present invention provides a kind of method for the treatment of the Mammals inflammatory diseases on the other hand, comprises the PRO245 antagonist of administering therapeutic significant quantity.Described inflammatory diseases is preferably selected from pneumonia, psoriasis, ephritis (nephritis), ecphyaditis (appendicitis) and arteriosclerosis (artherosclerosis).
The present invention relates to the method for diagnosing mammiferous inflammatory diseases on the other hand, described method comprises the specimen of the cell that detection (a) obtains from described Mammals and (b) in the known Normocellular control sample of same cell type, coding STIgMA, PRO310, the expression of gene level of PRO362 or PRO245 polypeptide, the expression level of wherein said gene in specimen is higher than the expression level in control sample, has immune correlated disease in the Mammals of the described test organization cell of expression acquisition.
The present invention relates to the method for diagnosing mammiferous inflammatory diseases on the other hand, described method comprises that (a) will resist-STIgMA, anti--PRO301, anti--PRO362 or anti--PRO245 antibody contact with specimen available from described mammiferous cell, and (b) detect STIgMA in described antibody and the specimen, PRO301, the formation of the mixture of PRO362 or PRO245 polypeptide, the formation of wherein said mixture are indicated in the described Mammals and are had inflammatory diseases.Antibody preferably carries the mark that can detect.The formation of mixture can be passed through, and for example, opticmicroscope microscopy, flow cytometry, fluorometry or other technology known in the art are monitored.
The present invention provides the method that detects the existence of tumour in the Mammals on the other hand, comprise the PRO301 that relatively encodes, PRO362, the gene of PRO245 or PRO1868 polypeptide is at (a) specimen and the expression level in the known Normocellular control sample of (b) same cell type available from described mammiferous cell, and the expression level in the specimen is higher than expression level in the control sample and represents to obtain to have tumour in the Mammals of described test organization cell.
The present invention provides the method for diagnosing mammiferous tumour on the other hand, anti--the PRO301 that comprises that (a) will be selected from, anti--PRO362, anti--PRO245 contacts with the specimen available from described mammiferous cell with the anti--antibody of PRO1868 antibody, and (b) detect anti--PRO301 in the specimen, anti--PRO362, anti--PRO245 or anti--PRO1868 antibody whether respectively with PRO301, PRO362, PRO245 or PRO1868 polypeptide form mixture.Forming mixture represents to have tumour in this Mammals.Antibody preferably carries the mark that can detect.The formation of mixture can be passed through, and for example, opticmicroscope microscopy, flow cytometry, fluorometry or other technology known in the art are monitored.Preferably, specimen is obtained from the Mammals that suspection has growth of tumorigenesis sexual cell or propagation (for example, cancer cells).Tumorigenesis sexual cell growth or propagation can with, for example, be selected from the disease-related of colorectal carcinoma, carcinoma of testis, lung cancer and mammary cancer.
The present invention provides the method for the treatment of disease relevant with bone and/or cartilage in the Mammals on the other hand, comprises the PRO1868 agonist to this Mammals drug treatment significant quantity.
The invention still further relates to isolating specificity in conjunction with STIgMA, PRO301, PRO362, the antibody of PRO245 or PRO1868 polypeptide.Described antibody can be, for example, antibody fragment, single-chain antibody, antiidiotypic antibody or monoclonal antibody, they can also comprise inhuman complementary determining region (CDR) residue and people's framework region (FR) residue.In one embodiment, described antibody has mark.In another embodiment, described antibody is fixed on the solid support.
In another embodiment, the invention provides composition, it comprises STIgMA, PRO301, PRO362, PRO245 or PRO1868 polypeptide or antibody and pharmaceutically acceptable carrier or vehicle.In one aspect, described composition comprises another kind of activeconstituents, for example, and another kind of antibody or cellulotoxic preparation or chemotherapeutics.
The present invention relates to isolated nucleic acid molecule on the other hand, it comprises the nucleotide sequence of coded polypeptide, shown in the amino acid 21-180 of the amino acid 21-182 of the amino acid 21-276 of described polypeptide and SEQ ID NO:32 or SEQ ID NO:33 or SEQ ID NO:34 there be at least about 80% aminoacid sequence, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 99% sequence identity.
The present invention provides isolated nucleic acid molecule on the other hand, it comprises the nucleotide sequence of coded polypeptide, and described polypeptide is selected from the amino acid 21-305 of amino acid 21-399, SEQ ID NO:33 of SEQ ID NO:32 and the amino acid 21-280 of SEQ ID NO:34.
The present invention provides isolated nucleic acid molecule on the other hand, it comprise with following dna molecular have DNA:(a at least about 80% sequence identity) dna molecular of coding PRO1868 polypeptide, described polypeptide comprises the sequence shown in the amino-acid residue 1-310 of Figure 22 (SEQ ID NO:31) or (b) complement of dna molecular (a).Sequence identity is preferably about 85%, and more preferably from about 90%, most preferably from about 95%.In one embodiment, described isolating nucleic acid comprises the DNA of coding PRO1868 polypeptide, and described polypeptide has the amino-acid residue 1-310 of Figure 22 (SEQ ID NO:31).
The present invention provides isolating nucleic acid on the other hand, and the complete encoding sequence of cDNA has at least 80% nucleotide sequence identity shown in it and the ATCC 203553.
The invention still further relates to the carrier and the cell that comprise nucleic acid of the present invention.In one embodiment, described carrier can be operated with control sequence and link to each other, and described control sequence can be by this carrier transformed host cells identification.The present invention also provides the host cell that comprises this class carrier.For example, host cell can be CHO, intestinal bacteria, the insect cell of yeast or baculovirus infection.The present invention also provides the method for preparing the PRO1868 polypeptide, is included in to cultivate described host cell under the condition that is suitable for described expression of polypeptides, and reclaims described polypeptide from cell cultures.
The present invention relates to a peptide species on the other hand, and it comprises aminoacid sequence shown in the amino acid 21-180 of the amino acid 21-182 of the amino acid 21-276 that is selected from SEQ ID NO:32 or SEQ ID NO:33 or SEQ ID NO:34.
The present invention provides isolating PRO1868 polypeptide on the other hand.Particularly, one embodiment of the invention provides isolating native sequences PRO1868, and it comprises aminoacid sequence shown in the amino-acid residue 1-310 of Figure 22 (SEQ ID NO:31).Another embodiment of the present invention relates to a kind of isolating PRO1868 polypeptide, and it comprises the amino-acid residue 1-X of Figure 22 (SEQ ID NO:31), and wherein X is any one among the amino acid 237-247.
The present invention provides isolated polypeptide on the other hand, and the coded aminoacid sequence of the complete encoding sequence of cDNA shown in it and the ATCC 203553 has at least 80% amino acid sequence identity.
The present invention provides chimeric molecule on the other hand, and it comprises the fusion of PRO1868 polypeptide and heterologous polypeptide or aminoacid sequence.In one embodiment, described chimeric molecule comprises the fusion of PRO1868 polypeptide and epi-position sequence label or immunoglobulin fc region.
The present invention relates to immunoadhesin on the other hand, and it comprises amino acid/11 or the amino acid/11 of about 21-about 182 or SEQ ID NO:34 or the fusion of about 21-about 180 and constant region for immunoglobulin of amino acid/11 or about 21-about 276 or the SEQ ID NO:33 of SEQ ID NO:32.
Isolated antibody is provided in another embodiment of the present invention, its specificity is in conjunction with being selected from down the polypeptide of organizing: isolating PRO301 polypeptide, the amino-acid residue 28-235 that comprises Fig. 2 (SEQ ID NO:1), the amino-acid residue 28-about 258 of Fig. 2 (SEQ ID NO:1), the amino-acid residue 28-299 of Fig. 2 (SEQ ID NO:1), or the amino-acid residue 1-299 of Fig. 2 (SEQ ID NO:1); Isolating PRO362 polypeptide comprises the amino-acid residue 1-321 of Fig. 3 (SEQ ID NO:2) or the amino-acid residue 1-X of Fig. 3 (SEQ ID NO:2), and wherein X is any among the amino acid 271-280; Isolating native sequences PRO1868 polypeptide comprises the amino-acid residue 1-310 of Figure 22 (SEQ ID NO:31) or the amino-acid residue 1-X of Figure 22 (SEQID NO:31), and wherein X is any among the amino acid 237-247; And isolating PRO245 polypeptide, comprise the amino-acid residue 1-312 of SEQ ID NO:9.In one embodiment, described isolated antibody specificity is in conjunction with described polypeptide or the specificity epi-position in conjunction with this polypeptide surface, but not in fact in conjunction with any other polypeptide or polypeptide epitope.In another embodiment, described antibody is monoclonal antibody, humanized antibody or single-chain antibody.
Accompanying drawing is described
Fig. 1 shows by A33 antigen (SEQ ID NO:6), DNA40628 (SEQ ID NO:1), DNA45416 (SEQ ID NO:2), the comparison of DNA35638 (SEQ ID NO:9) and JAM (SEQ ID NO:10) encoded polypeptides.
Fig. 2 shows native sequences PRO301 amino acid sequence of polypeptide (SEQ ID NO:1).This polypeptide has 299 amino acid, have the signal sequence that is positioned at residue 1-27, be positioned at the extracellular region of residue 28-about 235, be positioned at the Ig superfamily homology of residue 94-235, be positioned at the potential of residue 236-about 258 and stride the film district, and the intracellular region that is positioned at about residue 259-299.
Fig. 3 shows the Nucleotide 119-1081 institute deutero-aminoacid sequence (SEQ ID NO:2) of nucleotide sequence shown in Fig. 6 A and the 6B (DNA45416, SEQ ID NO:7).The underscore of Fig. 3 shows the position of glycosaminoglycan and strides the position in film district.
Fig. 4 A shows consensus sequence (consensus assembly) DNA35936 (SEQ ID NO:3), and Fig. 4 B shows consen01 (SEQ ID NO:4), and they all are used for DNA isolation 40628 (SEQ IDNO:11).Fig. 4 C shows consen02 (DNA42257) (SEQ ID NO:5), and it is used for DNA isolation 45416 (SEQ ID NO:7).
Fig. 5 shows the nucleotide sequence (SEQ ID NO:11) of native sequences DNA40628 cDNA, and it is exactly native sequences PRO301 cDNA, also claims " UNQ264 " and/or " DNA40628-1216 ".
Fig. 6 A and B show nucleotide sequence DNA45416 (SEQ ID NO:7), and it is exactly native sequences PRO362 cDNA, also claim " UNQ317 " and/or " DNA45416-1251 ".The protein translation that has also shown initial methionine and total length PRO362 polypeptide (SEQ ID NO:2) among the figure.
Fig. 7 shows the nucleotide sequence (SEQ ID NO:8) of native sequences PRO245 cDNA, and this nucleotide sequence is called as " UNQ219 " and/or " DNA35638 ".
Fig. 8 shows oligonucleotide sequence OLI2162 (35936.f1) (SEQ ID NO:12), OLI2163 (35936.p1) (SEQ ID NO:13), OLI2164 (35936.f2) (SEQ ID NO:14), OLI2165 (35936.r1) (SEQ ID NO:15), OLI2166 (35936.f3) (SEQ ID NO:16), OLI2167 (35936.r2) (SEQ ID NO:17), they are used for DNA isolation 40628.
Fig. 9 A and B show the double chain form of DNA42257 (consen02) (SEQ ID NO:5), and underscore is represented the position of 5 Oligonucleolide primers, and they all are used for DNA isolation 45416 (SEQ ID NO:7).Described oligonucleotide is: 42257.f1 (SEQ ID NO:18), 42257.f2 (SEQ ID NO:19), 42257.r1 (SEQ ID NO:20), 42257.r2 (SEQ ID NO:21) and 42257.p1 (SEQ ID NO:22).
Figure 10 A and B represent that Blast score value (Blast score), coupling (match) and the per-cent homology between two overlapping fragmentses of DNA40628 and A33_HUMAN compare (percent homologyalignment), and described A33_HUMAN is the antigenic precursor of people A33.The coding residue 17-284 (SEQ ID NO:24) of coding residue 24-283 of Figure 10 A comparison dna 40628 (SEQ ID NO:23) and A33_HUMAN; The coding residue 12-284 (SEQ ID NO:26) of coding residue 21-239 of Figure 10 B comparison dna 40628 (SEQ ID NO:25) and A33_HUMAN.
Figure 11 shows the aminoacid sequence of native sequences PRO245 polypeptide (SEQ ID NO:9), and it is encoded by nucleotide sequence shown in Figure 7 (DNA35638, SEQ ID NO:8).This polypeptide has 312 amino acid, the potential film district of striding that has the signal sequence that is positioned at residue 1-28 and be positioned at the about 237-of residue about 259.
Figure 12 shows between DNA40628 amino acid sequence coded (SEQ ID NO:1) and the A33 antigen (SEQ ID NO:6) 25.3% identity is arranged.
Figure 13 shows between DNA45416 amino acid sequence coded (SEQ ID NO:2) and the A33 antigen (SEQ ID NO:6) 20.8% identity is arranged
Figure 14 shows between DNA35638 amino acid sequence coded (SEQ ID NO:9) and the A33 antigen (SEQ ID NO:6) 24.3% identity is arranged.
Figure 15 shows between DNA40628 amino acid sequence coded (SEQ ID NO:1) and the JAM (SEQID NO:10) 67.6% identity is arranged
Figure 16 shows between DNA45416 amino acid sequence coded (SEQ ID NO:2) and the JAM (SEQID NO:10) 23.3% identity is arranged.
Figure 17 shows that DNA35638 amino acid sequence coded (SEQ ID NO:29) has 34.2% identity with JAM (SEQID NO:10).
Figure 18 shows that the antigenic aminoacid sequence of A33 (SEQ ID NO:6) has 26% identity with JAM (SEQ ID NO:10).
Figure 19 shows the result of the Dot blot hybridization of describing among the embodiment 8.
Figure 20 shows the TAQMAN that describes among the embodiment 9 TMMRNA expresses the result of test.
Figure 21 shows among the embodiment 7 the combining by DNA40628 encoded protein and human neutrophil of describing.
Figure 22 shows the aminoacid sequence (SEQ ID NO:31) of PRO1868, and  represents the signal cracking site of generally acknowledging, ● the outer halfcystine of born of the same parents that expression is conservative, underscore represents to stride the film district, and the dotted line coverage area is represented potential N-glycosylation site.This polypeptide has 310 amino acid, has signal sequence that is positioned at residue 1-30 and the potential film district of striding that is positioned at about residue 242-about 266.
Figure 23 shows the in situ hybridization of PRO362 in the mouse liver frozen section.
Figure 24 shows the in situ hybridization of PRO362 in people's liver frozen section.
Figure 25 shows the in situ hybridization of PRO362 in activatory pulmonary alveolar macrophage and Kupffer Cell (Kupffer cell).
Figure 26 shows the in situ hybridization of PRO362m RNA in placenta Hough Bao Er (Hofbauer) cell.
Figure 27 shows the in situ hybridization of PRO362 mRNA in A type synovial cell.
Figure 28 shows the in situ hybridization of PRO362 mRNA in brain microgliacyte (brain microglia cell).
Figure 29 shows the in situ hybridization of PRO362 mRNA in the tissue-derived cell of people's asthma.
Figure 30 shows the in situ hybridization of PRO362 mRNA in the tissue-derived cell of people's chronic hepatitis.
Figure 31 shows that PRO245 mRNA is in the lymphoglandula in health adult tissue source and the in situ hybridization in almond height endotheliocyte venule (HEV) cell.
Figure 32 shows PRO245 mRNA in the arteriole endotheliocyte of inflammation (inflamed) human lung tissue and normal people's lung tissue, and the in situ hybridization in the androgone (spermatogenic cell) in the normal vas deferens of testis.
Figure 33 shows the in situ hybridization of PRO245 mRNA in people's carcinoma of testis tissue, cancerous lung tissue and breast cancer (mammary carcinoma) tissue.
Figure 34 shows the in situ hybridization of PRO245 mRNA in human breast carcinoma (breast carcinoma) tissue.
Figure 35 shows the immunohistochemical analysis of PRO362 in the scavenger cell.
Figure 36 shows the immunohistochemical analysis of PRO362 in the Kupffer Cell.
Figure 37 shows the immunohistochemical analysis of PRO362 in the microgliacyte.
Figure 38 shows the immunohistochemical analysis of PRO362 in the hofbauer cell.
Figure 39 shows the PRO1868 mRNA that is detected by reverse transcription PCR (RT-PCR) at T clone J45 and Molt4, and with B clone JY, the SDS-PAGE among RPMI8866 and the RAMOS analyzes.
Figure 40 shows PRO245 by cytotoxic T cell, NK-T cell, and NK cell bonded overview.
Figure 41 shows NK (CD56+) cell and PRO245-Fc fusion rotein bonded flow cytometry result.
Figure 42 shows peripheral blood dendritic cells (PBDC) and PRO245-Fc fusion rotein bonded flow cytometry result.
Figure 43 shows J45 T cell and PRO245-Fc fusion rotein bonded flow cytometry result.
Figure 44 shows J45 T cell and PRO245-Fc fusion rotein bonded flow cytometry result.
Figure 45 shows the flow cytometry result, and it confirms excessive His-marking type-PRO1868 blocking-up J45 cell and adherent ability of PRO245-Fc fusion rotein.
Figure 46 shows the flow cytometry result of His-marking type-PRO1868 blocking-up PRO245-Fc fusion rotein and NK (CD56+) cell bonded ability.
Adherent per-cent takes place with the hole of being wrapped quilt by different concns PRO245 in the J45 cell of Figure 47 show tags.
Figure 48 shows the immunoprecipitation of biotinylation J45 cell on Fc-cross-linking type PRO245-Fc fusion rotein A matrix.
Figure 49 shows PRO1868 from J45 and PBMC cellular immunization precipitation, uses PRO245-Fc fusion rotein cross-linking type albumin A matrix.
Figure 50 shows that biotinylation PRO245 is combined by the hole with the PRO1868 bag.
Figure 51 shows that biotinylation PRO1868 is combined by the hole with the PRO245-Fc bag.
The data representation of Figure 52 is anti--and PRO1868 antibody is to the inhibition of J45 cell adhesion PRO245-Fc fusion rotein.Data are from three independently tests; Error bars (error bar) is illustrated in the SD under the situation of n=6.
Figure 53 shows the flow cytometry result, shows the ability of the keying action competition between 6x His-marking type PRO1868 albumen and CD56+NK cell and the PRO245-Fc fusion rotein.
Figure 54 shows PRO1868 and Chinese hamster ovary celI the combining under different condition of expressing PRO245.
Figure 55 shows, and anti--PRO1868 antibody combines with the specificity of the Chinese hamster ovary celI (CuL8r) of expressing PRO245.
Figure 56 shows people STIgMA (hSTIgMA; SEQ ID NO:32) and people STIgMA short (hSTIgMA short; SEQ ID NO:33) aminoacid sequence, and with the comparison of mouse STIgMA (SEQ IDNO:34).Shown hydrophobic leader sequence among the figure, striden the film district, and potential N-connects glycosylation site.Also shown Ig structural domain border among the figure, it is to derive out from the exon of people STIgMA gene-intron border.
Figure 57 is Northern engram analysis result, shows the expression (A) of people STIgMA in placenta, lung, heart, liver and suprarenal gland.1.5 and two transcripts of 1.8kb appear in people's tissue of expressing STIgMA.
Figure 58. (A) TAQMAN TMPcr analysis shows that the expression of people STIgMA in myelomonocyte (myelomonocytic cell line) HL60 of system and THP-1 and in the scavenger cell of differentiation increases.Low-level expression is found in Jurkat T cell, MOLT3, MOLT4 and RAMOSB-clone.(B) external monocyte is between the differentiation phase, and the expression of STIgMA mRNA increases.Broke up in 7 days by adhering to plastics from the isolating monocyte of human peripheral.Total RNA takes from the different time points in the atomization.(C) at monocyte in the scavenger cell process of differentiation, the proteic expression of STIgMA increases.Monocyte with full cell lysate electrophoresis on gel, is transferred to nitrocellulose filter as handling afterwards in (B), film is incubated with the anti-people STIgMA of polyclone antibody (4F7).The electrophoresis band of this polyclonal antibody identification 48 and 38kDa, they may represent microscler formula and the short-form of STIgMA.
Figure 59. in clone, identify the huSTIgMA protein molecular.(A) HuSTIgMA-gd expresses in the 293E cell in short-term, and with anti-gd antibody mediated immunity precipitation, trace is incubated with the polyclonal antibody of anti-gd antibody or anti-STIgMA extracellular region.(B) huSTIgMA that expresses in 293 cells is the N-glycosylated protein of monomeric form.Tyrosine phosphorylation takes place by handling the HEK293 cell with pervanadic acid sodium in STIgMA, but does not recover (recruit) Syk kinases.Phosphorylation STIgMA moves at the molecular weight slightly higher than non-phosphorylating STIgMA.
The selective expression of Figure 60 .STIgMA in person monocytic cell-deutero-scavenger cell.Peripheral blood lymphocytes dyes, and uses ALEXA with anti-B, T, NK cell, monocytic specific antibody TMThe anti-STIgMA monoclonal antibody of A488 coupling type (3C9) dyeing.In all peripheral blood leucocyte and dendritic cell, do not express, but in the scavenger cell of vitro differentiation expression is arranged at monocyte derived.
Figure 61 .STIgMA mRNA and protein expression are strengthened by IL-10 and dexamethasone (dexamethasone).(A) PCR in real time demonstration STIgMA mRNA is expressed in and uses IL-10, and TGFbeta handles the back and strengthens, and by the dexamethasone induced strong, but through LPS, IFN γ and TNF α processing back downward modulation.(B) handled 5 days with different cytokines and dexamethasone through the isolating peripheral blood lymphocytes of Ficoll, and carry out two dyeing with anti-CD14 and anti-STIgMA.Flow cytometer showed (Flow analysis) demonstration STIgMA is expressed in through the monocyte surface that dexamethasone is handled and strengthens greatly, and is strengthening greatly after IL-10 and LPS processing.
The Subcellular Localization of Figure 62 .STIgMA in the scavenger cell of monocyte derived.Monocyte was cultivated 7 days in the scavenger cell division culture medium, used acetone fixed, with polyclone anti-STIgMA antibody 6F1 or CD63 and goat-anti-rabbit FITC second antibody dyeing.Cell is observed under confocal microscope.STIgMA is found in kytoplasm, and D63 is positioned at (co-localize) with the lysosome membrane PROTEIN C.STIgMA also expresses in the mode that is similar to the F-Actin muscle in the trailing edge (trailing) and leading edge (leading) position of scavenger cell.Scale=10 μ m.
The location of Figure 63 .STIgMA mRNA in chronic inflammatory disease.In situ hybridization shows, STIgMA mRNA appear at pneumonia (A, B) or chronic asthma (C is D) in the pulmonary alveolar macrophage in patient tissue source.Also expression in the liver Kupffer Cell of chronic hepatitis patient liver biopsy of STIgMA mRNA (E, F).
Figure 64 .STIgMA mRNA is expressed in the synovial membrane of inflammation and strengthens.STIgMA mRNA is in low-level in the synovial membrane of the no joint inflammation that derives from knee displacement patient joint or does not have (A, C), but at the cell of osteoarthritis patient vessel screen (pannus), promptly high level expression in potential synovial cell or the synovial membrane scavenger cell (B, D).
Figure 65. and the STIgMA albumen in the cell of usefulness polyclonal antibody 6F1 detection degenerative arthritis (degenerative joint disease) patient's synovial membrane liner (A, B, C).In the contrast synovial membrane, do not observe STIgMA (D) by the immunohistochemical methods detection.
Figure 66 .STIgMA albumen is expressed in the scavenger cell hypotype of residing in tissue, and it is expressed in the chronic inflammatory disease and increases.(A) STIgMA is at the Chinese hamster ovary celI film surface expression of stably express STIgMA.STIgMA albumen is high level expression (B) in the pulmonary alveolar macrophage of chronic asthma patient tissue.(C) expression of STIgMA in people small intestine cell.Section is to obtain from the tissue of surgical resection, can comprise tumour (neoplasm).(D) expression in the hofbauer cell of STIgMA albumen placenta (pre-term placenta) before the people is mature.The high level expression of STIgMA albumen in scavenger cell is found in the Kupffer Cell (F) of suprarenal gland (E) and people's liver.5 μ m slabs dye as chromogen with DAB through acetone fixed.Image is taken pictures under the situation that 20X and 40X doubly amplify.
Figure 67. go up CD68 and STIgMA are carried out immunohistochemical staining deriving from arteriosclerotic's blood vessel spot (vascular plaque).Serial section is fixed, with the dyeing of anti-people CD68 monoclonal antibody (A, B) and with anti-people STIgMA polyclonal antibody 6F1 dye (C, D).Judge that according to the painted result of serial section STIgMA is found in the foam cell (phoam cell) in scavenger cell group and the atherosclerosis plaque, and with the positive scavenger cell overlapping (overlapped) of CD68.Magnification: 10X (A, C) and 20X (B, D).
Figure 68 .STIgMA and CD68 are to the common dyeing of matter scavenger cell between heart.The section of 5 μ m obtains from human heart (postmortem), with monoclonal anti STIgMA antibody (3C9) and resisting-dyeing of mouse second antibody through the FITC-mark.CD68 detects by the monoclonal anti CD68 antibody staining with the PE-mark.Magnification: 20X.
Figure 69 .STIgMA mRNA significantly increases in the colon that derives from ulcerative colitis, Crohn disease, chronic obstructive pulmonary disease (COPD) and asthmatic patient.Total RNA carries out PCR in real time from above-mentioned multiple tissue extraction.STIgMA mRNA significantly increases in from ulcerative colitis, Crohn disease and COPD patient's tissue.Statistical analysis carries out with Mann-Whitney U-check.
Figure 70 shows that the cell of expressing human STIgMA and the adhesion of human endothelial cell strengthen.(A) STIgMA stably express in people Jurkat T-clone.(B) in cell, load in advance fluorescence dye BCECF (Molecular Probes, Oregon), and with cell added to bag by through or 96 orifice plates of the individual layer Human umbilical vein endothelial cells (HUVEC) handled without 10ng/ml TNF α in.Wash plate 3 times, count fluorescence with photofluorometer, its expression still with the quantity of the cell of HUVEC cell adhesion.This figure has represented 4 independently experiments.
Figure 71 .muSTIgMA IgG-Fc fusion rotein suppresses the progress of sacroiliitis (CIA) mouse model of collagen (collagen)-initiation.One group of (CIA) mouse (n=7) gives 100 μ g muSTIgMA IgG-Fc fusion roteins (square), and CIA mouse control group (n=8) is accepted 100 μ g mouse IgG1 (circle), and 3 times weekly, totally 6 weeks.Check the inflammation performance of mouse every day and according to the grade scoring (seeing embodiment 25 for details) of 0-16, with result's mapping (mean value ± SD, Student ' s T check p-value=0.0004 is meant to contrast IgG1 with respect to the muSTIgMA test proteins).
DESCRIPTION OF THE PREFERRED
I. Definition
Term " PRO301 " herein, " PRO362 ", " PRO245 ", " PRO1868 " or " PRO301 polypeptide ", " PRO362 polypeptide ", " PRO245 polypeptide ", " PRO1868 " and " cancer associated antigens " comprises native sequences PRO301 respectively, PRO362, PRO245, or PRO1868 and variant (further limiting in this article) thereof.In addition, term " PRO301 " and " JAM-1 " can exchange use, term " PRO362 ", " JAM4 ", " STIGMA " and " STIgMA " also can.Term " PRO245 ", " JAM-IT " and " JAM-2 " can exchange use, term " PRO1868 ", " SHATR " and " JAM-3 " also can.PRO301, PRO362, PRO245 or PRO1868 polypeptide can separate from various sources, such as separating from people types of organization or from other source, perhaps by recombination method or synthetic method preparation.Here listed name is used in reference to native sequences molecule and their variant separately.
Therefore, for example, STIgMA comprises such polypeptide, and this polypeptide contains the amino acid/11-321 of SEQ ID NO:2; Amino acid/11-X of SEQ ID NO:2 (wherein X is any of amino acid 271-280); The amino acid 21-321 of SEQ ID NO:2; The amino acid 21-X of SEQ ID NO:2 (wherein X is any of amino acid 271-280); The amino acid/11-399 of SEQ ID NO:32; The amino acid 21-399 of SEQ ID NO:32; The amino acid/11-305 of SEQ ID NO:33; The amino acid 21-305 of SEQ ID NO:33; The amino acid/11-280 of SEQ ID NO:34; The amino acid 21-280 of SEQ ID NO:34; Extracellular region and stride partly or entirely that the film district has all lacked or those variants of inactivation.
Term " inflammatory diseases (inflammatory disease, inflammatory disorder) " is meant a kind of disease, and the composition of immune system causes, mediates or causes inflammatory response in this disease, causes this Mammals morbidity.This term also comprises and alleviates those diseases that inflammatory response can slow down progression of disease.Being included in this term is Ia inflammatory diseases, comprises autoimmune disease.
The disease of term " T-is cell-mediated " is meant that the T cell directly or indirectly mediates or cause those diseases of Mammals morbidity.The cell-mediated disease of T can be with the effect of cell-mediated effect, lymphokine mediation etc., when the B cell is subjected to, for example during the stimulation of the lymphokine of T emiocytosis, even also has the effect relevant with the B cell.
Immune correlated disease and inflammatory diseases comprise some of them by the cell-mediated disease of T, and their example includes but not limited to, inflammatory bowel disease; Systemic lupus erythematous; Rheumatoid arthritis; The adolescency chronic arthritis; Vertebral arthropathy; Systemic sclerosis (scleroderma); The special property sent out inflammation myopathy (dermatomyositis, polymyositis); Sjogren syndrome; Systemic vasculitis; Sarcoidosis; Autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria); AT (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia); Thyroiditis (Graves disease disease, struma lymphomatosa, adolescency lymphocytic thyroiditis, atrophic thyroiditis); Diabetes, immune-mediated ephrosis (glomerulonephritis, uriniferous tubules interstitial nephritis); The demyelination of maincenter and peripheral nervous system is such as multiple sclerosis, spontaneous polyneuropathy; Hepatic duct disease such as infectious hepatitis (first type, B-mode, third type, fourth type and hepatitis E and other non-have a liking for the hepatitis that liver venereal disease poison causes); ACAH; Primary biliary cirrhosis; Granulomatous hepatitis; And sclerosing cholangitis; Inflammatory and fibrotic lung disease (for example, cystic fibrosis); Seitan-susceptibility enteropathy; Whipple's disease; The tetter of autoimmunization or immunity-mediation comprises the bleb dermatosis, erythema multiforme and contact dermatitis, psoriasis; Lung's anaphylactic disease is such as the eosinophilic granulocyte pneumonia, and the special property sent out lung fibrosis and hypersensitivity pneumonia are transplanted diseases related transplant rejection and the graft versus host disease of comprising.
Term " tumour " in this article refers to all pernicious (malignant) or growth of optimum (benign) tumorigenesis sexual cell and hyperplasia, and all preceding carcinous (pre-cancerous) cell and tissue.
Term " cancer " and " cancer " are meant or describe Mammals is grown to characteristic feature with cell out of control pathologic situation.The example of cancer includes but not limited to, cancer (carcinoma), lymphoma, blastoma, sarcoma and leukemia.This kind cancer example more specifically comprises mammary cancer, prostate cancer, squamous cell carcinoma, small cell lung cancer, nonsmall-cell lung cancer, gastrointestinal cancer, carcinoma of the pancreas, glioblastoma multiforme, cervical cancer, ovarian cancer, liver cancer (liver cancer), bladder cancer, hepatocellular carcinoma, colorectal carcinoma, carcinoma of endometrium, salivary-gland carcinoma, kidney, liver cancer, carcinoma vulvae, thyroid carcinoma, liver property cancer (hepaticcarcinoma) and various incidence cancer.
" treatment " is the intervention of implementing for the pathology that stop progression of disease or change disease.Therefore, " treatment " both referred to that therapeutic measures also referred to preventive measure.Need the individuality of treatment to comprise that those have suffered from disease or hope prevents ill individuality.In the treatment of immune correlated disease, therapeutical agent can directly change the degree of replying of immunne response composition, perhaps makes disease more responsive to the treatment of other therapeutical agent (for example microbiotic, anti-mycotic agent, anti-inflammatory agent, chemotherapeutics etc.).
" pathology " of immune correlated disease comprise all phenomenons of patient health situation (well-being).This includes but not limited to; cell growth (neutrophil leucocyte, eosinophilic granulocyte, monocyte, lymphocyte) unusual or out of control; antibody generates; autoantibody generates, and complement generates, and disturbs the normal function of adjacent cells; discharge cytokine or other secretory product of abnormal level; suppress or increase the weight of any inflammatory response or immunne response, inflammatory cell (neutrophil leucocyte, eosinophilic granulocyte, monocyte, lymphocyte) soaks in the cell spaces, or the like.
Term " Mammals " in this article refers to any animal of mammals, includes but not limited to, people, domestic animal and farm-animals, and zoological park, sports events animal or the pet used are as horse, pig, ox, dog, cat and ferret (ferret) etc.In the preferred embodiment of the invention, Mammals is the people.
Comprise administration simultaneously with one or more other therapeutical agent " associating " administration and with the administration that links up of any order.
Term " cellulotoxic preparation " in this article refers to and suppresses or stop cell function and/or cause the material of cytoclasis.This term is intended to comprise radionuclide (I for example 131, I 125, Y 90, and Re 186), chemotherapeutics, the enzyme activity toxin of toxin such as bacterium, fungi, plant or animal-origin, or its fragment.
" chemotherapeutics " is compound useful in cancer therapy.The chemotherapeutics example comprises adriamycin (adriamycin), Zorubicin (doxorubicin), pidorubicin (epirubicin), 5 FU 5 fluorouracil, cytosine arabinoside (cytosine arabinoside, Ara-C), endoxan, thio-tepa (thiotepa), busulfan (busulfan), cytotoxin (cytoxin), taxol sample material (taxoid), as taxol (paclitaxel) (TAXOL , Bristol-Myers Squibb Oncology, Princeton is NJ) with Japanese yew terpene (doxetaxel) (TAXOTERE , Rh  ne-Poulenc Roher, Antony, France), toxotere, methotrexate (methotrexate), cis-platinum (cisplatin), alkeran (melphalan), vincaleucoblastine (vinblastine), bleomycin (bleomycin), etoposide (etoposide), ifosfamide (ifosfamide), ametycin (mitomycin C), mitoxantrone (mitoxantrone), vincristine(VCR) (vincristine) (Loucristine), Vinorelbine (vinorelbine), carboplatin (carboplatin), Vumon (teniposide), daunomycin (daunomycin), carminomycin (carminomycin), aminopterin (aminopterin), dactinomycin (dactinomycin), mitomycin (mitomycins), esperamicins (sees United States Patent (USP) 4,675,187), the relevant mustargen of alkeran with other.This definition also comprise regulate or inhibitory hormone to the hormone preparation of the effect of tumour, as tamoxifen (tamoxifen) and onapristone (onapristone).
" growth inhibitor " is meant in vivo or the growth of vitro inhibition cell herein, especially suppresses the compound or the composition of the growth of cancer cells of expression or overexpression any gene described herein.Therefore, growth inhibitor can be, is reduced in significantly that the S phase expresses or the medicine of the per-cent of the cell of this kind of overexpression gene.The example of growth inhibitor comprises that the medicine of blocking-up cell cycle progress (except that the stage of S the phase) is for example induced the medicine that G1 stagnates and the M phase stagnates.Classical M phase blocker comprises, Vinca class (vincristine(VCR) and vincaleucoblastine), taxol and topo II inhibitor such as Zorubicin, pidorubicin, gentle red rhzomorph (daunorubicin), etoposide and bleomycin.Those medicines also related (spill over) that G1 phase is stagnated are stagnated the S phase, and for example the DNA alkylating agent resembles tamoxifen, prednisone (prednisone), Dacarbazine (dacarbazine), mustargen (mechlorethamine), cis-platinum, methotrexate, 5 FU 5 fluorouracil and cytosine arabinoside.See The Molecular Basis of Cancer for details, Mendelsohn and Israel compile, chapter 1, the article (WB Saunders, the Philadelphia that are entitled as " Cell cycle regulation; oncogens, and antineoplastice drugs " of Murakami etc., 1995), especially see 13 pages.
Term " cytokine " " be general term, refer to by cell mass discharge to all rise albumen of iuntercellular medium effect of another cell.The example of this kind cytokine is a lymphocyte factor, the monocyte factor and traditional polypeptide hormone.These cytokines comprise tethelin, as human growth hormone, and N-methylenedisulfonyl human growth hormone, and Trobest; Parathyroid hormone; Thyroxine; Regular Insulin; Proinsulin; Relaxins; Preceding relaxins; Glycoprotein hormones such as follicular stimulating hormone (FSH), thyroid-stimulating hormone (TSH), short corpus luteum (generation) hormone (LH); PHGF; Fibroblast growth factor; Prolactin; Galactagogin (placental lactogen); Tumor necrosis factor-alpha and β; Gyneduct inhibitory substance (mullerian-inhibiting substance); Mouse gonad-stimulating hormone related peptides; Statin; Nrolone Phenylpropionate (activin); Vascular endothelial growth factor; Integrin; Thrombopoietin (TPO); Nerve growth factor such as NGF-β; PDGF; Transforming growth factor (TGF) is as TGF-α and TGF-β; Insulin like growth factor-1 and-II; Erythropoietin (EPO); Bone-inducing factor (osteoinductive factors); Interferon, rabbit such as interferon-' alpha ' ,-β ,-γ; G CFS (CSF) is as scavenger cell-CSF (M-CSF); Granulocyte-macrophage-CSF (GM-CSF); Granulocyte-CSF (G-CSF); Interleukin-(IL) is as IL-1, IL-1 α, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-11, IL-12; Tumour necrosis factor such as TNF-α or TNF-β and other polypeptide factor comprise LIF and kit part (KL).The term cytokine comprises from the albumen of natural origin or from the albumen of reconstitution cell culture and the biological activity equivalent of native sequences cytokine herein.
" treatment significant quantity " is as in inflammatory response, to realize measurable inhibition or stimulate required active PRO301, PRO362, the amount of PRO245 or PRO1868 antagonist or agonist.
" native sequences PRO301, PRO362, PRO245 or PRO1868 " comprise respectively with from natural deutero-PRO301, PRO362, PRO245 or PRO1868 have the polypeptide of identical aminoacid sequence.This kind native sequences PRO301, PRO362, PRO245 or PRO1868 can produce from the nature separation or by reorganization and/or synthetic method.Term " native sequences PRO301 ", " native sequences PRO362; " " native sequences PRO245 " and " native sequences PRO1868 " specifically comprises PRO301 respectively, PRO362, the natural clipped form of PRO245 and PRO1868 or secreted form (for example extracellular region sequence), natural variant form (for example alternative splicing form) and natural allelic variant.
In one embodiment, native sequences PRO301 is sophisticated or the native sequences PRO301 of total length, it comprises the amino acid/11-299 of Fig. 2 (SEQ ID NO:1), contain or do not contain the N-terminus signal sequence, contain or do not contain the initial methionine of position 1, contain or do not contain be positioned at about 236-Yue 258 potentially stride the film district, and contain or do not contain the intracellular region that is positioned at about 259-299 position.
In another embodiment, native sequences STIgMA polypeptide is sophisticated or the native sequences PRO362 of total length, it comprises the amino acid/11-321 of Fig. 3 (SEQ ID NO:2), contain or do not contain the N-terminus signal sequence, contain or do not contain the initial methionine of position 1, contain or do not contain and be positioned at the arbitrary of about 276-306 position or all potentially stride the film district, and contain or do not contain the intracellular region that is positioned at about 307-321 position.In another embodiment, native sequences STIgMA polypeptide is sophisticated or the polypeptide of total length, it comprises the amino acid/11-399 of SEQ IDNO:32 (huSTigMA), contain or do not contain the N-terminus signal sequence, contain or do not contain the initial methionine of position 1, and contain or do not contain and be positioned at the arbitrary of about 277-300 position or whole potential film districts of striding.In another embodiment, native sequences STIgMA polypeptide is sophisticated or the polypeptide of total length, it comprises the amino acid/11-305 of SEQ ID NO:33 (huSTigMA short), contain or do not contain the N-terminus signal sequence, contain or do not contain the initial methionine of position 1, and contain or do not contain and be positioned at the arbitrary of about 183-206 position or whole potential film districts of striding.In another embodiment, native sequences STIgMA polypeptide is sophisticated or the polypeptide of total length, it comprises the amino acid/11-280 of SEQ ID NO:34 (muSTIgMA), contain or do not contain the N-terminus signal sequence, contain or do not contain the initial methionine of position 1, and contain or do not contain and be positioned at the arbitrary of about 181-204 position or whole potential film districts of striding.
In another embodiment, native sequences PRO245 polypeptide is sophisticated or the native sequences PRO245 polypeptide of total length, it comprises the amino acid/11-312 of Figure 11 (SEQ ID NO:9), contain or do not contain the N-terminus signal sequence, contain or do not contain the initial methionine of position 1, contain or do not contain and potentially stride the film district, and contain or do not contain intracellular region.
In another embodiment, native sequences PRO1868 polypeptide is sophisticated or the native sequences PRO1868 polypeptide of total length, it comprises the amino acid/11-310 of Figure 22 (SEQ ID NO:31), contain or do not contain the N-terminus signal sequence that is positioned at about 1-30 position, contain or do not contain the initial methionine of position 1, contain or do not contain and be positioned at about 266 potential of about 242-and stride the film district, and contain or do not contain the intracellular region that is positioned at about 267-310 position.
" PRO301; PRO362 (STIgMA); PRO245 or PRO1868 extracellular region " or " PRO301; PRO362; PRO245 or PRO1868 ECD " are meant PRO301, PRO362 (STIgMA), what PRO245 or PRO1868 polypeptide a kind of form separately, described form did not contain full-length molecule separately substantially strides film district and cytoplasmic domain.Randomly, PRO301 ECD, PRO362 (STIgMA) ECD, PRO245 ECD or PRO1868 ECD have described film district and/or the cytoplasmic domain of striding less than 1%, preferably less than 0.5% described district.
Randomly, PRO301 polypeptide ECD comprises the middle amino-acid residue 1 or about 28 of Fig. 2 (SEQ ID NO:1) to X, and wherein X is any amino acid of amino acid 231-amino acid 241.
Randomly, PRO362 (STIgMA) polypeptide ECD comprise Fig. 3 (SEQ ID NO:2) or SEQ IDNO:32 amino-acid residue 1 or about 21 to X and wherein X be the arbitrary amino acid that is positioned at about 271-281 position, comprise SEQ ID NO:33 amino-acid residue 1 or about 21 to X and wherein X be the arbitrary amino acid that is positioned at about 178-186 position, comprise SEQ ID NO:34 amino-acid residue 1 or about 21 to X and wherein X be the arbitrary amino acid that is positioned at about 176-184 position of SEQ ID NO:34.
Randomly, PRO245 polypeptide ECD comprises amino-acid residue 1 or about 29 to X, and wherein X is the arbitrary amino acid that is positioned at about 232-242 position.
Randomly, PRO1868 polypeptide ECD comprises amino-acid residue 1 or about 31 to X, and wherein X is the arbitrary amino acid that is positioned at about 237-247 position.
Be appreciated that and identify PRO301 of the present invention, PRO362 (STIgMA), any film district of striding of PRO245 or PRO1868 polypeptide is to identify such hydrophobic region in order to set up the conventional accepted standard in this area.The actual boundary of striding the film district can have difference, but is no more than about 5 amino acid at initial each end of striding the film district of identifying probably.
" PRO301 variant " is meant with following dna molecular to have active PRO301:(a at least about 80% amino acid sequence identity) dna molecular of coding PRO301 polypeptide, contain or do not contain its natural signals sequence, contain or do not contain initial methionine, contain or do not contain and potentially stride the film district, and contain or do not contain intracellular region; Or (b) complement of dna molecular (a).In an embodiment, PRO301 variant and the PRO301 with derivation aminoacid sequence of total length native sequences PRO301 shown in Fig. 1 (SEQ ID NO:1) have the amino acid sequence homology at least about 80%.Such PRO301 variant comprises, for example, and in that sequence of N shown in Fig. 2 (SEQ ID NO:1)-or C-is terminal adds or lack the formed PRO301 polypeptide of one or more amino-acid residue.Preferred described nucleotide sequence or amino acid sequence identity are at least about 85%, more preferably at least about 90%, also more preferably at least about 95%.The highest preferred sequence identity appears at (Fig. 2, the amino acid 28-235 of SEQ ID NO:1) in the extracellular region.
" PRO245 variant " is meant with following dna molecular to have active PRO245:(a at least about 80% amino acid sequence identity) dna molecular of coding PRO245 polypeptide, contain or do not contain its natural signals sequence, contain or do not contain initial methionine, contain or do not contain and potentially stride the film district, and contain or do not contain intracellular region; Or (b) complement of dna molecular (a).In an embodiment, PRO245 variant and the PRO245 with derivation aminoacid sequence of total length native sequences PRO245 shown in Fig. 1 (SEQ ID NO:9) have the amino acid sequence homology at least about 80%.Such PRO245 variant comprises, for example, and in that sequence of N shown in the SEQ ID NO:9-or C-is terminal adds or lack the formed PRO245 polypeptide of one or more amino-acid residue.Preferred described nucleotide sequence or amino acid sequence identity are at least about 85%, more preferably at least about 90%, also more preferably at least about 95%.
" PRO362 variant " is meant with following dna molecular to have active PRO362 polypeptide at least about 80% amino acid sequence identity: (a) dna molecular of coding PRO362 polypeptide, contain or do not contain its natural signals sequence, contain or do not contain initial methionine, contain or do not contain and potentially stride the film district, and contain or do not contain intracellular region; Or (b) complement of dna molecular (a).In an embodiment, PRO362 variant and the PRO362 with derivation aminoacid sequence of total length native sequences PRO362 shown in Fig. 3 (SEQ ID NO:2) have the amino acid sequence homology at least about 80%.Such PRO362 variant comprises, for example, and in that sequence of N shown in Fig. 3 (SEQ ID NO:2)-or C-is terminal adds or lack the formed PRO362 polypeptide of one or more amino-acid residue.Usually, aminoacid sequence has the amino acid sequence identity at least about 80% shown in PRO362 polypeptide variants and Fig. 3 (SEQ ID NO:2), preferably at least about 85% amino acid sequence identity, more preferably at least about 90% amino acid sequence identity, also more preferably at least about 95% amino acid sequence identity.The highest preferred sequence identity appears at (wherein X is any amino-acid residue of position 271-281 for Fig. 3, amino acid/11-X of SEQ ID NO:2) in the extracellular region.
" STIgMA variant " is particularly including above-mentioned PRO362 variant, and SEQ ID NOS:32,33 and 34 variant.Particularly, the STIgMA variant is particularly including having active STIgMA polypeptide at least about 80% amino acid sequence identity with following dna molecular: (a) coding SEQ ID NO:32, the dna molecular of 33 or 34 polypeptide, contain or do not contain its natural signals sequence, contain or do not contain initial methionine, contain or do not contain and all or part ofly potentially stride the film district, and contain or do not contain intracellular region; Or (b) complement of dna molecular (a).In an embodiment, the STIgMA variant with have SEQ ID NO:32, the STIgMA polypeptide of the derivation aminoacid sequence shown in 33 or 34 has the amino acid sequence homology at least about 80%.Such STIgMA variant comprises, for example, at SEQ ID NOS:32, sequence of N shown in 33 and 34-or C-is terminal adds or lack the formed STIgMA polypeptide of one or more amino-acid residue.Usually, STIgMA polypeptide variants and SEQ ID NO:32, aminoacid sequence has the amino acid sequence identity at least about 80% shown in 33 or 34, preferably at least about 85% amino acid sequence identity, more preferably at least about 90% amino acid sequence identity, also more preferably at least about 95% amino acid sequence identity.Preferred described nucleotide sequence or amino acid sequence identity are at least about 85%, more preferably at least about 90%, also more preferably at least about 95%.The highest preferred sequence identity appears in the extracellular region.
" PRO1868 variant " is meant with following dna molecular to have active PRO1868 polypeptide at least about 80% amino acid sequence identity: (a) dna molecular of coding PRO1868 polypeptide, contain or do not contain its natural signals sequence, contain or do not contain initial methionine, contain or do not contain and potentially stride the film district, and contain or do not contain intracellular region; Or (b) complement of dna molecular (a).In an embodiment, PRO1868 variant and the PRO1868 with derivation aminoacid sequence of total length native sequences PRO1868 shown in the SEQ ID NO:31 have the amino acid sequence homology at least about 80%.Such PRO1868 variant comprises, for example, and in that sequence of N shown in the SEQ ID NO:31-or C-is terminal adds or lack the formed PRO1868 polypeptide of one or more amino-acid residue.Usually, aminoacid sequence has the amino acid sequence identity at least about 80% shown in PRO1868 polypeptide variants and the SEQID NO:31, preferably at least about 85% amino acid sequence identity, more preferably at least about 90% amino acid sequence identity, also more preferably at least about 95% amino acid sequence identity.
PRO301 described herein, PRO362 (STIgMA), " amino acid sequence identity per-cent (%) " of PRO245 or PRO1868 sequence, be defined as and carrying out sequence alignment, and introduce breach in case of necessity obtaining the largest percentage of sequence identity, and when not being considered as any conservative replacement of a part of sequence identity, in the candidate sequence respectively with PRO301, PRO362 (STIgMA), the per-cent of the amino-acid residue that the amino-acid residue in PRO245 or the PRO1868 sequence is identical.Being intended to the comparison of definite amino acid sequence identity per-cent can finish by the number of ways that those skilled in the art grasped, and for example uses disclosed computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software.Those skilled in the art can be identified for measuring the required suitable parameter of comparison, comprise that the high specific that can obtain the total length aligned sequences is to required any particular algorithms.
PRO301 described herein, PRO362 (STIgMA), the encoding sequence of PRO245 or PRO1868 (DNA40628 for example, DNA45416, DNA35638, DNA77624) " nucleotide sequence identity per-cent (%) ", be defined as and carrying out sequence alignment, and introduce breach in case of necessity to obtain the largest percentage of sequence identity, and when not being considered as any conservative replacement of a part of sequence identity, in the candidate sequence respectively with PRO301, PRO362 (STIgMA), the per-cent of identical Nucleotide in PRO245 or the PRO1868 encoding sequence.Being intended to the comparison of definite kernel acid sequence identity per-cent can finish by the number of ways that those skilled in the art grasped, and for example uses disclosed computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software.Those skilled in the art can be identified for measuring the required suitable parameter of comparison, comprise that the high specific that can obtain the total length aligned sequences is to required any particular algorithms.
" isolating " nucleic acid molecule, be from the natural origin of described nucleic acid, identify and with this source in common relative at least a impurity nucleic acid molecule isolated nucleic acid molecule.Isolated nucleic acid molecule is different with the form or the structure (setting) of natural middle this molecule of finding.Therefore isolated nucleic acid molecule can be distinguished mutually with the nucleic acid molecule in being present in n cell.Yet isolated nucleic acid molecule comprises the nucleic acid molecule that the cell of common expression encoded polypeptide contains, wherein, and the position of for example described nucleic acid molecule in karyomit(e) and its position different in n cell.
" isolating " coding PRO301, PRO362 (STIgMA), the nucleic acid molecule of PRO245 or PRO1868 polypeptide, be from coding PRO301, PRO362 (STIgMA), identify in the natural origin of the nucleic acid of PRO245 or PRO1868 polypeptide and with this source in common relative at least a impurity nucleic acid molecule isolated nucleic acid molecule.Separated coding PRO301, PRO362 (STIgMA), the nucleic acid molecule of PRO245 or PRO1868 polypeptide is different with the form or the structure of natural middle this molecule of finding.Therefore separated coding PRO301, PRO362 (STIgMA), the nucleic acid molecule of PRO245 or PRO1868 polypeptide can be respectively and the DNA40628 that is present in the n cell, DNA45416, DNA35638 or DNA77624 nucleic acid molecule are distinguished mutually.Yet, separated coding PRO301, PRO362 (STIgMA), the nucleic acid molecule of PRO245 or PRO1868 polypeptide comprises common expression PRO301, PRO362 (STIgMA), the coding PRO301 that the cell of PRO245 or PRO1868 polypeptide contains, PRO362 (STIgMA), the nucleic acid molecule of PRO245 or PRO1868 polypeptide, wherein, the position of for example described nucleic acid molecule in karyomit(e) and its position different in n cell.
Term " control sequence " is meant to express in concrete host living beings can operate the necessary dna sequence dna of continuous encoding sequence.The control sequence that is suitable for prokaryotic cell prokaryocyte comprises that for example, promotor is chosen operon sequence in addition wantonly, and ribosome bind site.The known promotor of utilizing of eukaryotic cell, polyadenylation signal, and enhanser.
When nucleic acid and another nucleotide sequence produced related on the function, this nucleic acid " can be operated and link to each other " with described another nucleotide sequence.For example, presequence or secretion leader sequence are expressed as when participating in before the polypeptide excretory albumen, and the DNA of coding presequence or secretion leader sequence can operate with the DNA of this polypeptide of coding and link to each other; When promotor or enhanser influenced transcribing of encoding sequence, described promotor or enhanser can be operated with this encoding sequence and link to each other; When ribosome bind site was in the position that promotes translation, it can be operated with encoding sequence and link to each other.Usually, " can operate continuous " is meant that continuous DNA is an adjacency, and, the secretion leader sequence situation in, be in abutting connection with and be in the same reading frame.But enhanser is not essential adjacency.Connection can be finished by connecting at restriction site easily.If there is no synthetic oligonucleotide adapter or joint can be used according to conventional practice in this class site.
Term " antibody " uses its broad sense herein, specifically comprise, for example, anti--PRO301, anti--PRO362 (anti--STIgMA), the single monoclonal antibody (comprising agonist, antagonist, neutralizing antibody) of anti--PRO245 or anti--PRO1868, and have anti--PRO301 of multi-epitope specificity (polyepitopicspecificity), anti--PRO362, anti--PRO245 or anti--PRO1868 antibody compositions, but be not limited thereto.Term " monoclonal antibody " is meant the antibody from the antibody population of basic homogeneous herein, that is, except the natural sudden change that may exist on a small quantity, each antibody in this antibody population is all identical.
" the strict degree " of hybridization can be determined at an easy rate by those skilled in the art, calculate by rule of thumb according to probe length, wash temperature and salt concn usually.Generally speaking, for correct annealing, long probe needs comparatively high temps, and short probe needs lesser temps.The reannealing ability when there is complementary sequence in the DNA of sex change in being lower than the environment of melting temperature(Tm) is depended in hybridization usually.Required homology degree is high more between probe and the hybridization sequences, and then spendable relative temperature is high more.The result is, the higher reaction conditions that will make of relative temperature is tending towards strict more, and lesser temps then makes the strict degree of reaction less.About other details and the explanation of the strict degree of hybridization, see Ausubel et al., CurrentProtocols in Molecular Biology, Wiley Interscience Publishers, (1995).
" stringent condition " or " height stringent condition " can be defined as herein: (1) uses low ionic strength and high temperature to wash, and for example, with 0.015M sodium-chlor/0.0015M Trisodium Citrate/0.1% sodium lauryl sulphate, washs at 50 ℃; (2) during hybridizing, use denaturing agent at 42 ℃, such as the methane amide that contains 0.1% bovine serum albumin (for example 50% (v/v) methane amide)/0.1%Ficoll/0.1% polyvinylpyrrolidone/50mM sodium phosphate buffer pH6.5 and 750mM sodium-chlor, 75mM Trisodium Citrate; Perhaps (3) use 50% methane amide, 5xSSC (0.75M NaCl at 42 ℃, 0.075M Trisodium Citrate), salmon sperm DNA (50 μ g/ml), 0.1%SDS and 10% T 500 of 50mM sodium phosphate (pH6.8), 0.1% trisodium phosphate, 5x Denhardt ' s solution, supersound process, in 42 ℃ of washings in 0.2xSSC (sodium chloride/sodium citrate), wash in 50% methane amide in 55 ℃, then carry out highly strict washing with the 0.1xSSC that contains EDTA in 55 ℃.
" moderate stringent condition " can be according to Sambrook et al., Molecular Cloning:ALaboratory Manual, New York:Cold Spring Harbor Press, 1989 definition, comprise and use strict degree (for example to be lower than aforesaid washing soln and hybridization conditions, temperature, ionic strength and %SDS).An example of medium stringent condition is, incubation spends the night in 37 ℃ of solution that comprising following composition: 20% methane amide, 5xSSC (150mM NaCl, the 15mM trisodium citrate), 50mM sodium phosphate (pH7.6), 5xDenhardt ' s solution, the salmon sperm DNA that 10% T 500 and 20mg/ml sex change are sheared then washs Hybond membrane in about 37-50 ℃ in 1xSSC.Those skilled in the art understand the conditions such as temperature, ionic strength of adjusting how as required, to adapt to such as factors such as probe length.
Term " has the epi-position label " herein, is meant the chimeric polyeptides that contains the polypeptide of the present invention that merges with " label polypeptide ".This label polypeptide has enough residues provides preparation antibody required epi-position, and will enough lack so that the activity of the polypeptide of its nonintervention and its fusion.The label polypeptide preferably also is unique, so that cross reaction does not take place basically for this antibody and other epi-position.Usually, suitable label polypeptide has at least 6 amino-acid residues, is generally about 8～50 amino-acid residues (being preferably about 10～20 amino-acid residues).
" activated " or " activity " is meant the proteic form of the present invention in relating to the context of polypeptide variants of the present invention, described form has kept the biologic activity and/or the immunologic competence of the polypeptide of the present invention of natural or natural generation.
" biologic activity " at other molecule that relates to antibody, polypeptide, maybe can identify with shaker test disclosed herein (for example, organic or inorganic small molecules, peptide etc.) context in, be partly to represent, these molecular changes inflammatory cells change the ability of the lymphokine release of T cell proliferation and change cell to the infiltration of tissue.Another kind of preferred activity is the influence to the saturating property of blood vessel.
Term " antagonist " uses its broad sense, comprises the bioactive molecule of any natural polypeptides of the present invention described herein of partially or even wholly blocking, suppress or neutralize.Similarly, belong to " agonist " and use its broad sense, comprise any can simulation or stimulate the bioactive molecule of natural polypeptides of the present invention described herein.Suitable agonist or antagonist molecules specifically comprise agonist or antagonist antibodies or antibody fragment, the fragment of natural polypeptides of the present invention or aminoacid sequence variant, and peptide, organic molecule comprises organic molecule, etc.
" small molecules " in this article refers to molecular weight and is lower than about 600 daltonian molecules.
" antibody " is the glycoprotein with same structure feature (Ig) with " immunoglobulin (Ig) " (Ab).Antibody shows the binding specificity to specific antigens, and immunoglobulin (Ig) comprises that antibody and other lack the antibody-sample molecule of antigen-specific.Back one class polypeptide for example is, low-level generation in lymphsystem and high level produces in myelomatosis those.Term " antibody " uses its broad sense, specifically comprise, but be not limited to, the monoclonal antibody of intact (intact), polyclonal antibody, the multi-specificity antibody (as bi-specific antibody) and the antibody fragment that are formed by at least two kinds of undamaged antibody are as long as they show required biologic activity.
" natural antibody " and " native immunoglobulin " normally about 150000 daltonian different tetramer glycoprotein, it is made up of with two identical heavy chains (H) two identical light chains (L).Every light chain links to each other with heavy chain by a covalent disulfide bonds, and the heavy chain of different immunoglobulin (Ig) isotypes has the disulfide linkage of different numbers.Every heavy chain and light chain be the intrachain disulfide bond at regular interval also.One end of every heavy chain has variable region (V H), be thereafter a plurality of constant regions.One end of every light chain has variable region (V L), the other end has constant region; The constant region of light chain is relative with first constant region of heavy chain, and the variable region of light chain is relative with the variable region of heavy chain.It is believed that some amino-acid residues form the interface between the variable region of light chain and heavy chain.
Term " variable " is meant that the sequence of variable region some parts has very big-difference between different antibodies, and they can play a role aspect its concrete antigenic combination and specificity at each antibody specific.Yet this variability is not the whole variable region that is uniformly distributed in antibody.It concentrates in light chain and the variable region of heavy chain in three sections that are called complementary determining region (CDR) hypervariable region.In the variable region more the part of high conservative be called framework (FR).The variable region of natural heavy chain and light chain respectively comprises 4 FR, mainly takes the βZhe Die configuration, is linked to each other by three hypervariable regions, forms ring-type and connects, and can form the part of described βZhe Die structure in some cases.The CDR of every chain closely links to each other by the FR district, and is very close each other, and forms the antigen binding site (seeing Kabat et al., NIHPubl.No.91-3242, Vol.I, pages 647-669 (1991)) of antibody with the CDR of other chain.Constant region is not participated in antibody directly and is combined with antigenic, but shows various effector functions, for example participates in the antibody dependent cellular cytotoxicity effect of antibody.
" antibody fragment " comprises the part of complete antibody, the antigen-binding portion thereof or the variable region part of preferred complete antibody.The example of antibody fragment comprises Fab, Fab ', F (ab ') 2With the Fv fragment; Bivalent antibody (diabodies); Linear antibody (Zapata et al., Protein Eng. 8(10): 1057-1062[1995]); The single-chain antibody molecule; With the multi-specificity antibody that forms by a plurality of antibody fragments.The example of antibody fragment comprises Fab, Fab ', F (ab ') 2And Fv fragment.
Can produce two identical Fabs that respectively have single antigen binding site (being called " Fab " fragment) and remaining " Fc " fragment with papain digestion antibody, the segmental title of Fc has been reacted it and has been easy to the crystalline ability.Through pepsin can produce have two antigen binding sites and still can with the F of antigen cross-linking (ab ') 2Fragment.
" Fv " be contain complete antigen-identification and-minimum antibody fragment of binding site.This district is made up of a variable region of heavy chain and the closely non-covalent dimer that is connected to form of variable region of light chain.In this configuration, three CDR of each variable region interact, at V H-V LThe dimer surface limits an antigen binding site.These six CDR give antibody jointly with antigen-binding specificity.Yet, even single variable region (or F vOn only contain half of three antigen-specific CDR) also have an ability of identification and conjugated antigen, although to compare its avidity lower with complete binding site.
The Fab section also comprises first constant region (CH1) of constant region of light chain and heavy chain.Fab ' fragment is different from Fab fragment part and is, Fab ' has more several residues at the C-terminal in heavy chain CH1 district, comprises one or more halfcystines of antibody hinge region.Fab '-SH in this article refers to those Fab ' that the constant region cysteine residues has at least one free sulfhydryl groups.F (ab ') 2Antibody fragment is produced as the right form of Fab ' fragment at first, has the hinge area halfcystine between them.Other chemical coupling of antibody fragment is well-known.
" light chain " of the antibody of any species of vertebrates (immunoglobulin (Ig)) can be classified as a kind of in two kinds complete dissimilar (being called κ and λ) according to its constant region aminoacid sequence.
Immunoglobulin (Ig) can be divided into different classes according to the aminoacid sequence of its CH.Mainly contain 5 immunoglobulin like protein: IgA, IgD, IgE, IgG and IgM, some of them also can further be divided into " subclass " (isotype), for example IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2.CH corresponding to inhomogeneity antibody is called α, δ, ε, γ and μ.The subunit structure of inhomogeneity immunoglobulin (Ig) and 3-d modelling are well-known.
Term " monoclonal antibody " is meant the antibody from the antibody population of basic homogeneous herein, that is, except the natural sudden change that may exist on a small quantity, each antibody in this antibody population is all identical.Monoclonal antibody has high degree of specificity, only at single antigen site.And opposite with routine (polyclone) antibody preparation that generally includes at the different antibodies of different determinants (epi-position), every kind of monoclonal antibody is at the single determinant on the antigen.The advantage of monoclonal antibody comprises that also they can be next synthetic by the hybridoma cultivation except their specificity, thereby has avoided the pollution of other immunoglobulin (Ig).Qualifier " mono-clonal " shows the characteristics of this antibody, that is, it is from the antibody population of basic homogeneous, and being not interpreted as needs to produce this antibody by any special methods.For example, the monoclonal antibody of using according to the present invention can be passed through by Kohler et al., Nature, 256: 495[1975] the hybridoma method at first described is prepared, and perhaps can be prepared (for example seeing United States Patent (USP) 4,816,567) by the recombinant DNA method." monoclonal antibody " also can utilize for example Clackson et al., Nature, 352: 624-628[1991] andMarks et al., J.Mol.Biol., 222: the described technology of 581-597 (1991) is separated from phage antibody library.Also can be referring to United States Patent (USP) 5,750,373,5,571,698,5,403,484 and 5,223,409, they have described the technology for preparing antibody with phagemid and phage vector.
Monoclonal antibody specifically comprises " chimeric " antibody (immunoglobulin (Ig)) herein, the part of its heavy chain and/or light chain be derived from concrete species or belong to the identical or homology of corresponding sequence of the antibody of antibody specific kind or subclass, but the sequence of the remainder of described chain be derived from another species or belong to the identical or homology of corresponding sequence of the antibody of another antibody type or subclass, monoclonal antibody also comprises the fragment of this antibody-like, as long as they show required biologic activity (United States Patent (USP) 4,816,567; Morrison etal., Proc.Natl.Acad.Sci.USA, 81: 6851-6855[1984]).
" humanization " inhuman (for example mouse) antibody is the gomphosis immunoglobulin that comprises the minmal sequence of non-human immunoglobulin, and immunoglobulin chain or its fragment (such as Fv, Fab, Fab ', F (ab ') 2Or other subsequence of conjugated antigen on the antibody).Most of occasions, humanized antibody is human normal immunoglobulin (receptor antibody), but wherein the CDR residue of a plurality of or whole residues of the complementary determining region of acceptor (CDR) with the inhuman source of mouse, rat or rabbit species antibody (donor antibody) of required specificity, avidity and ability replaces.In some instances, some framework regions (FR) residue of human normal immunoglobulin is replaced by corresponding non-human residue.And humanized antibody can be included in undiscovered residue in the CDR of receptor antibody or input or the framework sequence.These modifications are intended to the performance of further refinement (refine) and maximization antibody.Usually, humanized antibody consists essentially of the whole of at least one (generally including two) variable region, CDR whole or wherein, and FR whole or all be the sequence of human normal immunoglobulin basically basically all corresponding to the corresponding section of non-human immunoglobulin.The also optional at least a portion that comprises constant region for immunoglobulin (Fc) of humanized antibody is at least a portion of people's constant region for immunoglobulin usually.See Jones et al. for details, Nature, 321: 522-525 (1986); Reichmann et al., Nature 332: 323-329[1988]; And Presta, Curr.Op.Struct.Biol., 2: 593-596 (1992).Humanized antibody comprises " primatesization " antibody, wherein the antigen binding domain of this antibody antibody that target antigen immunity macaque (macaque monkey) is produced of using by oneself.The antibody that contains from the residue of Old World monkey (Old Worldmonkey) also can comprise in the present invention.Referring to, for example, United States Patent (USP) 5,658,570; 5,693,780; 5,681,722; 5,750,105; With 5,756,096.
" strand Fv " or " scFv " antibody fragment comprise the V of antibody HAnd V LStructural domain, and these structural domains are present on the single polypeptide chain.Preferred Fv polypeptide is at V HAnd V LAlso comprise a peptide linker between the structural domain, it can make scFv form antigen in conjunction with required structure.See The Pharmacology of Monoclonal Antibodies, vol.113, Rosenburg and Mooreeds., Springer-Verlag, New York, pp.269-315 (1994) about the summary of scFv.
Term " bivalent antibody (diabodies) " is meant the small molecular antibody fragment with two antigen binding sites, and these fragments are at a polypeptide chain (V H-V L) on contain a continuous variable region of heavy chain (V H) and a variable region of light chain (V L).To such an extent as to utilize two structural domains on a kind of too short same chain can't the paired joint, can force the complementary structure territory on these structural domains and another chain to be matched, and form two antigen binding sites.The detailed description of bivalent antibody referring to, as EP 404,097; WO93/11161; And Hollinger et al., Proc.Natl.Acad.Sci.USA, 90: 6444-6448 (1993).
" isolating " polypeptide comprises isolated antibody, be meant from the composition of its natural surroundings identify with separate and/or reclaim those.Impurity component in its natural surroundings is to disturb the diagnosis of this antibody or the material that treatment is used usually, can comprise enzyme, hormone, and other albumen or non-albumen solute.In preferred embodiments, polypeptide can reach following degree through purifying: (1) is pressed the Lowry method and is measured, reach more than 95% of this compound weight, weight more than 99% most preferably, (2) be enough to measure through rotary-cup type sequenator (spinning cup sequenator) at least 15 residues of-terminal amino acid sequence or internal amino acid sequence, perhaps (3) are dyeed to measure and are homogeneous through reduction or non--reductive condition SDS-PAGE and Coomassie blue or preferred silver down.Isolated compound, for example antigen or other polypeptide comprise the original position compound in the reconstitution cell, because at least a composition in the natural surroundings of described compound does not exist.But usually, prepare isolated compound by at least one step purification step.
Word " mark " is used in reference to detectable compound or composition in this article, and it and the direct or indirect coupling of compounds such as antibody or polypeptide form " mark " compound.Mark can detect himself (for example, labelled with radioisotope or fluorescent mark), perhaps, under the situation of enzyme labelling, can the catalytic substrate compound or the chemically changed of composition, this change can detect.
" solid phase " is meant that The compounds of this invention can adherent with it non-aqueous matrix.The example of solid phase comprises herein, partly or entirely those solid phases of being made by the glass glass of in check aperture (as have), polysaccharide (as agarose), polyacrylamide, polystyrene (polystyrene), polyvinyl alcohol and siloxanes (silicone).In some embodiments, based on context, solid phase can comprise the hole of test panel; In other embodiments, it can be purification column (as an affinity column).This term also comprises the discontinuous solid phase of discrete particles (discrete particle), and as United States Patent (USP) 4,275,149 is described.
" liposome " is by the small molecules vesica (vesicle) that can effectively transport each lipoids, phosphatide and/or the tensio-active agent composition of medicine (as described herein resisting-ErbB2 antibody, and optional chemotherapeutics in addition) to Mammals.The component of liposome is arranged as double-deck form usually, with biomembranous lipid homotaxy.
Herein, term " immunoadhesin " is meant antibody-sample molecule, and it is with the effector functions combination of the binding specificity and the constant region for immunoglobulin of heterologous protein (" adhesin ").On the structure, immunoadhesin comprises the aminoacid sequence with required binding specificity and the fusion of constant region for immunoglobulin sequence, and described aminoacid sequence is different from the antigen recognition and the binding site (being " allos ") of antibody.The adhesin of immunoadhesin molecule part normally comprise at least acceptor or ligand-binding site point in abutting connection with aminoacid sequence.Constant region for immunoglobulin sequence in the immunoadhesin can derive from any immunoglobulin (Ig), as IgG-1, IgG-2, IgG-3 or IgG-4 hypotype, IgA (comprising IgA-1 and IgA-2), IgE, IgD or IgM.
II. The compositions and methods of the invention
A. Preparation PRO301, PRO362, PRO245 or PRO1868 polypeptide
1. Total length PRO301, PRO362, PRO245 or PRO1868 polypeptide
The invention provides new evaluation and isolating nucleotide sequence, be called PRO301 in their code book applications, PRO362, the polypeptide of PRO245 or PRO1868.Particularly, the applicant identifies and has separated coding PRO301, PRO362, and the cDNA of PRO245 or PRO1868 polypeptide sees embodiment for details.The applicant utilizes BLAST and FastA sequence alignment computer program to find, total length native sequences PRO301 (Fig. 2, SEQ ID NO:1), PRO362 (Fig. 3, SEQ ID NO:3), PRO245 (Figure 11, SEQ ID NO:9) and PRO1868 (SEQ ID NO:31) and A33 antigen and JAM have significant homology.(see Fig. 1,12-18).Therefore, be sure of the disclosed PRO301 of the application, PRO362 at present, PRO245 and PRO1868 are the new members who identifies of A33 antigen protein family, and they may be relevant as inflammatory diseasess such as colorectal cancers with the ND (neoplastic disease) such as inflammatory bowel disease and people.
2. PRO301, PRO362, PRO245 or PRO1868 variant
Except total length native sequences PRO301 described herein, PRO362, PRO245 or PRO1868 the invention still further relates to preparation PRO301, PRO362, PRO245 or PRO1868 variant.PRO301, PRO362, PRO245 or PRO1868 variant can be introduced PRO301 respectively by the Nucleotide variation that will be fit to, PRO362, PRO245 or PRO1868DNA, and/or by synthetic required PRO301, PRO362, PRO245 or PRO1868 polypeptide prepare.It will be understood by those skilled in the art that amino acid whose variation can change PRO301, PRO362, the translation post-treatment of PRO245 or PRO1868 for example changes the number or the position of glycosylation site, or changes the film anchor and characteristic.
Arbitrary technology of for example conservative sudden change of use and non-conservative sudden change and guide are (as United States Patent (USP) 5,364,934 is described), can be at natural full length sequence PRO301, PRO362 is among PRO245 or the PRO1868, perhaps at PRO301 described herein, PRO362 makes variation in the various structural domains of PRO245 or PRO1868.Variation can be coding PRO301, PRO362, the replacement of one or more codons of PRO245 or PRO1868, disappearance or insertion, it causes described PRO301, PRO362, PRO245 or PRO1868 aminoacid sequence be with respect to native sequences PRO301, PRO362, and PRO245 or PRO1868 change.Randomly, described variation is at PRO301, PRO362, and at least one amino acid is by any other aminoacid replacement in one or more structural domain of PRO245 or PRO1868.With PRO301, PRO362, PRO245 or PRO1868 sequence and homologous known protein molecule compare, and make the varied number minimum of aminoacid sequence in the height homologous region, can formulate governing principle, determine which amino-acid residue can be inserted into, replaces or lack and to the no negative impact of required activity.Aminoacid replacement can be that an amino acid is had the result of the amino-acid substitution of similar structures and/or similar chemical property by another, as Serine displacement leucine, i.e. conservative amino acid replacement.Inserting or lack can be randomly in about 1～5 amino acid whose scope.By in sequence, systematically carrying out aminoacid insertion, disappearance or replacement and detecting the activity of gained variant in the described in vitro tests of embodiment chapters and sections, can determine the variation that can allow.
Variation can utilize oligonucleotide mediated (fixed point) mutagenesis, and methods known in the art such as L-Ala scanning and PCR mutagenesis produce.Can to clone DNA carry out site-directed mutagenesis [Carter et al., Nucl.Acids Res,, 13: 4331 (1986); Zoller et al., Nucl.Acids Res., 10: 6487 (1987)], cassette mutagenesis [Wells et al., Gene, 34: 315 (1985)], restriction enzyme selection mutagenesis [Wellset al., Philos.Trans.R.Soc.London SerA, 317: 415 (1986)] or other known technology, PRO301 produced, PRO362, PRO245 or PRO1868 modification D NA.
Also can adopt scanning amino acid analysis to identify one or more amino acid that can change along contiguous sequence.Preferred scanning amino acid is less relatively neutral amino acids.This amino acid comprises L-Ala, glycine, Serine, and halfcystine.L-Ala is preferred scanning amino acid in this group normally, because it has eliminated the side chain outside β-carbon, and seldom changes the main chain conformation of variant.Usually preferred another reason of L-Ala is that it is modal amino acid.In addition, all often find its [Creighton, The Proteins, (W.H.Freeman ﹠amp in embedding position and exposure position; Co., N.Y.); Chothia, J.Mol.Biol., 150: 1 (1976)].If L-Ala replaces the variant that can not produce q.s, can use isomorphism (isoteric) amino acid.
3. Modify PRO301, PRO362, PRO245 or PRO1868
The present invention includes PRO301, PRO362, the covalent modification of PRO245 or PRO1868.A kind of covalent modification comprises, makes PRO301, PRO362, target amino acid residue and the organic derivating agent of PRO245 or PRO1868 react, described organic derivating agent energy and PRO301, PRO362, the selected side chain of PRO245 or PRO1868 or N-or C-terminal residue react.Can be used for difunctional dose of deriving of carrying out, for example, make PRO301, PRO362, PRO245 or PRO1868 be-PRO301 anti-with purifying respectively, and be anti--PRO362, used water-insoluble supported matrix or surface-crosslinked in the method for anti--PRO245 or anti--PRO1868 antibody, vice versa.Linking agent commonly used comprises; for example; 1; two (two azo the ethanoyl)-2-phenylethanes of 1-; glutaraldehyde; N-hydroxyl-succinimide ester as with the salicylic ester of 4-azido-; high bi-functional imido grpup ester (homobifunctional imidoester); comprise that two succinimide esters are as 3; 3 '-dithio two (succinyl phosphorons amino propyl acid ester); bi-functional maleimide ester such as two-N-maleimide-1, the 8-monooctyl ester, and chemical reagent such as methyl-3-[(right-azidophenyl)-dithio] propine imines ester (methyl-3-[(p-azidophenyl) dithio] propioimidate).
Other modification comprise glutaminyl residue and asparaginyl residue respectively deacylated tRNA amine become corresponding glutamy residue and aspartoyl residue, proline(Pro) and Methionin hydroxylation, the hydroxyl phosphorylation of seryl residue or threonyl residue, the alpha-amino group of Methionin, arginine and the Histidine side chain [T.E.Creighton that methylates, Proteins:Structure and Molecular Properties, W.H.Freeman﹠amp; Co., San Francisco, pp.79-86 (1983)], the acetylize of N-terminal amine, and the amidation of any C-terminal carboxyl(group).
The present invention also comprises PRO301, PRO362, and the another kind of covalent modification of PRO245 or PRO1868 polypeptide, it comprises the Natively glycosylated pattern that changes described polypeptide." changing Natively glycosylated pattern " in this article refers to, deletion native sequences PRO301, PRO362, one or more carbohydrate part among PRO245 or the PRO1868, and/or at native sequences PRO301, PRO362 adds one or more non-existent glycosylation site among PRO245 or the PRO1868, and/or change and glycosyl turn to the ratio and/or the composition of the saccharide residue that chain links to each other.
At PRO301, PRO362 adds glycosylation site and can realize by changing aminoacid sequence in PRO245 or the PRO1868 polypeptide.This change can be, for example at native sequences PRO301, PRO362 adds among PRO245 or the PRO1868 or replaces one or more Serine or threonine residues (referring to the glycosylation site that O-connects).Randomly, can be by the variation of dna level, particularly by making coding PRO301, PRO362, previously selected base is undergone mutation among the DNA of PRO245 or PRO1868 polypeptide, and generation will be translated into amino acid needed codon, changes PRO301, PRO362, PRO245 or PRO1868 aminoacid sequence.
Another is at PRO301, PRO362, and the method that increases the quantity of carbohydrate part on PRO245 or the PRO1868 polypeptide is to make glucosides and this polypeptide generation chemical coupling or enzymatic coupling.These class methods can be referring to prior art, for example on September 11st, 1987 disclosed WO 87/05330, and Aplinand Wriston, CRC Crit.Rev.Biochem ., pp.259-306 (1981).
PRO301, PRO362, the carbohydrate part in PRO245 or the PRO1868 polypeptide can be removed with chemical process or enzyme method, perhaps removes by undergoing mutation property of the codon replacement that makes glycosylation target spot amino-acid residue.Chemistry de-glycosylation technology is known in the art, can be referring to for example Hakimuddin, and et al., Arch.Biochem.Biophys ., 259: 52 (1987); Edge et al., Anal.Biochem ., 118: 131 (1981).In the polypeptide enzymatic lysis of carbohydrate part can use various in-and outer-Glycosylase finish, described enzyme can be referring to Thotakura et al., Meth.Enzymol ., 138: 350 (1987).
PRO301, PRO362, the another kind of covalent modification of PRO245 or PRO1868, comprise PRO301, PRO362, a kind of (for example polyoxyethylene glycol, polypropylene glycol or polyoxyalkylene (polyoxyalkylene)) in the polymkeric substance of PRO245 or PRO1868 polypeptide and various non-property of protein is connected the mode of employing such as United States Patent (USP) 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337 is described.
PRO301 of the present invention, PRO362, PRO245 or PRO1868 polypeptide also can form chimeric molecule through modifying, comprise PRO301, and PRO362, PRO245 or PRO1868 and another heterologous polypeptide or aminoacid sequence merge.In one embodiment, described chimeric molecule contains PRO301, PRO362, and the fusion of PRO245 or PRO1868 and label polypeptide, label polypeptide wherein provides can be by the epi-position of anti--tag antibody selective binding.The epi-position label generally is positioned at PRO301, PRO362, amino-end of PRO245 or PRO1868 or carboxyl-end.This type of has the PRO301 of epi-position label, PRO362, and the existence of PRO245 or PRO1868 can be used the antibody test of anti-label polypeptide.In addition, provide the epi-position label also to make PRO301, PRO362, PRO245 or PRO1868 can utilize anti--tag antibody or another kind of and this epi-position label bonded affinity matrix to carry out purifying by affinity purification at an easy rate.In another embodiment, chimeric molecule can comprise PRO301, PRO362, the fusion in the concrete zone of PRO245 or PRO1868 and immunoglobulin (Ig) or immunoglobulin (Ig).For the chimeric molecule of bivalent form, described fusion can be the fusion with IgG molecule Fc district.
Various label polypeptide and separately antibody be known in the art.Example comprises poly--Histidine (poly-his) or poly--HIS-GLY (poly-his-gly) label; Flu HA label polypeptide and antibody 12CA5[Field et al. thereof, Mol.Cell.Biol., 8: 2159-2165 (1988)]; C-myc label and 8F9 thereof, 3C7,6E10, G4, B7 and 9E10 antibody [Evan et al., Molecular and CellularBiology, 5: 3610-3616 (1985)]; Herpes simplex virus glycoprotein D (gD) label and antibody thereof [Paborsky et al., Protein Engineering, 3(6): 547-553 (1990)].Other label polypeptide comprise the Flag-peptide [Hopp et al., BioTechnology, 6: 1204-1210 (1988)]; The KT3 epitope peptide [Martin et al., Science, 255: 192-194 (1992)]; Alpha-tubulin epitope peptide [Skinner et al., J.Biol.Chem ., 266: 15163-15166 (1991)]; With T7 gene 10 protein peptide tags [Lutz-Freyermuth et al., Proc.Natl.Acad.Sci.USA, 87: 6393-6397 (1990)].
4. The preparation and separate PRO301, PRO362, PRO245 or PRO1868
Below description relate generally to, with comprising PRO301, PRO362, the carrier conversion or the transfectional cell of PRO245 or PRO1868 nucleic acid prepare PRO301, PRO362, PRO245 or PRO1868 by cultivating described cell.Certainly also relate to, prepare PRO301 with alternative approach method well known in the art, PRO362, PRO245 or PRO1868.For example, PRO301, PRO362, PRO245 or PRO1868 sequence or its part can utilize solid phase technique by direct peptide synthesis prepare [referring to, for example, Stewart et al., Solid-Phase Peptide Synthesis, W.H.Freeman Co., SanFrancisco, CA (1969); Merrifield, J.Am.Chem.Soc ., 85: 2149-2154 (1963)].External albumen is synthetic can manually to carry out or carry out automatically.Automatically synthetic can, (Foster City CA) finishes according to producer's explanation for example to use AppliedBiosystems Peptide Synthesizer.PRO301, PRO362, the each several part of PRO245 or PRO1868 can be distinguished chemosynthesis, utilizes chemical process or enzymatic means to be combined into total length PRO301 then, PRO362, PRO245 or PRO1868.
A. Separate coding PRO301, PRO362, the DNA of PRO245 or PRO1868
Coding PRO301, PRO362, the DNA of PRO245 or PRO1868 can obtain from the cDNA library, described cDNA library is to have PRO301 from it is believed that, PRO362, PRO245 or PRO1868mRNA and with detectable horizontal expression PRO301, PRO362, the tissue preparation of PRO245 or PRO1868.Correspondingly, people's PRO301, PRO362, PRO245 or PRO1868 DNA can obtain from the cDNA library of people's tissue preparation easily, as described in embodiment.Coding PRO301, PRO362, the gene of PRO245 or PRO1868 also can obtain from genomic library, or obtains by oligonucleotide is synthetic.
The library can use probe (as anti-PRO301, PRO362, the antibody of PRO245 or PRO1868 or have oligonucleotide at least about 20-80 base) screening, described probe is to be designed for the probe of differentiating target gene or its encoded protein.Can carry out with standard method with selected probe screening cDNA or genomic library, as Sambrook et al., Molecular Cloning:A Laboratory Manual (New York:Cold Spring Harbor Laboratory Press, 1989) is described.Separate coding PRO301, PRO362, another selected for use method of the gene of PRO245 or PRO1868 be to use PCR method [Sambrook et al., document is the same; Dieffenbach et al., PCR Primer:ALaboratory Manual (Cold Spring Harbor Laboratory Press, 1995)].
Following embodiment describes the technology in screening cDNA library.The oligonucleotide sequence that is elected to be probe should have enough length and enough clear, so that make false positive the probability minimum occur.Oligonucleotide is mark preferably, so as it can by with the library of screening in DNA hybridization be detected.Marking method is well known in the art, comprise use radio-labeling as 32The ATP of P-mark, vitamin H or enzyme labelling.Hybridization conditions comprises the hybridization conditions that moderate is strict and highly strict, sees Sambrook etc., and document is the same.
The sequence identified in this type of library screening method and other known array that leaves in public database such as GenBank or other the privately owned sequence library can be compared.The sequence identity of designated area or full length sequence (amino acid levels or nucleotide level) can be used BLAS T, BLAST-2 in the molecule, ALIGN, computer software programs such as DNAstar and INHERIT determine that by sequence alignment described software program adopts various algorithm measurement homologys.
By using the disclosed first putative amino acid sequence of this paper, and in case of necessity, the conventional primer extension method that (document are the same) such as use Sambrook described, detect and be not reversed precursor and the processing intermediate of record, can obtain to have the nucleic acid of albumen coded sequence from selected cDNA or genomic library for the mRNA of cDNA.
B. The selection of host cell and conversion
Host cell is with preparing PRO301 herein, PRO362, the expression vector that PRO245 or PRO1868 are used or cloning vector transfection or conversion, in conventional nutritional medium, cultivate, described substratum is improved the gene of make it to be suitable for evoked promoter, selecting transformant or the required sequence of amplification coding.Culture condition such as substratum, temperature, pH etc. can be selected without loaded down with trivial details experiment by the professional and technical personnel.Usually, make principle, scheme and the practical technique of cell culture maximum production can be referring to Mammalian Cell Biotechnology:A Practical Approach, M.Butler, ed. (IRL Press, 1991) and Sambrook et al., document is the same.
Transfection method is that those skilled in the art are known, for example, and CaPO and electroporation.According to used host cell, use the standard technique that is suitable for this host cell to transform.Utilize calcium chloride to carry out the method (see Sambrook etc., document is the same) that calcium handles or electroporation is usually used in prokaryotic cell prokaryocyte or other comprises the cell of firm cell walls barrier.The infection of carrying out with Agrobacterium tumefaciens (Agrobacteriumtumefaciens) can be used to transform some vegetable cells, referring to Shaw et al., and Gene, 23: on June 29th, 315 (1983) and 1989 disclosed WO 89/05859.For the Mammals that does not have described cell walls, can use Graham and van der Eb, Virology, 52: the described calcium phosphate precipitation method of 456-457 (1978).Total situation that the mammalian cell host system transforms is at United States Patent (USP) 4,399, the existing description in 216.Yeast conversion is usually according to Van Solingen et al., J.Bact ., 130: 946 (1977) and Hsiao et al., Proc.Natl.Acad.Sci. (USA), 76: 3829 (1979) described methods are carried out.Yet, also can use other method of DNA being introduced cell, for example examine microinjection, electroporation, bacterium protoplastis and intact cell or polycation such as polybrene (polybrene), poly ornithine fusion.The whole bag of tricks of transformed mammalian cell can be referring to Keown et al., Methods inEnzymology, 185: 527-537 (1990) and Mansour et al., Nature, 336: 348-352 (1988).
Be suitable for cloning or expressing the host cell of the DNA in the carrier described herein, comprise the cell of prokaryotic organism, yeast or higher eucaryote.The prokaryotic organism that are fit to include but not limited to eubacterium, as Gram-negative or gram positive bacterium, and enterobacteriaceae (Enterobacteriaceae) for example, as Escherichia (Escherichia), for example, intestinal bacteria (E.coli).Multiple coli strain is that the public can obtain, for example e. coli k12 strain MM294 (ATCC 31,446); Intestinal bacteria X1776 (ATCC 31,537); Coli strain W3110 (ATCC 27,325) and K5 772 (ATCC53,635).
Except prokaryotic organism, eukaryotic microorganisms such as filamentous fungus or yeast also are to be suitable for the clone or to express coding PRO301, PRO362, the host of the carrier of PRO245 or PRO1868.Yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) is the most frequently used low microorganism such as eucaryon host such as grade.
Be suitable for expressing glycosylation PRO301, PRO362, the host cell of PRO245 or PRO1868 is from multicellular organism.The example of invertebral zooblast comprises insect cell, for example fruit bat (Drosophila) S2 and greedy noctuid (Spodoptera) Sf9, and vegetable cell.The example Chinese hamster ovary (CHO) and the COS cell of effective mammalian host cell line.Example comprises more specifically, through the monkey kidney CV1 cell (COS-7, ATCC CRL 1651) of SV40 conversion; HEKC (293 or 293 cells can be grown in suspension culture through subclone, Graham et al., and J.Gen Virol., 36: 59 (1977)); Chinese hamster ovary cell/-DHFR (CHO, Urlaub and Chasin, Proc.Natl.Acad.Sci.USA, 77: 4216 (1980)); Mouse podocyte (sertoli cell) (TM4, Mather, Biol.Reprod., 23: 243-251 (1980)); Human pneumonocyte (W138, ATCC CCL 75); People's liver cell (Hep G2, HB 8065); And the mouse mammary tumor cell (MMT 060562, ATCCCCL51).Selecting the suitable host cell is the interior thing of art technology category.
C. Select and use replicating vector
Can be with coding PRO301, PRO362, the nucleic acid of PRO245 or PRO1868 (for example cDNA or genomic dna) inserts in the replicating vector, so that clone (DNA cloning) or expression.Variety carrier is that the public can obtain.Carrier can be, for example the form of plasmid, clay, virion or phage.Can make ins all sorts of ways inserts carrier with suitable nucleotide sequence.Usually, utilize technology known in the art that DNA is inserted into suitable restriction endonuclease site.Carrier component generally comprises but is not limited to: one or more signal sequences, replication orgin, one or more marker gene, enhancer element, promotor and transcription termination sequence.The appropriate carrier that comprises one or more described component can use standard interconnection technique well known to those skilled in the art to make up.
PRO301, PRO362, PRO245 or the PRO1868 preparation of not only can directly recombinating also can be prepared into the fusion polypeptide with heterologous polypeptide, and described heterologous polypeptide is signal sequence or other polypeptide that has the specificity cracking site at the N-terminal of maturation protein or polypeptide.Usually, signal sequence is a component of carrier, or inserts the PRO301 of this carrier, PRO362, the part of PRO245 or PRO1868 DNA.Signal sequence can be to be selected from for example prokaryotic signal sequence of alkaline phosphatase, penicillinase, 1pp or thermally-stabilised enterotoxin 1 I leader.In the situation of yeast secretary, signal sequence can be for example yeast invertase leader, alpha factor leader (the alpha factor leader that comprises sugar yeast (Saccharomyces) and kluyveromyces (Kluyveromyces), the latter is at United States Patent (USP) 5,010, state in 182), or acid phosphatase leader, Candida albicans (C.albicans) glucoamylase leader (April 4 nineteen ninety disclosed EP 362,179), the perhaps signal described in the disclosed WO90/13646 on November 15 nineteen ninety.When mammalian cell expression, can use mammalian signal sequence direct secretion albumen, as derive from the signal sequence and the viral secretory leader of the secreted polypeptides of same species or relevant species.
Expression vector and cloning vector all contain the nucleotide sequence that carrier is duplicated in one or more selected host cell.This class sequence in various bacteria, yeast and the virus is well-known.Replication orgin from plasmid pBR322 is suitable for most of gram negative bacteriums, and 2 μ plasmid replication starting points are suitable for yeast, and various virus replication starting points (SV40, polyomavirus, adenovirus, VSV or BPV) are suitable for cloning vector in the mammalian cell.
Expression vector and cloning vector comprise the selection gene usually, are also referred to as selective marker.The typical gene coded protein of selecting, this albumen (a) provides microbiotic or other toxin, resistance as penbritin, Xin Meisu, methotrexate or tsiklomitsin etc., (b) remedy auxotrophy, or (c) provide the crucial nutritive substance that from complex medium, can not obtain, the gene of genus bacillus (Bacilli) the D-alanine racemase of for example encoding.
Being suitable for the selective marker example of mammalian cell, is that those enable to admit PRO301, PRO362, the mark that the cell of PRO245 or PRO1868 nucleic acid obtains identifying, for example DHFR or thymidine kinase.When using wild-type DHFR, appropriate host cell is the active defective type Chinese hamster ovary celI of a DHFR system, and it can be according to Urlaub et al., Proc.Natl.Acad.Sci.USA, 77: 4216 (1980) described preparation and amplifications.The selection gene that is suitable in yeast, using be present in trp1 gene among the yeast plasmid YRp7 [Stinchcomb et al., Nature, 282: 39 (1979); Kingsman et al., Gene, 7: 141 (1979); Tschemper et al., Gene, 10: 157 (1980)].The trp1 gene for the yeast mutant (for example ATCC 44076 or PEP4-1) that can not in tryptophane, grow provide selective marker [Jones, Genetics, 85: 12 (1977)].
Expression vector and cloning vector contain and PRO301 usually, PRO362, and PRO245 or PRO1868 nucleotide sequence can be operated continuous promotor, and be synthetic to instruct mRNA.Promotor by various potential host cell identifications is well-known.Be applicable to the promotor of prokaryotic hosts, comprise β-Nei Xiananmei and lactose promoter systems [Chang et al., Nature, 275: 615 (1978); Goeddel etal., Nature, 281: 544 (1979)], alkaline phosphatase, tryptophane (trp) promoter systems [Goeddel, Nucleic Acids Res ., 8: 4057 (1980); EP 36,776] and hybrid promoter such as tac promotor [deBoer et al., Proc.Natl.Acad.Sci.USA, 80: 21-25 (1983)].The promotor that is applicable to bacterial system also contains and coding PRO301, and PRO362, the DNA of PRO245 or PRO1868 can operate continuous Shine-Dalgarno (S.D.) sequence.
Be applicable to the example of the initiating sequence of yeast host, comprise glycerol 3-phosphate acid kinase [Hitzemanet al., J.Biol.Chem ., 255: 2073 (1980)] or other glycolytic ferment [Hess et al., J.Adv.Enzyme Reg., 7: 149 (1968); Holland, Biochemistry, 17: 4900 (1978)] promotor, described other glycolytic ferment such as Hydratase, phosphoenolpyruvate, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvic carboxylase, phosphofructokinase, the G-6-P isomerase, glycerol 3-phosphate mutase, pyruvate kinase, triosephosphate isomerase, glucose phosphate isomerase and glucokinase.
Other Yeast promoter, be those inducible promoters with the additional advantage of transcribing by growth conditions control, be the promoter region of following gene: alcoholdehydrogenase 2, different cell pigment C, acid phosphatase, degrading enzyme, metallothionein(MT), the glyceraldehyde-3-phosphate dehydrogenase relevant, and the enzyme of being responsible for utilizing maltose and semi-lactosi with nitrogen metabolism.Be applicable to the carrier of yeast expression and promotor at EP73, further describe in 657.
In mammalian host cell, transcribe PRO301 from carrier, PRO362, PRO245 or PRO1868 are controlled by following promotor can, described promotor is from viral genome such as polyomavirus, bird pox virus (fowlpox, on July 5th, 1989 disclosed UK 2,211,504), adenovirus (as adenovirus 2), bovine papilloma virus, avian sarcomata virus, cytomegalovirus, retrovirus, hepatitis B virus and simian virus 40 (SV40), perhaps from the mammiferous promotor of allos, as actin promoter or immunoglobulin promoter etc. with from the heat-shocked promotor, prerequisite is that these promotors are compatible with host cell systems.
Coding PRO301, PRO362, the DNA of PRO245 or PRO1868 transcribing in higher eucaryote can increase by insert enhancer sequence in carrier.Enhanser is the DNA cis-acting elements, and general about 10～300bp acts on promotor and transcribes to increase it.The enhancer sequence of multiple mammalian genes (globin, elastoser, albumin, alpha-fetoprotein and Regular Insulin) is known.Yet people use the enhanser of eukaryotic cell virus usually.Example is included in the SV40 enhanser of replication orgin side in late period (late side, bp 100-270), and the sub-enhanser of cytomegalovirus early promoter is at the polyomavirus enhanser and the adenovirus enhanser of replication origin side in evening.Can and insert PRO301 with the enhanser montage, PRO362,5 ' or 3 ' side of PRO245 or PRO1868 encoding sequence, but be preferably placed at 5 ' side of promotor.
Be used for the expression vector of eukaryotic host cell (yeast, fungi, insect, plant, animal, people or from the karyocyte of other multicellular organism), also comprise stopping transcribing and the necessary sequence of stable mRNA.These sequences are usually from 5 ' (being 3 ' once in a while) non-translational region of eucaryon or viral DNA or cDNA.These zones comprise be transcribed into the coding PRO301, PRO362, the segmental Nucleotide section of polyadenylation in the non-translational region of the mRNA of PRO245 or PRO1868.
In the recombinant vertebrate cell cultures, adapt to PRO301, PRO362, PRO245 or other proper method of PRO1868 synthetic, carrier and host cell are seen Gething et al., Nature, 293: 620-625 (1981); Mantei et al., Nature, 281: 40-46 (1979); EP 117,060; EP117,058.
D. Detect gene amplification/expression
Gene amplification and/or expression can directly be measured in sample, for example, use the probe of suitable mark, by the Northern trace [Thomas of conventional Southern trace, the mensuration mRNA amount of transcribing according to sequence provided herein, Proc.Natl.Acad.Sci.USA 77: 5201-5205 (1980)], Dot blot (DNA analysis) or in situ hybridization measures.Perhaps, can use the antibody that can discern specific two strands, described two strands comprises dna double chain, RNA two strands and DNA-RNA heterozygosis two strands or DNA-albumen two strands.This antibody of mark is tested, and in the test, two strands is incorporated into the surface, makes by forming two strands on this surface, detects the existence with this two strands bonded antibody.
Perhaps, genetic expression can be used determination of immunological methods, carries out immunohistochemical staining as pair cell or tissue slice, and pair cell culture or body fluid are analyzed, thereby direct quantitative is measured the expression of gene product.Can be used for the antibody that immunohistochemical staining and/or sample liquid are analyzed, can be monoclonal antibody or polyclonal antibody, and can in any Mammals, prepare.Can prepare anti-native sequences PRO301 easily, PRO362, the antibody of PRO245 or PRO1868 polypeptide, or the antibody of anti-synthetic peptide based on dna sequence dna provided herein, perhaps resist and PRO301, PRO362, the antibody of the exogenous array of PRO245 or PRO1868 DNA fusion and coding specific antibody epi-position.
E. The purifying of polypeptide
The PRO301 of various ways, PRO362, PRO245 or PRO1868 can reclaim from substratum or from the host cell lysate.In the situation of film combining form, can use suitable detergent solution (for example Triton-X 100) or discharge from described film by enzymatic lysis.PRO301, PRO362, PRO245 or PRO1868 express used cell and can use various physics or chemical means to make it to break, as multigelation, ultrasonic, Mechanical Crushing or lysis agent.
Can expect purifying PRO301, PRO362, PRO245 or PRO1868 from recombinant cell protein or polypeptide.Following method is to carry out suitably purified example: fractional separation on ion-exchange column; Ethanol sedimentation; Reversed-phase HPLC; Chromatography on silicon or positively charged ion-exchange resin such as DEAE; Chromatofocusing; SDS-PAGE; Ammonium sulfate precipitation; For example using, Sephadex G-75 carries out gel-filtration; Remove impurity such as IgG with albumin A Sepharose post; The PRO301, PRO362, PRO245 or the PRO1868 that have epi-position-label with the metal chelating column combination.The multiple protein purification process can use, and these methods are well known in the art, can be referring to for example Deutscher, and Methods in Enzymology, 182(1990); Scopes, Protein Purification:Principles and Practice, Springer-Verlag, New York (1982).The selection purification step depends on, for example employed preparation method and the concrete PRO301 that is produced, PRO362, the character of PRO245 or PRO1868.
F. Detect cell interaction
In order to determine whether polypeptide of the present invention is transport molecules (trafficking molecule) or immunoadhesin molecule, can carry out multinomial in vitro tests.
1) flow cytometry/facs analysis
In order to determine PRO301, PRO362, the interaction of PRO245 or PRO1868 and specific cell type, can prepare biotinylation human IgG fusion rotein, as PRO301-human IgG fusion rotein, PRO362-human IgG fusion rotein, PRO245-human IgG fusion rotein or PRO1868-human IgG fusion rotein.With the interactional cell of biotinylation fusion rotein, can separate with Streptavidin coupling type magnetic bead.Can also further identify and analyze surperficial CD-Ag expression by flow cytometry and/or FACS letter sorting art with the interactional cell of biotinylation fusion rotein.Can comprise with biotinylation PRO301-human IgG fusion rotein, PRO362-human IgG fusion rotein, PRO245-human IgG fusion rotein or the interactional cell of PRO1868-human IgG fusion rotein on inspection, peripheral blood cells for example, as NK cell, NK/T cell or cytotoxic T cell, more specifically comprise, the B cell of purifying, neutrophil leucocyte, monocyte, or dendritic cell.
To PRO301, PRO362, interactional inhibition between PRO245 or PRO1868 and the specific cell type, particularly resist-PRO301, anti--PRO245, anti--PRO362 or anti--antibody such as PRO1868 suppress the ability of this class cell interaction, can further identify by inhibition test.
2) co-immunoprecipitation
Identifying and PRO301 that PRO362 after the interactional cell of PRO245 or PRO1868-, can further analyze, identifying and be responsible for PRO301, PRO362, the interactional concrete acceptor of PRO245 or PRO1868.For example, can carry out the co-immunoprecipitation test, identify acceptor with the interactional cell surface of PRO245.Can will resist PRO245 antibody to be incubated with PRO245-interaction cell.Then, immunoprecipitate carries out SDS-PAGE analysis and immunoblotting with the antibody of anti-potential acceptor.In order to determine whether the PRO245 acceptor belongs to the albumen of JAM protein family, and the antibody that uses in the immunoblotting can comprise anti--PRO301, anti--PRO362 or anti--PRO1868.This alanysis can cause identifying the paired interaction protein of A33/JAM adhesion molecule family.
5. Tissue distribution
Expressing the location of the tissue of polypeptide of the present invention can pass through, and mRNA expression or the protein expression for example measured in various people's tissues are determined.The location of this genoid provides about which is organized stimulating activity that most possibly is subjected to polypeptide of the present invention or the information that suppresses activity influence.The location of gene in concrete tissue also provides following active blocking test used sample tissue.
The expression of gene in various tissues can be used the probe of suitable mark according to sequence provided herein, by conventional Southern trace, measure the mRNA amount of transcribing the Northern trace (Thomas, Proc.Natl.Acad.Sci.USA, 77: 5201-5205[1980]), Dot blot (DNA analysis) or in situ hybridization measures.Perhaps, can use the antibody that can discern specific two strands, described two strands comprises dna double chain, RNA two strands and DNA-RNA heterozygosis two strands or DNA-albumen two strands.
Perhaps, the expression of gene in various tissues can be used determination of immunological methods, and as tissue slice is carried out immunohistochemical staining, pair cell culture or body fluid are analyzed, thereby direct quantitative is measured the expression of gene product.Can be used for the antibody that immunohistochemical staining and/or sample liquid are analyzed, can be monoclonal antibody or polyclonal antibody, and can in any Mammals, prepare.The antibody that can prepare anti-native sequences polypeptide of the present invention easily, or the antibody of the synthetic peptide of anti-dna sequence dna based on code book invention polypeptide, perhaps anti-DNA with code book invention polypeptide merges and the antibody of the exogenous array of the specific antibody epi-position of encoding.The technology of preparation antibody, and the concrete grammar of Northern trace and in situ hybridization sees below.
6. The research of antibodies
The activity of polypeptide of the present invention can further be confirmed by antibodies research.In this research, detect anti--PRO301, anti--PRO362, anti--PRO245 or anti--PRO1868 antibody suppress PRO301, PRO362, the ability that PRO245 or PRO1868 polypeptide are expressed on histocyte.The antibody example comprises polyclonal antibody, monoclonal antibody, humanized antibody, bi-specific antibody and allos coupling antibody, and their preparation will be described below.
Antibodies research can be adopted methods known in the art, in conjunction with test, direct and indirect sandwich test, reaches the immunoprecipitation test as competition.Zola，Monoclonal Antibodies：A Manual ofTechniques，pp.147-158(CRC Press，Inc.，1987)。
The standard substance that CBA depends on mark combine the ability of the antibody of limited amount with the competition of specimen analyte.The hit amount of standard substance of proteic amount and binding antibody of specimen is inversely proportional to.For ease of the amount of the standard substance of measuring combining form, preferred antibody was insoluble before or after competition, like this can be easily making a distinction with the standard substance of antibodies and the standard substance and the analyte of analyte and maintenance unbound state.
Sandwich test relates to uses two kinds of antibody, and each antibody can be in conjunction with testing protein different immunogenicity part or epi-position.In a sandwich test, the first antibody at first making the specimen analyte and being fixed on solid carrier combines, and then second antibody is combined with analyte, thereby forms insoluble three component mixtures.Referring to for example United States Patent (USP) 4,376,110.But second antibody can be itself to be marked with test section (direct sandwich test), but perhaps can have the anti--immune globulin antibody of test section to measure (indirect sandwich test) by applying marking.For example, one type sandwich test is the ELISA test, but wherein the test section is an enzyme.
For immunohistochemistry, tissue sample can be fresh or refrigerated, or is embedded in the paraffin also with sanitas such as formalin fixed.
7. Test based on cell
Test and immune correlated disease animal model based on cell can be used for further understanding the interaction between this paper genes identified and the polypeptide, and the development of immune correlated disease and mechanism of causing a disease.
In another approach, the cell of the cell type of the concrete immune correlated disease of known participation can be analyzed the ability that these cDNA change immunologic function with cDNA transfection described herein.Suitable cell can be used required gene transfection, and monitoring immunologic function activity.This ability that can be used for checking polyclonal antibody or monoclonal antibody or antibody compositions change immunologic function then through cells transfected system for example, is regulated the ability of T cell proliferation or inflammatory cell infiltration.Encoding sequence cells transfected by this paper genes identified can be further used in the drug candidate of identifying the treatment immune correlated disease.
In addition, can in the experiment based on cell described herein, use from the primary cultures (as following) of transgenic animal, but preferred stable clone.From transgenic animal derive the technology of continuous cell line be known in the art (referring to, for example, Small et al., Mol.Cell.Biol. 5, 642-648[1985]).
A kind of suitable test based on cell is mixed lymphocyte reacion (MLR).CurrentProtocols in Immunology, unit 3.12; Editor J E Coligan, A M Kruisbeek, D HMarglies, E M Shevach, W Strober, National Institutes of Health, the JohnWiley ﹠amp of publisher; Sons, Inc.In this test, tested the ability of test-compound stimulation activated T cell proliferation.The reaction-ive T cell suspension with cultivating as the cell of allogeneic stimulator (allogenic stimulator), is measured the propagation of T cell by the absorption of tritium-labeled thymidine.This test is a general approach of measuring t cell responses.IL-2 is replied and produced in the back because most T cells are upset, and reactive difference can partly reflect the difference that the IL-2 of responsive cell generates in this test.MLR result can detect by the lymphokine (IL-2) of standard and verify.Current Protocols in Immunology, document is the same, and 3.15,6.3.
Proliferative T lymphocyte is replied and can be replied owing to mitogenesis in the MLR test, perhaps can be owing to the stimulation responses due to the T cell.The method of the T cell-stimulating activity of another kind of check polypeptide of the present invention is collaborative irritant test.The T cell activation need be by the antigen-specific signal of major histocompatibility complex (MHC) mediation with by second part association reaction (for example, costimulatory signal of B7 (CD80, CD86)/CD28 association reaction) mediation.The crosslinked secretion that can increase the activated T cell of CD28 to lymphokine.The T cell activation is subjected to passive and actively control by combining with the part with passiveness or positive influence.CD28 and CTLA-4 are in conjunction with the associated glycoprotein of B7 in the Ig superfamily.CD28 combines with B7 can actively stimulate the T cell activation; On the contrary, CTLA-4 combines with B7 and has the passive T cell effect of deactivating.Chambers，C.A.and Allison，J.P.，Curr.Opin.Immunol.(1997)9：396；Schwartz，R.H.，Cell(1992)71：1065；Linsley，P.S.and Ledbetter，J.A.，Annu.Rev.Immunol.(1993)11：191；June，C.H.et al，Immunol.Today(1994)15：321；Jenkins，M.K.，Immunity(1994)1：443-446。
In the MLR test, measure polypeptide of the present invention and other compound of the present invention of the stimulator that can be used as the T cell activation, can be used for, for example treat with immunologic hypofunction, immunologic function and do not reach satisfactory level (suboptimal) or the immunologic function deficiency is the immune correlated disease of feature.These diseases can be treated in the following way: the administration irritant compound, as have irritating polypeptide of the present invention, stimulate the propagation and the activation (and the cell-mediated immunizing power of T) of T cell, and strengthen the immunne response in the Mammals.The pungency polypeptide can be PRO301, PRO362, the antibody of PRO245 or PRO1868 polypeptide or their agonist character.The immunological adjuvant therapy that is used for oncotherapy that hereinafter will describe in detail is an example of the purposes of irritant compound of the present invention.With inhibitory polypeptide bonded antibody can enhancing immunity be replied by the retarding effect of eliminating these inhibitory polypeptides.This effect is found in in anti--the test that CTLA-4 antibody carries out that strengthens T cell proliferation, and it may be owing to eliminated CTLA-4 in conjunction with caused inhibition signal.Walunas，T.L.et al，Immunity(1994) 1：405。This purposes also is confirmed in the test of carrying out with 4-1BB glycoprotein, 4-1BB glycoprotein is the member of Tumor Necrosis Factor Receptors family, it combines with the part (4-1BBL) that is expressed in the T cell surface that is subjected to stimulation oversaturation, transmits the signal of T cell activation and growth.Alderson，M.E.et al.，J.Immunol.(1994) 24：2219。Suppress the 4-1BB combination by treating, can increase the severity of graft-vs.-host disease, and can be used to eliminate tumour with the anti-4-1 bb antibody.Hellstrom，I.and Hellstrom，K.E.，Crit.Rev.Immunol.(1998) 18：1。
On the other hand, can be used as polypeptide of the present invention (as the antibody of antagonist properties) and other compound of the present invention of the inhibitor of T cell proliferation/activation and/or lymphokine secretion, can be directly used in the inhibition immunne response.These compounds can be used to weaken the immunne response degree and be used for the treatment of with allergy, super best (superoptimal) replys or autoimmune response is the immune correlated disease of feature.Perhaps, combine and block the antibody of the stimulatory effect of these molecules, can breed by suppressor T cell/activate and/or lymphokine secretion, come the immunne response of suppressor T cell mediation with pungency polypeptide of the present invention.The stimulatory effect of blocking described polypeptide can suppress mammiferous immunne response.
8. Animal model
Use the interior animal model of body further to check based on the cells in vitro test-results.Multiple known animal model can be used for further understanding this paper genes identified in the development of immune correlated disease and the effect in the mechanism of causing a disease, and the effect of other antagonist (comprising the small molecules antagonist) of check candidate therapeutic preparation (comprising antibody) and natural polypeptides.Character makes it especially indicate reaction in the human patients in the body of this kind model.The animal model of immune correlated disease comprises non-reorganization and reorganization (transgenosis) animal.Non-recombinant animal model comprises, for example, and rodents, for example mouse model.This kind model can be by utilizing subcutaneous injection, tail vein injection, and the spleen plantation, intraperitoneal plantation and kidney packing standard technique such as plantation are down introduced cell in the homology mouse and are produced.
Contact hypersensitivity reaction is a kind of simple in vitro tests of measuring cell-mediated immunologic function.In this test, epidermic cell is exposed to external haptens, this haptens can cause delayed type hypersensitivity, measures then and quantitative this reaction.Tactiosensible property comprises initial sensitization phase and follow-up stimulating phase.When epidermic cell suffered from their once contacted antigen, stimulating phase appearred.Swelling and inflammation performance make it to become the splendid model of humans allergic's contact dermatitis.Suitable method can be referring to Current Protocols in Immunology, Eds.J.E.Cologan, A.M.Kruisbeek, D.H.Margulies, E.M.Shevach and W.Strober, John Wiley ﹠amp; Sons, Inc., 1994, unit4.2.See also Grabbe, S.and Schwarz, T, Immun.Today 19(1): 37-44 (1998).
Graft versus host disease comes across in immunologically competent cell is transplanted among immunosuppressed patient or the immunological tolerance patient.Donorcells identification is also replied host antigen.This replys can be from fatal serious inflammation to slight diarrhoea and differing appearance such as lose weight.The graft versus host disease model provides estimates the T cell respectively to the reactive method of MHC antigen and less important transplantation antigen.Suitable method sees Current Protocols in Immunology for details, and document is the same, and unit 4.3.
The animal model of skin allograft rejection is the means (means) of the cell-mediated in-vivo tissue destructive of check T ability, can show and measure the effect of T cell in antiviral immunity and tumour immunity.The most common and received model uses the dermatoplasty of mouse tail.Revision test shows that the skin allograft rejection is cell-mediated by T cell, helper cell and lethal effect T, rather than by antibody-mediated.Auchincloss，H.Jr.and Sachs，D.H.，Fundamental Immunology，2nded.，W.E.Paul ed.，Raven Press，NY，1989，889-992。A kind of suitable method is at Current Protocols in Immunology, and document is the same, describes in detail among the unit 4.4.Other transplant rejection models that can be used for testing The compounds of this invention are Tanabe, M.et al, Transplantation (1994) 58: 23 and Tinubu, S.A.et al, the described allogeneic heart transplantation of J.Immunol. (1994) 4330-4338 model.
The animal model of delayed type hypersensitivity also provides a kind of test of measuring cell-mediated immunologic function.Delayed type hypersensitivity is an immunne response in the cell-mediated body of T, it is characterized in that, antigen was attacked after for some time of back, and inflammation just peaks.These reactions are also shown in the organizing specific systemic autoimmune diseases, such as multiple sclerosis (MS) and experimental autoimmunization encephalomyelitis (EAE is a kind of model of MS).A kind of suitable method sees Current Protocols in Immunology for details, and document is the same, and unit 4.5.
EAE is the cell-mediated autoimmune disease of T, it is characterized in that T cell and monocyte inflammation (inflammation), the aixs cylinder in the central nervous system (axon) demyelination (demyelination) subsequently.EAE is considered to the corresponding animal model of people MS usually.Bolton，C.，Multiple Sclerosis(1995) 1：143。Developed acute model and recurrence-alleviation model (relapsing-remittingmodel) at present.Can use Current Protocols in Immunology, document is the same, units 15.1 and 15.2 described schemes, and the test The compounds of this invention is active at the T cell-stimulating activity or the inhibition of immune-mediated demyelination.Also can be referring to model at myelin (myelin) disease, wherein according to Duncan, I.D.et al, Molec.Med.Today (1997) 554-561 is described, and the perhaps prosperous Schwann Cells of oligodendroglia (oligodendrocyte) (Schwann cell) is transplanted in the central nervous system.
Arthritic animal model is collagen-induced sacroiliitis.It is arthritic clinical that this model has human autoimmune, histology and amynologic characteristic, and be the arthritic acceptable model of human autoimmune.The feature of mouse and rat model all is a synovitis, the destruction of skeletonization under joint and the cartilage.Can use Current Protocols in Immunology, document is the same, the scheme of describing among the units 15.5, the arthritic activity of the test anti-autoimmunity of The compounds of this invention.Also can be referring to Issekutz, A.C.et al., the model of the monoclonal antibody of anti-CD18 of the described use of Immunology (1996) 88:569 and VLA-4 integrin.
The existing document record of asthmatic model, wherein, make animal sensitization also, attack this animal with the same protein of aerosol form then with ovalbumin, induce antigen induction type air flue hyperergy (hyper-reactivity) thus, lung eosinophilia and inflammation.After aerosol antigen contacted, some animal models (cavy, rat, non-human primates) showed the symptom similar to people's atopic asthma.Mouse model has a plurality of features of people's asthma.The activity of test The compounds of this invention treatment asthma and the proper method of validity can be referring to Wolyniec, W.W.et al, Am.J.Respir.Cell Mol.Biol. (1998) 18: 777 and the reference wherein quoted.
In addition, The compounds of this invention also can be tested on the animal model of psoriasis sample disease.The evidence prompting, psoriasis has T cell mechanism of causing a disease.The compounds of this invention can be at Schon, M.P.et al, Nat.Med. (1997) 3: check in the 183 described scid/scid mouse models, the mouse in this model shows similar psoriasic histopathology skin injury.Another suitable model is according to Nickoloff, B.J.et al, Am.J.Path. (1995) 146: the people skin/scid mouse mosaic of 580 described preparations.
Can be when producing transgenic animal used standard technique is introduced the genome of target animal with the encoding part of this paper genes identified, makes reorganization (transgenosis) animal model.The animal that can be used as the target of transgeneic procedure includes, but not limited to mouse, rat, rabbit, cavy, sheep, goat, pig and non-human primates, for example baboon, chimpanzee and monkey.The technology that transgenosis is introduced this kind animal known in the art comprises pronucleus (pronucleic) microinjection (Hopp and Wanger, U.S. Patent No. 4,873,191); By retrovirus-mediated method with transgenosis to reproductive tract (for example, Van der Putten et al., Proc.Natl.Acad.Sci.USA 82, 6148-615[1985]); The gene target embryonic stem cell (Thompson et al., Cell 56, 313-321[1989]); Embryo's electroporation (Lo, Mol.Cell.Biol. 3, 1803-1814[1983]); Transgenosis (Lavitrano et al., the Cell of sperm mediation 57, 717-73[1989]).Summary can be referring to for example United States Patent (USP) 4,736,866.
According to purpose of the present invention, transgenic animal comprise that those have only its part cell to carry genetically modified animal (" mosaic (mosaic) animal ").This transgenosis can be used as single transgene or concatermer (concatamer), and for example head-head or head-tail is connected and is integrated.The transgenosis selectivity is introduced particular cell types, can be by for example Lasko et al., Proc.Natl.Acad.Sci.USA 89, the technology of 623-636 (1992) realizes.
The expression of transgenosis in transgenic animal can be monitored by standard technique.For example, Southern engram analysis or pcr amplification can be used for confirming this genetically modified integration.After this, the mRNA expression levels can be utilized such as in situ hybridization, Northern engram analysis, technical Analysis such as PCR or immunocytochemistry.
Can also check the pathological sign of Immunological diseases in the animal, for example, determine by histological examination whether immunocyte soaks in the particular organization.Also can carry out blocking experiment, wherein use compound treatment transgenic animal of the present invention, measure effect T cell proliferation.In these experiments, will as above-mentioned preparation give animal with polypeptide bonded blocking antibody of the present invention, measure Immune Effects.
Perhaps, can make up " gene is pounded out " animal, it is because the coding change type genomic dna generation homologous recombination of homopolypeptide mutually of the native gene of coding polypeptide described herein and this animal embryo cell of introducing causes this animal to have the gene of this polypeptide of coding of defective or change.For example, can use the cDNA of the concrete polypeptide of coding, come the genomic dna of this polypeptide of clones coding according to existing technology.The part of genomic dna of concrete polypeptide of encoding can lack, or is replaced by for example the encode gene of selective marker of another gene, and described selective marker can be used to monitoring and integrates.Usually, thousands of base pairs of unaltered flanking DNA (5 ' and 3 ' end) be included in the carrier [see for example Thomas andCapecchi, Cell, 51: 503 (1987) descriptions about homologous recombination vector].Carrier is introduced embryonic stem cell line (for example by electroporation introduce), and select the DNA of introducing and those cells that homologous recombination has taken place interior source DNA [see for example Li et al., Cell, 69: 915 (1992)].Then, the injection cell of selecting is arrived in the blastaea (blastocyst) of animal (for example mouse or rat), form aggregation chimera and [see for example Bradley, in Teratocarcinomas and Embryonic Stem Cells:A Practical Approach, E.J.Robertson, ed. (IRL, Oxford, 1987), pp.113-152].Subsequently, chimeric embryo is implanted in the suitable false pregnancy foster animal of female generation, made the embryo growth of implantation, form " gene is pounded out " animal.In its sexual cell, contain those offsprings of homologous recombination DNA, can identify, and be used for cultivating animal, make all cells of described animal all comprise described homologous recombination DNA with standard technique.Clpp gene goes out animal, and for example resisting the ability of some pathologic conditions and their produce pathologic conditions when lacking this polypeptide ability with them is feature.
9. Immune adjuvant therapy
In one embodiment, the compound of the present invention with immune-stimulating effect can be used for the immune adjuvant therapy of tumour (cancer) treatment.Now confirm T cell recognition people's tumour specific antigen.One group by MAGE, and the tumour antigen of the genes encoding of BAGE and GAGE family is all kept silent in all normal adult tissues, but expression amount is very big in such as tumours such as melanoma, lung tumor, tumor of head and neck and bladder cancer.DeSmet，C.et al，(1996)Proc.Natl.Acad.Sci.USA， 93：7149。Show that on evidence the collaborative stimulation of T cell can be disappeared and antitumor replying by induced tumor in vitro and in vivo.Melero，I.et al，Nature Medicine(1997) 3：682；Kwon，E.D.et al，Proc.Natl.Acad.Sci.USA(1997) 94：8099；Lynch，D.H.et al，NatureMedicine(1997) 3：625；Finn，O.J.and Lotze，M.T.，J.Immunol.(1998) 21：114。Irritant compound of the present invention can be used as the auxiliary administration, separately or with growth regulator, cellulotoxic preparation or chemotherapeutics, stimulates T cell proliferation/activation and the antitumor of tumour antigen replied.Described growth regulator, cellulotoxic preparation or chemotherapeutics can be used known dosage regimen, according to the convention amount administration.The immunostimulatory activity of The compounds of this invention can make the amount of growth regulator, cellulotoxic preparation or chemotherapeutics reduce, thereby reduces the toxicity to the patient greatly.
The feature of cancer is, increase from the quantity of healthy tissues deutero-abnormal cells or tumorigenesis sexual cell, these hyperplasias form the tumour entity, the tissue that closes on is invaded by these tumorigenesis tumour cells, produce malignant cell, they send out regional nodes and position (transfer) at a distance gradually by blood system or lymphsystem.In cancerous state, cell generation hyperplasia, and normal cell can not be grown under this condition.The performance of cancer itself has extensive various ways, is feature with in various degree intrusion and gathering (aggressiveness).
The change of genetic expression and cell growth out of control and do not break up closely relatedly, this all is the common trait of all cancers.Some expression through recessive gene in the genome of the abundant tumour of research reduce and/or some dominant genes oncogene of the effect that promotes malignancy (as have) overexpression, these recessive genes are commonly called tumor suppressor gene, and their normal function is to stop the malignant cell growth.As if this each hereditary change all causes introducing some new proterties, and the summation of these proterties forms complete tumorigenesis phenotype (Hunter, Cell 64, 1129[1991]; Bishop, Cell 64, 235-248[1991]).
As everyone knows, the mechanism of gene (for example oncogene) overexpression is gene amplification in the cancer cell.In this process, in the karyomit(e) of ancester cell, produce a plurality of copies of specific gene.This process comprises that the chromosomal region that comprises this gene irregularly duplicates, and the sections that duplicates is then got back to (Alitalo et al., Adv.Cancer Res. in the karyomit(e) again by reorganization 47, 235-281[1986]).The overexpression that it is believed that gene is parallel with gene amplification, and is promptly proportional with the copy number that is produced.
The proto-oncogene (Proto-oncogene) of coding somatomedin and growth factor receptors has been accredited as in the mechanism of causing a disease of various human malignant's diseases (comprising mammary cancer) and has played an important role.For example, finder ErbB2 gene (erbB2 also claims her2, or c-erbB-2) overexpression in the human breast carcinoma of about 25%-30%, this genes encoding 185-kd transmembrane glycopeptide polymeric immunoglobulin receptor (p185 HER2HER2), described acceptor relevant with EGF-R ELISA (EGFR) (Slamon et al., Science 235:177-182[1987]; Slamon et al., Science 244:707-712[1989]).
Report that the gene amplification of proto-oncogene is an incident that more is usually directed in the virulent cancer form, it can indicate clinical consequences (Schwab et al., Genes Chromosomes Cancer 1, 181-193[1990]; Alitalo et al., document is the same).Therefore, the erbB2 overexpression is considered to indicate prognosis mala usually, and especially (document is the same for Slamon et al., [1987] and [1989] in the patient who suffers from the primary disease that relates to axillary lymph knot (axillary lymph node); Ravdin andChamness, Gene 159: 19-27[1995]; Hynes and Stern, Biochim Biophys Acta 1198: 165-184[1994]), and existing people is associated it with susceptibility and/or tolerance to hormonotherapy and chemotherapy regimen, described chemotherapy comprises CMF (endoxan, methotrexate and Fluracil) and anthracene nucleus class (anthracycline) microbiotic (Baselga et al., Oncology 11(3 Suppl 1): 43-48[1997]).Yet although the erbB2 overexpression is relevant with prognosis mala, extremely odd, the HER2-positive patient is treated the ratio HER2-negative patient Senior Three times (the same) that responds to taxane clinically.Recombinant humanized is anti--and ErbB2 is (anti--HER2) monoclonal antibody (the humanization form of mouse-anti-ErbB2 antibody 4D5, also claim rhuMAb HER2 or Herceptin7), clinical application effectively (Baselga et al., J.Clin.Oncol.14:737-744[1996]) in accepting the patient high strength anticancer therapy, that suffer from ErbB2-overexpression metastatic breast cancer.
10. Medicine material standed for shaker test
The drug candidate shaker test is designed to identify, with the polypeptide of genes encoding described herein or its bioactive fragment combines or the compound compound, perhaps disturb the polypeptide expression and/or the active compound of genes encoding described herein, perhaps disturb coded polypeptide and the interactional compound of other cell protein.This type of shaker test comprises the test that is used for chemical library is carried out high flux screening, and this makes them be particularly suitable for identifying the small molecules drug candidate.The small molecules that relates to comprises: synthetic organic or inorganic compound, comprise peptide, particularly soluble peptide, (many) peptide-immunoglobulin-s syzygy, especially antibody, include but not limited to polyclonal antibody and monoclonal antibody and antibody fragment, single-chain antibody, anti--idiotype antibody and this antibody-like or segmental chimeric form or humanization form, and people's antibody and antibody fragment.Test can be carried out according to multiple mode, comprises protein-protein in conjunction with test, biochemical screening test, immunoassay with based on the test of cell, and they all are well known in the art.
The general character of all tests is: they are requirement all, makes the polypeptide of drug candidate and nucleic acid encoding described herein, being enough to allow the enough time of contact under the condition of these two kinds of component interactions, so that these two kinds of component interactions.
In in conjunction with test, interaction is combination, and the mixture that forms can separate from reaction mixture or detect.In one embodiment, be fixed on the solid phase by covalency or non--covalent attachment mode by the polypeptide or the drug candidate of genes encoding described herein, on microtiter plate.Non--covalent attachment is generally by being finished by this solid surface and drying with described polypeptide solution bag.Perhaps, can make polypeptide be fixed to solid surface with being specific to the insolubilized antibody (for example monoclonal antibody) for the treatment of the fixed polypeptide.Test is carried out like this: the non-solid components of adding in solid components (bag that for example contains the component that anchor to some extent is by the surface), described non-solid components can mark on detectable marker.After reaction is finished, remove unreacted component (for example, removing by mode of washing), the detection anchor the mixture at this solid surface.When initial non-solid components has detectable, detect the marker that is fixed on the surface, just show to have formed mixture.If non-at first-solid components does not carry marker, then can utilize, for example, specificity detects in conjunction with the traget antibody of the mixture that is fixed.
If the concrete protein-interacting of candidate compound and genes encoding described herein but do not combine with it can be analyzed and this proteic interaction with the method for known detection protein-protein interaction.This type of analytical procedure comprises traditional method, for example crosslinked, co-immunoprecipitation and be total to-purifying by gradient or chromatography column.In addition, protein-protein interaction can be used based on the zymic genetic system and monitor, and described system can be referring to Fields and colleague's thereof article [Fields and Song, Nature (London) 340, 245-246 (1989); Chien et al., Proc.Natl.Acad.Sci.USA 88, 9578-9582 (1991)] and as disclosed by Chevray and Nathans[Proc.Natl.Acad.Sci.USA 89, 5789-5793 (1991)].Multiple transcriptional activation agent is arranged, and as yeast GAL4, it is made of two fully decentralized assemblies (modular) district, and one is as the DNA-land, and another is as transcriptional activation domain.The yeast expression system of describing in the aforementioned publication (general designation " two hybrid systems (two-hybridsystem) ") has utilized this characteristic, and use two kinds of hybrid proteins, one merges the DNA-land of target protein and GAL4, and another merges candidate's activator and active region.The expression of GAL1-lacZ reporter gene under the control of GAL4-activity promotor depends on the GAL4 activity and rebuilds by protein-protein interaction.Contain of the chromogenic substrate detection of the colony of interaction polypeptide with beta-galactosidase enzymes.Utilize a complete set of test kit (MATCHMAKER of the protein-protein interaction between two two kinds of concrete albumen of hybrid technical evaluation TM) can be purchased from Clontech.This system also can be extended to the protein region that participates in specific protein-interacting is mapped, and finds out these interactional key amino acid residues.
Disturb component or the interactional compound of extracellular component in gene described herein and other cell in order to seek, usually preparation contains in the product of described gene and the cell or the reaction mixture of extracellular component, and prepare used condition and time is enough to allow this two kinds of products to interact and the generation combination.Suppress the bonded ability in order to test test-compound, under the condition that contains and do not contain test-compound, react.In addition, can join placebo in the 3rd reaction mixture, as positive control.According to the method described above, combining between the interior or extracellular component of cell (mixture formation) in monitoring test-compound and the mixture.In control reaction, there is mixture to form, and in containing the reaction mixture of test-compound, do not have mixture to form, then show the interaction between this test-compound intervention test-compound and its reaction counterpart.
11. The composition and the method for treatment immune correlated disease
The composition that can be used for the treatment of immune correlated disease includes but not limited to, the inhibition or the antibody of immune stimulatory function, organic and inorganic molecules, peptide, phosphopeptide (phosphopeptide), antisense molecule and ribozyme molecule, triple helix molecule etc., described immunologic function for example, T cell proliferation/activation, lymphokine discharges, or the immunocyte infiltration, this depends on the disease that will treat.
For example, sense-rna and RNA molecule are by with target mRNA hybridization with stop protein translation and directly block the mRNA translation.When using antisense DNA, preferred source is from translation initiation site (for example the target gene nucleotide sequence be'ss-10～+ 10 approximately) oligodeoxyribonucleotide.
Ribozyme is the RNA molecule that can catalysis RNA specificity cracked has enzymatic property.Ribozyme and complementary target rna carry out sequence-specific hybrid, then carry out cracking in the nucleic acid.Use known technology, can identify the specific ribozyme cracking site that is positioned at the potential rna target.See Rossi for example, Current Biology for details 4, 469-471 (1994) and PCT application WO 97/33551 (on September 18th, 1997 is open).
The nucleic acid molecule that is used to suppress to transcribe when forming triple helix should be a strand, and is made of deoxynucleotide.The based composition of these oligonucleotide designs, and its promotes to form triple helix by the Hoogsteen basepairing rule like this, and this generally needs in the two strands to have on the chain quite long one section purine or pyrimidine sequence.See PCT application WO 97/33551 for details, document is the same.
With above-mentioned any shaker test or its any combination, and/or any other triage techniques well known to those skilled in the art, these molecules can be identified.
12. Antibody
In drug candidate according to the present invention, what prospect (most promising) was arranged most is the antibody and the antibody fragment that can suppress (antagonist) or stimulate (agonist) T cell proliferation, leukocyte infiltration etc.The example of antibody comprises polyclonal antibody, monoclonal antibody, humanized antibody, bi-specific antibody and allos coupling antibody.
A. polyclonal antibody
The method for preparing polyclonal antibody is known for those skilled in the art.Polyclonal antibody can produce in Mammals, for example, causes immunizing agent by the one or many injection, if desired, can add adjuvant.Usually, subcutaneous or abdominal cavity multiple injection causes immunizing agent and/or adjuvant to Mammals.Cause immunizing agent and can comprise PRO301 of the present invention, PRO362, PRO245 or PRO1868 polypeptide or its fragment or its fusion rotein.To cause immunizing agent and known to carry out coupling be effective to had immunogenic albumen by immune Mammals.The example of this immunogenic protein includes but not limited to: keyhole limpet hemocyanin (keyhole limpet hemocyanin), serum albumin, bovine thyroglobulin and Trypsin inhibitor SBTI.The example of operable adjuvant comprises Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl lipid A, synthetic trehalose double blank larynx bacterium acid esters (dicorynomycolate)).Need not loaded down with trivial details test, those skilled in the art just can select immunization protocol.
B. monoclonal antibody
Identification and in conjunction with polypeptide of the present invention, perhaps the antibody that works as its antagonist also can be monoclonal antibody.Monoclonal antibody can prepare with hybridoma method, Kohler and Milstein for example, and Nature, 256: 495 (1975) described methods.In hybridoma method, mouse, hamster or other suitable host animal with causing the immunizing agent immunity, maybe can produce the lymphocyte that causes immunizing agent specificity bonded antibody with this to stimulate those to produce usually.Perhaps, lymphocyte can be in external sensitization.
Cause immunizing agent and generally include PRO301 of the present invention, PRO362, PRO245 or PRO1868 polypeptide or its antigenicity fragment or fusion rotein.Usually, when needs derive from people's cell, use peripheral blood lymphocyte (" PBLs "), when needs derive from the cell of non-human mammal, use splenocyte or lymph-node cell.Then, use suitable fusion reagent such as polyoxyethylene glycol, lymphocyte and immortal cell line are merged, thereby form hybridoma [Goding, monoclonal antibody: Principles and Practice, Academic Press, (1986) 59-103 page or leaf].The mammalian cell that immortal cell line normally transforms, particularly rodents, ox and myeloma cell anthropogenous.Usually use rat or mouse myeloma cell line.Can cultivate hybridoma in appropriate media, described substratum preferably contains one or more and suppresses infinite multiplication cell growth of not merging or the material of surviving.For example, parental cell lacks enzyme hypoxanthine guanine phosphoribosyltransferase (HGPRT or HPRT), and the substratum of hybridoma generally includes xanthoglobulin, aminopterin and thymidine (" HAT substratum "), and these materials suppress the growth of HGPRT-deficient cells.
Preferred immortal cell line is that those can effectively merge, support selected antibody-producting cell with stable high level generation antibody and to the cell of substratum sensitivities such as HAT.More preferably immortal cell line is a rat bone marrow tumour system, and they can be from, Salk Institute Cell Distribution Center for example, San Diego, and California and American type culture collection, Rockville, Maryland obtains.Report that also the heterogeneous myeloma cell line of human myeloma and mouse-people can be used for producing human monoclonal antibodies [Kozbor, J.Immunol ., 133: 3001 (1984); Brodeur et al., MonoclonalAntibody Production Techniques and Applications, Marcel Dekker, Inc., NewYork, (1987) pp.51-63].
Then, can detect anti-polypeptide of the present invention in the substratum of cultivating hybridoma or have existence to the monoclonal antibody of the similar active polypeptide of polypeptide of the present invention.Preferably, the binding specificity of the monoclonal antibody that is produced by hybridoma can pass through immunoprecipitation or external in conjunction with test determination, for example radioimmunoassay of described test (RIA) or enzyme linked immunosorbent assay (ELISA).This class technology and test are known in the art.The binding affinity of monoclonal antibody can, for example use Munson and Pollard, Anal.Biochem., 107: 220 (1980) Scatchard analyzes to determine.
After identifying required hybridoma, these clones are cloned and cultivate [Goding sees above] with standard method with limiting dilution assay.The substratum that is suitable for this purpose comprises that for example, Dulbecco ' s improves Eagle ' s substratum and RPMI-1640 substratum.Alternatively, hybridoma can be grown in mammalian body with the form of ascites.
Above-mentioned clone secreted monoclonal antibody again can be with classical immunoglobulin purification method isolated or purified from substratum or ascites, described method for example, albumin A-Sepharose, hydroxyapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.
The also available recombinant DNA method preparation of monoclonal antibody, as United States Patent (USP) 4,816,567 described methods.The DNA of code book invention monoclonal antibody can easily use ordinary method (for example, with can specific combination the oligonucleotide probe of gene of coding murine antibody heavy chain and light chain) to separate and check order.Hybridoma of the present invention can be used as the preferred source of this type of DNA.In case separate, just this DNA can be placed expression vector, use this expression vector transfection host cell such as monkey COS cell then, Chinese hamster ovary (CHO) cell, or do not generate the albuminous myeloma cell of immune globulin in addition, thereby in recombinant host cell, synthesize monoclonal antibody.Described DNA also can pass through, and for example, the encoding sequence of personnel selection heavy chain and constant region of light chain replaces homology mouse sequence and modifies [United States Patent (USP) 4,816,567; Morrisonet al., document is the same], or by with all or part of encoding sequence of non--immunoglobulin polypeptides and immunoglobulin coding sequence is covalently bound modifies.This class is non--and immunoglobulin polypeptides can replace the constant region of antibody of the present invention, or replace the variable region of an antigen-binding site of antibody of the present invention, thus produce chimeric bivalent antibody.
Antibody is univalent antibody preferably.The method for preparing univalent antibody is known in the art.For example, there is a method to relate to the recombinant expressed of light chain immunoglobulin and modified heavy chain.Heavy chain is usually in any site brachymemma of Fc district, and is crosslinked to prevent heavy chain.Perhaps, Xiang Guan cysteine residues is replaced by another amino-acid residue or lacks to prevent crosslinked.
In vitro method also is suitable for preparing univalent antibody.This area routine techniques digestion antibody be can use, antibody fragment, particularly Fab fragment produced.
C. people's antibody and humanized antibody
Antibody of the present invention also comprises humanized antibody or people's antibody.The humanization form of non--people (for example, mouse) antibody be gomphosis immunoglobulin, immunoglobulin chain or its fragment (as Fv, Fab, Fab ', F (ab ') 2Or other antigens of antibody are in conjunction with subsequence), they comprise few non-human immunoglobulin sequence.Humanized antibody comprises human normal immunoglobulin (receptor's antibody), and wherein the CDR residue of receptor's complementary determining region (CDR) residue with inhuman source species antibody (donor antibody) such as mouse, rat or rabbit of required specificity, avidity and performance replaces.In some instances, the Fv framework region residue of human normal immunoglobulin is replaced by corresponding inhuman residue.Humanized antibody also can comprise all non-existent residue in the CDR of receptor's antibody or introduction or the framework sequence.Usually, humanized antibody consist essentially of at least one, common two variable regions whole, CDR district whole or wherein, and FR district whole or all be the human normal immunoglobulin consensus sequence basically basically all corresponding to the corresponding section of non-human immunoglobulin.Humanized antibody is also optional comprise constant region for immunoglobulin (Fc) (being generally the human normal immunoglobulin constant region) at least a portion [Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., Nature, 332: 323-329 (1988); And Presta, Curr.Op.Struct.Biol., 2: 593-596 (1992)].
It is known in the art making non--people antibody humanization's method.Generally speaking, imported the amino-acid residue in one or more inhuman source in the humanized antibody.These inhuman amino-acid residues often are called " (import) of introduction " residue, and they are usually from " introduction " variable region.The humanization process substantially can according to Winter and colleague thereof [Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., Nature, 332: 323-327 (1988); Verhoeyen et al., Science, 239: 1534-1536 (1988)] described, the corresponding sequence that replaces human antibodies with rodents CDR or CDR sequence is carried out.Correspondingly, this kind " humanization " antibody is chimeric antibody (United States Patent (USP) 4,816,567), and wherein the seldom part of complete human variable region is replaced by the corresponding sequence of inhuman species.In the practice, humanized antibody is people's antibody normally, some of them CDR residue and have part FR residue and replaced by the residue in similar site in the rodents antibody.
People's antibody also can prepare with various techniques known in the art, comprise phage display library [Hoogenboom and Winter, J.Mol.Biol., 227: 381 (1991); Marks et al., J.Mol.Biol., 222: 581 (1991)].Cole etc. also can be used for preparing human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R.Liss, p.77 (1985) with the technology of descriptions such as Boerner; Boerner et al., J.Immunol ., 147 (1): 86-95 (1991); U.S.5,750,373].Similarly, people's antibody can by human immunoglobulin gene's seat is imported transgenic animal for example mouse produce, in described animal, endogenous immunoglobulin genes is by part or all of deactivation.After the attack, observe and produce people's antibody, the antibody seen in it and the mankind is all quite similar in every respect, comprises gene rearrangement, assembling and repertoire (antibody repertoire).This method can referring to, for example United States Patent (USP) 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and following scientific literature: Marks et al., Bio/Technology 10, 779-783 (1992); Lonberg et al., Nature 368856-859 (1994); Morrison, Nature 368, 812-13 (1994); Fishwild et al., Nature_Biotechnology 14, 845-51 (1996); Neuberger, Nature Biotechnology 14, 826 (1996); Lonberg and Huszar, Intern.Rev.Immunol. 1365-93 (1995).
D. bi-specific antibody
Bi-specific antibody is the monoclonal antibody (preferred people's antibody or humanized antibody) that has at least two kinds of antigenic binding specificities of difference.In the present invention, a kind of binding specificity can be at polypeptide of the present invention, and another kind of binding specificity is at any other antigen, preferred pin pair cell surface protein or acceptor or receptor subunits.
The method for preparing bi-specific antibody is known in the art.Traditionally, the reorganization of bi-specific antibody preparation is based on two coexpressions that heavy chain immunoglobulin-light chain is right, wherein these two heavy chains have not homospecificity (Milstein and Cuello, Nature, 305: 537-539[1983]).Because heavy chain immunoglobulin and light chain random assignment (random assortment), these hybridomas (quadroma) produce the mixture of 10 kinds of different antibodies molecules, wherein have only a kind of correct dual specific structure that has.Purifying to described correct molecule is undertaken by the affinity chromatography step usually.Similarly method is seen WO93/08829 (on May 13rd, 1993 is open) and Traunecker et al., EMBO J., 10: 3655-3659 (1991).
Antibody variable region and constant region for immunoglobulin sequence with required binding specificity (antibody-antigen binding site) can be merged.The preferred immunoglobulin heavy chain constant region with at least a portion that comprises hinge area, CH2 and CH3 district of this fusion merges.Preferably make and contain light chain and appear at least in a kind of fusion in conjunction with first CH (CH1) in required site.Can be with coding heavy chain immunoglobulin syzygy, and in case of necessity, the DNA of coding light chain immunoglobulin inserts different expression vectors, cotransfection is to suitable host living beings.The further detail content of preparation bi-specific antibody, referring to for example Sureshet al., Methods in Enzymology, 121: 210 (1986).
E. allos coupling antibody
Allos coupling antibody is made up of two covalently bound antibody.For example, have viewpoint to think, this kind antibody can make immune system cell target unwanted cells (United States Patent (USP) 4,676,980), and (WO 91/00360 to can be used for treating the HIV infection; WO 92/200373; EP 03089).Can consider to use currently known methods in the albumen chemosynthesis, comprise relating to the method for using linking agent, at this antibody-like of external preparation.For example, can make up immunotoxin with the disulfide exchange reaction or by forming thioether bond.The example that is used for the suitable reagent of this purpose comprises imino-thiol ester (iminothiolate) and methyl-4-sulfydryl butyl imidoether (methyl-4-mercaptobutyrimidate) and for example at United States Patent (USP) 4,676, those that describe in 980.
F. engineered (the Effector function engineering) of effector function
May wish to improve the effector function of antibody of the present invention, to strengthen this antibody in the effect for the treatment of aspect the immune correlated disease for example.For example, can in the Fc zone, introduce cysteine residues, thereby in this zone, form interchain disulfide bond.The antibody homodimer that makes like this can have the cell killing ability of complement-mediated of improved internalization ability and/or raising and the cytotoxic activity (ADCC) of antibody dependent cellular mediation.Referring to Caron et al., J.Exp Med. 176: 1191-1195 (1992); Shopes, B., J.Immunol. 148: 2918-2922 (1992).Also can be according to Wolff et al.Cancer Research 53: 2560-2565 (1993) is described, prepares anti-tumor activity enhanced antibody homodimer with the isodigeranyl functional cross-link agent.Perhaps, antibody can be had two Fc district through engineered one-tenth, thereby can strengthen complement cracking and ADCC ability.See Stevenson et al., Anti-Cancer Drug Design , 3: 219-230 (1989).。
G. immune conjugate
The invention still further relates to immune conjugate, wherein contain link coupled antibody with cellulotoxic preparation, described cellulotoxic preparation such as chemotherapeutics, toxin (for example enzyme activity toxin of bacterium, fungi, plant or animal-origin, or its fragment) or radio isotope (promptly radiating conjugate).
The chemotherapeutics that is applicable to this para-immunity conjugate of preparation is above being described.Adaptable enzyme activity toxin and fragment thereof comprise: diphtheria toxin A chain, the non-binding active fragments of diphtheria toxin, exotoxin A chain (from pseudomonas aeruginosa (Pseudomonas aeruginosa)), ricin (ricin) A chain, toxalbumin (abrin) A chain, modeccin (modeccin) A chain, the bent toxin (alpha-sarcin) of α-broom, tung oil tree (Aleutites fordii) albumen, oleanolic acid albumen (dianthin protein), dyers' grapes (Phytolaca Americana) albumen (PAPI, PAPII, and PAP-S), balsam pear (momordicacharantia) supressor, curcin (curcin), crotin (crotin), Saponaria officinalis (sapaonaria officinalis) inhibitor, gelonin (gelonin), mitogillin (mitogellin), restrictocin (restrictocin), phenomycin (phenomycin), enomycin (enomycin) and trichothecene (tricothecenes).Multiple radio isotope can be used for preparing radioactivity link coupled antibody, and example comprises 212Bi, 131I, 131In, 90Y and 186Re.
Antibody can be connected by multiple bifunctional protein coupling agent with the conjugate of cellulotoxic preparation; described bifunctional protein coupling agent is as N-succinimido-3-(2-pyridyl dimercapto) propionic ester (SPDP); imino-mercaptan (iminothiolane) (IT); the dual-function derivative of imido-ester (example hydrochloric acid dimethyl hexanodioic acid polyurethane (dimethyladipimidate HCl); active ester class (as two succinimido suberates); aldehydes (as glutaraldehyde (glutareldehyde)); two-triazo-compound (as two (right-the triazobenzene formyl radical) hexanediamines); two-diazo compound derivative (as two-(right-the diazobenzene formyl radical)-quadrols); vulcabond is (as tolylene 2; the 6-vulcabond); with two-active fluorine cpd (as 1; 5-two fluoro-2, the 4-dinitrobenzene).For example, the ricin immunotoxin can be as Vitetta et al., Science, 238: 1098 (1987) described preparations.C 14The 1-isothiocyanic acid phenmethyl of mark-3-methyl diethylidene three ammonia pentaacetates (MX-DTPA) are that the radioactive nuleus thuja acid is coupled to one of coupling agent of antibody.See WO94/11026.
In another embodiment, antibody can with " acceptor " (as Streptavidin) coupling of using in the pre-target of tumour, this antibody-acceptor conjugate is applied to the patient, remove unconjugated conjugate in the circulation with scavenging agent afterwards, " part " (as the avidin) of cellulotoxic preparation (as the radioactive nuleus thuja acid) that given coupling again.
H. immunoliposome
Albumen disclosed herein, antibody etc. also can be mixed with immunoliposome.The liposome that contains antibody can prepare by means known in the art, Epstein et al. for example, and Proc.Natl.Acad.Sci.USA, 82: 3688 (1985); Hwang et al., Proc.Natl Acad.Sci.USA, 77: 4030 (1980); United States Patent (USP) 4,485,045 and 4,544,545 is described.Liposome with cycling time of increase is disclosed in United States Patent (USP) 5,013, in 556.
Useful especially liposome can utilize the lipid composition that comprises phosphatidylcholine, cholesterol and PEG deutero-phosphatidylethanolamine (PEG-PE) to make through reverse phase evaporation.Liposome is pressed through the filter that limits the aperture, obtains to have the liposome of required diameter.Fab ' the fragment of antibody of the present invention can be according to Martin et al., _ J. Biol.Chem. 257: 286-288 (1982) is described, through disulfide exchange reaction and liposome coupling.Can choose wantonly and in described liposome, comprise a kind of chemotherapeutics (as Zorubicin).See Gabizon et al.., J.National Cancer Inst. 81(19) 1484 (1989).
13. Pharmaceutical composition
Bioactive molecule of the present invention comprises polypeptide and antibody, and by other molecule that above-mentioned screening method is identified, can treat inflammatory diseases with the form administration of pharmaceutical composition.
Bioactive molecule, preferred PRO301 of the present invention, PRO362, PRO245 or PRO1868 polypeptide or antibody, the therapeutic preparaton be prepared as follows and store: bioactive molecule that will have required purity and optional pharmaceutically acceptable carrier, vehicle or stablizer (Remington ' s Pharmaceutical Sciences16th edition, Osol, A.Ed.[1980]) be mixed into the form of freeze-dried or the aqueous solution.Acceptable carrier, vehicle, stablizer preferably in used dosage and concentration to receptor's nontoxicity, and comprise: buffer reagent is phosphoric acid salt for example, Citrate trianion, and other organic acid; Antioxidant comprises xitix and methionine(Met); Sanitas (stearyl dimethyl benzyl ammonium chloride for example; Chlorination hexane diamine; Benzalkonium chloride, benzethonium chloride; Phenol, butanols or phenylcarbinol; Alkyl parabens such as methyl or propyl para-hydroxybenzoate; Pyrocatechol; Resorcinol; Hexalin; The 3-amylalcohol; And meta-cresol); Low molecular weight polypeptide (being less than about 10 residues); Albumen such as serum albumin, gelatin or immunoglobulin (Ig); Hydrophilic polymer such as polyvinylpyrrolidone; Amino acid such as glycine, glutamine, l-asparagine, Histidine, arginine or Methionin; Monose, disaccharides and other steamed bun stuffed with sugar are drawn together glucose, seminose or dextrin; Sequestrant such as EDTA; Carbohydrate such as sucrose, N.F,USP MANNITOL, trehalose or sorbyl alcohol; Salify gegenion such as sodium; Metal composite (as the Zn-albumen composition) and/or nonionogenic tenside such as TWEEN TM, PLURONICS TMOr polyoxyethylene glycol (PEG).
Can use standard technique known in the art by screening method compounds identified of the present invention, prepare in a similar fashion.
Fat transfection or liposome can be used for described polypeptide, antibody or antibody fragment are transported to cell.When using antibody fragment, preferably use the minimal segment of specificity in conjunction with the target protein land.For example, can make it to keep ability according to antibody variable region sequences Design peptide molecule in conjunction with this target protein sequence.This peptide can chemosynthesis and/or by the recombinant DNA technology preparation (referring to, Marasco et al. for example, Proc.Natl.Acad.Sci.USA 90, 7889-7893[1993]).
The concrete indication that preparaton described herein can also be treated as required, and comprise more than one active compound preferably has complementary activity but does not have those of disadvantageous effect each other.Perhaps, or in addition, described composition can contain cellulotoxic preparation, cytokine or growth inhibitor.This quasi-molecule is suitable for existing so that described purpose is effectively measured.
Bioactive molecule also can be contained in the microcapsule, or the medicine that is contained in colloidal property transports system (as liposome, the albumin microsphere, microemulsion, nano particle and Nano capsule) in, perhaps be contained in the big emulsion (macroemulsions), described microcapsule can be by preparing such as cohesion (coacervation) technology or interfacial polymerization, and example has Walocel MT 20.000PV or gelatin microcapsule and poly--(methyl methacrylate) microcapsule respectively.These technology are seen Remington ' s Pharmaceutical Sciences 16th edition, Osol, A.Ed. (1980).
The preparaton that is used for vivo medicine-feeding must be aseptic.This can realize easily by the degerming membrane filtration.
Also can prepare sustained release preparation.The suitable example of sustained release preparation comprises half permeability matrix of the solid-state hydrophobic polymer that contains described antibody, and described matrix is the goods with definite shape, as film or microcapsule.The sustained-release matrix example comprises, polyester, hydrogel are (as poly-(2-hydroxyethyl-methacrylic acid ester) or poly-(vinyl alcohol), polylactide (United States Patent (USP) 3,773,919), the multipolymer of L-L-glutamic acid and γ ethyl-L-L-glutamic acid, nondegradable ethylene-ethyl acetate, degradable poly lactic coglycolic acid such as LUPRONDEPOT TM(the injectable microsphere of forming by poly lactic coglycolic acid and leucyl proline(Pro) (leuprolide) acetic ester), and poly-D-(-)-3-hydroxybutyric acid.Polymkeric substance such as ethylene-acetate ethyl ester and lactic-co-glycolic acid can continue to discharge molecule 1 more than 00 day, and that some hydrogels discharge the proteic time is shorter.When encapsulated albumen stopped in vivo for a long time, their may sex change or cohesion cause losing biological activity owing to be exposed in 37 ℃ of wet environments, and immunogenicity may change.Can make protein stabilized reasonable strategy according to Related Mechanism design.For example, if finding the mechanism of cohesion is to exchange by sulphur-disulfide linkage to form intermolecular S-S key, then can realize stablizing by modification sulfhydryl residue, freeze-drying from acidic solution, controlling moisture, suitable additive and the exploitation specificity polymer matrix composition of employing.
14. Methods of treatment
Estimate that polypeptide of the present invention, antibody and other active compound can be used for the treatment of multiple inflammatory diseases, such as the cell-mediated disease of T, comprise those with leukocyte infiltration in tissue, to stimulate T cell proliferation, suppressor T cell propagation, increase or reduce vascular permeability or it is suppressed be the disease of feature.
Encode a kind of a plurality of newcomers of protein family of PRO301, PRO362, PRO245 and PRO1868, the albumen of this family with the antigenic homology of A33 be feature.The short scorching characteristic of these polypeptide (proinflammatory nature) shows in following in vitro tests.Correspondingly, the antagonist of these polypeptide can effectively be treated inflammatory diseases.
PRO301, PRO362, PRO245 and PRO1868 (are respectively SEQ ID NO:1, SEQ IDNO:2, SEQ ID NO:9 and SEQ ID NO:31) be connected adhesion molecule (junctional adhesionmolecule, JAM, Martin-Padura et al., J.Cell Biol.1998 142(1): 117-27) share homology.Wherein the PRO301 albumen by DNA40628 (SEQ ID NO:1) coding has maximum identity 67%.JAM participates in replying MCP-1, the monocyte recruitement when MCP-3 and LPS in the body.Anti-JAM antibody is blocked monocyte migration (transmigration) in vivo.The JAM part accumulates in epithelium and the endothelium of mouse, is used for the monocyte migration as connecting adhesion molecule.Other white corpuscle also may utilize JAM, but at present still no data support this idea.JAM raises in the colon of colitis mice, probably monocyte or leukocyte recruitment is being worked in the process of colon damage location.
Can use PRO301 of the present invention, PRO362, the disease example that the antagonist of PRO245 or PRO1868 polypeptide, antibody or other compound are treated comprises, but be not limited to, inflammatory bowel disease (that is, ulcerative colitis (ulcerative colitis), Crohn ' s disease); Systemic lupus erythematous; Rheumatoid arthritis; The adolescency chronic arthritis; Vertebral arthropathy; Systemic sclerosis (scleroderma); The special property sent out inflammation myopathy (dermatomyositis, polymyositis); Sjogren syndrome; Systemic vasculitis; Sarcoidosis; Autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria); AT (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia); Thyroiditis (Graves disease disease, struma lymphomatosa, adolescency lymphocytic thyroiditis, atrophic thyroiditis); Diabetes, immune-mediated ephrosis (glomerulonephritis, uriniferous tubules interstitial nephritis); The demyelination of maincenter and peripheral nervous system is such as multiple sclerosis, spontaneous demyelination polyneuropathy (idiopathic demyelinating polyneuropathy) or Guillain-Barr é syndrome, chronic inflammatory demyelination polyneuropathy (chronic inflammatory demyelinating polyneuropathy); Hepatic duct disease such as infectious hepatitis (first type, B-mode, third type, fourth type and hepatitis E and other non-have a liking for the hepatitis that liver venereal disease poison causes), ACAH, primary biliary cirrhosis, granulomatous hepatitis, and sclerosing cholangitis; Inflammatory and fibrotic lung disease such as, cystic fibrosis; Seitan-susceptibility enteropathy; Whipple's disease; The tetter of autoimmunization or immunity-mediation comprises the bleb dermatosis, erythema multiforme and contact dermatitis, psoriasis; Anaphylactic disease (allergic diseases) is as asthma, allergic rhinitis (allergic rhinitis), atopic dermatitis (atopic dermatitis), food anaphylaxis reaction (food hypersensitivity) and urticaria (urticaria), lung's immunological disease (immunologic diseases of the lung) is such as the eosinophilic granulocyte pneumonia, the special property sent out lung fibrosis and hypersensitivity pneumonia are transplanted diseases related transplant rejection and the graft versus host disease of comprising.
The main cause of this disease of systemic lupus erythematous (central mediator) is, produce at oneself protein/tissue from body-reactive antibody, and the inflammation of generation immunity-mediation subsequently.Antibody directly or indirectly mediates tissue injury.Although there is not evidence to show that the T lymphocyte participates in tissue injury directly at present, the T lymphocyte be produce needed from body-reactive antibody.Therefore this disease depends on the T cell.Clinically have individual organ and system to be affected more, comprises kidney, lung, flesh bone (musculoskeletal) system, mucocutaneous (mucocutaneous), eye, central nervous system, cardiovascular systems, gi tract, marrow and blood.
Rheumatoid arthritis (RA) is a kind of chronic systemic autoimmunization inflammatory diseases, and it relates generally to the synovial membrane in a plurality of joints, and the result causes articular cartilage damage.Its pathogeny relies on the T lymphocyte, and with Rheumatoid factors, polyclonal, relevant at the generation of the autoantibody of self IgG, the result forms immunocomplex, it is high-level that this mixture reaches in synovial fluid and blood.These mixtures of intraarticular can induction of lymphocyte and monocyte significantly soak into synovial membrane, and synovial membrane obviously changes subsequently; Increasing a large amount of neutrophil leucocytes can make joint cavity/synovial fluid (joint space/fluid) by similar cellular infiltration.Affected tissue is mainly the joint, normally symmetric mode.Yet disease also can occur with two kinds of principal modes outside the joint.A kind of form be take place the outer infringement in joint and with carrying out property joint disease and lung fibrosis, vasculitis, and the typical case of skin ulcer damage.Second of disease kind of form is so-called Felty ' s syndrome outside the joint, this disease occurs lately in the RA course of disease, sometimes after becoming static (quiescent), joint disease occurs, and relate to neutrophilic granulocytopenia (neutropenia), the existence of thrombocytopenia and splenomegaly (splenomegaly).This can and form infraction (infarct), skin ulcer and gangrene (gangrene) with many organs vasculitis.(develop) rheumatoid nodules also appears in patient usually in the subcutis (subcutistissue) that covers the pathology joint; Tubercle has downright bad center late period, holds blended inflammatory cell infiltration thing on every side.Other performance that can occur in RA comprises: pericarditis (pericarditis), pleuritis (pleuritis), coronaritis (coronary arteritis), interstitial pneumonia (interstitial pneumonitis) with lung fibrosis, keratoconjunctivitis sicca (keratoconjunctivitis sicca), and rheumatoid nodules (rheumatoid nodule).
The adolescency chronic arthritis is a kind of chronic spontaneous inflammation, starts from less than 16 years old usually.Its phenotype and RA have some similar; Some Rheumatoid factors, polyclonal positive patients are classified as the adolescency rheumatoid arthritis.This disease is further divided into three major types: few joint type (pauciarticular), multi-joint type (polyarticular), and whole body type (systemic).This kind sacroiliitis can be very serious, and be generally destructive (destructive), causes ankylosis (joint ankylosis) and retarding of growing.Other performance can comprise chronic anterior uveitis (chronic anterior uveitis) and systemic amyloidosis (systemicamyloidosis).
Vertebral arthropathy be one group have some common Clinical symptoms and with the common relevant illness of the expression of HLA-B27 gene product.This disease comprises: rhizomelic spondylitis (ankylosing spondylitis), Reiter ' s syndrome (reactive arthritis), sacroiliitis is with inflammatory bowel disease (arthritis associatedwith inflammatory bowel disease), spondylitis is with psoriasis (spondylitis associatedwith psoriasis), adolescency outbreak vertebral arthropathy (juvenile onset spondyloarthropathy) and do not break up vertebral arthropathy (undifferentiated spondyloarthropathy).Distinguishing characteristics comprise with or without spondylitic sacroiliac (sacroileitis); The asymmetric sacroiliitis of inflammatory; Relevant with HLA-B27 (the serotype allelotrope of the HLA-B locus of I class MHC); Eye inflammation, and lack the relevant autoantibody of other rheumatism.As the key cells of inducing this disease, that the most normal referred (implicated) is CD8 +The T lymphocyte, this is the antigenic cell that a kind of target I class MHC molecule is presented.CD8 +The T cell can react with I class MHC allelotrope HLA-B27, is the expressed exogenous peptide of I class MHC molecule as it.There is hypothesis to think that the epi-position of HLA-B27 can be simulated bacterium or other microbial antigen epi-position, and therefore induces CD8 +T cell response.
Nosetiology the unknown of systemic sclerosis (scleroderma).The characteristics of this disease are the sclerosis of skin; Possible this is by reactivity inflammatory process inductive.Sclerosis can be partial or whole body; Blood vessel injury is common, and the damage of endotheliocyte is the early stage critical event of systemic sclerosis development in the microvasculature; Blood vessel injury may be immune-mediated.A lot of patients have monocyte infiltration and antinuclear antibody are arranged in skin injury, this hint has amynologic basis.In skin injury, the ICAM-1 on inoblast surface is raised usually, and this interaction that shows T cell and these cells may be worked in this sick pathogenesis.Other organ that involves comprises: gi tract: unstriated muscle atrophy and fibrosis cause unusual wriggling/motion (peristalsis/motility); Kidney: concentric, interior subcutaneous, tunica intima hamartoplasia (concentric subendothelial intimal proliferation) influences little arciform artery (small arcuate) and interlobular artery (interlobular arteries), the result is that the renal cortex blood flow reduces, cause proteinuria, azotemia (azotemia) and hypertension; Skeletal muscle: atrophy (atrophy), interstitial fibrosis; Inflammation; Lung: interstitial pneumonia and interstitial fibrosis; And heart: contraction bands necrosis (contraction band necrosis), scar/fibrosis (scarring/fibrosis).
The special property inflammation myopathy of sending out comprises dermatomyositis, and polymyositis and other are unknown but cause the chronic muscle inflammation illness of muscle weakness for nosetiology.Muscle injury/inflammation is symmetry and progressive normally.Autoantibody is with wherein most of forms are relevant.These myositis specific autoantibodies are at the function that also suppresses to participate in albumen synthetic composition, albumen and RNA.
Sjogren syndrome is owing to immune-mediated inflammation and afterwards lachrymal gland and salivary gland function destruction.This disease can be relevant with the inflammatory connective tissue disease or occurs together.The generation of the autoantibody of this disease and anti-Ro antigen and La antigen (this two be little RNA-albumen composition) is relevant.Infringement can cause keratoconjunctivitis sicca, and xerostomia (xerostomia), and other performance or related symptoms comprise biliary cirrhosis, periphery or sensorineural DPN and palpable purpura (palpablepurpura).
Systemic vasculitis comprises that primary lesion is inflammation and the disease of damaging blood vessel afterwards, causes the tissue ischemia/necrosis/sex change by the involved vessels blood supply in some cases, and the end-organ function is progressively disorderly.Vasculitis also can be the secondary lesion or the sequela (sequelae) of the disease (as rheumatoid arthritis, systemic sclerosis etc. particularly also form relevant disease with immunocomplex) of other immune inflammation mediation.The disease of primary systemic vasculitis comprises: the general necrotizing angiitis: polyarteritis nodosa (polyarteritis nodosa), allergic vasculitis (allergic angiitis) and granulomatosis (granulomatosis), many vasculitises (polyangiitis); Multiple granulomatosis (Wegener ' sgranulomatosis); Lymphomatoid granulomatosis (lymphomatoid granulomatosis); And giant cell arteritis (giant cell arteritis).Other multiple vasculitis comprises: kawasaki disease (MLNS or Kawasaki disease (Kawasaki ' s disease)), isolated (isolated) CNS vasculitis, Behet ' s disease, thromboangiitis obliterans (Buerger ' s disease) and cutaneous necrosis trichodophlebitis (cutaneousnecrotizing venulitis).The vasculitis of listed most of types, its pathomechanism it is believed that it mainly is because immunoglobulin complex deposits at vessel wall, have induced afterwards by ADCC or/and the inflammatory response that complement activation causes.
Sarcoidosis (Sarcoidosis) is the disease of nosetiology the unknown, and its characteristics are that epithelioid granuloma exists in almost any tissue of health; It is modal that lung is got involved.Cause of disease mechanism comprises activatory scavenger cell and lymphoidocyte continue (persistence) in focus, and discharges chronic sequela local and that the whole body active result was caused by these cell types afterwards.
Autoimmune hemolytic anemia (comprises autoimmune hemolytic anemia, the immunity pancytopenia, and paroxysmal nocturnal hemoglobinuria), be that generation and red corpuscle are (and in some cases, also comprise other hemocytes such as thrombocyte) result of the antigen reactive antibody of surface expression, it reflects that those are removed by the cracking of complement-mediated and/or the mechanism of ADCC/Fc-acceptor-mediation by the cell that antibody coats.
At AT, comprise thrombopenic purpura, in immune-mediated thrombocytopenia in other Clinical types (settings), platelet destruction/removals takes place is owing to, antibody or complement are attached to thrombocyte and subsequently by the complement cracking, the receptor-mediated mechanism of ADCC or FC-is removed.
Thyroiditis comprises Graves disease, struma lymphomatosa, the adolescency lymphocytic thyroiditis, and atrophic thyroiditis, all be result, wherein produced and be present in the Tiroidina and usually be the antibody that is specific to thyroid albumen test at the autoimmune response of thyroid antigen.Existing experimental model comprises spontaneous model: rat (BUF and BioBreeding rat) and chicken (fat chicken strain); Guidance model: with thyroglobulin or thyroid microsomal antigen (thyroid peroxidase) immune animal.
Type i diabetes or Regular Insulin-dependent diabetes mellitus are that the autoimmunization of beta Cell of islet is destroyed; This kind destruction is by autoantibody and ART mediation.The antibody of synalbumin or insulin receptor also can form the not reactive phenotype of Regular Insulin.
Immune-mediated ephrosis, comprise glomerulonephritis and uriniferous tubules interstitial nephritis, be the result to the injury of nephridial tissue of antibody or T cell mediated, it or directly be the result who produces antigenic autoreactivity antibody of anti-kidney or T cell, perhaps be indirectly with the antigen reactive antibody of other non-kidney and/or immunocomplex in the sedimentary result of kidney.Thereby other causes ephrosis that immunologically mediated disease that immunocomplex forms also can the induction of immunity mediation as indirect sequelae.Direct and indirect immunologic mechanism all causes inflammatory response, and it produces/induce the infringement development in nephridial tissue, and the result causes the organ dysfunction infringement, and can develop into renal failure in some cases.The pathogeny that humoral immunization and cellular immune mechanism can participate in damaging.
The demyelination of maincenter and peripheral nervous system comprises multiple sclerosis; Spontaneous demyelination polyneuropathy or Guillain Barre syndrome; And chronic inflammatory demyelination polyneuropathy, it is believed that to have autoimmune basis and cause neural demyelinization, it is to oligodendrocyte (oligodendrocyte) or direct result to the myelin infringement.At MS, prompting on evidence, disease bring out and progress is that to rely on T lymphocytic.Multiple sclerosis is a T lymphocyte dependency demyelination, has the recurrence-alleviation course of disease or the chronic progressive external course of disease.Its nosetiology is not clear; Yet, virus infection, the heredity inducement, environment and autoimmunization all have contribution.Infringement comprises main by the microgliacyte (microglial cell) of T cell mediated and the infiltration of wetting property scavenger cell; CD4 +The T lymphocyte is the main cell type of infringement place.Oligodendrocyte death and the mechanism of demyelinization is not clear thereafter, but driven by the T lymphocyte.
Inflammatory and fibrotic lung disease comprise the acidophilia pneumonia, spontaneous lung fibrosis and allergy pneumonia, and the immune inflammation that may relate to imbalance (disregulated) is replied.Will have result of treatment to this inhibition of replying.
Autoimmunity or immune-mediated dermatosis comprise the bleb dermatosis, and erythema multiforme, and contact dermatitis all are that the generation of described autoantibody then is that the T lymphocyte is dependent by the autoantibody mediation.
Psoriasis is the inflammation of T lymphocyte-mediation.Infringement comprises the T lymphocyte, scavenger cell and antigen presenting cell, and the infiltration of some neutrophil leucocytes.
Anaphylactic disease comprises asthma; Allergic rhinitis; Atopic dermatitis; Food hypersensitivity and urticaria are that the T lymphocyte is dependent.These diseases are mainly by T lymphocyte inductive inflammation, and the inflammation of IgE mediation or the combination of the two mediate.
Transplant diseases relatedly, comprise that transplant rejection and graft-anti--host-disease (GVHD) is that the T lymphocyte is dependent; Inhibition to the T lymphocyte function has the improvement effect.
The patient of other disease also can be benefited from the enhancing of immunity and/or inflammatory response.Described disease includes but not limited to, virus infection (includes but not limited to AIDS, first, second, third, fourth, hepatitis E), infectation of bacteria, fungi infestation, and protozoon and parasitic infection (stimulating the molecule of MLR or derivative/agonist to can be used for treating) to strengthen immunne response to infectant, immune deficiency disorder, comprise inborn, acquired, infectivity inductive (as in HIV infects), or because of doctor's treatment (promptly, as from chemotherapy) and the immune deficiency that causes, and tumorigenesis (neoplasia).
Confirm that now some human cancer patients react at the antigen on oncocyte surface, produce antibody and/or T lymphocyte.In addition, in the tumorigenesis animal model that enhancing immunity is replied, can cause this concrete neoplastic repulsion or disappear.The molecule that influences the T lymphocyte responses in MLR can be used for changing in the body immunne response of neoplasia resisting.
Inhibition with molecule of urging scorching characteristic also had result of treatment in the following areas: reperfusion injury (reperfusion injury); Outbreak (stroke); Myocardial infarction (myocardial infarction); Arteriosclerosis (atherosclerosis); Acute lung injury; Hemorrhagic shock (hemorrhagic shock); Burn (burn); Septicemia/septic shock (sepsis/septic shock); Acute pipe necrosis (acute tubularnecrosis); Endometriosis (endometriosis); Degenerative arthritis (degenerative jointdisease) and pancreatitis (pancreatitis).
PRO301, PRO362 and PRO245 polypeptide can be as the lymphopoietic stimulator of T (embodiment 5) of irriate.Therefore, PRO301, the antagonist of PRO362 and PRO245 can be used for the treatment of immune correlated disease, and especially inflammatory diseases suppresses PRO301 such as passing through, and the stimulatory effect of PRO362 and PRO245 polypeptide is realized.On the other hand, PRO301, PRO362 and PRO245 polypeptide and antagonist thereof can be used for the treatment of those can be from disease to being benefited the stimulation of immunne response.
PRO1868 polypeptid induction chondrocyte of the present invention breaks up (redifferentiation ofchondrocyte) (embodiment 19) again.So the antagonist of PRO1868 and PRO1868 can be used for the treatment of the various diseases relevant with bone and/or cartilage.
PRO301 of the present invention, PRO362, PRO245 and PRO1868 polypeptide, antibody and other compound can as set medicine group's (bolus) intravenous administration or by continue the infusion administration in a time period, pass through intramuscular according to currently known methods to Mammals (preferred people) administration, abdominal cavity (intraperitoneal), in the myelencephalon, subcutaneous, intraarticular is in the synovial membrane, in the sheath (intrathecal), oral, local (topical), or suck (in the nose, in the lung) administration.Preferred intravenous administration or inhalation-type drug administration polypeptide and antibody.
In immune adjuvant therapy (immunoadjuvant therapy), other treatment plan as the carcinostatic agent administration, can be united with albumen of the present invention, antibody or compound administration and carry out.For example, the patient with immune adjuvant of the present invention (immunoadjuvant) treatment can also accept carcinostatic agent (chemotherapeutics) or radiotherapy.The preparation of this based chemotherapy agent and dosage can be used or determine according to the experience of skilled operators according to manufacturer's specification sheets.The preparation of this based chemotherapy agent and dosage also can be referring to Chemotherapy Service Ed., M.C.Perry, Williams ﹠amp; Wilkins, Baltimore, MD (1992).Chemotherapeutics can be used on before or after the administration immune adjuvant, or administration simultaneously.In addition, also can administration estrogen antagonist compound tamoxifen (tamoxifen) or antiprogestin Onabristone (onapristone) (seeing EP 616812) for example for example, with the known dosed administration of this quasi-molecule.
May wish also to use the antibody of anti-other Immunological diseases related antigen or tumor associated antigen, for example in conjunction with CD20, CD11a, CD18, ErbB2, EGFR, ErbB3, ErbB4, the antibody of the vascular endothelial cell factor (VEGF).Perhaps, or in addition, can with described herein two or more in conjunction with identical or two or more different antigenic antibody to patient's Combined Preparation.Sometimes, still favourable in addition to one or more kind cytokines of patient's administration.In one embodiment, polypeptide of the present invention or other compound and growth inhibitor Combined Preparation.For example, growth inhibitor be can use earlier, polypeptide of the present invention or other compound used subsequently.But also can consider administration simultaneously or first administration.The suitable dosage of growth inhibitor is the dosage that uses at present, under the situation of growth inhibitor and polypeptide of the present invention or compound combined action (working in coordination with), can be lower than the dosage of present use.
Treatment or when alleviating the severity of immune correlated disease, the suitable dose of The compounds of this invention depends on that the purpose according to the severity of the type of disease for the treatment of described herein, this disease and the course of disease, the described preparation of administration is prevention or treatment, treatment before this, this patient's a clinical medical history and to the reaction of this compound, and clinicist's judgement.Described compound is suitable for once giving the patient, perhaps gives the patient in a series of treatments.Preferably, preferably earlier at external definite dose response curve and pharmaceutical composition of the present invention, effectively measuring dose response curve and pharmaceutical composition of the present invention in the animal model, in human body, test at last then.
For example, according to the type and/or the severity of disease, with polypeptide or the about 1 μ g/kg to 15mg/kg of antibody (for example 0.1-20mg/kg) as initial candidate's dosage to patient's administration, for example one or many administration or lasting infusion administration respectively.Representational per daily dose can be by about 1 μ g/kg to 100mg/kg or more, the difference with the variation of above-mentioned factor.For repeat administration in a couple of days or longer time, according to circumstances, treatment lasts till that significantly suppressing appears in disease symptoms.Yet, also can use other dosages.The progress of this treatment can be by routine techniques and test monitoring at an easy rate.
15. Goods (Articles of Manufacture)
In another embodiment of the present invention, provide and contained diagnosing or treat the goods of the useful material of above-mentioned illness.These goods comprise container and label.Proper container has bottle, bottle, and syringe, and test tube etc.Container can be made by various materials such as glass or plastics.Load efficient diagnosis in the container or treat the composition of described disease, and can have aseptic access port (for example this container can be intravenous drip bag (intravenous solution bag) or the bottle that has stopper that can be by the subcutaneous injection needle penetration).Active ingredient in composition polypeptide normally of the present invention or antibody.Label on container or that link to each other with container shows that composition can be used for diagnosing or treating specified disease, especially immune correlated disease.Described goods can also comprise second container, wherein contain pharmaceutically acceptable damping fluid, as phosphate buffered saline buffer, Ringer's solution (Ringer ' s solution), and glucose solution.It also can comprise the material that has commercial needs and meet user's needs, comprises other damping fluid, thinner, filter, syringe needle, syringe and the package insert that has operation instruction.
16. The diagnosis of disease and prognosis
Cell surface protein as the albumen of overexpression in some immune correlated diseases, all is the outstanding target of drug candidate or disease treatment.Same albumen with immune correlated disease in the secretory protein of the coded by said gene that increases when accompanying, can also be used for the diagnosis and the prognosis of these diseases.For example, the antibody of the protein product of the gene that increases in direct anti-multiple sclerosis, rheumatoid arthritis or the another kind of immune correlated disease can be used as diagnostic reagent (diagnostics) or prognosis agent (prognostics).Such antibody and carrier (for example, buffer reagent) can be included in the diagnostic kit, take suitable packing, and are furnished with the operation instruction of using the described protein product of this antibody test.
The PRO1868 polypeptide is at the various tumor tissues of the mankind, for example significantly overexpression (embodiment 20) in lung tumor and the breast tumor.Therefore, PRO1868 antibody can be used to diagnose patient's tumour.
We find that the PRO362 polypeptide expression is in the tissue relevant with tumorigenesis, and significantly increase in inflammatory diseases.The PRO245 polypeptide expression also significantly increases in the tissue of suffering from chronic inflammatory disease and neoplastic tissue.Therefore, PRO362 and PRO245 antibody can be used to diagnose the tissue (inflamed tissue) and the tumorigenesis of inflammation.
For example, antibody comprises antibody fragment, can be used for quantitatively or the proteic expression of the coded by said gene of qualitative detection overexpression or high expression level.Described antibody preferably is equipped with the mark that can detect, fluorescent mark for example, and in conjunction with monitoring by opticmicroscope microscopy, flow cytometry, fluorometry or other technology known in the art.In the situation of the genes encoding cell surface protein of overexpression, these technology are especially suitable.Combination test like this is known in the art, can carry out substantially as mentioned above.
To with the in situ detection of marker gene product bonded antibody can, for example undertaken by immunofluorescence or immuno-electron microscope method.For this reason, obtain histological specimen, on this sample, load the antibody of mark, preferably load by antibody is covered on the biological samples from the patient.This method also can be measured the distribution of marker gene product in the tissue that is detected.It will be apparent to those skilled in the art that have extensive multiple Histological method can be used in situ detection at an easy rate.
Following examples only illustrate, and are not to limit the scope of the invention by any way.
All patents quoted in this specification sheets and document all are incorporated herein by reference in full.
Embodiment
Except as otherwise noted, use the reagent of mentioning among the embodiment that is purchased according to manufacturer's explanation.The cell of differentiating with the ATCC preserving number in following examples and the whole specification sheets is from American type culture collection, 10801 University Boulevard, Manassas, VA 20110-2209.
Embodiment 1
The cDNA clone who separates coding people PRO301
Use derives from extracellular region (ECD) sequence (if any, also comprising secretory signal sequence) the retrieval est database of about 950 known secretory proteins of Swiss-Prot public database.Est database comprises public est database (as GenBank), privately owned est database (LIFESEQ , IncytePharmaceuticals, Palo Alto, CA).The program that uses a computer BLAST or BLAST2[Altschulet al., Methods in Enzymology, 266: 460-480 (1996)] retrieve, to compare the 6-framework translation product of ECD protein sequence and est sequence.To compare back BLAST score value and be the ECD sequence of 70 (or being 90 sometimes) or the higher known protein of not encoding and assemble cluster, and service routine " phrap " (Phil Green, University of Washington, Seattle Washington) is assembled into total dna sequence dna.
Use the total dna sequence dna of phrap assembling coding DNA 35936.In some cases, use the blast and the phrap that move in circles to extend total dna sequence dna, so that extend consensus sequence far away as far as possible with the est sequence in three kinds of above listed sources.
According to this consensus sequence, synthetic oligonucleotide: 1) to identify the cDNA library of containing required sequence by PCR, with 2) be used as probe to separate the clone of complete encoding sequence.Forward and inverse PCR primer (are expressed as respectively *.f and *.r) can be 20 to 30 Nucleotide (generally being about 24), and be designed to produce the PCR product that length is 100-1000bp.Probe sequence (is expressed as *.p) length is generally 40-55bp (generally being about 50bp).In some cases, when consensus sequence during, need synthetic extra oligonucleotide greater than 1-1.5kbp.In order to filter out the source of several libraries as full-length clone, use the PCR primer right, as Ausubel et al., the described pcr amplification that carries out of Current Protocols in Molecular Biology filters out DNA from the library.Then, by using the vivo clone method of a probe oligonucleotides and a PCR primer, use positive library to separate the clone of the required gene of coding.
In order to filter out the source of several libraries as full-length clone, use the PCR primer of above identifying right, from the library, filter out DNA by pcr amplification.Then, use probe oligonucleotides and a PCR primer, separate the clone of coding PRO301 gene with positive library.
The used RNA in construction cDNA library separates from human embryo kidney (HEK).Use be purchased reagent (as Invitrogen, San Diego, CA; Clontech etc.), make up the cDNA library that is used to separate the cDNA clone by standard method.With the few dT guiding cDNA that contains the NotI site, be connected with the adapter of flush end with SalI half kinasesization, use the NotI cracking, suitably measure size, and be cloned into unique XhoI of suitable cloning vector and NotI site (as pRKB or pRKD with the direction of determining by gel electrophoresis; PRK5B is the pRK5D precursor that does not contain the SfiI site; Referring to Holmes et al., Science, 253: 1278-1280 (1991)).
Measure cDNA clone's complete sequence.The full length nucleotide sequence of native sequences DNA40628 is shown in Fig. 5 (SEQ ID NO:11).Cloned DNA 40628 contains single open reading frame, contains tangible translation initiation site (Fig. 5 at nucleotide position 52-54 place; SEQ ID NO:11).The polypeptide precursor length of inferring is 299 amino acid, and the molecular weight of its supposition is 32583 dalton, and pI is 8.29.Cloned DNA 40628 is preserved in ATCC, its preserving number is ATCC 209432.
Analyze according to the BLAST of full length sequence and FastA sequence alignment, demonstrate amino acid sequence identity by the PRO301 of DNA40628 coding and A33 antigen precursor (30%) and COxsackie and adenovirus receptor albumen (29%).
Above used oligonucleotide sequence is as follows in the method:
OLI2162(35936.f1)(SEQ ID NO：12)
TCGCGGAGCTGTGTTCTGTTTCCC
OLI2163(35936.p1)(SEQ ID NO：13)
TGATCGCGATGGGGACAAAGGCGCAAGCTCGAGAGGAAACTGTTGTGCCT
OLI2164(35936.f2)(SEQ ID NO：14)
ACACCTGGTTCAAAGATGGG
OLI2165(35936.r1)(SEQ ID NO：15)
TAGGAAGAGTTGCTGAAGGCACGG
OLI2166(35936.f3)(SEQ ID NO：16)
TTGCCTTACTCAGGTGCTAC
OLI2167(35936.r2)(SEQ ID NO：17)
ACTCAGCAGTGGTAGGAAAG
Embodiment 2
The cDNA clone who separates coding people PRO362
Use derives from extracellular region (ECD) sequence (if any, also comprising secretory signal sequence) of about 950 known secretory proteins of the public albumen database of Swiss-Prot and retrieves expressed sequence tag (EST) database.Est database comprises public est database (as GenBank) and privately owned EST DNA database (LIFESEQ , Incyte Pharmaceuticals, Palo Alto, CA).The program that uses a computer BLAST or BLAST-2[such as Altschul et al., Methods in Enzymology, 266: 460-480 (1996)] retrieve, to compare 6 framework translation products of ECD protein sequence and est sequence.To compare back BLAST score value and be the ECD sequence of 70 (or being 90 sometimes) or the higher known protein of not encoding and assemble cluster, and service routine " phrap " (Phil Green, University of Washington, Seattle Washington) is assembled into total dna sequence dna.
Use phrap, with respect to the total dna sequence dna of other est sequence assembling.This paper is called DNA42257 (SEQ ID NO:5) (referring to Fig. 4 C) with consensus sequence.According to the DNA42257 shown in Fig. 4 C (SEQ ID NO:5) consensus sequence, synthetic oligonucleotide: 1) to identify the cDNA library of containing required sequence by PCR, with 2) be used as probe to separate the clone of PRO362 complete encoding sequence.Forward and inverse PCR primer can be 20 to 30 Nucleotide, and often are designed to produce the PCR product that length is 100-1000bp.The length of probe sequence is generally 40-55bp.In some cases, when consensus sequence during, need synthetic extra oligonucleotide greater than about 1-1.5kbp.In order to filter out the source of several libraries as full-length clone, use the PCR primer right, as Ausubel etal., the described pcr amplification that carries out of Current Protocols in Molecular Biology filters out DNA from the library.Then, use probe oligonucleotides and a PCR primer right, use positive library to separate the clone of the required gene of coding.
Synthetic pcr primer thing (forward and reverse):
Forward PCR primer 1 (42257.f1) 5 '-TATCCCTCCAATTGAGCACCCTGG-3 ' (SEQ ID NO:18)
Forward PCR primer 2 (42257.f2) 5 '-GTCGGAAGACATCCCAAC AAG-3 ' (SEQ ID NO:19)
Inverse PCR primer 1 (42257.r1) 5 '-CTTCACAATGTCGCTGTGCTGCTC-3 ' (SEQ ID NO:20)
Inverse PCR primer 2 (42257.r2) 5 '-AGCCAAATCCAGCAGCTGGCTTAC-3 ' (SEQ ID NO:21)
In addition, by total DNA42257 sequence construct synthetic oligonucleotide hybridization probe with following nucleotide sequences:
Hybridization probe (42257.p1)
5’-TGGATGACCGGAGCCACTACACGTGTGAAGTCACCTGGCAGACTCCTGAT-3’(SEQ ID NO：22)。
In order to filter out the source of several libraries as full-length clone, use the PCR primer of above identifying right, from the library, filter out DNA by pcr amplification.Then, use probe oligonucleotides and a PCR primer, separate the clone of coding PRO362 gene with positive library.
The used RNA in construction cDNA library separates from people's fetal brain tissue (LIB153).Use is purchased reagent, as derives from Invitrogen, San Diego, and the reagent of CA makes up the cDNA library that is used to separate the cDNA clone by standard method.With the few dT guiding cDNA that contains the NotI site, be connected with the adapter of flush end with SalI half kinasesization, use the NotI cracking, suitably measure size, and be cloned into unique XhoI of suitable cloning vector and NotI site (as pRKB or pRKD with the direction of determining by gel electrophoresis; PRK5B is the pRK5D precursor that does not contain the SfiI site; Referring to Holmes et al., Science, 253: 1278-1280 (1991)).
Isolating clone is as stated above carried out dna sequencing, obtain the full length DNA sequence (this paper is referred to as UNQ317 (DNA45416-1251) (SEQ ID NO:7)) of isolating PRO362.
The complete nucleotides sequence of UNQ317 (DNA45416-1251) is shown in Fig. 6 (SEQ ID NO:7).Clone UNQ367 (DNA45416-1251) (SEQ ID NO:7) contains single open reading frame, contains tangible translation initiation site (Fig. 6 at nucleotide position 1082-1084 place; SEQ ID NO:7).The polypeptide precursor length of inferring is 321 amino acid (Fig. 3; SEQ ID NO:2).The proteic estimation molecular weight of total length PRO362 shown in Figure 3 is about 35,544 dalton, and pI is 8.51.Analyze total length PRO362 polypeptide shown in Figure 3 (SEQ ID NO:7), the result confirms to have the mucopolysaccharide binding site at about amino acid/11 49 to about amino acid/11 52 places, has membrane spaning domain at about amino acid 276 to about amino acid 306 places.To clone UNQ317 (DNA45416-1251) and be preserved in ATCC, its preserving number is ATCC209620.
Embodiment 3
The cDNA clone who separates coding people PRO245
Use derives from extracellular region (ECD) sequence (if any, also comprising secretory signal sequence) retrieval expressed sequence tag (EST) database of about 950 known secretory proteins of the public albumen database of Swiss-Prot.Est database comprises public est database (as GenBank) and privately owned EST DNA database (LIFESEQ , Incyte Pharmaceuticals, Palo Alto, CA).The program that uses a computer BLAST or BLAST-2[such as Altschul et al., Methods in Enzymology, 266: 460-480 (1996)] retrieve, to compare 6 framework translation products of ECD protein sequence and est sequence.To compare back BLAST score value and be the ECD sequence of 70 (or being 90 sometimes) or the higher known protein of not encoding and assemble cluster, and service routine " phrap " (Phil Green, University of Washington, Seattle Washington) is assembled into total dna sequence dna.
With respect to the total dna sequence dna of other est sequence assembling, wherein this paper is called DNA30954 (SEQ ID NO:27) with consensus sequence.According to the DNA30954 consensus sequence, synthetic oligonucleotide to be identifying the cDNA library of containing required sequence by PCR, and as probe to separate the clone of PRO245 complete encoding sequence.
Synthetic one couple of PCR primers (forward and reverse):
Forward PCR primer 5 '-ATCGTTGTGAAGTTAGTGCCCC-3 ' (SEQ ID NO:28)
Inverse PCR primer 5 '-ACCTGCGATATCCAACAGAATTG-3 ' (SEQ ID NO:29)
Forward and inverse PCR primer are generally 20 to 30 Nucleotide, and often are designed to produce the PCR product that length is about 100-1000bp.The length of probe sequence is generally 40-55bp.In some cases, when consensus sequence during, need synthetic extra oligonucleotide greater than about 1-1.5kbp.In order to filter out the source of several libraries as full-length clone, use the PCR primer right, as Ausubel et al., the described pcr amplification that carries out of Current Protocols in Molecular Biology filters out DNA from the library.
In addition, by total DNA30954 sequence construct synthetic oligonucleotide hybridization probe with following nucleotide sequences:
Hybridization probe:
5’-GGAAGAGGATACAGTCACTCTGGAAGTATTAGTGGCTCCAGCAGTTCC-3’(SEQ ID NO：30)。
In order to filter out the source of several libraries as full-length clone, use the PCR primer of above identifying right, from the library, filter out DNA by pcr amplification.Then, use probe oligonucleotides and a PCR primer, separate the clone of coding PRO245 gene with positive library.
The used RNA in construction cDNA library separates from people's tire hepatic tissue.Use is purchased reagent, as derives from Invitrogen, San Diego, and the reagent of CA makes up the cDNA library that is used to separate the cDNA clone by standard method.With the few dT guiding cDNA that contains the NotI site, be connected with the adapter of flush end with SalI half kinasesization, use the NotI cracking, suitably measure size, and be cloned into unique XhoI of suitable cloning vector and NotI site (as pRKB or pRKD with the direction of determining by gel electrophoresis; PRK5B is the pRK5D precursor that does not contain the SfiI site; Referring to Holmes et al., Science, 253: 1278-1280 (1991)).
Isolating clone is as stated above carried out dna sequencing, obtain full length DNA sequence [this paper is referred to as UNQ219 (DNA35638) (SEQ ID NO:8)] and the deutero-protein sequence (SEQ ID NO:9) of native sequences PRO245.
The complete nucleotides sequence of UNQ219 (DNA35638) is shown in Fig. 7 (SEQ ID NO:8).Clone UNQ219 (DNA35638) (SEQ ID NO:8) contains single open reading frame, contain tangible translation initiation site (Kozak et al. at nucleotide position 89-91 place, document is the same), have terminator codon (Fig. 7, SEQ ID NO:8) at nucleotide position 1025-1027 place.The polypeptide precursor length of inferring is 312 amino acid (Figure 11) (SEQ ID NO:9).To clone UNQ219 (DNA35638) on September 17th, 1997 and be preserved in ATCC, its preserving number is ATCC209265.
Embodiment 4
The endothelial cell proliferation that inhibition stimulates through VEGF
Density with 500 cells/well (derives from primary culture with bovine adrenal cortex capillary endothelium (ACE) cell, go down to posterity at most through 12-14 time) be laid on 96 hole droplet plates (Amersham LifeScience), contain 100 μ L low dextrose DMEM in each hole of droplet plate, wherein contain 10% calf serum, the 2mM glutamine, 1 * penicillin/streptomycin and amphotericin and 3ng/mLVEGF.Contrast is laid in the hole of droplet plate according to identical mode, does not just comprise VEGF in the substratum.It is 200mcL that the given the test agent that adds 100 μ l PRO301 and PRO245 polypeptide makes final volume.37 ℃ are incubated cell 6-7 days.Absorb substratum, use PBS washed cell 1 time.Add acid phosphatase reaction mixture (100 μ L, 0.1M sodium-acetate, pH5.5,0.1%Triton-100,10mMp-nitrophenyl phosphoric acid).After 37 ℃ of insulations 2 hours, add 10mcL 1N NaOH with termination reaction.On droplet plate readout instrument, measure the OD value at 405nm place.Contrast for acellular, only cell, cell+FGF (5ng/mL), cell+VEGF (3ng/mL), cell+VEGF (3ng/ml)-TGF-β (1ng/ml) and cell+VEGF (3ng/mL)+LIF (5ng/mL) arranged.(concentration known is the TGF-β of a 1ng/ml 70-90%VEGF stimulated cell proliferation capable of blocking.)
Calculate by measuring OD 405The activity of acid phosphatase at nm place and measure to the restraining effect of VEGF (3ng/ml) stimulated cell proliferation with respect to (1) without stimulated cells and (2) VEGF stimulating activity with reference to the inhibiting per-cent of TGF-β, with this evaluation result.Result shown in the table 1 demonstrates PRO301 and PRO245 polypeptide at cell growth inhibiting, and particularly cancer therapy especially suppresses the effect in the tumor-blood-vessel growth.
Table 1
The compound of being tested Concentration % is with respect to the propagation of contrast
DNA40628 albumen (SEQ ID NO:1) 7.0nM 1.02
DNA40628 albumen (SEQ ID NO:1) 70.0nM 0.88
DNA40628 albumen (SEQ ID NO:1) 700.0nM 0.44
DNA40628 albumen (SEQ ID NO:1) 0.01％ 0.92
DNA40628 albumen (SEQ ID NO:1) 0.1％ 0.85
DNA40628 albumen (SEQ ID NO:1) 1.0％ 0.68
DNA35638 albumen (SEQ ID NO:9) 0.01％ 0.76
DNA35638 albumen (SEQ ID NO:9) 0.1％ 0.35
DNA35638 albumen (SEQ ID NO:9) 1.0％ 0.11
DNA35638 albumen (SEQ ID NO:9) 0.48nM 1.03
DNA35638 albumen (SEQ ID NO:9) 4.8nM 0.95
DNA35638 albumen (SEQ ID NO:9) 48.0nM 0.49
Embodiment 5
Stimulating activity in mixed lymphocyte reacion (MLR) test
Hereinafter described and measured the lymphopoietic test of T-whether PRO301, PRO362, PRO245 and PRO1868 polypeptide can stimulate irriate.When the enhancing Inflammatory response was comparatively favourable, for example in the immunne response that strengthens antitumor formation, stimulating lymphopoietic compound was useful in treatment.When alleviating Inflammatory response when comparatively favourable, the antagonist that stimulates lymphopoietic compound is useful in treatment.The form that therapeutical agent is taked can be the agonist or the antagonist of polypeptide of the present invention, for example chimeric at the mouse-people of described polypeptide, humanization or people's antibody.
The basic skills of this test is described in Current Protocol in Immunology, Unit 3.12, J.E.Coligan, A.M.Kruisbeek, DH Marglies, EM Shevach and W Strober, Eds, National Institute of Health, Published by John Wiley ﹠amp; Sons, Inc.
More specifically, in a test of changing to some extent, by Leukopheresis from mammalian subject, separating periphery blood monocytic cell (PBMC) (donor provides pungency PBMC, and another donor provides effect PBMC) in people volunteer's body for example.In case of necessity, place foetal calf serum and DMSO freezing in cell at after separating.Test(ing) medium (37 ℃, 5%CO 2) in frozen cell is melted spend the night, washing and suspending again then, making concentration is 3 * 10 6Individual cell/ml test(ing) medium (RPMI; 10% foetal calf serum, 1% penicillin/streptomycin, 1% glutamine, 1%HEPES, 1% non-essential amino acid, 1% pyruvic acid).
Go out pungency PBMC by irradiation (about 3000 rads) cell preparation.By tiling 100 μ l in three parts of holes be diluted to 1% or 0.1% given the test agent, 50 μ l prepare test through the irritation cell of irradiation and the mixture of 50 μ l reaction PBMC cell.With 100 μ l cell culture mediums or 100ml CD4-IgG with comparing.Then in 37 ℃, 5%CO 2In with hole insulation 4 days.The 5th day, with thymidine (the 1.0mC/ hole that contains tritium; Amersham) each hole of pulse.Washed cell 3 times, the picked-up of evaluation mark then.
In the test that another is changed to some extent, detect PRO301, PRO362 and PRO245 polypeptide.In this test, PBMC separates the spleen from BALB/c mouse and C57B6 mouse.Collecting cell from the spleen of new collection places test(ing) medium (RPMI; 10% foetal calf serum, 1% penicillin/streptomycin, 1% glutamine, 1%HEPES, 1% non-essential amino acid, 1% pyruvic acid) in, by these cells being covered on the Lympholyte M (Organon Teknika), with 2000rpm centrifugal 20 minutes, in test(ing) medium, collect and the washing mononuclear cell layer, be 1 * 10 with test(ing) medium suspension cell again to concentration 7Individual cell/ml, thus isolate PBMC.Test by mentioned above then.
Result shown in the following table 2 shows PRO301 of the present invention, and PRO362 and PRO245 polypeptide can be used as the stimulant of the lymphocytic propagation of irriate T-.The just increase that exceeds contrast is considered to positive findings, preferably increases more than or equal to 180%.Yet any value greater than contrast represents that all being tried albumen has hormesis.
Table 2
Compound Concentration Increased percentage compared with the control
DNA40628 albumen (SEQ ID NO:1) 0.1% 181.7
DNA40628 albumen (SEQ ID NO:1) 1.0% 187.3
DNA40628 albumen (SEQ ID NO:1) 0.1% 193.4
DNA40628 albumen (SEQ ID NO:1) 1.0% 204.1
DNA45416 albumen (SEQ ID NO:2) 0.1% 87.4
DNA45416 albumen (SEQ ID NO:2) 1.0% 180.2
DNA35638 albumen (SEQ ID NO:9) 0.1% 189.7
DNA35638 albumen (SEQ ID NO:9) 0.1% 193.7
DNA35638 albumen (SEQ ID NO:9) 1.0% 212.5
DNA35638 albumen (SEQ ID NO:9) 1.0% 300.5
Embodiment 6
Inflammatory cell infiltration is to guinea pig skin
It is short scorching that following examples demonstrate polypeptide of the present invention, because they can stimulate inflammatory cell infiltration (being neutrophil leucocyte, eosinophilic granulocyte, monocyte or lymphocyte) to guinea pig skin.Every kind of protein induced inflammatory cell infiltration of test monitoring as herein described is to the ability of guinea pig skin.When the enhancing Inflammatory response was comparatively favourable, stimulating the compound of inflammatory infiltration was useful in treatment.When the inhibition Inflammatory response was comparatively favourable, suppressing lymphopoietic compound was useful in treatment.The form that therapeutical agent is taked can be the antagonist of polypeptide of the present invention, for example chimeric at the mouse-people of described polypeptide, humanization or people's antibody.
Use ketamine (ketamine) (75-80mg/kg body weight) and xylazine (xylazine) (5mg/kg body weight) to anaesthetize body weight by intramuscular and be 350g or heavier no hair cavy (Charles RiverLabs).With the amount of each injection site 100 μ l, with the protein sample of PRO301, PRO362 and PRO245 and reference protein intradermal injection back to every animal.Every animal 16-24 injection site of having an appointment.The blue dyestuff (1%, be dissolved in the phosphate-buffered saline) of intracardiac injection 1ml Evans.After 6 hours animal is practised mercy killing, biopsy is carried out in each injection of skin site, and be fixed in the formalin.Be ready to skin to carry out the histopathology evaluation.Estimate the infiltration situation of each site inflammatory cell to skin.The site evaluation that will have visible inflammatory cell is positive.Can induce the sample of inflammatory cell infiltration to be evaluated as short scorching material.
Table 3
Compound is short scorching active
DNA40628 albumen (SEQ ID NO:1)+
DNA45416 albumen (SEQ ID NO:2)+
DNA35638 albumen (SEQ ID NO:9)+
Negative control-
Based on these results, PRO1868 (SEQ ID NO:31) also may have short scorching active.
Embodiment 7
Interact with human neutrophil
Following examples demonstrate the ability of polypeptide of the present invention in conjunction with human neutrophil (a kind of molecule relevant with inflammation and Inflammatory response).
Will be as Scan.J.Clin.Lab Invest.Suppl. 97: the described separation of 51-76 (1968) is incubated with the coded proteic Ig-fusion rotein of DNA40628 (by the hereinafter described method preparation of embodiment) or the humanized antibody of negative control from the neutrophil leucocyte of people's donor (PMN) blood.
According to condition, to be equivalent to 2 * 10 6The density of individual cell is suspended in PMN among the interior PBS of microfuge pipe again.With ice-cold PBS with cell washing 2 times, between twice washing with 400 * g sedimentation cell.In 4 ℃, use the PBS (encapsulant) that contains 0.5%BSA that PMN is carefully sealed and close 1 hour.After the insulation, again with encapsulant with cell washing 2 times.After the last washing, precipitation PMN, and be suspended in 1ml again with the amount of 0.1 μ g/ml and contain in the sealing damping fluid of DNA40628 albumen and control antibodies.4 ℃ of insulations 2 hours, on ice, every mistake 15 minutes with the slow resuspension of PMN cell once, then with the washing of sealing damping fluid with precipitate 5 times, each washing continues 5 minutes at 4 ℃, is deposited in 400 * g generation down.To seal damping fluid then and be used for the PMN cell, described damping fluid contain through 1: 1000 the dilution with alkaline phosphatase link coupled specificity goat and Anti-Human IgG Fc.In 4 ℃ the PMN cell is incubated 1 hour, on ice, every mistake 15 minutes is slowly mixed cell once, then with the sealing damping fluid with PMN cell washing 5 times, again be suspended in the suitable alkaline phosphatase substrate, be distributed in the droplet plate with 4 equal portions-100 μ l aliquots containig.Read the color that the O.D.405 place shows.The results are shown in Figure 21.
Embodiment 8
The hybridization of Dot blot tissue
In 65 ℃, containing the EXPRESSHYB of 100nM through psoralene-biotin labeled DNA40628 cDNA probe (SEQ ID NO:7) In the damping fluid,, people RNA master trace (Clontech) hybridization is spent the night according to manufacturer's explanation.Use the probe of Streptavidin-alkaline phosphatase detection of biological elementization.Make the trace colour developing with CDP-star substrate (Ambion), and go up the different time of exposure at Biomax film (Kodak).CDNA hybridization analysis to people's tissue shows that DNA40628 mRNA expresses in multiple tissue, but can not express (Figure 19) in cerebellum and spinal cord.DNA40628 mRNA is high expression level in colon, prostate gland, stomach, ovary, sialisterium, kidney, lung, tracheae and placenta.
Embodiment 9
The gene product overexpression
The gene that present embodiment shows coding multiple protein shown in Figure 20 CRF2-4-/-" pounding out " mouse suffers from overexpression in the colon of colitis.The antagonist form of gene product shown in therapeutical agent can adopt, for example chimeric, humanization or people's antibody at the mouse-people of described gene product.
CRF2-4-/-mouse (Spencer et al., J.Exp.Med. 187, 571-578 (1998)) and be that the IL-10 receptor knockout goes out animal, the subunit of the gene of its coding IL-10 acceptor is removed.Described mouse is used for the not reaction of down function of activating macrophage to IL-10, and can not reduce the reaction that scavenger cell TNF-α excretory lipopolysaccharides is caused.Described mouse can develop into the chronic colitis that can cause adenocarcinoma of colon.Spontaneous colitis is by lymphocyte, monocyte and neutrophil leucocyte mediation.IL-10 comes the inflammation-inhibiting reaction by the expression of modulating some inflammatory cytokines.
Proteic probe shown in Figure 20 by shown in the mRNA template of gene product produce, and be used to 5 '-nuclease test (TAQMAN for example TM) and real-time quantitative PCR (ABI PRIZM 7700SEQUENCE DETECTION SYSTEM for example TM(Perkin-Elmer, Applied BiosystemsDivision, Foster City, CA).The result is with Δ CT unit representation.1 unit be equivalent to normal comparatively speaking 1 take turns PCR circulation or about 2 times amplification, 2 units are equivalent to 4 times of amplifications, 3 units are equivalent to 8 times of amplifications etc.Use primer and through TAQMAN TMFluorescently-labeled, derive from the mRNA that is tried inflammation-genes involved product shown in Figure 20 and obtain quantitative result.Preferably from most probable contain unique nucleotide sequence and least may have the intron that got off by montage shown in the gene product zone, for example 3 '-non-translational region acquisition primer.
5 '-nuclease test reaction is based on the technology of fluorescent PCR, this technology utilize 5 of Taq archaeal dna polymerase '-exonuclease activity monitors amplification in real time.Use two antisense oligonucleotide primer deposits yields PCR to react typical amplicon.Design the 3rd oligonucleotide or probe to detect the nucleotide sequence between two PCR primers.Described probe can not be extended by the Taq archaeal dna polymerase, with report fluorescence dye and the described probe of cancellation fluorochrome label.When the position of two kinds of dyestuffs is leaned on very closely and when they are positioned on the probe, by any luminous by laser induced report dyestuff of quencher dyes cancellation.In the amplified reaction process, cut probe with the Taq archaeal dna polymerase in the mode that depends on template.The gained probe fragment is dissociated in solution, and the signal that the report dyestuff of release is sent is away from the cancellation effect of second fluorophore.For each synthetic recruit discharges 1 report dye molecule, the detection of the report dyestuff of not cancellation is provided the basis of quantitative explaination data.
5 '-nuclease tests at the real-time quantitative PCR instrument, as ABI Prism 7700 TMCarry out in the sequenator.This system is made up of thermal cycler, laser, charge coupled device (CCD), photographic camera and computer.This system on thermal cycler with the form in 96 holes amplification sample.In amplification procedure, by in whole 96 holes of fiber optic cables real-time collecting by the fluorescent signal of laser-initiation, and in CCD, detect described signal.This system comprises the software that is used to move instrument and analytical data.
5 '-the nuclease testing data is expressed as Ct at first or threshold circulates.The definition of Ct is that the report signal accumulation is to the circulation more than the fluorescence background level.With the quantitative assay value of Ct value as the initial relatively copy number of particular target sequence in the nucleic acid samples.
MRNA amplification the results are shown in Figure 20.With beta-actin as reference standard, with the expression in the wild-type animal and CRF2-4-/-the KO animal compares.Every group is detected 4 animals.All 4 KO animals all are diagnosed as colitis, in addition, suffer from adenocarcinoma of colon for wherein 3.
Figure 20 demonstrate suffer from the CRF2-4 of colitis-/-colon of mouse in, JAM mRNA has increased by 3.3 times.
As a result, in human inflammatory disorders, in inflammatory bowel and other gastroenteritis disease, PRO301, PRO362, the expression of PRO245 and PRO1868 also might raise.
Embodiment 10
The inducing endothelial cell apoptosis
In Human umbilical vein endothelial cells (HUVEC, Cell Systems), detect the ability of polypeptid induction endothelial cell apoptosis of the present invention.First day, with 2 * 10 4The density of individual cells/well, cell is laid on contains 10% serum (CSG-substratum, Cell Systems) 96 hole droplet plate (Amersham Life Sciences, cytostar-T flicker droplet plate, RPNQ160, aseptic, through tissue culture treated, pack respectively), the cumulative volume that makes every hole is 100 μ l.Second day, the extent of dilution with 1%, 0.33% and 0.11% added three parts of PRO301 and PRO245 polypeptide of being encoded by DNA40628 and DNA35638 respectively.The 3rd day,, use to be purchased test kit Apoptosis Detection Kit (R﹠amp according to the method that manufacturer is recommended; DSystems Minnesota) measures PRO301 and the apoptotic ability of PRO245 polypeptid induction, wherein uses the proteic member's annexin V of calcium and phospholipids incorporate to detect apoptosis.In cell, add annexin V and iodate third ingot through the Fluroescein-mark.Analyze with the cell counter that is equipped with single beam laser, described laser is at 488nm place launching excitation light.In this test, viable cell can be by any fluorescent dyeing, and downright bad cell can be by two kinds of fluorescent dyeings, and just standing apoptotic cell only can tunicle connection albumen V-FITC reagent dyeing.Detect the signal that annexin V-FITC produces with the FITC signal detecting and measuring apparatus.The results are shown in following table 4.
Table 4
The compound of being tested Concentration % is with respect to background fluorescence
DNA40628 albumen (SEQ ID NO:1) 0.11% 115.8
DNA40628 albumen (SEQ ID NO:1) 0.33% 199.3
DNA40628 albumen (SEQ ID NO:1) 1.0% 335.6
DNA35638 albumen (SEQ ID NO:9) 0.11% 77.6
DNA35638 albumen (SEQ ID NO:9) 0.33% 143.7
DNA35638 albumen (SEQ ID NO:9) 1.0% 146.0
DNA35638 albumen (SEQ ID NO:9) 6.82nM 67.2
DNA35638 albumen (SEQ ID NO:9) 20.46nM 102.6
DNA35638 albumen (SEQ ID NO:9) 62.0nM 118.8
The ability of proteinate inducing endothelial cell apoptosis of the present invention particularly engages the ability associating of formation with the destruction cell shown in embodiment 4, demonstrate described compound and work in cell adhesion and migration.JAM is similar with mouse, and this compound might be the cell joint molecule in epithelium and the endothelium, so just can explain their extensive organization's distributions.The endotheliocyte apoptosis induced is demonstrated effect in cell growth and apoptosis.
Embodiment 11
Antitumor activity in vitro
Basically as Skehan et al., J.Natl.Cancer Inst. 82: 1107-1112 (1990) is described, use sulfo group rhodamine B (SRB) dyestuff in conjunction with test, in the directed external anti-tumor medicine shaker test of research disease of National Cancer Institute (NCI), measure the antiproliferative activity of PRO301 of the present invention and PRO362 polypeptide.60 tumor cell lines that use in the research (" the NCI test group ") and be described in Monks et al., J.Natl.Cancer Inst. in external condition of keeping and cultivating them 83: 757-766 (1991).The purpose of screening is the preliminary assessment test-compound, and (Monks et al., document is the same, Boyd, Cancer:Princ.Pract.Oncol.Update to the cell toxicant of different types of tumors and/or the static activity of cell 3(10): 1-12 (1989)).
Cell with about 60 human tumor cell lines of trypsinase/EDTA (Gibco) collection washs 1 time, is suspended in again among the IMEM, measures their viability.Cell suspending liquid (volume is 100 μ l) is dropped to independently 96 hole droplet plates.Soak is that to be lower than soak be that 2 days cell density is to prevent hypertrophy to 6 days cell density.Make inoculating cell 37 ℃ of pre-incubations 24 hours so that cytotostaticization.In the time is 0 o'clock, 100 μ l aliquots containigs is added in the hole of droplet plate (dilution in 1: 2) to the extent of dilution of the detectable level that reaches in advance with 2 times.Estimate test-compound with half given-log10 dilution degree (1000 to 100,000 times).At 5%CO 2Insulation is 2 days and 6 days under atmosphere and 100% humidity.
After the insulation, remove substratum, in 40 ℃ with cell fixation in 0.1ml 10% Tricholroacetic Acid.With deionized water the droplet plate is washed 5 times, dry, the 0.4% sulfo group rhodamine B dyestuff (Sigma) that is dissolved in 1% acetic acid with 0.1ml dyeed 30 minutes, wash 4 times to remove unconjugated dyestuff with 1% acetic acid, dry, with 0.1ml 10mM Tris base[tris (methylol) aminomethane], pH10.5 extracted staining agent 5 minutes.The 96 hole droplet plate readout instruments at interface of using a computer are measured the absorbance value (OD) of sulfo group rhodamine Bs at the 492nm place.
If demonstrate at least 50% growth-inhibiting effect, just think that given the test agent is positive at one or more concentration place.Following table demonstrates positive findings, and it is as follows wherein to abridge:
NSCL=is non--small cell lung cancer
The CNS=central nervous system
The Leuk=leukemia
Table 5
The compound of being tested Concentration The length of test Tumor cell line
Type Title
DNA40628 albumen (SEQ ID NO:1) 0.075nM 6 The colon melanoma HCC-2998 M14
DNA40638 albumen (SEQ ID NO:1) 700nM 6 Melanoma M14
DNA40628 albumen (SEQ ID NO:1) 152nM 6 The colon melanoma SR LOX IMVI
DNA40628 albumen (SEQ ID NO:1) 15.2nM 6 Melanoma LOX IMVI
DNA40628 albumen (SEQ ID NO:1) 0.85nM 6 NSCL ovary prostate gland HOP62 OVCAR-3 PC3
DNA45416 albumen (SEQ ID NO:2) 15nM 2 Ovary SK-OV-3
DNA45416 albumen (SEQ ID NO:2) 15nM 6 The NSCL prostate gland NCI-H322M PC-3
DNA45416 albumen (SEQ ID NO:2) 4.7nM 6 Melanoma LOX IMVI
DNA45416 albumen (SEQ ID NO:2) 47nM 6 The NSCL colon NCI-H322M Colo 205
DNA45416 albumen (SEQ ID NO:2) 152nM 2 CNS mammary gland SR-295 T047D
DNA45416 albumen (SEQ ID NO:2) 152nM 6 Leuk NSCL colon C NS melanoma SR，HL-60(TB)，MOLT-4，K-562 NCI-H23，EKVX HCC-2998 U251 UACC-62，UACC-257，LOX IMVI
DNA35638 albumen (SEQ ID NO:9) 0.35nM 2 The NSCL ovary HOP92 OVCAR-4
DNA35638 albumen (SEQ ID NO:9) 0.35nM 2 Leuk SR
DNA35638 albumen (SEQ ID NO:9) 0.35nM 6 Colon HCC-2998
DNA35638 albumen (SEQ ID NO:9) 3.5nM 6 The Leuk colon SR SW-620
DNA35638 albumen (SEQ ID NO:9) 6.2nM 6 Colon HCT-116
DNA35638 albumen (SEQ ID NO:9) 6.2nM 6 Leuk RPMI-8226
Embodiment 12
With PRO301, PRO362, PRO245 or PRO1868 are as hybridization probe
Following method has been described the PRO301 that will encode, PRO362, and the nucleotide sequence of PRO245 or PRO1868 is as hybridization probe.
Native sequences PRO301 will be contained respectively, PRO362, the encoding sequence of PRO245 or PRO1868 is (shown in Fig. 5-7 and 61, SEQ ID NO:11,7,8 and 31) DNA is used as probe to screen homologous dna (as the PRO301 that encodes respectively, PRO362, the DNA of the natural variant of PRO245 or PRO1868) in people's tissue cDNA library or people's tissue gene group library.
Under following high stringent condition, contain the hybridization and the washing of the filter membrane of cDNA or genomic library DNA.In 42 ℃, at 50% methane amide, 5 * SSC, 0.1%SDS, 0.1% trisodium phosphate, the 50mM sodium phosphate, pH6.8 in the solution of 2 * Denhardt ' s solution and 10% dextran sulfate, makes through the radiolabeled PRO301-of deriving from, PRO362-, the probe of PRO245 or PRO1868-and filter hybridization 20 hours.In 42 ℃, in the aqueous solution of 0.1 * SSC and 0.1%SDS, carry out the washing of filter membrane.
Use standard technique known in the art to identify and coding total length native sequences PRO301 then, PRO362, the DNA of PRO245 or PRO1868 has the DNA of required sequence identity.
Embodiment 13
At expression in escherichia coli PRO301, PRO362, PRO245 or PRO1868
Present embodiment has been illustrated in intestinal bacteria PRO301, PRO362, PRO245 or the PRO1868 by the non-glycosylated form of recombinant expressed preparation.
At first use selected PCR primer amplification coding PRO301, PRO362, the dna sequence dna of PRO245 or PRO1868.Described primer should contain with selected expression vector on the corresponding restriction enzyme site of restriction enzyme site.Can use multiple expression vector.Suitably the example of carrier is that pBR322 (derives from intestinal bacteria; Referring to Bolivar et al., Gene, 2: 95 (1977)), this carrier contains penbritin and tetracycline resistance gene.With the Restriction Enzyme digested vector and make its dephosphorylation.Sequence through pcr amplification is connected with carrier.Preferred vector comprises that sequence, trp promotor, the poly-His leader sequence of the antibiotics resistance gene of encoding (comprise preceding 6 STII codons, poly-his sequence and enteropeptidase cleavage site), PRO301, PRO362, PRO245 or PRO1868 coding region, λ transcription termination sequence and argU gene.
Use (document is the same) described methods such as Sambrook then, transform selected coli strain with connecting mixture.Identify transformant by its energy for growth on the LB flat board, select the antibiotics resistance bacterium colony then.Isolated plasmid dna confirms its sequence by restriction analysis and dna sequencing.
Be added with antibiotic liquid nutrient medium, as selecting clone's overnight incubation in the LB meat soup.Subsequently, use the fairly large culture of overnight culture inoculation.Then with cell cultures to required optical density(OD), in this process, enabled the expression promotor.
Cell is cultivated after the several hrs again centrifugal collecting cell.Use plurality of reagents known in the art to dissolve the cell precipitation thing of centrifugal gained, come purifying dissolved PRO301, PRO362, PRO245 or PRO1868 albumen by for example under the condition that allows albumen to combine closely, using metal chelating column.
Use following method, in intestinal bacteria, gather the formal representation PRO301 of His mark with warp.At first use the DNA of selected PCR primer amplification coding PRO301.Described primer contains and selectes the corresponding restriction enzyme site of restriction enzyme site on the expression vector, and other translation initiation can be provided effectively and reliably, fast purifying and carry out the useful sequence that proteolysis is removed on metal chelating column with enteropeptidase.To be connected to expression vector through pcr amplification and sequence then, use escherichia coli host (W3110 fuhA (tonA) lon galE rpoHts (htpRts) clpP (lacIq) of this expression vector conversion based on bacterial strain 52 through gathering the His mark.At first in 30 ℃ of LB that containing the 50mg/ml Pyocianil with the transformant shaking culture, be 3-5 until O.D.600.Use the CRAP substratum (by in 500ml water, mixing 3.57g (NH then 4) 2SO 4, 0.71g Trisodium Citrate 2H 2O, 1.07g KCl, 5.36g Difco yeast extract, 5.36g Sheffield hycase SF and prepare wherein also contain 110mM MPOS, pH7.3,0.55% (w/v) glucose and 7mM MgSO 4) culture is diluted 50-100 doubly, in 30 ℃ of about 20-30 of shaking culture hours.Take out sample and confirm to express to analyze by SDS-PAGE, centrifugal a large amount of cultures are with sedimentation cell.The frozen cell throw out is until purifying and refolding.
The intestinal bacteria mashed prod (6-10g throw out) that derives from 0.5 to 1L fermented liquid is suspended in the 7M guanidine of 10 times of volumes (w/v), 20mM Tris, pH 8 damping fluids again.Add solid sodium sulfite and sodium tetrathionate, make their final concentration be respectively 0.1M and 0.02M, solution stirring is spent the night in 4 ℃.This step causes producing the metaprotein that all cysteine residues are closed because of sulphiting.In the Beckman ultracentrifuge, with 40,000rpm centrifugal solution 30 minutes.Metal chelating column damping fluid (pH 7.4 for 6M guanidine, 20mM Tris) with 3-5 times of volume dilutes supernatant liquor, and filters with clarified supernatant by 0.22 micron filter.Clarifying extract is splined in the Qiagen Ni-NTA metal chelating column that 5ml crosses with metal chelating column damping fluid balance.With containing 50mM imidazoles (Calbiochem, Utrol level), the extra damping fluid washing column of pH7.4.With the buffer solution eluted protein that contains the 250mM imidazoles.Collection contains the fraction of desirable proteins, and described fraction is stored in 4 ℃.The optical extinction coefficient that use calculates based on its aminoacid sequence is estimated protein concentration by its absorbance value at the 280nm place.
Refolding damping fluid by sample slowly is diluted in prepared fresh is with refolding albumen, and described damping fluid is made up of following compositions: 20mM Tris, pH8.6,0.3M NaCl, 2.5M urea, 5mM halfcystine, 20mM glycine and 1mM EDTA.Select the refolding volume, make that proteic final concentration is 50 to 100 micrograms/ml.In 4 ℃ refolding solution was slowly stirred 12-36 hour.By adding final concentration is that the TFA of 0.4% (pH is about 3) reacts with the cancellation refolding.Before being further purified albumen, by 0.22 micron filter filtering solution, adding final concentration is the acetonitrile of 2-10%.On Poros R1/H reversed-phase column, use 0.1%TFA as the damping fluid that flows, and with 10 to 80% the acetonitrile gradient wash-out albumen with the chromatography refolding.Analysis has the fraction aliquots containig of A280 absorbance value on sds page, collects and contains the proteic fraction of homogeneous refolding.In general, can the wash-out most ofs proteic suitably folding kinds of the acetonitrile of minimum concentration because the densification the most of the hydrophobic inner core of these kinds, thereby have been avoided interaction with reversed-phase resin.Usually with higher acetonitrile concentration wash-out accumulative kind.Except proteic false folding form is separated with desired form, anti-phase step has also been removed intracellular toxin from sample.
Collect and contain respectively, and use the nitrogen gas stream that slowly imports in the solution to remove acetonitrile by the folding proteic fraction of PRO301 of required mode.Carry out gel-filtration by dialysis or by using, albumen is formulated in the 20mM Hepes that contains 0.14M sodium-chlor and 4% N.F,USP MANNITOL, among the pH6.8, and carry out sterile filtration through preparation damping fluid equilibrated G25Superfine (Pharmacia) resin.
Embodiment 14
In mammalian cell, express PRO301, PRO362, PRO245 or PRO1868
Present embodiment has been illustrated in mammalian cell PRO301, PRO362, PRO245 or the PRO1868 by recombinant expressed preparation glycosylation form.
Carrier pRK5 (referring to EP 307,247, being disclosed on March 15th, 1989) is used as expression vector.Choose wantonly PRO301, PRO362, PRO245 or PRO1868DNA are connected to the pRK5 with selected Restriction Enzyme, insert PRO301, PRO362, PRO245 or PRO1868 DNA to allow to use as described method of attachment such as Sambrook (document is the same).The gained carrier is called pRK5-PRO301, pRK5-PRO362, pRK5-PRO245 or pRK5-PRO1868.
In one embodiment, Xuan Ding host cell can be 293 cells.In tissue culturing plate, be added with foetal calf serum and optional nutritive ingredient and/or the antibiotic substratum of being added with, be paved with as in the DMEM people's 293 cells (ATCC CCL 1573) being cultured to.With the DNA[Thimmappaya et al. of about 10 μ gpRK5-PRO301, pRK5-PRO362, pRK5-PRO245 DNA or pRK5-PRO1868 and about 1 μ g coding VA rna gene, Cell, 31: 543 (1982)] mix, and be dissolved in the 1mM Tris-HCl of 500 μ l, 0.1mM EDTA, 0.227M CaCl 2In.The 50mM HEPES (pH7.35) of Dropwise 5 00 μ l in this mixture, 280mM NaCl, 1.5mMNaPO 4, form throw out 10 minutes in 25 ℃.Suspended sediment adds them in 293 cells, places about 4 hours in 37 ℃.The sucking-off substratum adds the PBS that 2ml contains 20% glycerine and put 30 seconds.Wash 293 cells with serum free medium then, add fresh culture, cell is incubated about 5 days.
After the transfection about 24 hours, remove substratum and with substratum (only being substratum) or contain 200 μ Ci/ml 35S-halfcystine and 200 μ Ci/ml 35The substratum of S-methionine(Met) replaces.After being incubated 12 hours, the collection condition substratum concentrates on rotary filter, and is splined on the 15%SDS gel.Can dry gel through processing, and in selected for some time, they are exposed to film to disclose existing of PRO301, PRO362, PRO245 or PRO1868 polypeptide.Can (in serum free medium) further be incubated the culture that contains transfectional cell, and in selected bioassay method, detect substratum.
In an alternative technology, can use Somparyrac et al., Proc.Natl.Acad.Sci ., 12: 7575 (1981) described dextran sulfate methods, with instantaneous importing 293 cells of PRO301, PRO362, PRO245 or PRO1868DNA.In shaking bottle with 293 cell cultures to maximum density, add 700 μ g pRK5-PRO301, pRK5-PRO362, pRK5-PRO245 or pRK5-PRO1868 DNA.At first by centrifugal from shake bottle concentrating cells, wash with PBS again.On the cell precipitation thing, DNA-dextran throw out is incubated 4 hours.With 20% glycerin treatment cell 90 seconds,, and import again and contain the shaking in the bottle of tissue culture medium (TCM), 5 μ g/ml Sigma I8405s and 0.1 μ g/ml ox transferrin with the tissue culture medium (TCM) washing.After about 4 days, the centrifugal condition substratum also filters to remove cell and cell debris.Concentrate the sample that contains PRO301, the PRO362, PRO245 or the PRO1868 that have expressed then, and, carry out purifying as dialysis and/or column chromatography by any selected method.
In another embodiment, can in Chinese hamster ovary celI, express PRO301, PRO362, PRO245 or PRO1868.Can use known agent, as CaPO 4Or the DEAE-dextran with pRK5-PRO301, pRK5-PRO362, pRK5-PRO245 or pRK5-PRO1868 transfection to Chinese hamster ovary celI.As indicated above, the insulation cell culture, with substratum (only be substratum) or contain radio-labeling, as 35The substratum of S-methionine(Met) substitutes substratum.Measure after the existence of PRO301, PRO362, PRO245 or PRO1868 polypeptide, substitute substratum with serum free medium.Preferably culture is incubated about 6 days, then the collection condition substratum.Concentrate the substratum that contains PRO301, the PRO362, PRO245 or the PRO1868 that have expressed, and carry out purifying by any selected method.
Also can in host CHO cell, express PRO301, PRO362, PRO245 or the PRO1868 that has the epi-position label.Can be from the pRK5 carrier subclone PRO301, PRO362, PRO245 or PRO1868.To the subclone inset carry out PCR with in rhabdovirus expression vector with selected epi-position label, carry out the frame endomixis as poly--his mark.Then will be through PRO301, PRO362, PRO245 or the PRO1868 inset subclone of poly--his mark to containing selective marker, drive carrier to select stable clone as the SV40 of DHFR.At last, drive carrier transfection (as mentioned above) Chinese hamster ovary celI with SV40.Carry out mark as mentioned above to confirm expression.Concentrate then contain expressed, through the substratum of PRO301, PRO362, PRO245 or the PRO1868 of poly--his mark, and by any selected method, as pass through Ni 2+-chelating affinity chromatography is carried out purifying.
In Chinese hamster ovary celI, express PRO301, PRO362, PRO245 and RO1868 by instantaneous and stably express method.
Use following method in Chinese hamster ovary celI, to carry out stably express.Protein expression become IgG construct (immunoadhesin) and/or through the form of poly--His mark, in described construct, the encoding sequence of various proteic soluble forms (as extracellular region) with contain hinge region, the IgG1 constant region sequence fusion in CH2 and CH2 district.
After the pcr amplification, use as Ausubel et al., Current Protocols of MolecularBiology, Unit 3.16, the described standard technique of John Wiley and Sons (1997), with various DNA subclones to the CHO expression vector.5 ' and the 3 ' end that the CHO expression vector generally is built at required DNA has the restriction site of coupling so that reorganization cDNA.Carrier of in Chinese hamster ovary celI, expressing used herein such as Lucas et al., Nucl.Acids Res. 24: 9,1774-1779 (1996) is described, and described carrier uses SV40 early promoter/enhanser to drive required cDNA and Tetrahydrofolate dehydrogenase (DHFR) is expressed.DHFR expresses the plasmid that can select stable maintenance after transfection.
Use commercially available transfection reagent Superfect 7(Qiagen), Dosper 7Or Fugene 7(Boehringer Mannheim) imports about 10 with the required plasmid DNA of 12 micrograms 7Individual Chinese hamster ovary celI.Press (document is the same) described culturing cells such as Lucas.In ampoule freezing about 3 * 10 -7Individual cell is to carry out subculture and production by hereinafter described.
The ampoule that will contain plasmid DNA places water-bath to melt, and mixes by vortex.With content move into contain the 10ml substratum in spigot, centrifugal 5 minutes of 1000rpm.The sucking-off supernatant liquor is suspended in 10ml again with cell and selects substratum (the filtering PS20 of 0.2 μ m wherein contains the foetal calf serum of 5%0.2 μ m diafiltrations).Select the 100ml of substratum in spigot to containing 90ml the cell five equilibrium then.After 1-2 days, with cell transfer to 250ml that 150ml selects growth medium being housed in spigot, and in 37 ℃ of insulations.After 2-3 days, with 3 * 10 5Individual cell/ml inoculation 250mL, 500mL and 2000mL from spigot.By centrifugal and be suspended in the production substratum again, change cell culture medium with fresh culture.Although can use any suitable CHO substratum, what reality was used is the production substratum of describing in the United States Patent (USP) 5,122,469 of promulgation on June 16th, 1992.With 1.2 * 10 6Individual cell/ml inoculation 3L produces from spigot.The 0th day, measure cell number and pH.The 1st day, from from spigot, taking a sample, and begin to spray filtered air.The 2nd day from taking a sample from spigot, is 33 ℃ with temperature transition, adds 30mL 500g/L glucose and 0.6mL 10% defoamer (as 35% polydimethylsiloxane emulsion, Dow Corning 365 Medical Grade Emulsion).In process of production, regulate pH in case of necessity, pH is maintained about 7.2.After 10 days, or reduce to 70% when following when viability, the centrifugal collecting cell culture, and filter by 0.22 μ m filter.Filtrate is stored in 4 ℃, or is splined on post immediately to carry out purifying.
For for the construct of poly--His mark, use Ni-NTA post (Qiagen) purifying protein.Before the purifying, adding imidazoles to concentration in conditioned medium is 5mM.In 4 ℃,, conditioned medium is splined on the 6ml 20mM Hepes that contains 0.3M NaCl and 5mM imidazoles, the Ni-NTA post that pH7.4 damping fluid balance is crossed with pump with 4-5ml/ minute flow velocity.After the last sample, with extra level pad washing column, and with the level pad eluted protein that contains the 0.25M imidazoles.Subsequently, with 25ml G25 Superfine (Pharmacia) post with highly purified albumen desalination to containing 10mMHepes, 0.14M NaCl and 4% N.F,USP MANNITOL, the store buffer liquid of pH6.8, and be stored in-80 ℃.
By following from conditioned medium immunoadhesin (the containing Fc) construct of purifying protein.With pump conditioned medium is splined on 5ml 20mM sodium phosphate buffer, the albumin A post (Pharmacia) that the pH6.8 balance is crossed.After the last sample,, use the 100mM citric acid again, the pH3.5 wash-out with level pad thorough washing post.Contain 275mL 1M Tris damping fluid by the 1ml fraction is collected, in the pipe of pH9, immediately in and the albumen of wash-out.Subsequently, as mentioned to described like that through the albumen of poly--His mark, with highly purified albumen desalination to store buffer liquid.Estimate homogeneity by sds page with by the sequence of Edman degraded mensuration-terminal amino acid.
Also produce PRO301, PRO362, PRO245 and PRO1868 by transient expression in the COS cell.
Embodiment 15
In yeast, express PRO301, PRO362, PRO245 or PRO1868
Following method has been described recombinant expressed PRO301, PRO362, PRO245 or PRO1868 in yeast.
At first, make up Yeast expression carrier with by producing in the ADH2/GAPDH promotor cell or secretion PRO301, PRO362, PRO245 or PRO1868.With the DNA of coding PRO301, PRO362, PRO245 or PRO1868, selected signal peptide and promotor are inserted the suitable restriction enzyme site of selected plasmid, with the cell inner expression of mediation PRO301, PRO362, PRO245 or PRO1868.In order to secrete, can be with the DNA of coding PRO301, PRO362, PRO245 or PRO1868, DNA together with coding ADH2/GAPDH promotor, yeast α-factor secretion signal/leader sequence and joint sequence (if necessary) are cloned into selected plasmid, to express PRO301, PRO362, PRO245 or PRO1868.
Use above described expression plasmid transformed yeast cell then,, and in selected fermention medium, cultivate as yeast strain AB110.By separating, then analyze the supernatant liquor of transformed yeast with Coomassie blue dyeing gel with 10% Tricholroacetic Acid precipitation and by SDS-PAGE.
Subsequently, by the centrifugal yeast cell of from fermention medium, removing, use selected cylindricality filter enrichment medium then, with PRO301, PRO362, PRO245 or the PRO1868 of separation and purification of Recombinant.Use selected column chromatography resin to be further purified the enriched material that contains PRO301, PRO362, PRO245 or PRO1868.
Embodiment 16
By the expressed in insect cells PRO301 of baculovirus infection, PRO362, PRO245 or PRO1868
Following method has been described recombinant expressed PRO301, PRO362, PRO245 or PRO1868 in by the insect cell of baculovirus infection.
PRO301, PRO362, PRO245 or PRO1868 are merged to the upstream of the contained epi-position label of rhabdovirus expression vector.Described epi-position label comprises poly--his mark and immune globulin white marker (as the Fc district of IgG).Can use multiple plasmid, comprise derived from being purchased plasmid, as the plasmid of pVL1393 (Novagen).Briefly, the primer of use and 5 ' and 3 ' regional complementarity, by pcr amplification PRO301, PRO362, PRO245 or PRO1868, or the desirable part of PRO301, PRO362, PRO245 or PRO1868 (as the sequence of coding extracellular region).5 ' primer can mix flank (selected) restriction enzyme site.Use selected Restriction Enzyme digestion product and subclone to expression vector then.
By using lipofectin (available from GIBCO-BRL) with above-mentioned plasmid and BACULOGOLD TMViral DNA (Pharmingen) cotransfection to fall army worm (Spodoptera frugiperda) (" Sf9 ") cell (ATCC CRL 1711) to produce recombinant baculovirus.After 28 ℃ of insulations 4-5 days, the virus that results discharge also is used for further amplification.Press O ' Reilley et al., Baculovirus expressionvectors:A laboratory Manual, described virus infection and the protein expression of carrying out of Oxford:Oxford University Press (1994).
Then, by the following for example Ni that passes through 2+The warp that-chelating affinitive layer purification has been expressed is poly--PRO301, PRO362, PRO245 or the PRO1868 of his mark.Press Rupert et al., Nature, 362: 175-179 (1993) is described, from being prepared extract the Sf9 cell of recombinant virus infection.Briefly, washing Sf9 cell is suspended in supersound process damping fluid (25mL Hepes, pH7.9 again; 12.5mM MgCl 20.1mM EDTA; 10% glycerine; 0.1%NP-40; 0.4M KCl), supersound process on ice 2 times, each 20 seconds.By centrifugal clarification supersound process thing, (10% glycerine filters pH7.8) with 50 times of supernatant liquor dilutions, and by the 0.45Fm filter for 50mM phosphoric acid salt, 300mM NaCl with sample-loading buffer.The preparation bed volume is the Ni of 5mL 2+-NTA agarose column (available from Qiagen) is used the 25mL water washing, and with 25mL sample-loading buffer balance.Flow velocity with per minute 0.5mL is splined on post with filtered cell extract.With sample-loading buffer post is washed to baseline A 280, begin to collect fraction at this point.Then, with proteic second lavation buffer solution (the 50mM phosphoric acid salt of energy wash-out non-specific binding; 300mM NaCl, 10% glycerine, pH6.0) washing column.Reach A once more 280After the baseline, in second lavation buffer solution with 0 to 500mM imidazoles gradient development post.Collect the 1mL fraction, and dye or use and alkaline phosphatase (Qiagen) link coupled Ni by SDS-PAGE and silver 2+-NTA carries out the western trace and analyzes fraction.Collection contains through wash-out with through His 10The fraction of the PRO301 of-mark, PRO362, PRO245 or PRO1868, and dialyse facing to sample-loading buffer.
Perhaps, can use known chromatographic technique, comprise that albumin A for example or Protein G column chromatography purification are through IgG mark (or Fc mark) PRO301, PRO362, PRO245 or PRO1868.
By Sf9 expressed in insect cells PRO301, PRO362 and the PRO245 of baculovirus infection.In fact carry out with the scale of 0.5-2L although express, (as 8L) can easily expand the scale of production.Protein expression become IgG construct (immunoadhesin) and/or through the form of poly--His mark, in described construct, proteic extracellular region with contain hinge region, the IgG1 constant region sequence fusion in CH2 and CH3 district.
After the pcr amplification, each encoding sequence subclone to rhabdovirus expression vector (is pb.PH.IgG to the IgG fusions, albumen through poly--His mark is pb.PH.His.c), use Lipofectin (Gibco BRL) with carrier and BACULOGOLD TMBaculovirus DNA (Pharmingen) cotransfection to 10 5Individual fall army worm (" Sf9 ") cell (ATCC CRL 1711).Pb.PH.IgG and pb.PH.His are the modified forms that is purchased rhabdovirus expression vector pVL1393 (Pharmingen), and they have modified polylinker zone to comprise His or Fc flag sequence.Culturing cell in being added with the Hink ' s TNM-FH substratum of 10%FBS (Hyclone).In 28 ℃ cell is incubated 5 days.Collect supernatant liquor, subsequently, infect the Sf9 cell that is in the Hink ' s TNM-FH substratum that is added with 10%FBS (Hyclone) to be about 10 infection multiplicity (MOI) with supernatant liquor, to carry out first round virus amplification.In 28 ℃ cell is incubated 3 days.Collect supernatant liquor, by the 1ml supernatant liquor is combined with 25mL Ni-NTA pearl (QIAGEN) (for the albumen through histidine mark) or Protein-A Sepharose CL-4B pearl (Pharmacia) (for the albumen through the IgG mark) in batches, then analyze with protein standard and compare, thereby the construct of measuring in the rhabdovirus expression vector is expressed through the concentration known of Coomassie blue stain by SDS-PAGE.
To be about 0.1 MOI, the supernatant liquor of usefulness first round virus amplification infects the Sf9 cell turn culture (500ml) of growth in ESF-921 substratum (Expression Systems LLC).In 28 ℃ cell is incubated 3 days.Collect supernatant liquor and filtration.Repeat combination in batches and SDS-PAGE in case of necessity and analyze, until the expression that confirms the turn culture.
Centrifugal collection, and is filtered by 0.22 micron filter removing cell through the conditioned medium (0.5 to 3L) of transfectional cell.For construct, use Ni-NTA post (Qiagen) purifying protein construct through poly--His mark.Before the purifying, adding imidazoles to concentration in conditioned medium is 5mM.In 4 ℃,, conditioned medium is splined on the 6ml 20mM Hepes that contains 0.3M NaCl and 5mM imidazoles, the Ni-NTA post that pH7.4 damping fluid balance is crossed with pump with 4-5ml/ minute flow velocity.After the last sample, with extra level pad washing column, and with the level pad eluted protein that contains the 0.25M imidazoles.Subsequently, with 25ml G25 Superfine (Pharmacia) post with highly purified albumen desalination to containing 10mM Hepes, 0.14M NaCl and 4% N.F,USP MANNITOL, the store buffer liquid of pH6.8, and be stored in-80 ℃.
By following from conditioned medium immunoadhesin (the containing Fc) construct of purifying protein.With pump conditioned medium is splined on 5ml 20mM sodium phosphate buffer, the albumin A post (Pharmacia) that the pH6.8 balance is crossed.After the last sample,, use the 100mM citric acid again, the pH3.5 wash-out with level pad thorough washing post.Contain 275mL 1M Tris damping fluid by the 1ml fraction is collected, in the pipe of pH9, immediately in and the albumen of wash-out.Subsequently, as mentioned to described like that through the albumen of poly--His mark, with highly purified albumen desalination to store buffer liquid.Estimate homogeneity by sds page (PEG) electrophoresis with by the sequence of Edman degraded mensuration-terminal amino acid.
In addition, use similar method, in by the High-5 cell of baculovirus infection, express PRO301, PRO362 and PRO245.In 27 ℃, at no CO 2, under the situation of no penicillin and no Streptomycin sulphate, High-5 cell cultures to 50% is paved with.In each 150mm culture plate, make 30 μ g contain PRO301, carrier and 1ml Ex-Cell substratum (substratum: the Ex-cell 401 of PRO362 or PRO245 based on pIE, 1/100L-Glu JRH Biosciences, #14401-78P, annotate: substratum is a photosensitivity) mixing, at one independently in the pipe, make 100 μ l CELLFECTIN TM(GibcoBRL #10362-010) mixes with 1ml Ec-Cell substratum.Design pIE1-1 and pIE1-2 carrier with in the insect cell of stable conversion by baculovirus ie1 promotor constitutive expression recombinant protein (Cartier, J.L., et al., J.Virol. 68, 7728-7737) (1994).These two direction differences that the unique difference of plasmid is a multiple clone site, they contain known vital all promoter sequences of genetic expression and hr5 enhancer element for the mediation of the ie1-in the not infected insect cell.PIE1-1 and pIE1-2 comprise the ie1 translation initiation site and can be used for producing fusion rotein.
Mix this two kinds of solution, room temperature insulation 15 minutes.At 2ml DNA/CELLFECTIN TMAdd 8ml Ex-Cell substratum in the mixture, be laid on and use in advance on the washed High-5 cell of Ex-Cell substratum.Room temperature is incubated 1 hour in the dark with culture plate.Sucking-off DNA/CELLFECTIN TMMixture, with Ex-Cell washed cell 1 time to remove excessive CELLFECTIN TMAdd fresh Ex-Cell substratum (30ml), cell is incubated 3 days in 28 ℃.Collect supernatant liquor, according to at the described similar method of Sf9 cell, by in batches in conjunction with the expression of measuring PRO301, PRO362 or PRO245.
Embodiment 17
Preparation is in conjunction with the antibody of PRO301, PRO362, PRO245 and PRO1868
Present embodiment has been illustrated the MONOCLONAL ANTIBODIES SPECIFIC FOR of specificity in conjunction with PRO301, PRO362, PRO245 or PRO1868.
The technology of manufacture order clonal antibody is known in the art, and described technical description is in for example Goding, Document is the sameOperable immunogen comprises PRO301, PRO362, PRO245 and the PRO1868 of purifying, the fusion rotein that contains PRO301, PRO362, PRO245 and PRO1868, and at the cell of cell surface expression reorganization PRO301, PRO362, PRO245 and PRO1868.Those skilled in the art need not undo experimentation can select immunogen.
With PRO301, the PRO362, PRO245 and the PRO1868 immunogen immune mouse that are emulsifiable in the complete Freund's adjuvant, as BALB/c, and with the amount of 1-100 microgram subcutaneous or peritoneal injection.Perhaps, the MPL-TDM adjuvant (Ribi Immunochemical Research, Hamilton, MT) in the emulsification immunogen, and be injected to the metapedes pad of animal.After 10 to 12 days, be used in the selected adjuvant emulsive immunogen again to carrying out booster immunization through mice immunized.After several weeks, carry out immunization once more with the booster immunization mouse.Periodically in the mouse body, obtain serum sample by getting blood behind the socket of the eye, be used for the ELISA test to detect PRO301, PRO362, PRO245 and PRO1868 antibody.
Detected after the suitable antibody titers, finally given antibody " positive " animal intravenous injection PRO301, PRO362, PRO245 and PRO1868.After 3 to 4 days, put to death mouse and collect splenocyte.Make splenocyte and selected rat bone marrow tumour cell system then, as derive from ATCC, the P3X63AgU.1 of No.CRL1597 merges (using 35% polyoxyethylene glycol).Merge to produce hybridoma, then hybridoma is laid on the 96 hole tissue culturing plates of containing HAT (xanthoglobulin, aminopterin and thymidine) substratum propagation with the cell, myelomatosis heterozygote and the splenocyte heterozygote that suppress not merge.
The screening hybridoma is to the reactivity of PRO301, PRO362, PRO245 or PRO1868 in ELISA.Those skilled in the art can easily measure the " the positive " hybridoma of the required monoclonal antibody that can secrete anti-PRO301, PRO362, PRO245 or PRO1868.
The ascites that positive hybridoma cell peritoneal injection to homology BALB/c mouse can be contained anti--PRO301, anti--PRO362, anti--PRO245 or anti--PRO1868 monoclonal antibody with generation.Perhaps, in tissue culture flasks or rolling bottle, cultivate hybridoma.Use ammonium sulfate precipitation, then get final product the monoclonal antibody that produces in the purifying ascites with gel exclusion chromatography.Perhaps, can use bonded affinity chromatography based on antibody and albumin A or Protein G.
From people's colon cDNA library, isolate people PRO245 and PRO1868cDNA by colony hybridization.Press the described preparation of Ashkenazi et al.Curr.Opin.Immun.9:195 (1997) PRO245 (PRO245.Fc, be also referred to as JAM-IT.Fc or JAM2.Fc) and the human IgG1 Fc fusion rotein (immunoadhesin) of PRO1868 (PRO1868.Fc or JAM3.Fc), and by albumin A post (AmershamPharmacia Biotech, NJ USA) carries out purifying.Confirm its identity by the N-terminal sequence analysis.
Via foot pad injection 10 μ g PRO245.Fc or through the PRO1868 of 8 * His-mark immunity and booster immunization BALB/c female mice.Filter out anti-PRO245.Fc or through the single clone of the PRO1868 of 8 * His-mark.Detect the cross reactivity of selected clone and A33/JAM family member and human IgG Fc.To clone titration to unicellular density and screening again.Find that clone 12D10.2F9 can optionally react with JAM2 (PRO245) rather than JAM or JAM3.Find that clone MaJIR1 can optionally react with JAM3 rather than JAM or JAM2.Separate these two clones and be used to produce ascites.By Protein G column purification Ab.
Anti--PRO245 antibody 12D10.2F9 interacts specifically with the Chinese hamster ovary celI of expressing PRO245, and not with the Chinese hamster ovary celI of expressing human PRO301 interact (Figure 58).Briefly, use to be specific to encoding sequence 5 ' and 3 ' terminal primer, by PCR from people's colon cDNA library (Clontech Laboratories, Palo Alto, CA, PRO245 cDNA increases in USA).The purifying segment is connected to the pSD5 expression vector with segment, and transfection is to Chinese hamster ovary (CHO) cell, and by described selection of Lucas et al.Nuc.Acids Res.24:1774 (1996).Screening stabilized cell clone's antibody response.Shown in Figure 58, anti--PRO245 antibody (12D10.2F9) does not combine with the CHO transfectant CuL8r that expresses huJAM.CuL8r does not interact with anti--huJAM antibody 10A5.
Embodiment 18
The cDNA clone who separates coding people PRO1868 by cloning by expression
Mixing cDNA library transient transfection to the COS cell of growing on the glass chamber slide by will encode secretion and transmembrane protein is identified PRO1868.After the transfection 24 hours, add PRO245 or PRO245-Fc fusions (0.5 μ g/ml), and be incubated 30 minutes.Measure the combination (Klein et al., Nature, 387:717 and 392:210 (1998)) of PRO245/PRO245-Fc fusions.The binding ability of selection and PRO245/PRO245-Fc fusions positive clone identify for further.
Embodiment 19
Induce the chondrocyte to break up again
In the chondrocyte, detect the ability that polypeptid induction of the present invention breaks up again.The albumen that can induce the chondrocyte to break up again is used for the treatment of multiple bone and/or cartilage disease, as sport injury and sacroiliitis.
With collagenase the connection cartilage digestion of the palm toe joint of 4-6 monthly age sow is spent the night to isolate the pig chondrocyte.Then with 25,000 cell/cm 2Amount isolated cells is inoculated in the Ham F-12 that contains 10%FBS and 4 μ g/ml gentamicins.Changed a subculture in every the 3rd day, then with 5, the amount of 000 cells/well with cell inoculation in 96 well culture plates, the same medium that 100 μ l do not contain serum is contained in wherein every hole, add 100 μ l and tried the PRO1868 polypeptide, 5nM Staurosporine (positive control) or only to add substratum (negative control) to final volume be 200 μ l/ holes.37 ℃ of insulations were taken the photo in each hole after 5 days, measured chondrocyte's differentiation state.When the chondrocyte who determines breaks up when more being similar to positive control rather than negative control again, test-results is promptly positive.
After testing, the PRO1868 polypeptid induction chondrocyte ability of breaking up again is positive.
Embodiment 20
Overexpression PRO1868 polypeptide in cancerous tumours
In the present embodiment, checked the PRO1868 expression of polypeptides level in the cancerous tissue.The polypeptide of overexpression not only can be used as the diagnostic flag that one or more cancerous tumours exist in cancerous tumours, also can be used as the described tumor treatment target of treatment.
In order to detect the overexpression of PRO1868 polypeptide, use nucleic acid microarray to identify for healthy tissues the gene of differential expression in ill respective organization.Use the nucleic acid microarray reverse transcription to derive to be tried with the control tissue sample tried and contrasted the mRNA sample, the described mRNA sample of mark is to produce the cDNA probe.Make cDNA probe and the nucleic acid array hybridization of being fixed on the solid support then.Microarray sets, and is known thereby make the sequence of each member in the array and position.For example, can select the known sequence in the gene of in certain morbid state, expressing on solid support.Hybridize the sample that the expression probe originates through the probe of mark and specific array member and express this gene.If the hybridization signal that derives from the probe that is subjected to examination (illing tissue) sample is better than the hybridization signal of the probe that derives from contrast (healthy tissues) sample, can identify one or more genes of overexpression in illing tissue.The albumen of this result's hint overexpression in illing tissue not only can be used as the diagnostic flag that morbid state exists, and also can be used as the treatment target for the treatment of described morbid state.With the methodology and the microarray technology of nucleic acid hybridization be well-known in the art.
In the present embodiment, study the expression of gene situation (for non-cancer people's tissue) of coding PRO1868 polypeptide in the cancerous tumours that derives from the various human tissue, attempted identifying the PRO1868 polypeptide of overexpression in cancerous tumours.Concrete preparation, slide and the hybridization conditions of hybrid nucleic acid and probe all is described in detail in the U.S. Provisional Patent Application serial number of submitting on March 31st, 2,000 60/193,767 (listing this paper in as a reference).Two cover experimental datas have been produced.In a sets of data, obtain canceration human colon tumor tissue and the non-cancer human colon tumor tissue of coupling that derives from same patient (" contrast of coupling colon "), use above-mentioned microarray technology to analyze their PRO1868 expression of polypeptides.In second sets of data, by multiple different people's tumour, comprise that lung and breast tumor obtain canceration people tumor tissues, and compare with " general " epithelium control sample, described control sample is by merging non-cancer people's epithelium source, comprising that liver, kidney and lung prepare.Separate from the mRNA that merges tissue and represent these different tissues expressed genes mixture of products.Use the microarray hybridization experiment that merges control sample in the 2-chromatographic analysis, to produce linear graph.Then, (tried: ratio control test) in each experiment of line gradient normalization method that produces in the use 2-chromatographic analysis.Compare the normalization method ratio in the different experiments then, use trooping of this ratio identified gene expression.Therefore, " general contrast " sample of merging can not only effectively be measured relative genetic expression in relatively at simple 2-sample, can also stride the more a plurality of samples of several experiments.
The nucleic acid probe that use derives from the nucleotide sequence of coding PRO1868 polypeptide described herein produces microarray, with the RNA and the microarray hybridization that derive from above-mentioned tumor tissues.Will be based on the normalization method ratio: the numerical value of experiment ratio be called " truncation ratio ".Only the numerical value greater than this truncation ratio is considered to significant.Organize contrast to compare with non-cancer people, PRO1868 polypeptide of the present invention is at the various human tumor tissues, for example significantly overexpression in lung and the breast tumor.
These data show that PRO1868 polypeptide of the present invention both can be used as diagnostic flag, also can be used as treatment tumor treatment target.
Embodiment 21
Inducing cell propagation
A. endothelial cell proliferation
In Human umbilical vein endothelial cells (HUVEC, Cell Systems), detect the ability of polypeptid induction endothelial cell proliferation of the present invention.The polypeptide of energy inducing endothelial cell propagation is used as useful somatomedin.
At the 0th day, amount with 1000 cells/well (derives from clone with the Human umbilical vein endothelial cells that 100 microlitres merge, pass at most 12-14 generation) be laid on 96 well culture plates, and at perfect medium [(EGM Clonetics), adds additive to the epithelial cell growth substratum: people's epidermal growth factor (hEGF), Medulla Bovis seu Bubali extract (BBE), hydrocortisone, and GA-1000 and foetal calf serum (FBS, Clonetics)] middle incubated overnight.The 1st day, substitute perfect medium with minimum medium [EGM adds 1%FBS], and add 1%, 0.1% and 0.01% PRO1868 polypeptide.The 7th day, by ALAMAR BLUE TMTest is then estimated cell proliferation by Crystal Violet.The result is expressed as the % that grows with the observed cell of contrast damping fluid.
In this test, the ability of the merging Human umbilical vein endothelial cells propagation during the PRO1868 polypeptid induction is cultivated is positive, the result, and described polypeptide can be used as useful somatomedin.
B. human coronary artery's smooth muscle cell proliferation
Detect the ability of polypeptid induction cell proliferation of the present invention in human coronary artery's smooth muscle cell in cultivation.The polypeptide of the present invention of energy inducing cell propagation can be used as somatomedin.
At the 0th day, amount with 1000 cells/well (derives from clone with 100 microlitre human coronary artery smooth muscle cells, pass at most 12-14 generation) be laid on 96 well culture plates, and at perfect medium [(SmGM Clonetics), adds additive: Regular Insulin to the unstriated muscle growth medium, people's epidermal growth factor (hEGF), human fibroblastic growth factor (hFGF), and GA-1000 and foetal calf serum (FBS, Clonetics)] middle incubated overnight.The 1st day, substitute perfect medium with minimum medium [SmGM adds 1%FBS], and add 1%, 0.1% and 0.01% PRO1868 polypeptide.The 7th day, by ALAMAR BLUE TMTest is then estimated cell proliferation by Crystal Violet.The result is expressed as the % that grows with the observed cell of contrast damping fluid.
In this test, the ability of the human coronary artery's smooth muscle cell proliferation during the PRO1868 polypeptid induction is cultivated is positive, can be used as useful somatomedin.
Embodiment 22
PRO mRNA and expression of polypeptides
A. In situ hybridization and immunohistochemical methods
By carry out in situ hybridization in multiple tissue, immunohistochemical methods and RT-PCR estimate the expression of PRO362, PRO245 and PRO1868mRNA.
In order to carry out in situ hybridization, with fixation of tissue (4% formalin), use paraffin embedding, section (3-5 μ m is thick), deparaffnize is removed Deproteinization (20 μ g/ml) (37 ℃, 15 minutes) with Proteinase K, handles to carry out in situ hybridization.Produce the probe of polypeptide of the present invention by PCR.Primer comprises T7 or T3 RNA polymerase initiation site, by the amplified production in-vitro transcription justice or antisense probe to be arranged.Make 33The have justice and the antisense probe hybridization of P-UTP mark are spent the night (55 ℃), washing (55 ℃, 0.1 * SSC, 2 hours), and (NY), exposure (4-6 week, 4 ℃) develops the color and redyes with phenodin and eosin for Eastman Kodak, Rochester to immerse NBT2 nuclear spike emulsion.Present representational bright and dark-field image in pairs.
Use DAKO Autostainer on the thick freezing microtome section of 5 μ m, to carry out immunohistochemical staining.With Kirkegaard and Perry blocking solution (1: 10,4 minutes, 20 ℃) blocking-up endogenous peroxidase activity.Dilute and block with the TBS/0.05% tween 20 (DAKO) that contains 10%NGS.Use 0.13mg/ml MAb 4F722.2 anti--STIgMA (anti--PRO362) or mouse IgG.With 1: 200 amount use biotinylated goat anti--mouse IgG (Vector Labs), Burlingame, CA), and with Vector Labs Standard ABC Elite Kit (Vector Labs, Burlingame CA) detects.Use Pierce metal-enhanced diaminobenzidine (Pierce Chemicals, Rockford, IL) colour developing slide.On freezing microtome section, carry out the dual immunohistochemical methods that PRO362 (STIgMA) and CD68 express, with the STIgMA expression and localization on scavenger cell.Utilize mAb 4F7.22.2 to resist-STIgMA and anti--CD68 mAb KP-1 (DAKO), and detect by phycoerythrin and FITC mark respectively.
1. the tissue of Jian Chaing
In people and other mammiferous multiple tissue and cell type, check and express.
A. healthy tissues
Checked normal adult tissue comprises tonsil, lymphoglandula, spleen, kidney, bladder, lung, heart, aorta, coronary artery, liver, gall-bladder, prostate gland, stomach, small intestine, colon, pancreas, Tiroidina, skin, suprarenal gland, placenta, uterus, ovary, testis, retina and brain (cerebellum, brain stem, pallium).Also detected and comprised E12-E16 brain in age in week, spleen, intestines and thyroid normal people's tire tissue.In addition, also in the mouse liver, studied expression.
B. the tissue of inflammation
The Inflamed tissue that in situ hybridization is checked comprises the tissue of suffering from chronic inflammatory disease, the lung of for example suffering from chronic asthma, chronic bronchial pneumonia, chronic bronchitis/chronic obstructive pulmonary disease, suffer from the kidney of chronic lymphocytic interstitial nephritis, and the liver of suffering from the liver cirrhosis that causes because of the chronic inflammatory diseases due to the chronic hepatitis C infection and sclerosis, autoimmune hepatitis or alcohol.
C. primary tumor forms
Check that by in situ hybridization primary people's tumorigenesis that PRO362, PRO245 and PRO1868 express comprises mammary cancer, squamous cell lung carcinoma, adenocarcinoma of lung, adenocarcinoma of prostate and adenocarcinoma of colon.
2. result
A.PRO362 expresses
Found that PRO362 can be at mouse liver freezing microtome section (Figure 23), people's liver freezing microtome section (Figure 24) and multiple tissue macrophages-like cell, comprise in residence scavenger cell (resident macrophage) in colon scavenger cell (Figure 25 A), Kupffer Cell (Kupffercell) (Figure 25 B), suprarenal gland scavenger cell (Figure 25 C), hofbauer cell (Hofbauer cell) (Figure 25 D), synovial cell (Figure 26), pulmonary alveolar macrophage, the intestinal mucosa lamina propria and a lot of tissue between express in the matter scavenger cell.PRO362 also significantly expresses in the brain microgliacyte.When passing through tumour or inflammatory diseases, comprise rheumatoid arthritis (Figure 27), inflammatory bowel, chronic hepatitis (Figure 28), pneumonia, chronic asthma (Figure 29), neurospongioma (Figure 30) and bronchitic existence and when being activated, the PRO362 in these tissues expresses significantly to be increased.
In order to check that further PRO362 expresses, and carries out immunohistochemical staining to multiple types of organization.In tissue macrophages, comprise and carry out PRO362 and the dual immunohistochemical staining of CD68 on suprarenal gland scavenger cell, liver Kupffer Cell, brain microgliacyte and the placenta hofbauer cell whether in homologue, express to measure PRO362 and CD68.
Discovery is in suprarenal gland scavenger cell (Figure 35), liver Kupffer Cell (Figure 36), brain microgliacyte (Figure 37) and placenta hofbauer cell (Figure 38), and PRO362 and CD68 can coexpressions.
B.PRO245 expresses
Found that PRO245 significantly is positioned epithelium and Inflamed tissue.
(i) healthy tissues
In normal adult tissue, Venule (HEV) is (Figure 31), significantly express in the middle trophoderm of the spermatogeny cell (Figure 32 I and J) of testis vas deferens epithelium and placenta on the endothelium of tonsil and lymphoglandula for PRO245 mRNA.
In normal people's tire tissue, PRO245 mRNA significantly expresses in endotheliocyte, more specifically, find that PRO245 mRNA significantly expresses in the blood vessel endothelium of little and great vessels (eliminating capillary vessel), mesentery blood vessel, intestines parietal vessel and developmental mesenteric lymph nodes and thyroid little blood vessel.
In spleen, normal skin or foreskin, normal lung, Tiroidina, normal bowel, normal cardiac tissue or suprarenal gland, the expression of PRO245 is not remarkable.
(ii) Inflamed tissue
In suffering from the tissue of chronic inflammatory disease, the expression of PRO245 is more extensive.In suffering from the lung biopsy samples of chronic bronchial pneumonia, PRO245 mRNA be present in lymphocyte inflammation focus inner or near little-(Figure 32 A and B), in-express in (Figure 32 C and D) and greatly-arteriolar endothelium of (Figure 32 E and F) bore.In normal lung tissue, do not observe PRO245 mRNA (Figure 32 G and H).In addition, finding also that PRO245 suffers from the blood vessel endothelium of acute or chronic inflammatory diseases at following tissue significantly expresses: arteriole, vein and the capillary vessel of chronic matter pneumonia related tissue; The psoriasis epiderm skin blood vessel of psoriasis related tissue; The arteriole of chronic hardening ephritis related tissue; Blood vessel endothelium and capillary vessel in the ecphyaditis related tissue inflammation focus; The endothelium of a plurality of blood vessels, HEV, capillary vessel, arteriole and the vein of all holes of tonsil and folliculus related tissue; And the capillary vessel in all stromas of the relevant aortal artery of aorta with arteriosclerosis.The expression of PRO245 in aortic tunica intima is not remarkable.
At the kidney of suffering from the chronic lymphocytic interstitial nephritis with suffer from the biopsy samples of liver of chronic lymphocytic hepatitis, PRO245 in lymphocyte inflammation site inner and near the arteriole endothelium in significantly expression.The expression of PRO245 in chronic inflammation or sclerosis liver is not remarkable.
In the biopsy samples of suffering from chronic inflammatory diseases and hardened liver, the expression of PRO245 is not remarkable.
At the large intestine of inflammation or suffer from the meningitic brain, the expression of PRO245 is not remarkable.
(iii) tumorigenesis sex organization
At multiple primary tumor, comprise adenocarcinoma of colon, carcinoma of testis (Figure 33 A and B), adenocarcinoma of lung (Figure 33 C and D), adenocarcinoma of breast (Figure 33 E and F) little-and in-observe PRO245 in the arteriolar endothelium of bore to express, PRO245 significantly expresses in adenocarcinoma of prostate and adenocarcinoma of colon.Found that PRO245 mRNA expresses (Figure 34) in mammary cancer.Yet shown in Figure 33 G and H, PRO245 does not significantly express in contiguous normal galactophore tissue, and in described figure, mammary cancer represents that with asterisk normal galactophore tissue represents with arrow.Only with the contiguous blood vessel of tumour in observe PRO245 and express (arrow), but in healthy tissues, do not observe expression.
Blood vessel endothelium in epididymis blood vessel endothelium and carcinoma of testis or spermocytoma chronic lymphocytic areas of inflammation, the blood vessel endothelium of tumor focus in the adenocarcinoma of lung chronic lymphocytic areas of inflammation, the blood vessel endothelium of tumor focus in the squamous cell lung carcinoma chronic lymphocytic areas of inflammation, blood vessel endothelium in the mammary cancer chronic lymphocytic areas of inflammation and the blood vessel endothelium contiguous with tumor focus, and with chondrosarcoma in arteriole, vein and the contiguous zone of capillary vessel blood vessel endothelium in, found the PRO245 expression.
C.PRO1868 expresses
Found that PRO1868 expresses on NK cell, CD8+T cell and dendritic cell.
B. Reverse transcription polymerase chain reaction (RT-PCR)
Reverse transcription polymerase chain reaction (RT-PCR) is the sensitive technology of detection and quantification of mrna, and this technology is by being made up of the synthetic cDNA of RNA by reverse transcription.Express in order to detect PRO1868, detect the existence of PRO1868mRNA by RT-PCR.
By reverse transcriptase PCR (RT-PCR), at T clone J45 and Molt5, rather than B clone JY, significantly detect PRO1868mRNA (Figure 39) among RPMI8866 and the RAMOS.
Embodiment 22
The interaction of PRO245 and particular cell types
Measure through flow cytometry, peripheral blood cells can not significantly be expressed PRO245 (table 6, upper part).Whether can interact in order to measure PRO245, carried out a plurality of PRO245-test cell lines with the discrete hypotype of peripheral blood cells.Described test comprises by magnetic or FACS letter sorting PRO245-interaction cell.By the used peripheral blood of all experiments of following acquisition.
A. Magnetic letter sorting and flow cytometry
Whether can interact in order to measure PRO245, by the biotinylated PRO245-human IgG of following generation fusion rotein with peripheral blood leucocyte.Use separates the interactional peripheral blood leucocyte with PRO245 with Streptavidin link coupled magnetic bead.The surface C D-Ag that checks isolated cell then expresses.The result who uses biotinylation PRO-245-human IgG fusion rotein to obtain is compared with the result who uses the biotinylation human IgG to obtain.
In 4 ℃, (contain 10%FBS (v/v at the SerF damping fluid; Life Technologies) adds 0.1%NaN3 (w/v; Sigma-Aldrich, St.Louis, MO), do not contain phenol red or sodium bicarbonate, with 10mMHEPES (Life Technologies) buffered HBSS (HBSS+; Life Technologies), pH7.4) in, make biotinylated PRO245-human IgG fusion rotein or human IgG1's albumen and PBMC (10 μ g/10 7) be incubated 1 hour.With SerF damping fluid washed cell, with 80 μ l/10 7The density of individual cell suspends again.With 20 μ l/10 7The density of individual cell adds Streptavidin magnetic bead (Miltenyi Biotec), and 4 ℃ are incubated 15 minutes, with the washing of SerF damping fluid, with 500ml/10 8The density of individual cell suspends again, and the MACS post of flowing through and just selecting.Cell according to manufacturer's explanation wash-out is just being selected washs with the SerF damping fluid, according to condition, by flow cytometry 2 * 10 5The surface C D Ag of individual cell.With the per-cent of the positive staining cell of data description, be illustrated in according to the flow cytometry dyeing condition collect altogether 2 * 10 5In the individual cell, by the shared per-cent of the cell of positive staining.
1. Albumen coupling
Room temperature in PBS, made PRO245-human IgG fusion rotein, human IgG1 or PRO362-human IgG fusion rotein biotinylation 30 minutes with the amount of every 1mg protein 20 0 μ g EZ-Link sulfo-NHS-LC-vitamin H (Pierce).Add (final concentration is) 200mM Tris, pH8 is with the cancellation biotinylation, and room temperature is incubated 30 minutes.Facing to the PBS biotinylated albumen of fully dialysing, (MA) being concentrated into concentration is 2mg/ml for Millipore, Bedford with the Centricon-10 microconcentrator then.
(OR) the albumen coupling test kit is to be coupled to Alexa-488 on PRO245-human IgG fusion rotein or the human IgG1 for Molecular Probes, Eugene to use Alexa-488 according to manufacturer's explanation.
2. Flow cytometry
In 4 ℃, cell flow cytometry is used with the SerF damping fluid sealed 30 minutes, used and FITC, PE or CyChrome (BD PharMingen, San Diego, the CA) Ab of the anti-CD3 of link coupled, CD4, CD8, CD14, CD19 or CD56 dyeing.
3. The result
Following four cell colonys and the PRO245 that find peripheral blood leucocyte interact significantly: T cell (CD3+), CD8+ cell, B cell (CD19+) and NK cell (CD56+).Can be as follows in single experiment: 20.99%-CD3+ cell, 6.68%-CD8+ cell, 9.66%-CD19+ cell and 36.89%-CD56+ cell with the interactional cell per-cent of PRO245.Can to contrast interactional cell per-cent as follows: 2.39%-CD3+ cell, 1.78%-CD8+ cell, 4.42%-CD19+ cell and 6.69%-CD56+ cell with human IgG.
B. FACS letter sorting and flow cytometry
By FACS divide sort out can with PRO245-human IgG fusion rotein bonded peripheral blood cells.
In order to carry out the FACS letter sorting, (containing 5 μ g/ml resists-CD16Ab 3G8 (BD PharMingen) and 20 μ g/ml human IgG1 (Calbiochem at the SerF damping fluid through changing, San Diego, CA) SerF damping fluid), make cell with Alexa-488-link coupled human IgG1 or PRO245-human IgG fusion rotein (10 μ g/10 6Individual cell) insulation (30 minutes, 4 ℃) is together washed and (Beckman Coulter, Miami FL) go up letter sorting at Elite ESP.Under these conditions, will be used as background with Alexa-488-link coupled PRO245 or human IgG.For the test that is at war with, room temperature in the serF damping fluid with competitor (20 μ g/10 6Individual cell), imports and Alexa-488-link coupled PRO245-human IgG fusion rotein or human IgG then with cytomixis 20 minutes.Washed cell is as stated above by the flow cytometry cell.
With the interactional cell of PRO245-human IgG fusion rotein (JAM-IT.Fc) in, the 12.5%th, CD3+T cell, the 32.4%th, CD8+T cell, the 50.4%th, CD56+NK cell.In FACS letter sorting test, do not detect the CD19+B cell.In the CD56+NK cell, 22.4% expresses CD3, and 40.2% expresses CD8.In the CD8+T cell, 23.5% expresses CD3, and 73.2% expresses CD56 (Figure 40).
Table 6: on peripheral blood cells, express PRO245 and peripheral blood cells is combined with PRO245
Dyeing first Dyeing once more
CD3 CD4 CD8 CD14 CD19 CD56 PMN
Anti--PRO245 positive staining is anti--and the PRO301 positive staining is anti--mouse IgG positive staining 0.2％ 76.7％ 0.25 0.1％ 73.9％ 0.1％ 0.1％ 80.4％ 0.1％ 0.7％ 99％ 0.7％ 0.1％ 90％ 0.1％ 0.3％ 85％ 0.3％ 0.9％ 98.7％ 0.9％
Total PRO245 is in conjunction with per-cent and the per-cent of PRO245 bonded CD56+ cell and the per-cent of PRO245 bonded CD8+ cell of cell 12.6％ 22.4％ 23.5％ 1.1％ 0.2％ 0.1％ 32.4％ 40.2％ 0.3％ 0.5％ 0.6％ 0.4％ 0.4％ 0.3％ 50.4％ 73.2％ NA NA NA
C. combine with purifying cells
B cell, neutrophil leucocyte, CD14+ monocyte by the flow cytometry purifying, derive from Clonetics (San Diego, peripheral blood dendritic cells CA) (PBDC), by negative select the peripheral blood CD56+NK cell that obtains and CD3+T clone J45 with the interactional ability of Alexa-488-link coupled PRO245-human IgG fusion rotein.Analyze simultaneously with the ability of Alexa-488-link coupled human IgG1 protein-interacting with comparing.
In the adult healthy volunteers body, obtain blood by venipuncture, use Ficoll-Plaque PLUS (Amersham Pharmacia Biotech) separating blood according to manufacturer's explanation.Obtain PBMC from separation surface, with ice-cold PBS washing, carry out cracking (neutralizing with 0.2%NaCl processing 30 seconds and with 1.6%NaCl) in case of necessity, counting is with 5 * 10 7The concentration of individual cell/ml places stand-by on ice.Through flow cytometry, do not observe thrombocyte in the PBMC fraction of purifying and pollute.Behind the RBC that cracking is polluted, from throw out, obtain neutrophil leucocyte.With ice-cold PBS washing neutrophil leucocyte, counting is with 5 * 10 7The concentration of individual cell/ml places stand-by on ice.In order to separate the peripheral blood hypotype, according to manufacturer's explanation use " former state (untouched) " MACS test kit (Miltenyi Biotec, Auburn, CA).
Through Flow cytometry, the B cell of purifying, neutrophil leucocyte and CD14+ monocyte do not interact with PRO245-human IgG fusion rotein.Yet, found that multiple other cell type and PRO245.Fc interact.Figure 41 shows PRO245.Fc and CD56+NK cell interaction.Described interaction is specific, because by adding anti--PRO245 antibody interaction capable of blocking.Found the interaction (under Figure 46 and Figure 53 lower right) of PRO1868 (being also referred to as 77624, JAM3 and SHATr) PRO245 capable of blocking and CD56+NK cell.Add un-marked, can block by adding the observed change in fluorescence of PRO245.Fc through the PRO1868 of His mark (JAM3).On the other hand, shown in Figure 53 upper right side, add the interaction that PRO301 can not block PRO245 and NK cell.
Peripheral blood dendritic cells (PBDC) also interacts with PRO245, but does not express PRO245 (Figure 42).PBDC derives from Clonetics.Figure 41 I shows: compare with human IgG1's (histogram of band shade), PRO245.Fc (solid line) and PBDC interact consumingly.Yet, do not observe PBDS and can express PRO245 (Figure 41 II; Mouse IgG-black histogram; Anti--PRO245 antibody 12D10.2F9-solid line).
In addition, find J45T cell that PRO245 that the surface does not have to survey expresses can interact with PRO245 (Figure 43 and 44).By the change of comparing fluorescence peak with the link coupled human IgG1 detect and Alexa-488 link coupled PRO245-Fc fusion rotein and J45 cell between interaction (Figure 44).-PRO245 antibody anti-by adding is blocked the change (Figure 44) of fluorescence peak.The PRO1868 of un-marked (His-PRO1868 albumen) also can suppress and Alexa-488 link coupled PRO245-Fc fusion rotein and J45 cell between interaction (Figure 45).Find also that in addition anti--PRO1868 antibody (MaJIR1) can suppress to depend on the J45 adhesion of PRO245, and mouse IgG is to adhering to not influence (Figure 52).
Therefore, as follows with the interactional cell type of PRO245: the CD56+ cell comprises the CD56+NK cell, CD56+CD3+NK/T cell, CD56+CD3+CD8+ cytolytic T lymphocyte, PBDC and J45T cell.In addition, excessive PRO1868 albumen can suppress PRO245 and combine with J45 and CD56+NK cell, and anti--PRO1868 antibody capable suppresses PRO245 and combines with the CD56+NK cell.
D. based on the adherence test of culture plate
For based on the culture plate analysis can with the interactional cell of PRO245, except as otherwise noted, with 50 μ l/ holes (being dissolved in HBSS+), the condition of 10 μ g/ml is with hole (the NUNC Maxisor 96-well culture plate of droplet plate; VWR, Scientific Products, Brisbane, CA) the room temperature bag was by 2 hours.In order to carry out adherence test, apply bag by condition before, earlier with 50 μ l, 10 μ g/ml goat Anti-Human IgG1 Fc-specificity Ab (for example PRO245-human IgG fusion rotein) room temperature bag quilts with sealed 1 hour, apply then and be in combination/sealing damping fluid (BBB; The HBSS+ that contains 10% (v/v) FBS) condition in.Cell (5 * 10 6Individual cell/ml BBB) with 5mg/ml 2 ', 7 '-two-(2-propyloic)-5 (with-6)-Fluoresceincarboxylic acid, and acetoxyl group methyl esters (BCECF AM) (Molecular Probes) processing (10 minutes, 37 ℃, 5%CO 2), after the washing, in 37 ℃/5%CO 2In itself and hole through the bag quilt were adhered to 1 hour (2 * 10 5Individual cells/well BBB).
(CA) the total application fluorescence on the reading culture plate gently washs 3 times (with No. 28 syringe needles suctions) and reads total adhesion fluorescence for Molecular Devices, Sunnyvale with SpectraMax fluorescence culture plate readout instrument.Use following equation to calculate and adhere to per-cent: ((always adhering to fluorescence)/(always using fluorescence)) * 100.The blank cell is formed by the hole by being exposed to through the BBB-of the J45 cell of BCECF AM-mark bag.From all experiment conditions, deduct the numerical value (adhesion per-cent) that obtains by blank well to produce final numerical value.
Use finds that based on the adherence test of culture plate J45 T cell adhesion is in the hole (Figure 47) through PRO245-human IgG fusion rotein (VJ2.Fc) bag quilt.Anti--PRO245 antibody rather than mouse IgG can suppress the J45 cell and PRO245-human IgG1 fusion rotein adheres to, and this shows that interacting is specific (Figure 47).
Embodiment 23
Identify the acceptor of PRO245
For identify with the interactional cell of PRO245 in be responsible for interactional albumen, carried out immunoprecipitation research.
A. CD56+NK cell and J45 cell
In order to separate the cell surface receptor of PRO245 on J45 or the NK cell, make and the interactional cell biological of PRO245 elementization, carry out cracking then.With the supernatant liquor of lysing cell being carried out immunoprecipitation with the crosslinked PRO245-human IgG fusion rotein albumin A matrix of Fc.By Western engram analysis throw out.
1. Biotinylation
In order to carry out biotinylation, at first use the HBSS+ washed cell, then in 4 ℃, make cell biological elementization (200 μ g/10 with sulfo group-NHS-LC-vitamin H 6Individual cell) 30 minute.In 4 ℃ with TBS with cell washing 30 minutes with the cancellation biotinylation.
2. Cracking
In 4 ℃, (every 7ml lysis buffer is for containing 1%Triton X-100 and 1 Complete-Mini does not have EDTA proteinase inhibitor (Roche Biochemicals, Indianapolis, HBSS+ IN)) lysing cell (10 with lysis buffer 8Individual cell/ml) 30 minutes.Then in 4 ℃ with the centrifugal lysate of 22,000 * g 1 hour, and filter with 0.2 μ m filter.In 4 ℃ with 5 μ l/10 6The recombinant protein A pearl of individual cell (Amersham Pharmacia Biotech) was with lysate predefecation 2 hours.
3. Immunoprecipitation
Filter clarifying lysate with 0.2 μ m filter, in 4 ℃ and 5 μ g/10 6The PRO245-human IgG fusion rotein or the human IgG1 of individual cell are incubated 2 hours together, use ImmunoPure Protein A IgGPlus Orientation test kit (Pierce) and the coupling of albumin A matrix.Make the pearl precipitation, with the lysis buffer washing, by adding 15 μ l/10 6The non-reduced SDS sample buffer of individual cell (contain the 2mM iodo-acid amide, but do not contain the standard model damping fluid of DTT or 2 mercapto ethanol) carries out sex change, and 100 ℃ were boiled 3 minutes.
4. The Western trace
(CA) going up resolution concentration is the sample of 15 μ l/ swimming lanes, is transferred to 0.2-μ m Protran nitrocellulose filter (Schleicher ﹠amp in 4 ℃ with 100mA for Bio-Rad, Hercules at 4-20%Bio-Rad Tris-HCl Ready Gel; Schuell, Keene NH) reaches 2 hours.(contain 5% skimmed milk and 0.05% tween at Blotto TM20 TBS; Bio-Rad) in trace was sealed 1 hour.For biotinylated sample, room temperature uses 0.5 μ g/ml and HRP-link coupled Streptavidin (Pierce) to reach 30 minutes.Sample for abiotic elementization, the Blotto of use contains 10 μ g/ml anti--PRO1868 antibody (MaJIR1), 25 ℃ are incubated 1 hour, use in room temperature then and contain 1 μ g/ml and resist-mouse IgG (Caltag Laboratories with HRP-link coupled goat, Burlingame, Blotto CA) reaches 30 minutes.Thoroughly wash trace with TTBS (TBS that contains 0.05% polysorbas20), and develop the color with ECL Plus reagent (Amersham Pharmacia Biotech), be exposed to Kodak BioMax ML film then, and develop the color with Kodak M35A X-OMAT Film Processor (Eastman Kodak).
5. The result
Biotinylated sample with identify a Streptavidin-reaction band that is about 40kDa with the immunoprecipitation and the Western engram analysis of the crosslinked PRO245-human IgG fusion rotein albumin A matrix of Fc, this band can with PRO245-human IgG fusion rotein interaction (Figure 48).Use the immunoprecipitation that carries out with the crosslinked human IgG albumin A matrix of Fc, and with in the PRO245 bonded Ramos/HH B clone do not using the band that does not have 40kDa in the PRO245-immunoprecipitation that carries out with the crosslinked human IgG albumin A matrix of Fc.
For whether the band of measuring 40kDa represents PRO1868, with PRO245-human IgG fusion rotein albumin A matrix, the abiotic elementization sample that derives from Ramos/HH cell (not interacting with PRO245), MOLT4 cell (combining with PRO245) and PBMC (combining with PRO245) is carried out immunoprecipitation.By carrying out immunoblotting and analyze throw out with anti--PRO1868 antibody.Immunoblotting confirms that 40kDa's represents PRO1868 (Figure 49) with the interactional band of PRO245.
6. By the combination between ELISA confirmation PRO245 and the PRO1868
Use anti--PRO1868 antibody, the PRO245 of purifying and PRO1868 fusion rotein confirm the interaction between PRO245 and the PRO1868 in based on the test of culture plate.In the presence of 0.25 μ g/ hole mouse IgG or anti--PRO1868Ab, will be exposed to biotinylated PRO245-Fc fusion rotein (Figure 50) with culture plate bonded PRO1868-Fc fusion rotein (JAM3.Fc) or contrast people's PRO301-Fc fusion rotein (huJAM.Fc).Use Streptavidin HRP to detect through combining between the hole of PRO1868-Fc fusion rotein bag quilt and the PRO245-Fc vitamin H.Perhaps the PRO245-Fc fusion rotein is trapped on the culture plate, uses biotinylated PRO1868-Fc fusion rotein to check PRO245-PRO1868 interaction (Figure 51) with particular concentration.In addition, detect anti--PRO1868 antibody and anti--PRO245 antibody between PRO245 and the PRO1868 based on the interactional inhibition of culture plate.
In order to carry out ELISA, room temperature with the BBB bag by after 30 minutes, the sealing culture plate, room temperature with combine condition and be incubated 1 hour.Needing under the situation of EDTA, in whole experiment, using BBB through changing (with not calcic and magnesium but the HBSS that contains EDTA substitutes common HBSS+).With culture plate washing 3 times, tetramethyl benzidine substrate (Kirkegaard ﹠amp is used in room temperature and 1 μ g/ml Streptavidin HRP (Pierce) insulation 30 minutes; Perry Laboratories, Gaithersburg, MD) colour developing to be assessing, and goes up reading at ThermoMax Microplate Reader (Molecular Devices).
By identify the interaction (Figure 50 and 51) between PRO245 and the PRO1868 based on the test of culture plate.Figure 50 demonstrates through the hole of PRO1868.Fc (JAM3.Fc) bag quilt and shows the PRO245.Fc combination, and does not show described combination through the hole of PRO301.Fc bag quilt.Mouse IgG (MIgG) is in conjunction with inoperative, and anti--PRO1868 antibody (MaJIR1) can suppress the PRO245 combination.When PRO245.Fc combines with culture plate (Figure 51), observe the interaction of PRO245.Fc and PRO1868.Fc once more.In addition, anti--PRO1868 antibody MaJIR1 still can the inhibitory phase mutual effect, and mouse IgG is inoperative.
B. One group of potential acceptor
The PRO245 polypeptide is incubated to identify that receptor/ligand interacts with one group of potential acceptor molecule.Identify the part of known receptor, the acceptor of known ligand or new receptor/ligand are to can be used for multiple use, for example comprise bioactive molecules (linking to each other) but the cell of known expressed receptor of target or part with part or acceptor, with acceptor or part as reagent to detect in the composition that contains part or acceptor under a cloud whether have part or acceptor, wherein composition can contain cell, described cell is under a cloud can express part or acceptor, modulate known can expressed receptor or growth or the another kind of biology or the immunocompetence of the cell that maybe can react to acceptor or part of part, the immunne response of the cell of modulated energy expressed receptor or part or modulation are at the immunne response of described cell, can prepare agonist at biological or immunocompetent acceptor of the growth of the cell that can modulate expressed receptor or part or part, antagonist and/or antibody, and multiple other purposes also is conspicuous to those skilled in the art.
With under a cloud be the fusion rotein (immunoadhesin) that the PRO245 expression of polypeptides of the present invention of the part of acceptor becomes to contain human IgG Fc district.By making PRO245 immunoadhesin polypeptide and expressing candidate receptor, the cell (as the COS cell) that comprises the PRO1868 polypeptide receptor interacts, use at the fluorescent reagent of Fc corresponding circle of sensation and observe the bonded immunophilin, and detect the receptor-ligand combination by microscope inspection.By producing the cell of expressing candidate receptor with the cDNA expression vector of determining hypotype (for example coding can be used as the carrier of the PRO1868 polypeptide of acceptor molecule) library transient transfection abreast.Then after testing may with insulation cell in the presence of the PRO245 polypeptide immune adhesin of receptors bind 1 hour.Washed cell and fix then with paraformaldehyde.Make cell with being incubated with fluorescence link coupled antibody, the Fc part of the anti-PRO245 polypeptide immune of described antibody adhesin (as with FITC link coupled goat Anti-Human-Fc antibody).And then washed cell and by microscopy.When there is fluorescent mark in the cDNA cells transfected with coding specific PRO1868 polypeptide receptor or receptoire, and when not having similar fluorescent mark, can judge that interaction is positive with the cell by the similar approach preparation of other cDNA or the transfection of cDNA storehouse.If judge that the interaction of definite cDNA expression vector storehouse and PRO245 polypeptide immune avidin is positive, detect each cDNA classification (with storehouse " segmentation ") contain this storehouse respectively, with measure encode can with the specific cDNA of PRO245 polypeptide immune avidin interaction receptor.
In another embodiment of this test, make the potential part PRO245 polypeptide (as 8 Histidines " His " mark) and the interaction of molecules of a series of potential receptor polypeptides that have the epi-position label, described acceptor is expressed as the fusion rotein (immunoadhesin) with human IgG Fc district.After the common insulation of the PRO245 polypeptide that has the epi-position label 1 hour, with every kind of candidate receptor of albumin A pearl immunoprecipitation, and the washing pearl.By the antibody that uses anti-epi-position label the mixture through immunoprecipitation is carried out the western engram analysis, measure the potential ligand interaction.If in the western engram analysis, observe the band of the proteic expection molecular weight that has the epi-position label, and when not observing this band, can judge interaction has taken place with potential other member who is subjected to series with candidate receptor.
Use these tests, identify following receptor/ligand and interact: PRO245 (DNA35638-1141) combines with PRO1868 (DNA77624-2515).
C. The albumen of JAM family
Carry out the interaction of flow cytometry with further research JAM protein family member.By the embodiment 14 described PRO245 that in Chinese hamster ovary celI, express.Make the Chinese hamster ovary celI of expression PRO245 then and, comprise that PRO245, PRO301 and PRO1868 are incubated together through the JAM of His mark albumen.By flow cytometry combining through PRO362, the PRO1868 of His mark or PRO301 albumen and the Chinese hamster ovary celI of expressing PRO245.
For PRO1868 is combined with the Chinese hamster ovary celI of expressing PRO245,5 μ g/mlPRO1868-HIS (SHATr.His) are incubated with the Chinese hamster ovary celI of expressing PRO245 through labelled protein.PRO1868 (SHATr.His) can with the Chinese hamster ovary celI of expressing PRO245 interact (Figure 54).Check that different competition albumen suppresses PRO1868 and PRO245 bonded ability.PRO1868 albumen (SHATr.His) and anti--PRO245 antibody (12D10.2F9) can with PRO1868-HIS through labelled protein competition combine (Figure 54) with the surperficial PRO245 of Chinese hamster ovary celI.What form contrast with it is that PRO301.Fc, PRO362.Fc, mouse IgG and His contrast can not suppress in conjunction with (Figure 54).
Based on The above results, PRO245 and PRO1868 interact.
Embodiment 24
STIgMA (PRO362) is relevant with chronic inflammatory diseases
According to embodiment 2 and hereinafter described clone and A33 antigen and JAM1 the new scavenger cell associated receptor of homology is arranged, and it is accredited as single the stride film Ig superfamily member (STIgMA or PRO362 or JAM4) relevant with scavenger cell.
STIgMA is expressed as two splice variants, and one contains terminal IgV spline structure territory of N-and the terminal IgC2 spline structure of C-territory, and another splicing form lacks C-end structure territory.These two acceptors all have singlely strides the film district and contains the cytoplasmic region of tyrosine residues, described residue external in scavenger cell by composing type ground phosphorylation.
This research is illustrated STIgMA in the optionally expression on the scavenger cell hypotype of tissue of residing, and relevant with chronic inflammatory diseases.
Material and method
Cell
In the adult healthy volunteers body, obtain blood by venipuncture, use Ficoll-Plaque PLUS (Amersham Pharmacia Biotech) separating blood according to manufacturer's explanation.Obtain PBMC from separation surface, the PBS washing with ice-cold neutralizes with 0.2%NaCl cracking 30 seconds and with 1.6%NaCl.Counting cells places cell stand-by on ice.In order to separate the peripheral blood hypotype, according to manufacturer's explanation use " former state " MACS test kit (Miltenyi Biotec, Auburn, CA).In order to cultivate the scavenger cell of differentiation, the negative monocyte of selecting is transferred to the HGDMEM that contains 20% foetal calf serum and 10% human serum in the 6 hole culture dish.Changed substratum on the 5th day,, use ice-cold cell dissociation solution (Sigma) dissociated cell from the culture dish in order to carry out flow cytometry.By directly in the hole, adding the 0.5ml lysis buffer with the used lysate of preparation Western engram analysis.Lysate is mixed, electrophoresis and be transferred to nitrocellulose filter on the Tris-Glycine gel with the sample buffer that contains SDS and beta-mercaptoethanol.
Flow cytometry
In 4 ℃, (cell that flow cytometry is used of PBS CA) sealed 30 minutes for Calbiochem, San Diego with containing 2% foetal calf serum and 5 μ g/ml human IgGs.Then, make cell with anti--STIgMA (anti--PRO362) monoclonal antibody 3C9 is incubated.After the PBS washing, use and phycoerythrin (the PE)-anti-CD11b antibody staining of link coupled cell, CD14, CD163, CD15, CD68 derive from Pharmingen.
Cell-cellular adhesion studies
Select and self clone the pRK expression vector that letter sorting stably express in people Jurkat T-clone contains total length STIgMA by the described use Xin Meisu in other places.Make cell in advance load fluorescence dye BCECF (Molecular Probes Oregon), adds 96 hole Maxisorb culture plate (CORNING with cell TM), described culture plate is coated with through 10ng/ml TNF α and handles or untreated Human umbilical vein endothelial cells (HUVEC) individual layer.Add in the hand-hole by being incubated damping fluid (containing 10mM CaCl, the HBSS of 10mM magnesium and 1.5mM NaCl), then culture plate is inverted on the trace paper with washed cell gently.After 3 washings, count fluorescence at the fluorescence spectrophotometer random encounter.Fluorescence readings signify and HUVEC cell keep the number of adherent cell.
The Northern engram analysis
According to the method that manufacturer is recommended, use the Ambion test kit, with the warp of the total length STIgMAcDNA that causes at random 32The probe of P mark is surveyed and is organized Northern trace (CLONTECH) more.Trace is exposed to the phosphorescence imaging screen, and analyzes with Storm phosphorescence developing instrument.
RtPCR analyzes in real time
In order to carry out quantitative PCR analysis (TAQMAN TM), recommendation derives from total mRNA (100ng) (PerkinElmer Life Sciences) of people's tissue or primary cell, and primer is based on the encoding sequence of STIgMA.
Produce Fc-and His-fusion rotein
People STIgMA is cloned into rhabdovirus expression vector pHIF (Pharmingen).Form by the STIgMA extracellular region that merges with 8 Histidines through the STIgMA of HIS-mark fusion rotein.Use the affine resin of nickel from suspension culture by purifying the insect cell supernatant liquor of baculovirus infection through the fusion rotein of His mark.
Produce mono-clonal and polyclonal antibody
By mentioned above, via 10 μ g STIgMA-His8 immunity of foot pad injection and the female mouse of booster immunization BALBc.Screen the single clone of anti-STIgMA (PRO362)-His by ELISA.Detect selected clone at JAM family member and human IgG Fc.To clone titration to unicellular density and screening again.Find clone 3C9 (IgG1) can with the STIgMA selective reaction.The clone is used to produce ascites, and carries out purifying by Protein G (Amersham Pharmacia Biotech); (Pierce, Rockford IL) measure protein concentration to use Pierce BCA reagent.
By injecting new zealand rabbit with 150 μ g STIgMA-His to produce polyclonal antibody.Measure serum titer by ELISA.Collection reaches the serum of circulation IgG horizontal peak, and carries out purifying by the albumin A post.
In situ hybridization
Design PCR primer (going up primer 5 '-TCTCTGTCTCCAAGCCCACAG (SEQ IDNO:35) and following primer 5 '-CTTTGAGGAGTCTTTGACC (SEQ ID NO:36)) is with the fragment of amplification huJAM4 700bp.Primer comprises that T7 or T3 RNA polymerase initiation site are to have justice or antisense probe by the amplified production in-vitro transcription respectively.Health adult tissue comprises tonsil, lymphoglandula, spleen, kidney, lung and heart.The tissue of suffering from chronic inflammatory disease comprise suffer from chronic asthma, the lung of chronic bronchitis, suffer from chronic inflammatory diseases and the scleratogenous liver of chronic hepatitis C infection.Described according to other places, fixation of tissue in 4% formalin, is used paraffin embedding, section (3-5 μ m is thick), deparaffnize is removed Deproteinization (37 ℃, 15 minutes) with 20 μ g/ml Proteinase Ks, handles to carry out in situ hybridization.
Immunohistochemical methods
Use DAKO Autostainer on the thick freezing microtome section of 5 μ m, to carry out immunohistochemical staining.With Kirkegaard and Perry Blocking Solution (1: 10,4 minutes, 20 ℃) blocking-up endogenous peroxidase activity.Dilute and block with the TBS/0.05% tween 20 that contains 10% normal goats serum (NGS).Use the Mab 3C9 of 1 μ g/ml.Use Pierce metal-enhanced diaminobenzidine (Pierce Chemicals) colour developing slide.
For immunofluorescence dyeing is carried out in section, cut into slices with the PBS/10%NGS sealing, and be incubated 1 hour with mAb 3C9 in 20 ℃.To be used as detection agent with the second antibody of FITS link coupled rabbit-anti-mouse FITC-mark.In order to carry out double staining, use subsequently with the anti-people CD68 of PE link coupled monoclonal antibody and dye.
The result
The molecular cloning of people STIgMA
Use can be discerned the degenerated primer in the conservative Ig district of people JAM1, clones HuSTIgMA from people's tire cDNA library.The order-checking that several clones are carried out discloses 400 amino acid whose open reading frame.The Blast retrieval confirms to have similarity with 1 type transmembrane protein Z39Ig (Langnaese et al., Biochim Biophys Acta1492 (2000) 522-525).The extracellular region of STIgMA is made up of 2 Ig-spline structure territories, contains terminal V-set district of N-and the terminal C2-set of C-district.Use 3 ' and 5 ' primer, clone the splice variant STIgMA short of STIgMA, this variant lacks and film immediate IgC district and short 50 amino acid.
Clone mouse STIgMA also carries out sequence with people STIgMA and compares
Use the complete open reading frame of huSTIgMA (PRO362) and expressed sequence tag (EST) database of tblastn algorithm retrieval mouse.The dna sequencing that 3 clones are carried out has produced 280 identical amino acid whose complete open reading frame.Use is cloned the total length transcript at the primer of 3 trigger areas from the mice spleen library.The mouse clone is similar to the splicing form of hu STIgMA, because it lacks the Ig-spline structure territory of C-end.Between people and mouse acceptor, the outer IgV-district of born of the same parents is comparatively conservative, and their identity is 93%.The cytoplasmic region conservative property of mouse is relatively poor, and than short 20 amino acid of its people's counterpart, identity only is 40%.
STIgMA expresses on the residence scavenger cell hypotype of different tissues, and it is expressed in the inflammation and has Increase
The Northern engram analysis of huSTIgMA is demonstrated the transcript (Figure 57) of two 1.8 and 2.2kb, and expression amount is the highest in suprarenal gland, lung and placenta, and the expression in heart, spinal cord, Tiroidina, mammary gland and lymphoglandula is lower.Institute in a organized way in, the transcript of 2.2kb is the highest transcript of expression amount, infers its coding elongated STIgMA.
TAQMAN TM PCR in real time is analyzed
In order to identify the specific cells system of expressing STIgMA, real-time quantitative PCR and the primer/probe that is specific to the terminal Ig of N-district have been used.Express (Figure 58 A) though in myeloid cell series HL-60 that handled with PMA and monocytic series THP-1, found mRNA low but still that can measure.
The expression of STIgMA (PRO362) on the monocyte of differentiation
For the details of determining when STIgMA expresses in the monocyte/macrophage of differentiation, the monocytic STIgMA mRNA of the adhesion level that we have measured not adherent monocyte and induced differentiation in the presence of the AHS.After bed board, STIgMA mRNA level improves in time gradually, reaches highest level (Figure 58 B) in 7 days.In the differentiation phase, the mRNA level is higher 100 times than undifferentiated monocyte.
The Western trace that the monocyte/macrophage lysate is carried out demonstrates and the synchronous STIgMA protein expression increase (Figure 58 C) of STIgMAmRNA expression increase, and this shows that when monocyte was differentiated to form scavenger cell, STIgMA was expressed.Occurred the band of 48kDa and the band of 40kDa on the trace, inferred that they represent elongated and short type people STIgMA.
The Molecular Identification of STIgMA (PRO362)
STIgMA moves similarly under reduction and non-reduced condition, and this shows that STIgMA is expressed as monomer (Figure 59 A).When using PNGase F to make the STIgMA de-glycosylation, only observe the slight change of migration model, demonstrate inapparent N-glycosylation.When expressing the cell of STIgMA with the pervanadate excessive handling, STIgMA is by phosphorylation (Figure 59 B).The STIgMA of phosphorylation moves as the slightly high albumen of molecular weight (55kDa).In people HEK 293 cells, Syk kinases (result does not show) can not be collected in the STIgMA cytoplasmic structure territory of tyrosine-phosphorylation.
The flow cytometry that STIgMA expresses on the peripheral blood lymphocytes
In order to measure the expression pattern of STIgMA in the round-robin white corpuscle, use directly and ALEXA TMA488 link coupled mono-clonal Anti-Human STIgMA antibody 3C9 carries out flow cytometry to the lymphocyte that separates from healthy donors blood.With PE coupling antibody several immune cell surface antigenics are redyed.All white corpuscles comprise that B-T-Nk cell, monocyte and granulocytic surface all lack STIgMA (Figure 60).Yet, in the scavenger cell division culture medium, expressed STIgMA on 7 days the monocyte of cultivation.
The STIgMA that regulates in the monocyte expresses
In order to study the adjusting that STIgMA expresses, in the presence of multiple short inflammation and anti-inflammatory cytokines, cultivate 7 days scavenger cells, measure the STIgMA expression level by PCR in real time or flow cytometer showed.After with IL-10 and TGF-β scavenger cell being handled 2 days, the expression of STIgMA mRNA increases, and IL-4, IL13 and LPS can reduce expression (Figure 61 A).Compare with undressed contrast scavenger cell, handle to make to express increasing by 500 with dexamethasone.For the adjusting of the STIgMA that measures cell surface expression, carry out flow cytometry handling with the various kinds of cell factor and dexamethasone on 5 days the peripheral blood lymphocytes.Use and ALEXA TMA488 link coupled monoclonal antibody clone 3C9 detects STIgMA.With anti-CD-14 antibody while staining cell.With IL-10 and LPS the monocyte processing after 5 days, is found that surperficial STIgMA expresses increase (Figure 61 B) to some extent.After the dexamethasone processing, find that surperficial STIgMA expresses significantly increase.
The ubcellular of STIgMA distributes
For the ubcellular of studying STIgMA distributes, MDM was cultivated 15 days, fixing then and dye with monoclonal antibody (clone 3C9) or multi-clone rabbit antibody 4F7, then use with FITC link coupled second antibody with through anti-CD 63 antibody stainings of PE mark.Confocal microscopy demonstrates the STIgMA high expression level of nuclear in all kytoplasms, the expression of described expression and lysosome membrane PROTEIN C D63 overlapping (Figure 62 A, B).STIgMA also expresses at the head and the tail edge of scavenger cell, and wherein its dyeing pattern and CD63's is not overlapping.
In normal and diseased tissue, express STIgMA
The STIgMA that has studied in the tissue residence scavenger cell expresses and STIgMA change of Expression in suffering from the tissue of chronic inflammatory disease.Use in situ hybridization, measure a series of STIgMA mRNA and express with paraformaldehyde fixed people tissue.In the pulmonary alveolar macrophage of the necrotomy lung that derives from pneumonia or chronic asthma patient, find high expression level (Figure 63 A-D).The high mRNA expression of discovery in the Kupffer Cell of chronic hepatitis patient liver (Figure 63 E, F).
Former research (Walker, Biochimica et Biophysica Acta 1574 (2002) 387-390), and in the electron screening in library, in the synovial membrane of patient with rheumatoid arthritis, find the high expression level of STIgMA mRNA.Therefore, studied STIgMA expression pattern in the synovial membrane that derives from rheumatoid arthritis, osteoarthritis and degenerative bone disease patient.In the synovial cell who derives from the osteoarthritis patient, find the high expression level (Figure 64 A-D) of STIgMA mRNA.Top layer synovial cell's STIgMA expresses the highest (Figure 64 D).In addition, the STIgMA that uses polyclonal antibody 6F1 to study in the people's synovial membrane freezing microtome section that derives from patient with rheumatoid arthritis expresses.STIgMA expresses (Figure 65 A-C) in the tissue macrophages of synovial cell's hypotype (20-40%) and synovial membrane.These cells most possibly are A type macrophage-like synovial cells.The contrast synovial membrane is not colored (Figure 65 D).
On the scavenger cell of multiple different tissues, find the proteic expression of STIgMA.Demonstrate the film location (Figure 66 A) of STIgMA by the freezing microtome section of the Chinese hamster ovary celI of stably express STIgMA preparation.In pulmonary alveolar macrophage (Figure 66 B), small intestine lamina propria histocyte (Figure 66 C), placenta hofbauer cell (Figure 66 D), suprarenal gland scavenger cell (Figure 66 E) and liver Kupffer Cell (Figure 66 F), found STIgMA albumen.
Atherosclerotic plaque contains a large amount of and the tightly adherent scavenger cell of aorta lumen wall or scavenger cell-foam cell.Consider the effect of STIgMA in scavenger cell-endothelium adheres to, studied the STIgMA in the atherosclerotic plaque and expressed.With anti-CD 63 (Figure 67 A and B) or anti--STIgMA (Figure 67 C and D) dyeing alternative harden plaque section.Being arranged in the overlapping dyeing pattern of finding anti--CD63 and STIgMA on the foam cell of vessel wall, show STIgMA role in arteriosclerosis.
In order to measure whether selective expression on scavenger cell of STIgMA, matter scavenger cell between heart is carried out double staining immunofluorescence (Figure 68).Shown in coverage diagram (Figure 68 C), most of STIgMA positive between the matter scavenger cell also be CD68+.Not every CD68+ scavenger cell also is the STIgMA positive, and this shows that the latter is specific to tissue residence scavenger cell hypotype.
For the mRNA expression level in quantitative assay inflammatory bowel (IBD) syndrome, extract mRNA by the colon that derives from ulcerative colitis, Crohn disease patient or derive from the patient of no IBD performance.The primer that use is specific to STIgMA carries out PCR in real time to measure relative expression's level.Compare with control tissue, the expression level in the patients of ulcerative colitis is high 16 times, the expression level among the Crohn disease patient high 5 times (Figure 69 A).Measure the relative rna expression level in the lung tissue similarly, expression level the highest (COPD: higher 14 times than healthy tissues) in the tissue of discovery patients with chronic obstructive pulmonary diseases is not significantly distinguished (Figure 69 B) with healthy tissues in asthmatic patient.
As everyone knows, the identification of the molecular energy mediated cell of Ig superfamily surface and cell-cell adhesion.Since be arranged in blood vessel between STIgMA in the matter scavenger cell express higherly, studied STIgMA in scavenger cell-inner skin cell viscosity attached middle school role.With total length STIgMA-long stable transfection Jurkat clone (Figure 70 A), make described cell loading fluorescence dye BCECF, it is added in the hole of the 96 hole maxisorb culture plates of having cultivated individual layer HUVEC cell.Measure adhesion by the fluorescence volume that keeps after 3 soft washings.Compare with Jurkat cell, express the Jurkat cell of STIgMA and both, be i.e. the adhesive power stronger (Figure 70 B) of contrast and the endotheliocyte that stimulates through TNF α with the control plasmid stable transfection.
Discuss
This research has been described tissue distribution, the expression of new Ig superfamily member STIgMA/Z39Ig first and has been regulated and Molecular Identification, and confirms its selective expression in tissue residence scavenger cell.
Found in having the residence scavenger cell of complete phenotypic differentiation that STIgMA expresses.Suffering from chronic inflammatory diseases, in the tissue as rheumatoid arthritis and inflammatory bowel, STIgMA expresses to some extent to be increased.Often be accredited as STIgMA expresses in the disease of Th2 type disease increase with to regulate its expression by the Th2 cytokine consistent external at these.At present still the increase expressed of undetermined is because due to the increase that the positive scavenger cell of STIgMA exists, still due to the increase of the expression on the free macrophage.
But a kind of effector function of STIgMA Mediated Human scavenger cell comprises bacterium identification, phagolysis, antigen presentation and release of cytokines.Yet, up to now, do not find evidence to confirm the effect of STIgMA in any process.The cytoplasmic region of STIgMA contains 3 tyrosine residuess, can make described residue phosphorylation by Tyrosylprotein kinase.Therefore, STIgMA can be used as acceptor.Up to now, do not find the part of STIgMA.
These results show STIgMA scavenger cell to the adhesion of vascular endothelial cell wall and might mobility aspect effect.
Inflammatory diseases at non--microorganism property, in ulcerative colitis and chronic obstructive pulmonary disease (COPD), the expression of STIgMA increases to some extent, but passing through with LPS or other bacteria cell wall composition, in the isolating scavenger cell as lipoteichoic acid and bacterial lipoprotein processing, the expression of STIgMA is reduced.Cause the expression of STIgMA to increase with LPS long-term disposal (above 2 days).This may be because due to the autocrine effect of the scavenger cell excretory IL-10 that stimulates through LPS.By handling monocyte or scavenger cell, observe the remarkable rise of STIgMA on mRNA and protein level with dexamethasone.Found to handle, had only the expression of a few monocyte/macrophage surface receptor to increase to some extent by dexamethasone.An example is CD163, but dexamethasone is remarkable inadequately to inducing of its.Quite important by anti-inflammatory cytokines IL10 and TGF β rise STIgMA, show that STIgMA can mediate the anti-inflammatory action of glucocorticosteroid.
As described herein, STIgMA expresses representing on the CD68+ scavenger cell hypotype of activated macrophage.Use the sealing of anti-STIgMA and STIgMA-Fc fusion rotein and activate antibody, studied the effect of STIgMA in scavenger cell effector function, adhesion and migration and the effect in chronic inflammatory disease thereof, the results are described in embodiment 25.
Have only the scavenger cell of a few cell surface marker, go up specific expressed as CD68 and CD163 in differentiation.Although CD68 obviously expresses, on other medullary cell and some non--medullary cells, also can detect antigen in everyone scavenger cell colony.Therefore, STIgMA is first cell-surface antigens of selective expression on a matter full-brown macrophage hypotype.
Embodiment 25
The DBA-1J mouse is by the STIgMA fusion rotein in the sacroiliitis (CIA) of collagen initiation
The purpose of this experiment is to compare STIgMA fusion rotein and contrast mouse IgG1 in disease progression and CIA (sacroiliitis that collagen causes, the experimental animal model system of rheumatoid arthritis) process.
Discuss as embodiment 24, STIgMA is specific expressed in a large number on the scavenger cell hypotype, and the expression amount in the chronic inflammatory diseases tissue improves.In the inflammation joint of the arthritic mouse that suffers from the collagen initiation, scavenger cell and synovial cell's great expression mouse STIgMA.In vitro study confirms that STIgMA is relevant to the adhesion of endotheliocyte with scavenger cell.The STIgMA-Fc fusion rotein is by influencing the characteristic of tissue macrophages, or influencing autoimmune disease by the immunne response that influences other cell (for example T cell, B cell, epithelial cell, endotheliocyte), be the arthritic process of mouse by the collagen initiation this moment.This may cause the alleviation of arthritis, swelling and long-term bone erosion.
Animal model species: mouse
Strain: DBA-1J
Supplier: JACKSON
The range of age: 7 to 8 ages in week
These methods of types of pain: 3-cause being better than minimum or instantaneous pain and/or misery, but can research not produced adverse influence using narcotic, pain killer or tranquillizer to implement under the situation of these methods.
Selecting the species of mouse as research CIA, is because CIA is clinical and pathological characteristics is similar to the inflammatory polyarthritis of people RA (rheumatoid arthritis).This animal model was used in a lot of laboratories, and the histopathology of CIA is similar to the RA with synovial membrane propagation, can progressively develop into to form pannus, cartilage degradation/damage and marginal bone erosion, joint deformity subsequently.In addition, in phylogeny, mouse also is the Mammals of minimum grade.
And, there is not the available external model can simulate RA (rheumatoid arthritis) complexity and polyfactorial pathology yet.
Experimental design
The treatment group:
1) mIgG1 isotype, 6mg/kg is dissolved in the 200 μ l salt solution, subcutaneous (SC) administration, 3 times/week, totally 7 weeks (n=8).
2) muSTIgMA (PRO362), 4mg/kg is dissolved in the 100 μ l salt solution, SC administration, 3 times/week, totally 7 weeks (n=8).
With immune mouse between the ox CII that is emulsifiable in CFS (Difco) (100 μ g, Sigma, St Louis) skin.After 21 days, attack mouse again with the IFA (Difco) that contains CII.Since the 24th day, use 100 μ g muSTIgMA (PRO362) Fc for one group of mouse (n=7), 3 totally 6 weeks weekly, use 100 μ g mouse IgG1 with comparing for second group of mouse (n=8).Check the arthritis sign of mouse every day, and it is as follows to mark: 0, normal; 1, be confined to the erythema and the mild swelling of ankle joint; 2, extend to the erythema and the mild swelling of the sole of the foot or metacarpal joint by ankle; 3, extend to the erythema and the moderate swelling of the sole of the foot or metacarpal joint by ankle; 4, extend to the erythema and the severe swelling of toe joint by ankle.The highest arthritis score of every claw is 4, and the higher assessment of every mouse is divided into 16 (Figure 71).
At the 0th day, with all mouse of 100 μ g ox II Collagen Type VIs immunity that are in the 100 μ l complete Freund's adjuvants (CFA).Be in II Collagen Type VI among the CFA in right side intradermal injection at the bottom of the tail.The 21st day, immune to carry out the second time at the 100 μ g ox II Collagen Type VIs that left side intradermal injection at the bottom of the tail is in the 100 μ l incomplete Freund's adjuvants.Check animal by researchist's every day (Mon-Fri).Nestlet is used as enriching apparatus, for animal provides extra bedding and padding.In case of necessity, provide the food of getting wet in the cage bottom.After consulting the animal doctor, put to death weak animal.When research finishes, adopt terminal faxitron X-ray and microCT, and estimate joint damage/erosion.In addition, before treatment and treatment weigh to animal when finishing.
When the 35th day and research finish, get blood with preparation serum pK for the 1st to 8 group of mouse, and measure the antibody titers (100 μ l eye socket blood) of anti--II Collagen Type VI.
The 70th day, finally under 3% isofluranum, all mouse are carried out getting in the heart blood to obtain final blood picture, counting differential white corpuscle and evaluation serum pK (G3).
The 70th day, after causing sacroiliitis, mouse is practised mercy killing.Collect 4 all limbs and carry out radiography, 5CT and histopathological analysis.
Stable breeding of animal (housing) and diet
The food that cotton pad is provided on the floor of cage and gets wet is so that the easier feed of animal and more comfortable.
Constraint (restraint) used medicine
Work after isofluranum (isofurane)-suction
The method of euthanasia: under narcosis, pass through cardiac puncture (through skin) bloodletting
Isofluranum-work by suction
The result
Compare with the control group mice of accepting IgG1 (circle), in accepting the test group mouse (square) of STIgMA fusion rotein, STIgMA fusion rotein muSTIgMA-Fc general is injected to sacroiliitis mouse (Animal Model of Rheumatoid Arthritis) that collagen causes causes the CIA process significantly (referring to Figure 71: p-value=0.0004) slow down.
The preservation of biomaterial
Following material has been deposited in American type culture collection, 10801 UniversityBoulevard, and Manassas, VA 20110-2209, USA (ATCC):
Name The ATCC preserving number Preservation day
Based on plasmid DNA 40628-1216 209432 November 7 of pRK5,1997
DNA45416-1251 209620 February 5,1998
DNA35638-1141 209265 September 16,1997
DNA77624-2515 203553 December 22,1998
These preservations are to carry out according to the microbial preservation budapest treaty that is used for patented procedure of international recognition and article (budapest treaty) thereof.This guarantees to keep the culture alive of this preservation thing in 30 years preservation days.This preservation can be according to budapest treaty and Genentech, Inc. and the agreement between the ATCC obtain from ATCC, described agreement guarantees that the public is authorized to or after any U.S. Patent application or foreign patent application be disclosed (to be as the criterion earlier) in related U.S. patent, can be forever and unrestrictedly obtain offspring's culture of this preservation thing, and guarantee to obtain described offspring's culture by the people that the United States Patent (USP) trade mark council determines according to the detailed rules and regulations (comprising 37CFR § 1.14, especially referring to 886 OG 638) of the 35USC ' 122 and the council.
The application's transferee agrees, and is dead or lose or destroyed when the culture of preserved material is cultivated under optimum conditions, will be in the back that has notice rapidly with another same material replacement.Obtain this preserved material and do not show, can run counter to any government and implement the present invention according to its patent law institute granted entitlements.
We think that the specification sheets of writing previously is enough to make those skilled in the art to implement the present invention.Scope of the present invention is not limited to the explanation (construct) that this paper provides, because these explanations only are to set forth aspects more of the present invention, the explanation of any function equivalent all is included in the category of the present invention.The preservation of biomaterial mentioned in this article and not meaning that is admitted, content described herein is not enough to guarantee to implement either side of the present invention, comprise its optimal mode, also should not be understood that the scope that claim is explained is restricted to the specific examples of these preservation thing representatives.In fact, except shown in this paper and described, those skilled in the art can carry out various changes to the present invention according to the description of front obviously, and these changes also fall in the scope of protection of present invention.
Sequence table
＜110〉Genentech Inc (GENENTECH, INC.)
Ashkenazi，Avi J.
Fong，Sherman
Goddard，Audrey
Gurney，Austin L.
Napier，Mary A.
Tumas，Daniel
Van Lookren，Menno
Wood，William I.
＜120〉purposes of A33 antigen and JAM-IT
<130>39766-0100PCT
<150>US 10/633,008
<151>2003-07-31
<150>US 10/265,542
<151>2002-10-03
<160>36
<170>FastSEQ for Windows Version 4.0
<210>1
<211>299
<212>PRT
＜213〉people (homo sapiens)
<400>1
Met Gly Thr Lys Ala Gln Val Glu Arg Lys Leu Leu Cys Leu Phe Ile
1 5 10 15
Leu Ala Ile Leu Leu Cys Ser Leu Ala Leu Gly Ser Val Thr Val His
20 25 30
Ser Ser Glu Pro Glu Val Arg Ile Pro Glu Asn Asn Pro Val Lys Leu
35 40 45
Ser Cys Ala Tyr Ser Gly Phe Ser Ser Pro Arg Val Glu Trp Lys Phe
50 55 60
Asp Gln Gly Asp Thr Thr Arg Leu Val Cys Tyr Asn Asn Lys Ile Thr
65 70 75 80
Ala Ser Tyr Glu Asp Arg Val Thr Phe Leu Pro Thr Gly Ile Thr Phe
85 90 95
Lys Ser Val Thr Arg Glu Asp Thr Gly Thr Tyr Thr Cys Met Val Ser
100 105 110
Glu Glu Gly Gly Asn Ser Tyr Gly Glu Val Lys Val Lys Leu Ile Val
115 120 125
Leu Val Pro Pro Ser Lys Pro Thr Val Asn Ile Pro Ser Ser Ala Thr
130 135 140
Ile Gly Asn Arg Ala Val Leu Thr Cys Ser Glu Gln Asp Gly Ser Pro
145 150 155 160
Pro Ser Glu Tyr Thr Trp Phe Lys Asp Gly Ile Val Met Pro Thr Asn
165 170 175
Pro Lys Ser Thr Arg Ala Phe Ser Asn Ser Ser Tyr Val Leu Asn Pro
180 185 190
Thr Thr Gly Glu Leu Val Phe Asp Pro Leu Ser Ala Ser Asp Thr Gly
195 200 205
Glu Tyr Ser Cys Glu Ala Arg Asn Gly Tyr Gly Thr Pro Met Thr Ser
210 215 220
Asn Ala Val Arg Met Glu Ala Val Glu Arg Asn Val Gly Val Ile Val
225 230 235 240
Ala Ala Val Leu Val Thr Leu Ile Leu Leu Gly Ile Leu Val Phe Gly
245 250 255
Ile Trp Phe Ala Tyr Ser Arg Gly His Phe Asp Arg Thr Lys Lys Gly
260 265 270
Thr Ser Ser Lys Lys Val Ile Tyr Ser Gln Pro Ser Ala Arg Ser Glu
275 280 285
Gly Glu Phe Lys Gln Thr Ser Ser Phe Leu Val
290 295
<210>2
<211>321
<212>PRT
＜213〉people (homo sapiens)
<400>2
Met Gly Ile Leu Leu Gly Leu Leu Leu Leu Gly His Leu Thr Val Asp
1 5 10 15
Thr Tyr Gly Arg Pro Ile Leu Glu Val Pro Glu Ser Val Thr Gly Pro
20 25 30
Trp Lys Gly Asp Val Asn Leu Pro Cys Thr Tyr Asp Pro Leu Gln Gly
35 40 45
Tyr Thr Gln Val Leu Val Lys Trp Leu Val Gln Arg Gly Ser Asp Pro
50 55 60
Val Thr Ile Phe Leu Arg Asp Ser Ser Gly Asp His Ile Gln Gln Ala
65 70 75 80
Lys Tyr Gln Gly Arg Leu His Val Ser His Lys Val Pro Gly Asp Val
85 90 95
Ser Leu Gln Leu Ser Thr Leu Glu Met Asp Asp Arg Ser His Tyr Thr
100 105 110
Cys Glu Val Thr Trp Gln Thr Pro Asp Gly Asn Gln Val Val Arg Asp
115 120 125
Lys Ile Thr Glu Leu Arg Val Gln Lys Leu Ser Val Ser Lys Pro Thr
130 135 140
Val Thr Thr Gly Ser Gly Tyr Gly Phe Thr Val Pro Gln Gly Met Arg
145 150 155 160
Ile Ser Leu Gln Cys Gln Ala Arg Gly Ser Pro Pro Ile Ser Tyr Ile
165 170 175
Trp Tyr Lys Gln Gln Thr Asn Asn Gln Glu Pro Ile Lys Val Ala Thr
180 185 190
Leu Ser Thr Leu Leu Phe Lys Pro Ala Val Ile Ala Asp Ser Gly Ser
195 200 205
Tyr Phe Cys Thr Ala Lys Gly Gln Val Gly Ser Glu Gln His Ser Asp
210 215 220
Ile Val Lys Phe Val Val Lys Asp Ser Ser Lys Leu Leu Lys Thr Lys
225 230 235 240
Thr Glu Ala Pro Thr Thr Met Thr Tyr Pro Leu Lys Ala Thr Ser Thr
245 250 255
Val Lys Gln Ser Trp Asp Trp Thr Thr Asp Met Asp Gly Tyr Leu Gly
260 265 270
Glu Thr Ser Ala Gly Pro Gly Lys Ser Leu Pro Val Phe Ala Ile Ile
275 280 285
Leu Ile Ile Ser Leu Cys Cys Met Val Val Phe Thr Met Ala Tyr Ile
290 295 300
Met Leu Cys Arg Lys Thr Ser Gln Gln Glu His Val Tyr Glu Ala Ala
305 310 315 320
Arg
<210>3
<211>390
<212>DNA
＜213〉people (homo sapiens)
<400>3
cttcttgcca actggtatca ccttcaagtc cgtgacacgg gaagacactg ggacatacac 60
ttgtatggtc tctgaggaag gcggcaacag ctatggggag gtcaaggtca agctcatcgt 120
gcttgtgcct ccatccaagc ctacagttaa catcccctcc tctgccacca ttgggaaccg 180
ggcagtgctg acatgctcag aacaagatgg ttccccacct tctgaataca cctggttcaa 240
agatgggata gtgatgccta cgaatcccaa aagcacccgt gccttcagca actcttccta 300
tgtcctgaat cccacaacag gagagctggt ctttgatccc ctgtcagcct ctgatactgg 360
agaatacagc tgtgaggcac ggaatgggta 390
<210>4
<211>726
<212>DNA
＜213〉people (homo sapiens)
<400>4
tctcagtccc ctcgctgtag tcgcggagct gtgttctgtt tcccaggagt ccttcggcgg 60
ctgttgtgct caggtgcgcc tgatcgcgat ggggacaaag gcgcaagctc gagaggaaac 120
tgttgtgcct cttcatattg gcgatcctgt tgtgctccct ggcattgggc agtgttacag 180
ttgcactctt ctgaacctga agtcagaatt cctgagaata atcctgtgaa gttgtcctgt 240
gcctactcgg gcttttcttc tccccgtgtg gagtggaagt ttgaccaagg agacaccacc 300
agactcgttt gctataataa caagatcaca gcttcctatg aggaccgggt gaccttcttg 360
ccaactggta tcaccttcaa gtccgtgaca cgggaagaca ctgggacata cacttgtatg 420
gtctctgagg aaggcggcaa cagctatggg gaggtcaagg tcaagctcat cgtgcttgtg 480
cctccatcca agcctacagt taacatcccc tcctctgcca ccattgggaa ccgggcagtg 540
ctgacatgct cagaacaaga tggttcccca ccttctgaat acacctggtt caaagatggg 600
atagtgatgc ctacgaatcc caaaagcacc cgtgccttca gcaactcttc ctatgtcctg 660
aatcccacaa caggagagct ggtctttgat cccctgtcag cctctgatac tggagaatac 720
agctgt 726
<210>5
<211>1503
<212>DNA
＜213〉people (homo sapiens)
<400>5
gcaggcaaag taccagggcc gcctgcatgt gagccacaag gttccaggag atgtatccct 60
ccaattgagc accctggaga tggatgaccg gagccactac acgtgtgaag tcacctggca 120
gactcctgat ggcaaccaag tcgtgagaga taagattact gagctccgtg tccagaaact 180
ctctgtctcc aagcccacag tgacaactgg cagcggttat ggcttcacgg tgccccaggg 240
aatgaggatt agccttcaat gccagggttc ggggttctcc tcccatcagt tatatttggt 300
ataagcaaca gactaataac cagggaaccc atcaaagtag caaccctaag taccttactc 360
ttcaagcctg cggtgatagc cgactcaggc tcctatttct gcactgccaa gggccaggtt 420
ggctctgagc agcacagcga cattgtgaag tttgtggtca aagactcctc aaagctactc 480
aagaccaaga ctgaggcacc tacaaccatg acatacccct tgaaagcaac atctacagtg 540
aagcagtcct gggactggac cactgacatg gatggctacc ttggagagac cagtgctggg 600
ccaggaaaga gcctgcctgt ctttgccatc atcctcatca tctccttgtg ctgtatggtg 660
gtttttacca tggcctatat catgctctgt cggaagacat cccaacaaga gcatgtctac 720
gaagcagcca gggcacatgc cagagaggcc aacgactctg gagaaaccat gagggtggcc 780
atcttcgcaa gtggctgctc cagtgatgag ccaacttccc agaatctggg gcaacaacta 840
ctctgatgag ccctgcatag gacaggagta ccagatcatc gcccagatca atggcaacta 900
cgcccgcctg ctggacacag ttcctctgga ttatgagttt ctggccactg agggcaaaag 960
tgtctgttaa aaatgcccca ttaggccagg atctgctgac ataattgcct agtcagtcct 1020
tgccttctgc atggccttct tccctgctac ctctcttcct ggatagccca aagtgtccgc 1080
ctaccaacac tggagccgct gggagtcact ggctttgccc tggaatttgc cagatgcatc 1140
tcaagtaagc cagctgctgg atttggctct gggcccttct agtatctctg ccgggggctt 1200
ctggtactcc tctctaaata ccagagggaa gatgcccata gcactaggac ttggtcatca 1260
tgcctacaga cactattcaa ctttggcatc ttgccaccag aagacccgag gggaggctca 1320
gctctgccag ctcagaggac cagctatatc caggatcatt tctctttctt cagggccaga 1380
cagcttttaa ttgaaattgt tatttcacag gccagggttc agttctgctc ctccactata 1440
agtctaatgt tctgactctc tcctggtgct caataaatat ctaatcataa cagcaaaaaa 1500
aaa 1503
<210>6
<211>319
<212>PRT
＜213〉people (homo sapiens)
<400>6
Met Val Gly Lys Met Trp Pro Val Leu Trp Thr Leu Cys Ala Val Arg
1 5 10 15
Val Thr Val Asp Ala Ile Ser Val Glu Thr Pro Gln Asp Val Leu Arg
20 25 30
Ala Ser Gln Gly Lys Ser Val Thr Leu Pro Cys Thr Tyr His Thr Ser
35 40 45
Thr Ser Ser Arg Glu Gly Leu Ile Gln Trp Asp Lys Leu Leu Leu Thr
50 55 60
His Thr Glu Arg Val Val Ile Trp Pro Phe Ser Asn Lys Asn Tyr Ile
65 70 75 80
His Gly Glu Leu Tyr Lys Asn Arg Val Ser Ile Ser Asn Asn Ala Glu
85 90 95
Gln Ser Asp Ala Ser Ile Thr Ile Asp Gln Leu Thr Met Ala Asp Asn
100 105 110
Gly Thr Tyr Glu Cys Ser Val Ser Leu Met Ser Asp Leu Glu Gly Asn
115 120 125
Thr Lys Ser Arg Val Arg Leu Leu Val Leu Val Pro Pro Ser Lys Pro
130 135 140
Glu Cys Gly Ile Glu Gly Glu Thr Ile Ile Gly Asn Asn Ile Gln Leu
145 150 155 160
Thr Cys Gln Ser Lys Glu Gly Ser Pro Thr Pro Gln Tyr Ser Trp Lys
165 170 175
Arg Tyr Asn Ile Leu Asn Gln Glu Gln Pro Leu Ala Gln Pro Ala Ser
180 185 190
Gly Gln Pro Val Ser Leu Lys Asn Ile Ser Thr Asp Thr Ser Gly Tyr
195 200 205
Tyr Ile Cys Thr Ser Ser Asn Glu Glu Gly Thr Gln Phe Cys Asn Ile
210 215 220
Thr Val Ala Val Arg Ser Pro Ser Met Asn Val Ala Leu Tyr Val Gly
225 230 235 240
Ile Ala Val Gly Val Val Ala Ala Leu Ile Ile Ile Gly Ile Ile Ile
245 250 255
Tyr Cys Cys Cys Cys Arg Gly Lys Asp Asp Asn Thr Glu Asp Lys Glu
260 265 270
Asp Ala Arg Pro Asn Arg Glu Ala Tyr Glu Glu Pro Pro Glu Gln Leu
275 280 285
Arg Glu Leu Ser Arg Glu Arg Glu Glu Glu Asp Asp Tyr Arg Gln Glu
290 295 300
Glu Gln Arg Ser Thr Gly Arg Glu Ser Pro Asp His Leu Asp Gln
305 310 315
<210>7
<211>2181
<212>DNA
＜213〉people (homo sapiens)
<400>7
cccacgcgtc cgcccacgcg tccgcccacg ggtccgccca cgcgtccggg ccaccagaag 60
tttgagcctc tttggtagca ggaggctgga agaaaggaca gaagtagctc tggctgtgat 120
ggggatctta ctgggcctgc tactcctggg gcacctaaca gtggacactt atggccgtcc 180
catcctggaa gtgccagaga gtgtaacagg accttggaaa ggggatgtga atcttccctg 240
cacctatgac cccctgcaag gctacaccca agtcttggtg aagtggctgg tacaacgtgg 300
ctcagaccct gtcaccatct ttctacgtga ctcttctgga gaccatatcc agcaggcaaa 360
gtaccagggc cgcctgcatg tgagccacaa ggttccagga gatgtatccc tccaattgag 420
caccctggag atggatgacc ggagccacta cacgtgtgaa gtcacctggc agactcctga 480
tggcaaccaa gtcgtgagag ataagattac tgagctccgt gtccagaaac tctctgtctc 540
caagcccaca gtgacaactg gcagcggtta tggcttcacg gtgccccagg gaatgaggat 600
tagccttcaa tgccaggctc ggggttctcc tcccatcagt tatatttggt ataagcaaca 660
gactaataac caggaaccca tcaaagtagc aaccctaagt accttactct tcaagcctgc 720
ggtgatagcc gactcaggct cctatttctg cactgccaag ggccaggttg gctctgagca 780
gcacagcgac attgtgaagt ttgtggtcaa agactcctca aagctactca agaccaagac 840
tgaggcacct acaaccatga catacccctt gaaagcaaca tctacagtga agcagtcctg 900
ggactggacc actgacatgg atggctacct tggagagacc agtgctgggc caggaaagag 960
cctgcctgtc tttgccatca tcctcatcat ctccttgtgc tgtatggtgg tttttaccat 1020
ggcctatatc atgctctgtc ggaagacatc ccaacaagag catgtctacg aagcagccag 1080
gtaagaaagt ctctcctctt ccatttttga ccccgtccct gccctcaatt ttgattactg 1140
gcaggaaatg tggaggaagg ggggtgtggc acagacccaa tcctaaggcc ggaggccttc 1200
agggtcagga catagctgcc ttccctctct caggcacctt ctgaggttgt tttggccctc 1260
tgaacacaaa ggataattta gatccatctg ccttctgctt ccagaatccc tgggtggtag 1320
gatcctgata attaattggc aagaattgag gcagaagggt gggaaaccag gaccacagcc 1380
ccaagtccct tcttatgggt ggtgggctct tgggccatag ggcacatgcc agagaggcca 1440
acgactctgg agaaaccatg agggtggcca tcttcgcaag tggctgctcc agtgatgagc 1500
caacttccca gaatctgggc aacaactact ctgatgagcc ctgcatagga caggagtacc 1560
agatcatcgc ccagatcaat ggcaactacg cccgcctgct ggacacagtt cctctggatt 1620
atgagtttct ggccactgag ggcaaaagtg tctgttaaaa atgccccatt aggccaggat 1680
ctgctgacat aattgcctag tcagtccttg ccttctgcat ggccttcttc cctgctacct 1740
ctcttcctgg atagcccaaa gtgtccgcct accaacactg gagccgctgg gagtcactgg 1800
ctttgccctg gaatttgcca gatgcatctc aagtaagcca gctgctggat ttggctctgg 1860
gcccttctag tatctctgcc gggggcttct ggtactcctc tctaaatacc agagggaaga 1920
tgcccatagc actaggactt ggtcatcatg cctacagaca ctattcaact ttggcatctt 1980
gccaccagaa gacccgaggg aggctcagct ctgccagctc agaggaccag ctatatccag 2040
gatcatttct ctttcttcag ggccagacag cttttaattg aaattgttat ttcacaggcc 2100
agggttcagt tctgctcctc cactataagt ctaatgttct gactctctcc tggtgctcaa 2160
taaatatcta atcataacag c 2181
<210>8
<211>1295
<212>DNA
＜213〉people (homo sapiens)
<400>8
cccagaagtt caagggcccc cggcctcctg cgctcctgcc gccgggaccc tcgacctcct 60
cagagcagcc ggctgccgcc ccgggaagat ggcgaggagg agccgccacc gcctcctcct 120
gctgctgctg cgctacctgg tggtcgccct gggctatcat aaggcctatg ggttttctgc 180
cccaaaagac caacaagtag tcacagcagt agagtaccaa gaggctattt tagcctgcaa 240
aaccccaaag aagactgttt cctccagatt agagtggaag aaactgggtc ggagtgtctc 300
ctttgtctac tatcaacaga ctcttcaagg tgattttaaa aatcgagctg agatgataga 360
tttcaatatc cggatcaaaa atgtgacaag aagtgatgcg gggaaatatc gttgtgaagt 420
tagtgcccca tctgagcaag gccaaaacct ggaagaggat acagtcactc tggaagtatt 480
agtggctcca gcagttccat catgtgaagt accctcttct gctctgagtg gaactgtggt 540
agagctacga tgtcaagaca aagaagggaa tccagctcct gaatacacat ggtttaagga 600
tggcatccgt ttgctagaaa atcccagact tggctcccaa agcaccaaca gctcatacac 660
aatgaataca aaaactggaa ctctgcaatt taatactgtt tccaaactgg acactggaga 720
atattcctgt gaagcccgca attctgttgg atatcgcagg tgtcctggga aacgaatgca 780
agtagatgat ctcaacataa gtggcatcat agcagccgta gtagttgtgg ccttagtgat 840
ttccgtttgt ggccttggtg tatgctatgc tcagaggaaa ggctactttt caaaagaaac 900
ctccttccag aagagtaatt cttcatctaa agccacgaca atgagtgaaa atgtgcagtg 960
gctcacgcct gtaatcccag cactttggaa ggccgcggcg ggcggatcac gaggtcagga 1020
gttctagacc agtctggcca atatggtgaa accccatctc tactaaaata caaaaattag 1080
ctgggcatgg tggcatgtgc ctgcagttcc agctgcttgg gagacaggag aatcacttga 1140
acccgggagg cggaggttgc agtgagctga gatcacgcca ctgcagtcca gcctgggtaa 1200
cagagcaaga ttccatctca aaaaataaaa taaataaata aataaatact ggtttttacc 1260
tgtagaattc ttacaataaa tatagcttga tattc 1295
<210>9
<211>312
<212>PRT
＜213〉people (homo sapiens)
<400>9
Met Ala Arg Arg Ser Arg His Arg Leu Leu Leu Leu Leu Leu Arg Tyr
1 5 10 15
Leu Val Val Ala Leu Gly Tyr His Lys Ala Tyr Gly Phe Ser Ala Pro
20 25 30
Lys Asp Gln Gln Val Val Thr Ala Val Glu Tyr Gln Glu Ala Ile Leu
35 40 45
Ala Cys Lys Thr Pro Lys Lys Thr Val Ser Ser Arg Leu Glu Trp Lys
50 55 60
Lys Leu Gly Arg Ser Val Ser Phe Val Tyr Tyr Gln Gln Thr Leu Gln
65 70 75 80
Gly Asp Phe Lys Asn Arg Ala Glu Met Ile Asp Phe Asn Ile Arg Ile
85 90 95
Lys Asn Val Thr Arg Ser Asp Ala Gly Lys Tyr Arg Cys Glu Val Ser
100 105 110
Ala Pro Ser Glu Gln Gly Gln Asn Leu Glu Glu Asp Thr Val Thr Leu
115 120 125
Glu Val Leu Val Ala Pro Ala Val Pro Ser Cys Glu Val Pro Ser Ser
130 135 140
Ala Leu Ser Gly Thr Val Val Glu Leu Arg Cys Gln Asp Lys Glu Gly
145 150 155 160
Asn Pro Ala Pro Glu Tyr Thr Trp Phe Lys Asp Gly Ile Arg Leu Leu
165 170 175
Glu Asn Pro Arg Leu Gly Ser Gln Ser Thr Asn Ser Ser Tyr Thr Met
180 185 190
Asn Thr Lys Thr Gly Thr Leu Gln Phe Asn Thr Val Ser Lys Leu Asp
195 200 205
Thr Gly Glu Tyr Ser Cys Glu Ala Arg Asn Ser VAl Gly Tyr Arg Arg
210 215 220
Cys Pro Gly Lys Arg Met Gln Val Asp Asp Leu Asn Ile Ser Gly Ile
225 230 235 240
Ile Ala Ala Val Val Val Val Ala Leu Val Ile Ser Val Cys Gly Leu
245 250 255
Gly Val Cys Tyr Ala Gln Arg Lys Gly Tyr Phe Ser Lys Glu Thr Ser
260 265 270
Phe Gln Lys Ser Asn Ser Ser Ser Lys Ala Thr Thr Met Ser Glu Asn
275 280 285
Val Gln Trp Leu Thr Pro Val Ile Pro Ala Leu Trp Lys Ala Ala Ala
290 295 300
Gly Gly Ser Arg Gly Gln Glu Phe
305 310
<210>10
<211>300
<212>PRT
＜213〉mouse (Mus Musculus)
<400>10
Met Gly Thr Glu Gly Lys Ala Gly Arg Lys Leu Leu Phe Leu Phe Thr
1 5 10 15
Ser Met Ile Leu Gly Ser Leu Val Gln Gly Lys Gly Ser Val Tyr Thr
20 25 30
Ala Gln Ser Asp Val Gln Val Pro Glu Asn Glu Ser Ile Lys Leu Thr
35 40 45
Cys Thr Tyr Ser Gly Phe Ser Ser Pro Arg Val Glu Trp Lys Phe Val
50 55 60
Gln Gly Ser Thr Thr Ala Leu Val Cys Tyr Asn Ser Gln Ile Thr Ala
65 70 75 80
Pro Tyr Ala Asp Arg Val Thr Phe Ser Ser Ser Gly Ile Thr Phe Ser
85 90 95
Ser Val Thr Arg Lys Asp Asn Gly Glu Tyr Thr Cys Met Val Ser Glu
100 105 110
Glu Gly Gly Gln Asn Tyr Gly Glu Val Ser Ile His Leu Thr Val Leu
115 120 125
Val Pro Pro Ser Lys Pro Thr Ile Ser Val Pro Ser Ser Val Thr Ile
130 135 140
Gly Asn Arg Ala Val Leu Thr Cys Ser Glu His Asp Gly Ser Pro Pro
145 150 155 160
Ser Glu Tyr Ser Trp Phe Lys Asp Gly Ile Ser Met Leu Thr Ala Asp
165 170 175
Ala Lys Lys Thr Arg Ala Phe Met Asn Ser Ser Phe Thr Ile Asp Pro
180 185 190
Lys Ser Gly Asp Leu Ile Phe Asp Pro Val Thr Ala Phe Asp Ser Gly
195 200 205
Glu Tyr Tyr Cys Gln Ala Gln Asn Gly Tyr Gly Thr Ala Met Arg Ser
210 215 220
Glu Ala Ala His Met Asp Ala Val Glu Leu Asn Val Gly Gly Ile Val
225 230 235 240
Ala Ala Val Leu Val Thr Leu Ile Leu Leu Gly Leu Leu Ile Phe Gly
245 250 255
Val Trp Phe Ala Tyr Ser Arg Gly Tyr Phe Glu Thr Thr Lys Lys Gly
260 265 270
Thr Ala Pro Gly Lys Lys Val Ile Tyr Ser Gln Pro Ser Thr Arg Ser
275 280 285
Glu Gly Glu Phe Lys Gln Thr Ser Ser Phe Leu Val
290 295 300
<210>11
<211>1842
<212>DNA
＜213〉people (homo sapiens)
<400>11
gtctgttccc aggagtcctt cggcggctgt tgtgtcggga gcctgatcgc gatggggaca 60
aaggcgcaag tcgagaggaa actgttgtgc ctcttcatat tggcgatcct gttgtgctcc 120
ctggcattgg gcagtgttac agtgcactct tctgaacctg aagtcagaat tcctgagaat 180
aatcctgtga agttgtcctg tgcctactcg ggcttttctt ctccccgtgt ggagtggaag 240
tttgaccaag gagacaccac cagactcgtt tgctataata acaagatcac agcttcctat 300
gaggaccggg tgaccttctt gccaactggt atcaccttca agtccgtgac acgggaagac 360
actgggacat acacttgtat ggtctctgag gaaggcggca acagctatgg ggaggtcaag 420
gtcaagctca tcgtgcttgt gcctccatcc aagcctacag ttaacatccc ctcctctgcc 480
accattggga accgggcagt gctgacatgc tcagaacaag atggttcccc accttctgaa 540
tacacctggt tcaaagatgg gatagtgatg cctacgaatc ccaaaagcac ccgtgccttc 600
agcaactctt cctatgtcct gaatcccaca acaggagagc tggtctttga tcccctgtca 660
gcctctgata ctggagaata cagctgtgag gcacggaatg ggtatgggac acccatgact 720
tcaaatgctg tgcgcatgga agctgtggag cggaatgtgg gggtcatcgt ggcagccgtc 780
cttgtaaccc tgattctcct gggaatcttg gtttttggca tctggtttgc ctatagccga 840
ggccactttg acagaacaaa gaaagggact tcgagtaaga aggtgattta cagccagcct 900
agtgcccgaa gtgaaggaga attcaaacag acctcgtcat tcctggtgtg agcctggtcg 960
gctcaccgcc tatcatctgc atttgcctta ctcaggtgct actggactct ggcccctgat 1020
gtctgtagtt tcacaggatg ccttatttgt cttctacacc ccacagggcc ccctacttct 1080
tcggatgtgt ttttaataat gtcagctatg tgccccatcc tccttcatgc cctccctccc 1140
tttcctacca ctgctgagtg gcctggaact tgtttaaagt gtttattccc catttctttg 1200
agggatcagg aaggaatcct gggtatgcca ttgacttccc ttctaagtag acagcaaaaa 1260
tggcgggggt cgcaggaatc tgcactcaac tgcccacctg gctggcaggg atctttgaat 1320
aggtatcttg agcttggttc tgggctcttt ccttgtgtac tgacgaccag ggccagctgt 1380
tctagagtgg gaattagagg ctagagcggc tgaaatggtt gtttggtgat gacactgggg 1440
tccttccatc tctggggccc actctcttct gtcttcccat gggaagtgcc actgggatcc 1500
ctctgccctg tcctcctgaa tacaagctga ctgacattga ctgtgtctgt ggaaaatggg 1560
agctcttgtt gtggagagca tagtaaattt tcagagaact tgaagcgaaa aggatttaaa 1620
accgctgctc taaagaaaag aaaactggag gctgggcgca gtggctcacg cctgtaatcc 1680
cagaggctga ggcaggcgga tcacctgagg tcgggagttc gggatcagcc tgaccaacat 1740
ggagaaaccc tgctggaaat acagagttag ccaggcatgg tggtgcatgc ctgtagtccc 1800
agctgctcag gagcctggca acaagagcaa aactccagct ca 1842
<210>12
<211>24
<212>DNA
＜213〉artificial sequence
<220>
＜223〉synthetic oligonucleotide probe
<400>12
tcgcggagct gtgttctgtt tccc 24
<210>13
<211>50
<212>DNA
＜213〉artificial sequence
<220>
＜223〉synthetic oligonucleotide probe
<400>13
tgatcgcgat ggggacaaag gcgcaagctc gagaggaaac tgttgtgcct 50
<210>14
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉synthetic oligonucleotide probe
<400>14
acacctggtt caaagatggg 20
<210>15
<211>24
<212>DNA
＜213〉artificial sequence
<220>
＜223〉synthetic oligonucleotide probe
<400>15
taggaagagt tgctgaaggc acgg 24
<210>16
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉synthetic oligonucleotide probe
<400>16
ttgccttact caggtgctac 20
<210>17
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉synthetic oligonucleotide probe
<400>17
actcagcagt ggtaggaaag 20
<210>18
<211>24
<212>DNA
＜213〉artificial sequence
<220>
＜223〉synthetic oligonucleotide probe
<400>18
tatccctcca attgagcacc ctgg 24
<210>19
<211>21
<212>DNA
＜213〉artificial sequence
<220>
＜223〉synthetic oligonucleotide probe
<400>19
gtcggaagac atcccaacaa g 21
<210>20
<211>24
<212>DNA
＜213〉artificial sequence
<220>
＜223〉synthetic oligonucleotide probe
<400>20
cttcacaatg tcgctgtgct gctc 24
<210>21
<211>24
<212>DNA
＜213〉artificial sequence
<220>
＜223〉synthetic oligonucleotide probe
<400>21
agccaaatcc agcagctggc ttac 24
<210>22
<211>50
<212>DNA
＜213〉artificial sequence
<220>
＜223〉synthetic oligonucleotide probe
<400>22
tggatgaccg gagccactac acgtgtgaag tcacctggca gactcctgat 50
<210>23
<211>260
<212>PRT
＜213〉people (homo sapiens)
<400>23
Leu Ala Leu Gly Ser Val Thr Val His Ser Ser Glu Pro Glu Val Arg
1 5 10 15
Ile Pro Glu Asn Asn Pro Val Lys Leu Ser Cys Ala Tyr Ser Gly Phe
20 25 30
Ser Ser Pro Arg Val Glu Trp Lys Phe Asp Gln Gly Asp Thr Thr Arg
35 40 45
Leu Val Cys Tyr Asn Asn Lys Ile Thr Ala Ser Tyr Glu Asp Arg Val
50 55 60
Thr Phe Leu Pro Thr Gly Ile Thr Phe Lys Ser Val Thr Arg Glu Asp
65 70 75 80
Thr Gly Thr Tyr Thr Cys Met Val Ser Glu Glu Gly Gly Asn Ser Tyr
85 90 95
Gly Glu Val Lys Val Lys Leu Ile Val Leu Val Pro Pro Ser Lys Pro
100 105 110
Thr Val Asn Ile Pro Ser Ser Ala Thr Ile Gly Asn Arg Ala Val Leu
115 120 125
Thr Cys Ser Glu Gln Asp Gly Ser Pro Pro Ser Glu Tyr Thr Trp Phe
130 135 140
Lys Asp Gly Ile Val Met Pro Thr Asn Pro Lys Ser Thr Arg Ala Phe
145 150 155 160
Ser Asn Ser Ser Tyr Val Leu Asn Pro Thr Thr Gly Glu Leu Val Phe
165 170 175
Asp Pro Leu Ser Ala Ser Asp Thr Gly Glu Tyr Ser Cys Glu Ala Arg
180 185 190
Asn Gly Tyr Gly Thr Pro Met Thr Ser Asn Ala Val Arg Met Glu Ala
195 200 205
Val Glu Arg Asn Val Gly Val Ile Val Ala Ala Val Leu Val Thr Leu
210 215 220
Ile Leu Leu Gly Ile Leu Val Phe Gly Ile Trp Phe Ala Tyr Ser Arg
225 230 235 240
Gly His Phe Asp Arg Thr Lys Lys Gly Thr Ser Ser Lys Lys Val Ile
245 250 255
Tyr Ser Gln Pro
260
<210>24
<211>268
<212>PRT
＜213〉people (homo sapiens)
<400>24
Val Thr Val Asp Ala Ile Ser Val Glu Thr Pro Gln Asp Val Leu Arg
1 5 10 15
Ala Ser Gln Gly Lys Ser Val Thr Leu Pro Cys Thr Tyr His Thr Ser
20 25 30
Thr Ser Ser Arg Glu Gly Leu Ile Gln Trp Asp Lys Leu Leu Leu Thr
35 40 45
His Thr Glu Arg Val Val Ile Trp Pro Phe Ser Asn Lys Asn Tyr Ile
50 55 60
His Gly Glu Leu Tyr Lys Asn Arg Val Ser Ile Ser Asn Asn Ala Glu
65 70 75 80
Gln Ser Asp Ala Ser Ile Thr Ile Asp Gln Leu Thr Met Ala Asp Asn
85 90 95
Gly Thr Tyr Glu Cys Ser Val Ser Leu Met Ser Asp Leu Glu Gly Asn
100 105 110
Thr Lys Ser Arg Val Arg Leu Leu Val Leu Val Pro Pro Ser Lys Pro
115 120 125
Glu Cys Gly Ile Glu Gly Glu Thr Ile Ile Gly Asn Asn Ile Gln Leu
130 135 140
Thr Cys Gln Ser Lys Glu Gly Ser Pro Thr Pro Gln Tyr Ser Trp Lys
145 150 155 160
Arg Tyr Asn Ile Leu Asn Gln Glu Gln Pro Leu Ala Gln Pro Ala Ser
165 170 175
Gly Gln Pro Val Ser Leu Lys Asn Ile Ser Thr Asp Thr Ser Gly Tyr
180 185 190
Tyr Ile Cys Thr Ser Ser Asn Glu Glu Gly Thr Gln Phe Cys Asn Ile
195 200 205
Thr Val Ala Val Arg Ser Pro Ser Met Asn Val Ala Leu Tyr Val Gly
210 215 220
Ile Ala Val Gly Val Val Ala Ala Leu Ile Ile Ile Gly Ile Ile Ile
225 230 235 240
Tyr Cys Cys Cys Cys Arg Gly Lys Asp Asp Asn Thr Glu Asp Lys Glu
245 250 255
Asp Ala Arg Pro Asn Arg Glu Ala Tyr Glu Glu Pro
260 265
<210>25
<211>263
<212>PRT
＜213〉people (homo sapiens)
<400>25
Leu Cys Ser Leu Ala Leu Gly Ser Val Thr Val His Ser Ser Glu Pro
1 5 10 15
Glu Val Arg Ile Pro Glu Asn Asn Pro Val Lys Leu Ser Cys Ala Tyr
20 25 30
Ser Gly Phe Ser Ser Pro Arg Val Glu Trp Lys Phe Asp Gln Gly Asp
35 40 45
Thr Thr Arg Leu Val Cys Tyr Asn Asn Lys Ile Thr Ala Ser Tyr Glu
50 55 60
Asp Arg Val Thr Phe Leu Pro Thr Gly Ile Thr Phe Lys Ser Val Thr
65 70 75 80
Arg Glu Asp Thr Gly Thr Tyr Thr Cys Met Val Ser Glu Glu Gly Gly
85 90 95
Asn Ser Tyr Gly Glu Val Lys Val Lys Leu Ile Val Leu Val Pro Pro
100 105 110
Ser Lys Pro Thr Val Asn Ile Pro Ser Ser Ala Thr Ile Gly Asn Arg
115 120 125
Ala Val Leu Thr Cys Ser Glu Gln Asp Gly Ser Pro Pro Ser Glu Tyr
130 135 140
Thr Trp Phe Lys Asp Gly Ile Val Met Pro Thr Asn Pro Lys Ser Thr
145 150 155 160
Arg Ala Phe Ser Asn Ser Ser Tyr Val Leu Asn Pro Thr Thr Gly Glu
165 170 175
Leu Val Phe Asp Pro Leu Ser Ala Ser Asp Thr Gly Glu Tyr Ser Cys
180 185 190
Glu Ala Arg Asn Gly Tyr Gly Thr Pro Met Thr Ser Asn Ala Val Arg
195 200 205
Met Glu Ala Val Glu Arg Asn Val Gly Val Ile Val Ala Ala Val Leu
210 215 220
Val Thr Leu Ile Leu Leu Gly Ile Leu Val Phe Gly Ile Trp Phe Ala
225 230 235 240
Tyr Ser Arg Gly His Phe Asp Arg Thr Lys Lys Gly Thr Ser Ser Lys
245 250 255
Lys Val Ile Tyr Ser Gln Pro
260
<210>26
<211>273
<212>PRT
＜213〉people (homo sapiens)
<400>26
Leu Cys Ala Val Arg Val Thr Val Asp Ala Ile Ser Val Glu Thr Pro
1 5 10 15
Gln Asp Val Leu Arg Ala Ser Gln Gly Lys Ser Val Thr Leu Pro Cys
20 25 30
Thr Tyr His Thr Ser Thr Ser Ser Arg Glu Gly Leu Ile Gln Trp Asp
35 40 45
Lys Leu Leu Leu Thr His Thr Glu Arg Val Val Ile Trp Pro Phe Ser
50 55 60
Asn Lys Asn Tyr Ile His Gly Glu Leu Tyr Lys Asn Arg Val Ser Ile
65 70 75 80
Ser Asn Asn Ala Glu Gln Ser Asp Ala Ser Ile Thr Ile Asp Gln Leu
85 90 95
Thr Met Ala Asp Asn Gly Thr Tyr Glu Cys Ser Val Ser Leu Met Ser
100 105 110
Asp Leu Glu Gly Asn Thr Lys Ser Arg Val Arg Leu Leu Val Leu Val
115 120 125
Pro Pro Ser Lys Pro Glu Cys Gly Ile Glu Gly Glu Thr Ile Ile Gly
130 135 140
Asn Asn Ile Gln Leu Thr Cys Gln Ser Lys Glu Gly Ser Pro Thr Pro
145 150 155 160
Gln Tyr Ser Trp Lys Arg Tyr Asn Ile Leu Asn Gln Glu Gln Pro Leu
165 170 175
Ala Gln Pro Ala Ser Gly Gln Pro Val Ser Leu Lys Asn Ile Ser Thr
180 185 190
Asp Thr Ser Gly Tyr Tyr Ile Cys Thr Ser Ser Asn Glu Glu Gly Thr
195 200 205
Gln Phe Cys Asn Ile Thr Val Ala Val Arg Ser Pro Ser Met Asn Val
210 215 220
Ala Leu Tyr Val Gly Ile Ala Val Gly Val Val Ala Ala Leu Ile Ile
225 230 235 240
Ile Gly Ile Ile Ile Tyr Cys Cys Cys Cys Arg Gly Lys Asp Asp Asn
245 250 255
Thr Glu Asp Lys Glu Asp Ala Arg Pro Asn Arg Glu Ala Tyr Glu Glu
260 265 270
Pro
<210>27
<211>413
<212>DNA
＜213〉people (homo sapiens)
<400>27
ctcgagccgc tcgagccgtg cggggaaata tcgttgtgaa gttagtgccc catctgagca 60
aggccaaaac ctggaagagg atacagtcac tctggaagta ttagtggctc cagcagttcc 120
atcatgtgaa gtaccctctt ctgctctgag tggaactgtg gtagagctac gatgtcaaga 180
caaagaaggg aatccagctc ctgaatacac atggtttaag gatggcatcc gtttgctaga 240
aaatcccaga cttggctccc aaagcaccaa cagctcatac acaatgaata caaaaactgg 300
aactctgcaa tttaatactg tttccaaact ggacactgga gaatattcct gtgaagcccg 360
caattctgtt ggatatcgca ggtgtcctgg ggaaacgaat gcaagtagat gat 413
<210>28
<211>22
<212>DNA
＜213〉artificial sequence
<220>
＜223〉synthetic oligonucleotide probe
<400>28
atcgttgtga agttagtgcc cc 22
<210>29
<211>23
<212>DNA
＜213〉artificial sequence
<220>
＜223〉synthetic oligonucleotide probe
<400>29
acctgcgata tccaacagaa ttg 23
<210>30
<211>48
<212>DNA
＜213〉artificial sequence
<220>
＜223〉synthetic oligonucleotide probe
<400>30
ggaagaggat acagtcactc tggaagtatt agtggctcca gcagttcc 48
<210>31
<211>310
<212>PRT
＜213〉people (homo sapiens)
<400>31
Met Ala Leu Arg Arg Pro Pro Arg Leu Arg Leu Cys Ala Arg Leu Pro
1 5 10 15
Asp Phe Phe Leu Leu Leu Leu Phe Arg Gly Cys Leu Ile Gly Ala Val
20 25 30
Asn Leu Lys Ser Ser Asn Arg Thr Pro Val Val Gln Glu Phe Glu Ser
35 40 45
Val Glu Leu Ser Cys Ile Ile Thr Asp Ser Gln Thr Ser Asp Pro Arg
50 55 60
Ile Glu Trp Lys Lys Ile Gln Asp Glu Gln Thr Thr Tyr Val Phe Phe
65 70 75 80
Asp Asn Lys Ile Gln Gly Asp Leu Ala Gly Arg Ala Glu Ile Leu Gly
85 90 95
Lys Thr Ser Leu Lys Ile Trp Asn Val Thr Arg Arg Asp Ser Ala Leu
100 105 110
Tyr Arg Cys Glu Val Val Ala Arg Asn Asp Arg Lys Glu Ile Asp Glu
115 120 125
Ile Val Ile Glu Leu Thr Val Gln Val Lys Pro Val Thr Pro Val Cys
130 135 140
Arg Val Pro Lys Ala Val Pro Val Gly Lys Met Ala Thr Leu His Cys
145 150 155 160
Gln Glu Ser Glu Gly His Pro Arg Pro His Tyr Ser Trp Tyr Arg Asn
165 170 175
Asp Val Pro Leu Pro Thr Asp Ser Arg Ala Asn Pro Arg Phe Arg Asn
180 185 190
Ser Ser Phe His Leu Asn Ser Glu Thr Gly Thr Leu Val Phe Thr Ala
195 200 205
Val His Lys Asp Asp Ser Gly Gln Tyr Tyr Cys Ile Ala Ser Asn Asp
210 215 220
Ala Gly Ser Ala Arg Cys Glu Glu Gln Glu Met Glu Val Tyr Asp Leu
225 230 235 240
Asn Ile Gly Gly Ile Ile Gly Gly Val Leu Val Val Leu Ala Val Leu
245 250 255
Ala Leu Ile Thr Leu Gly Ile Cys Cys Ala Tyr Arg Arg Gly Tyr Phe
260 265 270
Ile Asn Asn Lys Gln Asp Gly Glu Ser Tyr Lys Asn Pro Gly Lys Pro
275 280 285
Asp Gly Val Asn Tyr Ile Arg Thr Asp Glu Glu Gly Asp Phe Arg His
290 295 300
Lys Ser Ser Phe Val Ile
305 310
<210>32
<211>399
<212>PRT
＜213〉people (homo sapiens)
<400>32
Met Gly Ile Leu Leu Gly Leu Leu Leu Leu Gly His Leu Thr Val Asp
1 5 10 15
Thr Tyr Gly Arg Pro Ile Leu Glu Val Pro Glu Ser Val Thr Gly Pro
20 25 30
Trp Lys Gly Asp Val Asn Leu Pro Cys Thr Tyr Asp Pro Leu Gln Gly
35 40 45
Tyr Thr Gln Val Leu Val Lys Trp Leu Val Gln Arg Gly Ser Asp Pro
50 55 60
Val Thr Ile Phe Leu Arg Asp Ser Ser Gly Asp His Ile Gln Gln Ala
65 70 75 80
Lys Tyr Gln Gly Arg Leu His Val Ser His Lys Val Pro Gly Asp Val
85 90 95
Ser Leu Gln Leu Ser Thr Leu Glu Met Asp Asp Arg Ser His Tyr Thr
100 105 110
Cys Glu Val Thr Trp Gln Thr Pro Asp Gly Asn Gln Val Val Arg Asp
115 120 125
Lys Ile Thr Glu Leu Arg Val Gln Lys Leu Ser Val Ser Lys Pro Thr
130 135 140
Val Thr Thr Gly Ser Gly Tyr Gly Phe Thr Val Pro Gln Gly Met Arg
145 150 155 160
Ile Ser Leu Gln Cys Gln Ala Arg Gly Ser Pro Pro Ile Ser Tyr Ile
165 170 175
Trp Tyr Lys Gln Gln Thr Asn Asn Gln Glu Pro Ile Lys Val Ala Thr
180 185 190
Leu Ser Thr Leu Leu Phe Lys Pro Ala Val Ile Ala Asp Ser Gly Ser
195 200 205
Tyr Phe Cys Thr Ala Lys Gly Gln Val Gly Ser Glu Gln His Ser Asp
210 215 220
Ile Val Lys Phe Val Val Lys Asp Ser Ser Lys Leu Leu Lys Thr Lys
225 230 235 240
Thr Glu Ala Pro Thr Thr Met Thr Tyr Pro Leu Lys Ala Thr Ser Thr
245 250 255
Val Lys Gln Ser Trp Asp Trp Thr Thr Asp Met Asp Gly Tyr Leu Gly
260 265 270
Glu Thr Ser Ala Gly Pro Gly Lys Ser Leu Pro Val Phe Ala Ile Ile
275 280 285
Leu Ile Ile Ser Leu Cys Cys Met Val Val Phe Thr Met Ala Tyr Ile
290 295 300
Met Leu Cys Arg Lys Thr Ser Gln Gln Glu His Val Tyr Glu Ala Ala
305 310 315 320
Arg Ala His Ala Arg Glu Ala Asn Asp Ser Gly Glu Thr Met Arg Val
325 330 335
Ala Ile Phe Ala Ser Gly Cys Ser Ser Asp Glu Pro Thr Ser Gln Asn
340 345 350
Leu Gly Asn Asn Tyr Ser Asp Glu Pro Cys Ile Gly Gln Glu Tyr Gln
355 360 365
Ile Ile Ala Gln Ile Asn Gly Asn Tyr Ala Arg Leu Leu Asp Thr Val
370 375 380
Pro Leu Asp Tyr Glu Phe Leu Ala Thr Glu Gly Lys Ser Val Cys
385 390 395
<210>33
<211>305
<212>PRT
＜213〉people (homo sapiens)
<400>33
Met Gly Ile Leu Leu Gly Leu Leu Leu Leu Gly His Leu Thr Val Asp
1 5 10 15
Thr Tyr Gly Arg Pro Ile Leu Glu Val Pro Glu Ser Val Thr Gly Pro
20 25 30
Trp Lys Gly Asp Val Asn Leu Pro Cys Thr Tyr Asp Pro Leu Gln Gly
35 40 45
Tyr Thr Gln Val Leu Val Lys Trp Leu Val Gln Arg Gly Ser Asp Pro
50 55 60
Val Thr Ile Phe Leu Arg Asp Ser Ser Gly Asp His Ile Gln Gln Ala
65 70 75 80
Lys Tyr Gln Gly Arg Leu His Val Ser His Lys Val Pro Gly Asp Val
85 90 95
Ser Leu Gln Leu Ser Thr Leu Glu Met Asp Asp Arg Ser His Tyr Thr
100 105 110
Cys Glu Val Thr Trp Gln Thr Pro Asp Gly Asn Gln Val Val Arg Asp
115 120 125
Lys Ile Thr Glu Leu Arg Val Gln Lys His Ser Ser Lys Leu Leu Lys
130 135 140
Thr Lys Thr Glu Ala Pro Thr Thr Met Thr Tyr Pro Leu Lys Ala Thr
145 150 155 160
Ser Thr Val Lys Gln Ser Trp Asp Trp Thr Thr Asp Met Asp Gly Tyr
165 170 175
Leu Gly Glu Thr Ser Ala Gly Pro Gly Lys Ser Leu Pro Val Phe Ala
180 185 190
Ile Ile Leu Ile Ile Ser Leu Cys Cys Met Val Val Phe Thr Met Ala
195 200 205
Tyr Ile Met Leu Cys Arg Lys Thr Ser Gln Gln Glu His Val Tyr Glu
210 215 220
Ala Ala Arg Ala His Ala Arg Glu Ala Asn Asp Ser Gly Glu Thr Met
225 230 235 240
Arg Val Ala Ile Phe Ala Ser Gly Cys Ser Ser Asp Glu Pro Thr Ser
245 250 255
Gln Asn Leu Gly Asn Asn Tyr Ser Asp Glu Pro Cys Ile Gly Gln Glu
260 265 270
Tyr Gln Ile Ile Ala Gln Ile Asn Gly Asn Tyr Ala Arg Leu Leu Asp
275 280 285
Thr Val Pro Leu Asp Tyr Glu Phe Leu Ala Thr Glu Gly Lys Ser Val
290 295 300
Cys
305
<210>34
<211>280
<212>PRT
＜213〉mouse (Mus Musculus)
<400>34
Met Glu Ile Ser Ser Gly Leu Leu Phe Leu Gly His Leu Ile Val Leu
1 5 10 15
Thr Tyr Gly His Pro Thr Leu Lys Thr Pro Glu Ser Val Thr Gly Thr
20 25 30
Trp Lys Gly Asp Val Lys Ile Gln Cys Ile Tyr Asp Pro Leu Arg Gly
35 40 45
Tyr Arg Gln Val Leu Val Lys Trp Leu Val Arg His Gly Ser Asp Ser
50 55 60
Val Thr Ile Phe Leu Arg Asp Ser Thr Gly Asp His Ile Gln Gln Ala
65 70 75 80
Lys Tyr Arg Gly Arg Leu Lys Val Ser His Lys Val Pro Gly Asp Val
85 90 95
Ser Leu Gln Ile Asn Thr Leu Gln Met Asp Asp Arg Asn His Tyr Thr
100 105 110
Cys Glu Val Thr Trp Gln Thr Pro Asp Gly Asn Gln Val Ile Arg Asp
115 120 125
Lys Ile Ile Glu Leu Arg Val Arg Lys Tyr Asn Pro Pro Arg Ile Asn
130 135 140
Thr Glu Ala Pro Thr Thr Leu His Ser Ser Leu Glu Ala Thr Thr Ile
145 150 155 160
Met Ser Ser Thr Ser Asp Leu Thr Thr Asn Gly Thr Gly Lys Leu Glu
165 170 175
Glu Thr Ile Ala Gly Ser Gly Arg Asn Leu Pro Ile Phe Ala Ile Ile
180 185 190
Phe Ile Ile Ser Leu Cys Cys Ile Val Ala Val Thr Ile Pro Tyr Ile
195 200 205
Leu Phe Arg Cys Arg Thr Phe Gln Gln Glu Tyr Val Tyr Gly Val Ser
210 215 220
Arg Val Phe Ala Arg Lys Thr Ser Asn Ser Glu Glu Thr Thr Arg Val
225 230 235 240
Thr Thr Ile Ala Thr Asp Glu Pro Asp Ser Gln Ala Leu Ile Ser Asp
245 250 255
Tyr Ser Asp Asp Pro Cys Leu Ser Gln Glu Tyr Gln Ile Thr Ile Arg
260 265 270
Ser Thr Met Ser Ile Pro Ala Cys
275 280
<210>35
<211>21
<212>DNA
＜213〉artificial sequence
<220>
＜223〉synthetic oligonucleotide probe
<400>35
tctctgtctc caagcccaca g 21
<210>36
<211>19
<212>DNA
＜213〉artificial sequence
<220>
＜223〉synthetic oligonucleotide probe
<400>36
ctttgaggag tctttgacc 19

Claims (51)

1. treat the method for Mammals inflammatory diseases, described method comprises the anti-native sequences STIgMA to described administration treatment significant quantity, PRO301, the antagonist of PRO362 or PRO245 polypeptide.
2. the method for claim 1, wherein (1) described native sequences STIgMA polypeptide is selected from SEQID NOS:2,32,33, with polypeptide shown in 34, and (2) described PRO301 polypeptide comprises sequence SEQ IDNO:1, and (3) described PRO362 polypeptide comprises sequence SEQ ID NO:2, or (4) described PRO245 polypeptide comprises sequence SEQ ID NO:9.
3. the process of claim 1 wherein that described antagonist is an antibody.
4. the method for claim 3, wherein said antibody is monoclonal antibody.
5. the method for claim 4, wherein said antibody has non--people's complementary determining region (CDR) residue also comprises people's framework region (FR) residue.
6. the method for claim 5, wherein said antibody are the compositions with pharmaceutically acceptable carrier or mixed with excipients.
7. the process of claim 1 wherein that described antagonist is an immunoadhesin.
8. the method for claim 7, wherein said immunoadhesin comprise STIgMA, PRO301, PRO362 or the PRO245 polypeptide extracellular region sequence that merges with the constant region for immunoglobulin sequence.
9. the method for one of claim 5-8, wherein said extracellular region sequence is substantially free of strides the film region sequence.
10. the method for claim 9, wherein said immunoglobulin (Ig) is IgG.
11. the method for claim 10, wherein said IgG is IgG1 or IgG3.
12. the process of claim 1 wherein that described inflammatory diseases is selected from: inflammatory bowel disease; Systemic lupus erythematous; Rheumatoid arthritis; The adolescency chronic arthritis; Vertebral arthropathy; Systemic sclerosis, for example, scleroderma; The spy for example sends out property inflammation myopathy, dermatomyositis, polymyositis; Sjogren syndrome; Systemic vasculitis; Sarcoidosis; Autoimmune hemolytic anemia for example, immune pancytopenia, paroxysmal nocturnal hemoglobinuria; AT, for example, idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia; Thyroiditis, for example, Graves disease, struma lymphomatosa, adolescency lymphocytic thyroiditis, atrophic thyroiditis; Diabetes, immune-mediated ephrosis, for example, glomerulonephritis, uriniferous tubules interstitial nephritis; The demyelination of maincenter and peripheral nervous system is such as multiple sclerosis, spontaneous polyneuropathy; Hepatic duct disease such as infectious hepatitis (having a liking for the hepatitis that liver venereal disease poison causes) as first type, B-mode, third type, fourth type and hepatitis E and other are non-; ACAH; Primary biliary cirrhosis; Granulomatous hepatitis; And sclerosing cholangitis; Inflammatory and fibrotic lung disease (for example, cystic fibrosis); Seitan-susceptibility enteropathy; Whipple's disease; The tetter of autoimmunization or immunity-mediation comprises the bleb dermatosis, erythema multiforme and contact dermatitis, psoriasis; Lung's anaphylactic disease is such as the eosinophilic granulocyte pneumonia, and the special property sent out lung fibrosis and hypersensitivity pneumonia are transplanted diseases related transplant rejection and the graft versus host disease of comprising.
13. the method for claim 12, wherein said inflammatory diseases is a rheumatoid arthritis.
14. the method for claim 12 or 13, wherein said Mammals is the people.
15. the method for diagnosis Mammals inflammatory diseases, described method comprises, in (a) specimen available from described mammiferous cell, and in the known Normocellular control sample of (b) same cell type, detect coding STIgMA, PRO301, the expression of gene level of PRO362 or PRO245 polypeptide, when the expression level of wherein said gene in specimen was higher than level in control sample, there was immune correlated disease in prompting as the Mammals in the histiocytic source of being tested.
16. the method for claim 15, wherein (1) described STIgMA polypeptide is selected from SEQ ID NOS:2,32,33, with polypeptide shown in 34, (2) described PRO301 polypeptide comprises sequence SEQ ID NO:1, and (3) described PRO362 polypeptide comprises sequence SEQ ID NO:2, or (4) described PRO245 polypeptide comprises sequence SEQ ID NO:9.
17. the method for inflammatory diseases in the diagnosis Mammals, described method comprises, (a) will resist-STIgMA, anti--PRO301, anti--PRO362 or anti--PRO245 antibody contact with specimen available from described mammiferous cell, and (b) STIgMA in the described antibody of detection and the described specimen, PRO301, whether PRO362 or PRO245 polypeptide form mixture, wherein form described mixture and point out in the described Mammals and have inflammatory diseases.
18. detect the method for the existence of tumour in the Mammals, described method comprises, in (a) specimen available from described mammiferous cell, and in the known Normocellular control sample of (b) same cell type, the STIgMA that relatively encodes, PRO301, the expression of gene level of PRO362 or PRO245 polypeptide, when the expression level of wherein said polypeptide in specimen is higher than level in control sample, point out described Mammals to have tumour.
19. the method for tumour in the diagnosis Mammals, described method comprises, (a) will be selected from anti--PRO301 antibody, anti--PRO362 antibody, anti--PRO245 antibody contacts with the specimen available from described mammiferous cell with the anti--antibody of PRO1868 antibody, and (b) detect described anti--PRO301 antibody, anti--PRO362 antibody, anti--PRO245 antibody or anti--PRO1868 antibody respectively with described specimen in PRO301, PRO362, whether PRO245 or PRO1868 polypeptide form mixture, wherein form mixture and point out in the described Mammals and have tumour.
20. the method for claim 19, wherein said specimen has the tumorigenesis sexual cell to grow or outgrowth Mammals available from doubtful.
21. the method for claim 20, doubtful growth of tumorigenesis sexual cell or the hyperplasia that has and be selected from the disease-related of colorectal carcinoma, carcinoma of testis, lung's cancer and mammary cancer of wherein said Mammals.
22. the method for bone and/or cartilage relative disease in the treatment Mammals comprises the PRO1868 agonist to described administration treatment significant quantity.
23. isolated antibody, its specificity be in conjunction with STIgMA, PRO301, PRO362, PRO245 or PRO1868 polypeptide.
24. the antibody of claim 23, wherein (1) described STIgMA polypeptide is selected from SEQ ID NOS:2,32,33, with polypeptide shown in 34, and (2) described PRO301 polypeptide comprises sequence SEQ ID NO:1, and (3) described PRO362 polypeptide comprises sequence SEQ ID NO:2, or (4) described PRO245 polypeptide comprises sequence SEQ ID NO:9.
25. the antibody of claim 23 or 24, it is a monoclonal antibody.
26. the antibody of claim 25, it comprises non--people's complementary determining region (CDR) residue and comprises people's framework region (FR) residue.
27. the antibody of claim 26, it has mark.
28. the antibody of claim 27, it is fixed on the solid support.
29. the antibody of claim 23 or 24, it is antibody fragment, single-chain antibody or anti--idiotype antibody.
30. composition, the antibody and this antibody that comprise claim 29 mix with pharmaceutically acceptable carrier.
31. the composition of claim 30 also comprises second kind of antibody or cellulotoxic preparation or chemotherapeutics.
32. isolated nucleic acid molecule, it comprises the nucleotide sequence of coded polypeptide, the amino acid 21-276 of described polypeptide and SEQ ID NO:32, or the amino acid 21-182 of SEQ ID NO:33, the amino acid 21-180 of SEQID NO:34, or aminoacid sequence shown in the amino acid/11-310 of SEQ ID NO:31 has the sequence identity at least about 80%.
33. the isolated nucleic acid molecule of claim 32, wherein said sequence identity is at least about 85%.
34. isolated nucleic acid molecule, it comprises the DNA:(a that has at least 80% sequence identity with following dna molecular) dna molecular of coding PRO1868 polypeptide, described polypeptide comprises sequence shown in the amino-acid residue 1-310 of Figure 22 (SEQID NO:31), or (b) complement of dna molecular (a).
35. the isolated nucleic acid molecule of claim 34, it comprises the dna molecular of coding PRO1868 polypeptide, and described polypeptide comprises sequence shown in the amino-acid residue 1-310 of Figure 22 (SEQ ID NO:31).
36. the complete encoding sequence of cDNA has at least 80% nucleotide sequence identity shown in the isolated nucleic acid molecule, itself and ATCC preserving number 203553.
37. isolated nucleic acid molecule comprises the nucleotide sequence of coded polypeptide, described polypeptide is selected from the amino acid 21-399 of SEQ ID NO:32, the amino acid 21-305 of SEQ ID NO:33 and the amino acid 21-280 of SEQID NO:34.
38. carrier comprises the nucleic acid of one of claim 32-37.
39. the carrier of claim 38 can be operated with control sequence and to link to each other, described control sequence is by this carrier transformed host cells identification.
40. host cell comprises the carrier of claim 38 or 39.
41. the host cell of claim 40, described host cell is selected from Chinese hamster ovary celI, intestinal bacteria, the insect cell of yeast cell and baculovirus infection.
42. prepare the method for PRO1868 polypeptide, be included in the host cell of cultivating claim 41 under the condition that is suitable for described expression of polypeptides, and reclaim described polypeptide from cell culture.
43. isolated polypeptide, comprise the aminoacid sequence that is selected from down group: the amino acid 21-276 of SEQ ID NO:32, the amino acid 21-182 of SEQ ID NO:33, the amino acid 21-180 of SEQ ID NO:34, amino acid/11-the X of the amino acid/11-310 of SEQ ID NO:31 and SEQ ID NO:31 and X are one of amino acid 237-247.
44. the coded aminoacid sequence of the complete encoding sequence of cDNA shown in the isolated polypeptide, itself and ATCC preserving number 203553 has at least 80% amino acid sequence identity.
45. chimeric molecule comprises polypeptide and this polypeptide and the fusion of allogeneic amino acid sequence of claim 43 or 44.
46. the chimeric molecule of claim 45, wherein said allogeneic amino acid sequence is epi-position label or immunoglobulin fc region.
47. immunoadhesin, comprise the following sequence that merges with the constant region for immunoglobulin sequence: the amino acid/11 of SEQ ID NO:32 or about 21-about 276, or the amino acid/11 of SEQ ID NO:33 or about 21-are about 182, or the amino acid/11 of SEQ ID NO:34 or about 21-about 180.
48. the immunoadhesin of claim 47, wherein said constant region sequence is the immunoglobulin heavy chain constant region sequence.
49. isolated antibody, its specificity is in conjunction with the polypeptide of claim 43 or 44.
50. the isolated antibody of claim 49, described antibodies specific be in conjunction with described polypeptide, or specificity is in conjunction with the epi-position on the described polypeptide, but not substantive in conjunction with any other polypeptide or polypeptide epitope.
51. the isolated antibody of claim 50 is monoclonal antibody, humanized antibody or single-chain antibody.
CN 200380105090 2002-10-03 2003-10-01 Use of A33 antigens and JAM-IT Pending CN1720336A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US10/265,542 US20030171568A1 (en) 1998-09-16 2002-10-03 Use of A33 antigens and JAM-IT
US10/265,542 2002-10-03
US10/633,008 2003-07-31

Publications (1)

Publication Number Publication Date
CN1720336A true CN1720336A (en) 2006-01-11

Family

ID=35931721

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 200380105090 Pending CN1720336A (en) 2002-10-03 2003-10-01 Use of A33 antigens and JAM-IT

Country Status (2)

Country Link
CN (1) CN1720336A (en)
ZA (1) ZA200502502B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102643785A (en) * 2012-04-23 2012-08-22 浙江峰盛生物工程有限公司 Method for targeted inhibition of infiltration and transfer of glioma cells and application of method
CN110082533A (en) * 2008-04-09 2019-08-02 健泰科生物技术公司 The new compositions and method for the treatment of for immune correlated disease

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110082533A (en) * 2008-04-09 2019-08-02 健泰科生物技术公司 The new compositions and method for the treatment of for immune correlated disease
US11390678B2 (en) 2008-04-09 2022-07-19 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
CN102643785A (en) * 2012-04-23 2012-08-22 浙江峰盛生物工程有限公司 Method for targeted inhibition of infiltration and transfer of glioma cells and application of method

Also Published As

Publication number Publication date
ZA200502502B (en) 2006-10-25

Similar Documents

Publication Publication Date Title
KR101855381B1 (en) Novel compositions and methods for the treatment of immune related diseases
US7741056B2 (en) Use of A33 antigens and JAM-IT
CN1777621A (en) Antibodies against human il-21 receptor and applications therefor
JP2008519599A (en) Novel compositions and methods for the treatment of immune related diseases
JP3950097B2 (en) A-33 related antigens and their pharmacological uses
JP2006501862A5 (en)
JP2007525416A5 (en)
CN113412130A (en) Identification and targeting of pro-tumor cancer-associated fibroblasts for diagnosis and treatment of cancer and other diseases
CN1720336A (en) Use of A33 antigens and JAM-IT
US20030171568A1 (en) Use of A33 antigens and JAM-IT

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C12 Rejection of a patent application after its publication
RJ01 Rejection of invention patent application after publication

Open date: 20060111