CN1705740B - Adenovirus expressing genes in reverse order and use thereof - Google Patents

Abstract

The invention relates to an adenovirus expressing a first protein which is selected among the group comprising an E1B protein and an E4 protein prior to a second protein that is selected among the group comprising an E1A protein.

Description

Adenovirus and application thereof with expressing genes in reverse

The present invention relates to adenovirus, encode their nucleic acid and application thereof, particularly be used for the treatment of the application of the medicine of tumour in preparation.

Currently utilize many treatment principles in the tumour in treatment.Except using surgical operation, chemotherapy and radiotherapy are dominant.Yet all these technology are all with sizable side effect.Duplicate the new platform that the optionally application of oncolytic virus provides the treatment tumour.Correspondingly, cause in the optionally tumour of viral agent and duplicate, cause virus replication, be subjected to the diffusion of the cracking of transfected tumor cell and virus to adjacent tumor cells.Because the virus replication ability is limited to tumour cell, healthy tissues avoids virus replication and therefore avoids virolysis.

At present, several viral systems are carried out purpose and be the clinical trial of tumour cracked.An example of this adenovirus is dl1520 (Onyx-015), and it successfully has been used for the I phase and the II phase clinical (Khuri, Nature Medicine 6 such as F., 879-885,2000).Onyx-015 is a kind of adenovirus that lacks the E1B-55kDa gene fully that has.The proteic disappearance fully of the E1B-55kDa of adenovirus is based on a discovery, and the adenovirus carrier that promptly has a p53 disappearance may cause duplicating and therefore cracking (Kirn, the D. etc. of cell, Proc.Am.Soc.Clin.Oncol.17,391a, 1998), wherein normal cell preserves from.More specifically, the E1B-55kDa gene product participates in the inhibition of p53, and the transhipment of virus mRNA and host cell proteins synthetic cut off.The inhibition of p53 is by taking place by the proteic mixture of E1B-55kDa of p53 and adenovirus coding and/or by the forming of mixture of E1B-55kDa and E4orf6.By the p53 of TP53 coding is the starting point (Zambetti, G.P. etc., FASEB J.7,855-865,1993) of mixture regulation mechanism, and it suppresses the cellular replication of viral (as adenovirus) especially effectively.Gene TP53 lacks in about 50% everyone tumour or suddenlys change, and causes the apoptotic shortage of expectation that caused by chemotherapy or radiotherapy, causes common unsuccessful oncotherapy.

Another principle of cracking tumour (tumorlytic) adenovirus is based on a discovery, if promptly E1A albumen exists with specific disappearance form or comprises one or more sudden changes and do not influence the combination of Rb/E2F and/or p107/E2F and/or p130/E2F, this adenovirus not cell of inductive infection enters the S phase, and can duplicate in not containing the proteic tumour cell of functional Rb.In addition, E1A albumen can comprise one or more sudden changes at the N-terminal deletion with on the amino acid region of the proteic 1-76 of E1A respectively, so that suppress combining and so being provided at copy choice in the tumour cell of E1A and p300.These methods are described in the mode that exemplifies in European patent EP 0 931 830.These viral examples are Ad Δs 24, dl922-947, E1Ad/01/07 and CB016 (Howe, J.A. etc., Molecular Therapy 2,485-495,2000; Fueyo, J. etc., Oncogene 19,2-12,2000; Heise, C. etc., Nature Medicine 6,11341139,2001; Balague, C. etc., J.Virol.75,7602-7611,2001).Therefore these adenovirus systems that become known for oncolysis in the prior art comprise disappearances different in the E1A albumen, wherein under following hypothesis, made these disappearances: functional Rb albumen and can block respectively in the effective body by the mixture that the Rb albumen and the E2F of non-activity forms and to duplicate, so that adenovirus only carries out duplicating in the body in Rb-feminine gender/mutant cell.These adenovirus systems according to prior art are based on E1A, so that by duplicating in early stage E2 promotor (English is E2 early promoter) and free E2F (Dyson, N.Genes﹠Development, 12,2245-2262, the 1998) control volume.

The another kind of form of cracking tumour adenovirus system is based on the use to selective actuation of specific expressed viral oncogene E1A, it is provided at copy choice (Rodriguez, R. etc., Cancer Res.57 in the tumour cell, 2559-2563,1997).

As mentioned above, the cell background of selecting to be suitable for the principle of each binding mode is important for the various principles of adenovirus tumour lytic virus.In other words, have only when being familiar with different molecular biology prerequisites, could use current known various adenovirus systems.This has limited these system applies in different patient groups.

In case the patient produces so-called multi-medicine resistance (English is multidrug resistance (MDR)), a specific question can appear during the treatment neoplastic disease, resistance (Gottesman and the Pastan of a kind of tumour cell growth inhibitor of studying detailedly especially (cytostatics) of this multi-medicine resistance representative, Annu.Rev.Biochem.62,385-427,1993).It is based on the overexpression of film binding transport albumen P-glycoprotein, and this albumen belongs to so-called abc transport albumen (JBC 276 for Stein, U. etc., 28562-69,2001, J.Wijnholds, Novartis Found Symp., 243,69-79,2002).Bargou, R.C. etc. and Oda, (Bargou, R.C. etc., Nature Medicine 3,447-450,1997 such as Y.; Clin.CancerRes.4,2273-2277,1998) can prove that human transcription factor YB-1 appraises and decides the activation that the position is participated in the P-P-glycoprotein expression directly.Studies confirm that further YB-1 is by administration (Koike, K. etc., the FEBS Lett 17 of various stress conditions such as UV irradiation, cytostatic agent, 390-394,1997) and overheated (Stein, U. etc., JBC 276,28562-69,2001) and be transported in the nuclear.Studies confirm that further the position of appraising and deciding of YB-1 has influence to another abc transport albumen.This abc transport albumen is called MRP (English is multidrug resistance-related protein, multiple medicine resistance-associated protein), and participates in forming the dependent multiple medicine resistance (Stein of the non-P-glycoprotein of so-called atypia, U. etc., JBC 276,28562-69,2001).

The problem that the present invention solves is, a kind of technology instruction and particularly a kind of method are provided, and it allows to use particularly cracking tumor promotion agent treatment organism, more specifically treats human organism and one group of patient respectively.Another problem that the present invention solves is, provides to be suitable for causing tumour cracked method in the patient, and described patient suffers from the neoplastic disease of anti-cell growth inhibitor, particularly has those of multi-medicine resistance.At last, a problem of the present invention's solution is that a kind of adenovirus that is suitable for lysis is provided.

The first aspect of the problem that the present invention solves is to be selected from first kind of proteic adenovirus solution comprising proteic group of E1B albumen and E4 by expressing before expression is selected from the second kind of albumen that comprises proteic group of E1A-.

In one embodiment, first kind of albumen is E1B albumen, preferred E1B55kd albumen.

In another embodiment, first kind of albumen is E4 albumen, preferred E4orf6 albumen.

In a preferred embodiment, first kind of albumen is E1B albumen and the proteic combination of E4, preferred E1B55kD albumen and the proteic combination of E4orf6.

In a preferred embodiment, E1A albumen is E1A12S albumen.

The second aspect of the problem that the present invention solves solves by adenovirus, wherein said adenovirus comprises at least a coding and is selected from the proteic nucleic acid that comprises proteic group of E1B albumen, E4 albumen and E1A, wherein at least a albumen is under the control of promotor, and described promotor is different with the promotor of control protein expression in wild-type adenovirus.

In an embodiment of second aspect, adenovirus is an adenovirus according to a first aspect of the invention.

In an embodiment of second aspect, at least a albumen is E1B albumen, preferred E1B55kD albumen.

In an embodiment of second aspect, at least a albumen is E4 albumen, preferred E4orf6 albumen.

In an embodiment of second aspect, at least a albumen is E1A albumen, preferred E1A12S albumen.

In an embodiment preferred of second aspect, at least a albumen is E1B albumen and the proteic combination of E4, preferred E1B55kD albumen and the proteic combination of E4orf6.

In an embodiment of second aspect, at least a albumen is E1B albumen and the proteic combination of E1A, preferred E1B55kD albumen and the proteic combination of E1A12S.

In an embodiment preferred of second aspect, at least a albumen is E4 albumen and the proteic combination of E1A, preferred E4orf6 albumen and the proteic combination of E1A12S.

In an embodiment of second aspect, at least a albumen is E1B albumen, E4 albumen and the proteic combination of E1A, preferred E1B55kD albumen, E4orf6 albumen and the proteic combination of E1A12S.

In an embodiment of second aspect, the proteic expression of E1B is controlled by promotor, wherein said promotor is selected from the group of the promotor that comprises tumour-specific, organ specific promotor, tissue-specific promotor, allogeneic promoter and adenovirus promoter, and wherein said adenovirus promoter is different with the E1B promotor.

In an embodiment of second aspect, the proteic expression of E4 is controlled by promotor, wherein said promotor is selected from the group of the promotor that comprises tumour-specific, organ specific promotor, tissue-specific promotor, allogeneic promoter and adenovirus promoter, and wherein said adenovirus promoter is different with the E4 promotor.

In the preferred embodiment aspect second, the promotor of adenovirus is the E1A promotor.

In the embodiment aspect second, the E1A protein expression is controlled by promotor, wherein said promotor is selected from and comprises following group: the promotor of tumour-specificity promoter, organ-specificity promoter, tissue-specificity promoter, allogeneic promoter and adenovirus, wherein the promotor of adenovirus is different from the E1A promotor.

In an embodiment preferred of second aspect, the proteic expression promoter of control E1A is YB-1 control, or can regulate and control by YB-1.

In an embodiment preferred of second aspect, the proteic expression promoter of control E1A is adenovirus 2 late promoters.

In the embodiment aspect first and second, E4 albumen, preferably E4orf6 albumen and E1B albumen, preferably E1B55kd albumen under the control of identical or common promotor.

The third aspect of the problem that the present invention solves solves by adenovirus, wherein said adenovirus provides YB-1 by at least a adenovirus protein in nuclear, perhaps the supply of the YB-1 in the nuclear is by at least a adenovirus protein mediation, and wherein said adenovirus protein is preferably different with E1A.

In an embodiment of the third aspect, this adenovirus is according to the present invention first and/or the adenovirus of second aspect.

The fourth aspect of the problem that the present invention solves solves by adenovirus, wherein said adenovirus provides YB-1 by at least a adenovirus protein for duplicating of adenovirus, the providing of the YB-1 that duplicates of adenovirus perhaps is provided by the mediation of at least a adenovirus protein, and wherein said adenovirus protein is preferably different with E1A.

In an embodiment of fourth aspect, this adenovirus is according to the present invention first and/or second and/or the adenovirus of the third aspect.

In the embodiment aspect third and fourth, adenovirus protein is the mixture of E4orf6 and E1B55kd.

The 5th aspect of the problem that the present invention solves solves by adenovirus, and the nucleic acid of wherein said adenovirus comprises the adenovirus zone of non-activity at least one function, and wherein said zone is selected from the group that comprises E1 district, E3 district, E4 district and combination thereof.

In the embodiment aspect the 5th, described adenovirus is the adenovirus according to first and/or second and/or the 3rd and/or the 4th aspect of the present invention.

In the embodiment aspect the 5th, this district is the E1 district.

In the embodiment aspect the 5th, this district is the E3 district.

In the embodiment aspect the 5th, this district is the E4 district.

In the embodiment aspect the 5th, this district comprises E1 district, E3 district and E4 district.

The 6th aspect of the problem that the present invention solves solves by adenovirus, wherein said adenovirus comprises at least one expression cassette, wherein said expression cassette comprises at least one promotor and the proteic nucleic acid of encoding adenovirus, wherein said adenovirus protein is an E1B albumen, preferred E1B55kD albumen.

In the embodiment aspect the 6th, this adenovirus is the adenovirus of the first and/or second and/or the 3rd and/or the 4th and/or the 5th aspect according to the present invention.

In the embodiment aspect the 6th, this promotor is different with the E1B promotor.

In the embodiment aspect the 6th, this promotor is the group that is selected from the promotor that comprises tumour-specific, organ specific promotor, tissue-specific promotor, allogeneic promoter and adenovirus promoter, and wherein said promotor is different with the E1B promotor.

The 7th aspect of the problem that the present invention solves solves by adenovirus, wherein said adenovirus comprises at least one expression cassette, wherein said expression cassette comprises at least one promotor and the proteic nucleic acid of encoding adenovirus, wherein said adenovirus protein is an E4 albumen, preferred E4orf6 albumen.

In the embodiment aspect the 7th, described adenovirus is the adenovirus according to first and/or second and/or the 3rd and/or the 4th and/or the 5th and/or the 6th aspect of the present invention.

In the embodiment aspect the 7th, this promotor is different with the E4 promotor.

In the embodiment aspect the 7th, this promotor is selected from the group of the promotor that comprises tumour-specific, organ specific promotor, tissue-specific promotor, allogeneic promoter and adenovirus promoter, and wherein adenovirus promoter is different with the E4 promotor.

In the embodiment aspect the 7th, this promotor is the E1A promotor.

The eight aspect of the problem that the present invention solves solves by adenovirus, wherein said adenovirus comprises at least one expression cassette, wherein said expression cassette comprises at least one promotor and the proteic nucleic acid of encoding adenovirus, wherein said adenovirus protein is an E1A albumen, preferred E1A12S albumen.

In an embodiment of eight aspect, this adenovirus is the adenovirus of the first and/or second and/or the 3rd and/or the 4th and/or the 5th and/or the 6th and/or the 7th aspect according to the present invention.

In an embodiment of eight aspect, this promotor is different with the E1A promotor.

In an embodiment of eight aspect, this promotor is selected from the group of the promotor that comprises tumour-specific, organ specific promotor, tissue-specific promotor, allogeneic promoter and adenovirus promoter.

First and/or second and/or the 3rd and/or the 4th and/or the 5th and/or the 6th and/or the 7th and/or an embodiment of eight aspect in, this adenovirus comprises nucleic acid, wherein said nucleic acid encoding YB-1.

In an embodiment preferred of eight aspect, the nucleic acid of coding YB-1 is under the control of promotor, and wherein said promotor is the E2 late promoter preferably.

In an embodiment of eight aspect, the nucleic acid of coding YB-1 is under the control of promotor, and wherein said promotor is respectively the dependent and YB-1 control of YB-1.

In an embodiment of eight aspect, the nucleic acid of coding YB-1 is the part of expression cassette, and described expression cassette comprises the proteic nucleic acid of coding E1A, the proteic nucleic acid of optimized encoding E1A12S.

In an embodiment of eight aspect, the proteic nucleic acid of coding E1A is to go out by the separate nucleic acid of IRES sequence from coding YB-1.

The 6th and/or the 7th and/or an embodiment of eight aspect in, coding E4 albumen, the preferred proteic nucleic acid of E4orf6 and coding E1B albumen, the preferred proteic nucleic acid of E1B55kD are included in the expression cassette, and wherein two encoding sequences preferably by the IRES sequence separately.

In an embodiment preferred of eight aspect, the promotor of expression cassette is selected from the group of the promotor that comprises tumour-specific, organ specific promotor, tissue-specific promotor, allogeneic promoter and adenovirus promoter, wherein adenovirus promoter is different with the E4 promotor, also different with the E1B promotor, preferably different, also different with wild-type E1B promotor with wild-type E4 promotor.

First and/or second and/or the 3rd and/or the 4th and/or the 5th and/or the 6th and/or the 7th and/or an embodiment of eight aspect in, this adenovirus comprises an expression cassette, it comprises a promotor and one section nucleotide sequence, and wherein said nucleotide sequence is selected from the group that comprises fit (aptamer), ribozyme, suitable enzyme (aptazyme), antisense molecule and siRNA.

First and/or second and/or the 3rd and/or the 4th and/or the 5th and/or the 6th and/or the 7th and/or an embodiment of eight aspect in, this adenovirus comprises an expression cassette, it comprises a promotor and one section nucleotide sequence, wherein said nucleotide sequence is a coding nucleic acid, and the molecule of wherein said nucleic acid encoding is selected from the group that comprises peptide, polypeptide, albumen, anti-caline, antibody and antibody fragment.

First and/or second and/or the 3rd and/or the 4th and/or the 5th and/or the 6th and/or the 7th and/or an embodiment of eight aspect in, this adenovirus comprises an expression cassette, wherein said expression cassette comprises a promotor and a nucleotide sequence, and wherein said nucleotide sequence is selected from the group that comprises apoptosis-inducing gene, prodrug gene, proteinase inhibitor, tumor inhibitor gene, cytokine and angiogenesis inhibitor.

First and/or second and/or the 3rd and/or the 4th and/or the 5th and/or the 6th and/or the 7th and/or an embodiment of eight aspect in, this adenovirus is a recombinant adenovirus.

First and/or second and/or the 3rd and/or the 4th and/or the 5th and/or the 6th and/or the 7th and/or an embodiment of eight aspect in, this adenovirus is an adenoviral mutants.

First and/or second and/or the 3rd and/or the 4th and/or the 5th and/or the 6th and/or the 7th and/or an embodiment of eight aspect in, this adenovirus is a replication defect type.

First and/or second and/or the 3rd and/or the 4th and/or the 5th and/or the 6th and/or the 7th and/or an embodiment of eight aspect in, this adenovirus can be duplicated in cell, described cell contains the YB-1 that regulates or contain YB-1 in nuclear.

First and/or second and/or the 3rd and/or the 4th and/or the 5th and/or the 6th and/or the 7th and/or an embodiment of eight aspect in, this cell contains YB-1 in being independent of the nuclear of cell cycle.

First and/or second and/or the 3rd and/or the 4th and/or the 5th and/or the 6th and/or the 7th and/or an embodiment of eight aspect in, this adenovirus does not comprise any E1A13S albumen and/or this adenovirus does not comprise the proteic nucleic acid of any coding E1A13S.

The 9th aspect of the problem that the present invention solves is to solve by first each the nucleic acid of adenovirus to the eight aspect of encoding.

The tenth aspect of the problem that the present invention solves solves by dubbing system, described dubbing system comprise according to the 9th aspect nucleic acid and the nucleic acid of helper virus, the nucleic acid of wherein said helper virus comprises one or more according to first each the expression cassette of adenovirus to eight aspect.

In the embodiment aspect the tenth, this adenovirus or its nucleic acid of encoding lack the expression cassette that is included in the helper virus.

The tenth of the problem that the present invention solves solves by carrier on the one hand, and described carrier comprises according to the nucleic acid of the 9th aspect and/or according to the dubbing system of the tenth aspect.

In an embodiment of the tenth one side, this carrier is an expression vector.

The 12 aspect of the problem that the present invention solves solves by the adenovirus cell, described adenovirus cell comprise according to first to eight aspect each adenovirus and/or according to the nucleic acid of the 9th aspect and/or according to the dubbing system of the tenth aspect and/or according to the tenth on the one hand carrier.

In the embodiment aspect the 12, this cell is an eukaryotic cell, preferred zooblast, more preferably mammalian cell.

In the embodiment preferred aspect the 12, mammalian cell is the cell that is selected from the group of the cell that comprises mouse, rat, cavy, pig, sheep, goat, ox, horse, dog, cat and people.

The 13 aspect of the problem that the present invention solves solves by organism, preferred mammal organism, described organism comprise according to first the adenovirus to eight aspect, according to the nucleic acid of the 9th aspect, according to the dubbing system of the tenth aspect, according to the tenth on the one hand carrier or according to the cell of the 12 aspect, wherein said organism preferably is selected from the group that comprises mouse, rat, cavy, pig, sheep, goat, ox, horse, dog and cat.

The 14 aspect of the problem that the present invention solves solves by following manner: according to first to eight aspect each adenovirus, according to the nucleic acid of the 9th aspect, according to the dubbing system of the tenth aspect, according to the carrier of the tenth one side or according to the cell of the 12 aspect duplicate adenovirus, the application in the adenovirus is duplicated in the preferred body other places.

The 15 aspect of the problem that the present invention solves solves by following manner: according to first to eight aspect each adenovirus, according to the nucleic acid of the 9th aspect, according to the dubbing system of the tenth aspect, according to the tenth on the one hand carrier or according to the application of cell in production adenovirus, the nonlocal production adenovirus of preferred body of the 12 aspect.

The 16 aspect of the problem that the present invention solves solves by following manner: according to first to eight aspect each adenovirus, according to the nucleic acid of the 9th aspect, according to the dubbing system of the tenth aspect, according to the carrier of the tenth one side or according to the application of cell in expressing gene of the 12 aspect, preferred described gene promotes lysis, the preferably lysis in the adenoviral replication process, and/or promote adenovirus mediated lysis.

In the embodiment aspect the 16, the gene of expression is a transgenosis disclosed herein.

The 17 aspect of the problem that the present invention solves solves by following manner: according to first to eight aspect each adenovirus, according to the nucleic acid of the 9th aspect, according to the dubbing system of the tenth aspect, according to the tenth on the one hand carrier or according to the application of cell in preparing medicine of the 12 aspect.

In the embodiment aspect the 14 to 17, the cell that adenovirus is duplicated therein contains YB-1 in its nuclear, preferably contain YB-1 in it is independent of the nuclear of cell cycle.

In the embodiment aspect the 14 to 17, the cell that adenovirus is duplicated therein comprises the YB-1 that regulates.

In the embodiment of the application aspect the 17, this medicine is used for the treatment of neoplastic disease.

In the embodiment preferred of the application aspect the 17, this neoplastic disease is selected from the group that comprises malignant diseases, cancer, carcinous disease and tumour.

In the embodiment of the application aspect the 17, this neoplastic disease is selected from the group that comprises solid tumor, non-solid tumor, malignant tumor and innocent tumor.

In the embodiment of the application aspect the 17, the cell that at least a portion forms tumour has YB-1 in nuclear, preferably have YB-1 in being independent of the nuclear of cell cycle.

In the embodiment of the application aspect the 17, the cell that at least a portion forms tumour comprises the YB-1 that regulates.

In the embodiment of the application aspect the 17, the cell that at least a portion forms tumour is Rb male or Rb feminine gender.

In the embodiment of the application aspect the 17, the cell of at least a portion formation tumour has the resistance to forms of pharmacologically active agents, preferred multiple resistance.

In the embodiment of the application aspect the 17, this resistance is multiple resistance.

In the embodiment of the application aspect the 17, this resistance is to antitumour drug, the preferred cell inhibitor, and/or this resistance is caused by irradiation.

In the embodiment of the application aspect the 17, the target patient of medicine comprises many cells, and wherein said cell is at the cell described in each embodiment of according to a seventeenth aspect of the invention application.

In the embodiment of the application aspect the 17, this medicine comprises at least a other forms of pharmacologically active agents.

In the embodiment of the application aspect the 17, this medicine is used with a kind of other forms of pharmacologically active agents, or should be like this.

In the embodiment of the application aspect the 17, other forms of pharmacologically active agents is selected from the group that comprises cytokine, inhibitors of metalloproteinase, angiogenesis inhibitor, cytostatics, tyrosine kinase inhibitor and cell cycle inhibitor.

In the embodiment of the application aspect the 17, this medicine is before irradiation, in the process or uses afterwards.

In the embodiment of the application aspect the 17, the purpose of using of this irradiation is the treatment tumour.

In the embodiment of the application aspect the 17, cell or the organism that treat are taken measures, wherein said measure is selected from the group that comprises irradiation, dosed cells inhibitor and hyperthermy.

In the embodiment of the application aspect the 17, this measure is to use partly or capapie.

In the embodiment of the application aspect the 17, this irradiation uses high-energy irradiation, the preferred any irradiation that uses in the treatment neoplastic disease that uses.

The tenth eight aspect of the problem that the present invention solves solves by following manner: according to first each the adenovirus to eight aspect, nucleic acid according to the 9th aspect, dubbing system according to the tenth aspect, according to the tenth on the one hand carrier or be used for the treatment of application in the medicine of neoplastic disease according to the cell of the 12 aspect in preparation, it is characterized in that, this neoplastic disease is selected from and comprises mastadenoma, osteoma, the stomach knurl, enteroncus, cholecystoncus, Vipoma, liver tumor, tumor of kidney, brain tumor, ovarian tumor, skin tumour, the tumour of cutaneous appendage, head and neck cancer, hysteroma, close plethora, laryngeal tumor, the oesophagus knurl, the tongue knurl, the group of prostate tumor, a kind of each the described feature that has in the aforementioned claim in the preferably aforementioned neoplastic disease.

The 19 aspect of the problem that the present invention solves solves by following manner: according to first to eight aspect each adenovirus, according to the nucleic acid of the 9th aspect, according to the dubbing system of the tenth aspect, be used for the treatment of application in the medicine of neoplastic disease in preparation according to the carrier of the tenth one side or according to the cell of the 12 aspect, the promotor of wherein said tumour-specific is the promotor of the tumour-specific that will use this medicine.

The 20 aspect of the problem that the present invention solves solves by a kind of pharmaceutical composition, it comprise according to first to eight aspect each adenovirus, according to the nucleic acid of the 9th aspect, according to the dubbing system of the tenth aspect, according to the tenth on the one hand carrier or according to the cell and the optional pharmaceutical carrier of the 12 aspect.

In aspect the 21, problem of the present invention is by virus, preferably adenovirus preparation in the medicine application and solved, wherein said virus does not comprise in the normal cell of YB-1 respectively in nucleus, in being independent of the nucleus of cell cycle, do not comprise in the cell of YB-1, with in the cell that does not comprise the YB-1 that regulates, be replication defective, and described encoding viral oncogene or oncoprotein, virogene of trans-activation at least in YB-1 nucleus positive cell particularly, the oncogene protein of preferred adenoviral gene, wherein said gene is selected from and comprises E1B55kDa, E4orf6, the group of E4orf3 and E3ADP.Preferably, described expressing viral virus protein E1B55kD, it also is expressed as E1B55kDa and E4orf6 at this paper.

In aspect the 22, problem of the present invention is by virus, the preferably adenovirus application of in cell, duplicating and being solved, described cell comprises YB-1 in nucleus, wherein said virus does not comprise in the cell of YB-1 in nucleus, or in being independent of the nucleus of cell cycle, do not comprise in the cell of YB-1, or in not comprising any cell that removes the YB-1 that regulates, be replication defective, wherein said encoding viral oncogene or oncoprotein, at least one virogene of trans-activation particularly, the oncogene protein of preferred adenoviral gene, wherein said gene is selected from and comprises E1B55kDa, E4orf6, the group of E4orf3 and E3ADP.

According to the of the present invention the 21 and the 22 aspect in the embodiment using, virus, particularly adenovirus is duplicated in cell, described cell comprises YB-1 or do not comprise YB-1 in being independent of the nucleus of cell cycle in nucleus, or does not comprise any YB-1 of regulating of going.

According to the of the present invention the 21 and the 22 aspect in another embodiment of using, viral oncogene protein is that E1A and/or oncogene are that gene and/or the oncogene protein of coding E1A is E1A.

In a preferred embodiment, the Rb tumor suppressor gene product of viral oncogene protein E1A energy combined function.

In an alternate embodiment, the Rb tumor suppressor gene product that viral oncogene protein E1A can not combined function.

According to the of the present invention the 21 and the 22 aspect in another embodiment of using, viral oncogene protein E1A does not induce the nucleus location of YB-1.

According to the of the present invention the 21 and the 22 aspect in another embodiment of using, medicine is that to be applied to cell be the Rb positive or Rb negative patients.

In a preferred embodiment, described cell is the cell that those participations are formed by the illness of described drug influence.

According to the of the present invention the 21 and the 22 aspect in another embodiment of using, described cell is Rb feminine gender or YB-1 male in nucleus, particularly is the YB-1 positive in being independent of the nucleus of cell cycle.

According to the of the present invention the 21 and the 22 aspect in another embodiment of using, described medicine is used for treating tumour.

According to the of the present invention the 21 and the 22 aspect in another embodiment of using, described cell, particularly form the cell of tumour or its part, be resistive, particularly medicine had multiple resistance, described medicine is antineoplastic agent preferably, more preferably is cytostatics.

According to the of the present invention the 21 and the 22 aspect in the preferred embodiment using, cell expressing, preferably overexpression film binding transport protein P-glycoprotein and/or MRP.

According to the of the present invention the 21 and the 22 aspect in another embodiment of using, cell is the p53 positive or p53 feminine gender.

According to the of the present invention the 21 and the 22 aspect in the embodiment using, E1A compares with the wild-type oncogene protein, oncogene protein comprises one or several sudden change or disappearance, and wherein said disappearance preferably is selected from those in disappearance that comprises the CR3 district and the group that the N end lacks and the C end lacks.Be intended to E1A oncogene protein mass-energy in conjunction with Rb.

According to the of the present invention the 21 and the 22 aspect in another embodiment of using, compare with the wild-type oncogene protein, oncogene protein comprises one or several sudden change or disappearance, and wherein said disappearance is in CR1 district and/or CR2 district preferred one.Being intended to oncogene protein E1A can not be in conjunction with Rb.

According to the of the present invention the 21 and the 22 aspect in the embodiment using, viral oncogene protein, particularly E1A are under tissue specificity and/or tumor-specific promoters control.

According to the of the present invention the 21 and the 22 aspect in another embodiment of using, virus, particularly adenovirus coding YB-1.

According to the of the present invention the 21 and the 22 aspect in another embodiment of using, YB-1 is under tissue specificity and/or tumor-specific promoters control.

According to the of the present invention the 21 and the 22 aspect in the preferred embodiment using, virus, adenovirus particularly, coding are selected from least one protein among proteinic group of the E3ADP that comprises E4orf6, E4orf3, E1B55k and adenovirus.

According to the of the present invention the 21 and the 22 aspect in the alternative embodiment using, cell comprises YB-1 in nucleus, the cell that particularly forms tumour or its part comprises YB-1 in nucleus.

According to the of the present invention the 21 and the 22 aspect in another embodiment of using, induce the YB-1 transhipment entered nucleus after, tumour comprises YB-1 in nucleus.

According to the of the present invention the 21 and the 22 aspect in the preferred embodiment using, YB-1 is caused by at least one method that to nuclear transhipment wherein said method is selected from the group that comprises radiation, dosed cells inhibitor and cross heating therapy.

According to the of the present invention the 21 and the 22 aspect in the particularly preferred embodiment using, described method is applied to cell, organ or organism.

According to the of the present invention the 21 and the 22 aspect in the preferred embodiment using, virus, adenovirus particularly, be selected from and comprise following group: the virus of the viral E1A oncogene that Ad Δ 24, dl922-947, E1Ad/01/07, dl1119/1131, CB 016, dl520 and shortage are expressed, described viral E1A oncogene can combined function Rb tumor suppressor gene product.

In aspect the 23, problem is by virus, preferably adenovirus preparation in the medicine application and solved, wherein said virus, particularly adenovirus be fit to feasible duplicate through or the activation of E2-late promoter by the YB-1 mediation controlled, preferably mainly controlled by the activation of E2-late promoter.In one embodiment, YB-1 is the YB-1 that removes the YB-1 that regulates or go to regulate of the YB-1 of genetically modified YB-1 or cell, particularly cell.Genetically modified YB-1 preferably in cell by carrier, the YB-1 by or described gland virus expression particularly.The E2-late promoter preferably as be included in adenovirus E2-late promoter or as the E2-late promoter of relevant use with transgene expression described herein in the wild-type adenovirus.

In aspect the 24, problem is by virus, the particularly adenovirus application of in cell, duplicating and being solved, described cell comprises YB-1 in nucleus, wherein said virus, particularly adenovirus is the feasible activation of duplicating by the E2 late promoter that is fit to, and preferably main activation cause YB-1 by the E2 late promoter controls.In one embodiment, YB-1 be the YB-1 of genetically modified YB-1 or cell, particularly cell go to regulate or remove the YB-1 that regulates.The YB-1 that genetically modified YB-1 preferably expresses in cell by carrier, described carrier particularly are one or described adenovirus.E2-evening promotor preferably as the adenovirus E2-late promoter that in wild-type adenovirus, exists, or as with the E2-late promoter of the relevant use of genetically modified expression described herein.

In the preferred embodiment aspect the of the present invention the 23 and/or 24, be to be fit to as adenovirus as described in disclosed herein, particularly suitable, make it to use according to the present invention.

Aspect the 25, problem is by the oncogene protein of virus, and particularly an isolating viral oncogene protein is solved, and wherein said viral oncogene protein has following feature:

A) trans-activation of at least one virogene in YB-1 nucleus positive cell, described gene are selected from and comprise following group: E1B55k, E3ADP and E4orf6 and E4orf4;

With

B) in nucleus.Particularly in the nucleus that has the proteinic cell of viral oncogene, there be not inducing of YB-1.

Be adenovirus nucleic acid preparation in the medicine application and solved, wherein said virus is fit to, and makes to duplicate activation through the E2-late promoter, is preferably mainly controlled by YB-1 through the activation of E2-late promoter.In one embodiment, YB-1 be genetically modified YB-1 or cell, particularly cell go regulate, or remove the YB-1 that regulates.Genetically modified YB-1 is preferably by carrier, particularly the YB-1 that expresses in cell by or described adenovirus.The E2-late promoter preferably adenovirus E2-late promoter such as the E2-late promoter that is included in the wild-type adenovirus, or as the E2-late promoter of relevant use with transgene expression described herein.

In aspect the 30, problem is by coding as viral used according to the present invention, application during particularly the nucleic acid of adenovirus duplicates in cell and being solved, wherein said virus is the feasible activation of duplicating through the E2-late promoter that is fit to, and preferred main activation through the E2-late promoter is controlled by YB-1.In one embodiment, YB-1 is the YB-1 that regulates of going of genetically modified YB-1 or cell, particularly cell.Genetically modified YB-1 is preferably by carrier, preferably the YB-1 that expresses in cell by or described adenovirus.The E2-late promoter preferably as the adenovirus E2-late promoter that in wild-type adenovirus, exists, or as the E2-late promoter of relevant use with transgene expression described herein.

In aspect hentriaconta-is individual, problem is used according to the present invention the 21 or the 22 aspect by the carrier that will comprise one of aforementioned nucleic acid and is solved.

In aspect the 32, the present invention relates to application with the interactional reagent of YB-1, be used to give the cell of cell, tumor tissues or patient with feature, so as to determine whether they will by as virus, particularly adenovirus contact and/or handle used according to the present invention.

In one embodiment, described reagent is selected from the group that comprises antibody, anti-caline (anticaline), fit, suitable enzyme (aptazymes) and spiegelmers.

In aspect the 32, problem is solved in preparation as with application in virus, the particularly adenovirus of the relevant use of purposes aspect the present invention the 21 and the 22 by viral oncogene protein according to the present invention or their nucleic acid of encoding.

In one embodiment, described virus comprises the genetically modified nucleic acid of coding.

In another embodiment, described virus comprises translation product and/or genetically modified transcription product.

In a preferred embodiment, the nucleic acid of the nucleic acid of adenoviral replication system and/or helper virus comprises transgenosis or encodes genetically modified nucleic acid.

In another embodiment, nucleic acid comprises transgenosis or encodes genetically modified nucleic acid.

In an alternate embodiment, transgenosis is selected from and comprises following group: prodrug, cytokine, natural death of cerebral cells induced gene, tumor suppressor gene, inhibitors of metalloproteinase gene and angiogenesis inhibitor gene and tyrosine kinase inhibitor gene.

In one embodiment, transgenosis is selected from the group of the nucleic acid that comprises siRNA, fit, antisense molecule and ribozyme, and wherein said siRNA, fit, antisense molecule and/or ribozyme are at target molecule.

In another embodiment, target molecule is selected from and comprises following group: resistance correlation factor, anti-cell are transferred the plasminogen activator of the die factor, oncogene, angiogenesis factor, DNA synthetic enzyme, DNA repair enzyme, somatomedin and their acceptor, transcription factor, metalloprotease, particularly matrix metalloproteinase and urokinase type.In one embodiment, the resistance correlation factor preferably is selected from the group that comprises P-glycoprotein, MRP and GST, and comprises their nucleic acid of coding.In one embodiment, anti-cell transfers the factor of dying to be selected from the group that comprises BCL2, and comprises their nucleic acid of coding.In one embodiment, oncogene is selected from and comprises Ras, the group of Tu Bian Ras, Rb and MYC particularly, and comprise their nucleic acid of coding.In one embodiment, angiogenesis factor is selected from and comprises proteic group of VEGF and HMG, and comprises their nucleic acid of coding.In one embodiment, the DNA synthetic enzyme is selected from the group that comprises Telomerase, and comprises their nucleic acid of coding.In one embodiment, the DNA repair enzyme is selected from the group that comprises Ku-80, and comprises their nucleic acid of coding.In one embodiment, somatomedin is selected from the group that comprises PDGF, EGF and M-CSF, and comprises their nucleic acid of coding.In another embodiment, acceptor is the acceptor of somatomedin preferably, and wherein preferably, somatomedin is selected from the group that comprises PDGF, EGF and M-CSF, and comprises their nucleic acid of coding.In one embodiment, transcription factor is selected from the group that comprises YB-1, and comprises their nucleic acid of coding.In one embodiment, metalloprotease matrix metalloproteinase particularly.In a preferred embodiment, matrix metalloproteinase is selected from the group that comprises MMP-1 and MMP-2, and comprises their nucleic acid of coding.In one embodiment, the plasminogen activator of urokinase type is selected from the group that comprises uPa-R, and comprises their nucleic acid of coding.

In another embodiment, described medicine also comprises at least one medicinal activity compound.

In the preferred embodiment of the present invention aspect any one, medicinal activity compound is selected from and comprises following group: cytokine, inhibitors of metalloproteinase, angiogenesis inhibitor, cytostatics and cell cycle inhibitor and tyrosine kinase inhibitor.

Above-mentioned disclosed according to adenovirus of the present invention, particularly with of the present invention first to eight aspect relevant described those, be also referred to as I group adenovirus here; And have trans-activation oncogene protein (for example, E1A and/or here and particularly above mentionedly want used according to the invention those) adenovirus be also referred to as II group adenovirus here.I group adenovirus and II group adenovirus also are called adenovirus or in this article together according to adenovirus of the present invention or according to virus of the present invention.

The present invention is based on unexpected a discovery, the i.e. cell that the counter-rotating of the expressed sequence of adenoviral gene causes effectively duplicating and randomly cracking is subjected to adenovirus infection.Expression about the temporal variation of adenoviral gene focuses on E1B albumen and the E4 albumen, they here also individually or the concentrated area be called first kind of albumen, they were expressed before second kind of albumen.Second kind of albumen is selected from E1A albumen.This order of representation is compared with wild-type adenovirus and is reversed, and in wild-type adenovirus, at first expresses E1A albumen, just express E1B albumen and E4 albumen subsequently, to guarantee activating transcription factor, for example transhipment is advanced in the nuclear of infected cell, and influence or control further replication activity.The kinetics of the adenovirus transcript in the wild-type adenovirus is documented in for example Glenn G.M. and Ricciardi R.P.Virus Research 1988,9, among the 73-91, it is reported, in wild-type, just can detect E1A transcript (being E1A12S transcript and E1A13S transcript) before at transcript and translation product (being respectively E4orf6 and E1B55k) usually.In this article, if there is not opposite explanation, E1B albumen E1B-55kD albumen preferably usually in this article.In this article, if there is not opposite explanation, E4 albumen is E4orf6 albumen preferably usually.In this article, if there is not opposite explanation, E1A albumen is E1A12S albumen preferably usually, or the relevant E1A albumen of adenovirus described in this article and that E1A-modifies.

The present invention includes, E1A albumen (more specifically also being E1A12S albumen) can replace in principle.If there is not opposite explanation, the E1A albumen of this replacement and E1A12S albumen also are called E1A albumen and E1A12S albumen in this article respectively, perhaps think to be comprised by this term.E1A12S albumen just can also not use the E1A albumen with tumor suppression function, Dickopp A for example, Esche H, Swart G, Seeber S, Kirch HC, Opalka B.CancerGene Ther.2000, Jul; 7 (7): put down in writing among the 1043-50.Other derivative of the as used herein and/or E1A albumen (particularly E1A12S albumen) mentioned is by also being the albumen that can discharge factor E2F from the Rb/E2F mixture.Particularly as Chellappan S. etc., Proc.Natl.Acad.Sci.USA 1992,89, the described simian virus 40 tumour antigen of 4549-4533 (SV40 large T antigen), papillomavirus E7 albumen (HPV E7) for they.

The present invention also comprises, can use the derivative of E4orf6 and E1B55k, and is as used herein, and wherein said term E4orf6 and E1B55k comprise such derivative.Derivative is documented in for example Shen Y etc., J.of Virology 2001,75,4297-4307; Querido E. etc., J.ofVirology 2001,75, among the 699-709.

The present invention includes, E1B albumen was expressed before E1A albumen, or E4 albumen expressed before E1A albumen, or E1B albumen and E4 albumen all expressed before E1A albumen, and each all as mentioned above.

Can duplicate with extra high level behind cells infected with the adenovirus that this mode designs, described cell is expressed YB-1 in nuclear, preferably express YB-1 in being independent of the nuclear of cell cycle, and perhaps it comprises the YB-1 that regulates, preferably in tenuigenin.Hope is not limited thereto, the present inventor supposes below, independent a kind of in the mixture that E1B albumen and/or E4 albumen are formed and these two kinds of albumen can transport the YB-1 that goes to regulate respectively in the nucleus, perhaps can start duplicating of adenovirus there under prior to the E1B albumen of E1A protein expression and/or the proteic influence of E4.In case in nucleus or with the activatory form, be present in the there, as described here, more specifically use the E2-late promoter, YB-1 duplicates effectively.Therefore, E1B albumen and/or E4 early express on the proteic time and have avoided observed cascade in the wild-type with the proteic initial expression of E1A.In a preferred embodiment, E1A albumen is special no longer trans-activation or only E1B albumen and/or E4 albumen trans-activation can be arrived the very E1A albumen of limited extent.Preferably, this trans-activation neither sufficient to guarantee effectively duplicates, and also is not enough to guarantee duplicating in cell, does not contain YB-1 in the nuclear of described cell.Preferably, trans-activation does not occur in such cell, and it is independent of in the nuclear of cell cycle and does not contain YB-1, does not perhaps have the YB-1 that regulates.

And, the present invention is based on unexpected a discovery, be that adenovirus can be duplicated with special efficient manner, if it comprises the nucleic acid of at least a energy proteins encoded, wherein said albumen is selected from and comprises proteic group of E1B albumen, E4 albumen and E1A, at least a albumen wherein is under the control of promotor, and described promotor is different with the promotor of each protein expression of control in wild-type adenovirus.Duplicating like this is effective especially, and cause the tumour cracking usually,, particularly in being independent of the nuclear of cell cycle, contain YB-1 if this cell contains YB-1 in nuclear, if perhaps this cell contains the YB-1 that regulates, particularly in tenuigenin, contain the YB-1 that regulates.The content of describing about E1B albumen, E4 albumen and E1A albumen in the above also is applicable to this.In wild-type adenovirus, E1B albumen is by the control of E1B promotor, and E4 albumen is by the control of E4 promotor, and E1A albumen is controlled by the E1A promotor.By selecting and the different promotor of promotor of in wild-type adenovirus, controlling aforementioned protein expression, change the interaction of the modulability between aforementioned proteic expression and each adenoviral nucleic acid and the albumen thus.By selecting promotor, can go up different expression maps Time Created, wish not limitedly below, cause observed duplicating in the cell, mechanism wherein may be that to go up different expression about the time of adenovirus protein E1B, E4 and E1A in front described.Example by promotor (different) the described proteic specific design of control with each proteic expression promoter of control in wild-type adenovirus, can from following claim and embodiment part, obtain, wherein more specifically, viral XVirPSJL1 that mentions and XVirPSJL2 are wherein representational.Preferably, E1B albumen is E1B55kD albumen, and E4 albumen is E4orf6 albumen, and E1A albumen is E1A12S albumen.

Preferably control the group that the proteic promotor of E1B albumen and E4 is selected from the promotor that comprises tumour-specific, organ specific promotor, tissue-specific promotor, allogeneic promoter and adenovirus promoter, its condition is, when using adenovirus promoter, they are different with the E1B promotor of control E1B protein expression, and different with the E4 promotor of control E4 protein expression.Particularly preferably be, use E1A promotor control E1B albumen and/or E4 protein expression.The E1A promotor is documented in for example Boulanger P.A. and Blair, G.E.Biochem.J.1991, and 275, among the 281-299.In addition, can also use each and any other allogeneic promoter, promptly with the different promotor of promotor of each protein expression of control in wild-type adenovirus.Representational example is the CMV promotor, and other promotor is conspicuous to those skilled in the art.

Be used to control the group that the proteic promotor of E1A can also be selected from the promotor that comprises tumour-specific, organ specific promotor, tissue-specific promotor, allogeneic promoter and adenovirus promoter, its condition is that adenovirus promoter is different with the E1A promotor.The present invention includes, one or more in the aforementioned albumen (being E1B albumen, E4 albumen or E1A albumen) are under the control of identical promoters, and however, preferably, particularly E1B albumen and E4 albumen are under the control of identical promoters.Particularly preferably be, the proteic expression of E1A maybe can be controlled by the promotor that YB-1 regulates by the promotor of YB-1-control.Such promotor is open relevantly with others of the present invention in this article.Particularly preferably, expression with adenovirus 2-late promoter control E1A promotor, because it at first can be regulated by YB-1, secondly also do not having only to show small in fact negligible transcribing under the situation of YB-1, thereby can guarantee very well to control expression of nucleic acids by the control of E2-late promoter.This has improved biological safety significantly, particularly when being used for field of medicaments.

And, the present inventor has been found that, adenovirus can be duplicated in cell particularly well, described cell contains YB-1 in nuclear, more specifically in being independent of the nuclear of cell cycle, contain YB-1, and/or contain the YB-1 that regulates, preferably in tenuigenin, contain the YB-1 that regulates, if directly or indirectly particularly in nucleus, provide YB-1 for duplicating, if perhaps providing of YB-1 is directly or indirectly to mediate by adenovirus protein, wherein said adenovirus protein is different with E1A.This aspect of the present invention is with disclosed aspect is different herein, the application that is the preferred II group of the adenovirus adenovirus of trans-activation E1A-modification can make these viruses duplicate in YB-1 nuclear-male tumour cell, particularly the YB-1 male is independent of the YB-1 nuclear-positive cells of cell cycle, and contain the YB-1 that regulates, those cells that particularly in tenuigenin, contain YB-1, do not utilize the trans-activation feature of E1A albumen (particularly E1A13S albumen) here, promptly about I group adenovirus, but in a preferred embodiment, E1A13S albumen is inactivation on the function, thereby no longer can trans-activation E4orf6 and E1B55k, they directly or indirectly participate in the transhipment of YB-1 respectively and provide in nuclear.As a result, according to this aspect of the present invention, can not duplicate adenovirus effectively.In this scope, now the YB-1 that provides and carry out for adenoviral replication of the YB-1 in the nuclear the control that no longer is subjected to the proteic direct or indirect participation of E1A is provided, but the E1B albumen (particularly E1B55kD albumen) by not being subjected to E1A control and/or the expression of E4 albumen (particularly E4orf6 albumen) realize.

This embodiment of adenovirus can also be by a kind of realization the in the above-mentioned measure, for example by comparing with the proteic expression of E1A, in advance E1B albumen and/or proteic time of E4 go up and express, perhaps by in E1B albumen, E4 albumen and the E1A albumen one or more being placed and controlling under the control of the different promotor of each proteic expression promoter in wild-type adenovirus.

At last, the present inventor is from unexpected discovery, be that effective adenoviral replication can also take place particularly to contain in nuclear in the cell of YB-1, more specifically in being independent of the nuclear of cell cycle, contain in the cell of YB-1, perhaps containing the YB-1 that regulates, preferably in tenuigenin, containing in the cell of the YB-1 that regulates, if at least one in E1B albumen, E4 albumen and the E1A albumen, particularly their preferred form are to express in the expression cassette under promotor control.In one embodiment of the invention, provide 3 kinds of expression cassettes basically, each all contains a kind of described albumen separately.In an alternative embodiment, expression cassette can also contain two or more albumen E1B, E4 and E1A and their derivative and possible surrogate respectively, particularly under the situation of E1A12S.Describedly in the past comprise the content of the nucleic acid relevant with E1A, also be applicable to the various albumen of design and the promotor of use separately with albumen E1B, E4 about adenovirus.When using such expression cassette, preferably, completely or partially deleted the albumen in the genome of wild-type adenovirus and their nucleic acid of encoding, described albumen is corresponding to each albumen of expression cassette, guaranteeing that virus is stable, and preventing reorganization, is at least on bigger degree.

In principle, expression cassette can be cloned each zone and each site of adenovirus into respectively, wherein preferably with one or several expression cassette respectively or combination with one another ground be inserted into viral E1 district, E3 district and/or E4 district.The nucleic acid in E1, E3 and E4 district may be by completely, partly deletion, perhaps not deleted at all, yet according to the present invention preferably about adenovirus, the nucleic acid of coding E1A13S gene be inactivation or disappearance, so this virus can not provide any trans-activation E1A albumen.This disappearance degree of one or more area E 1, E3 and E4 depends on the expression cassette of use and the foreign gene or the transgenosis that randomly further import or contains their other expression cassette, promptly different genes with adenoviral gene, at least to a certain extent different, be that they are not that adjusting content by dominant adenoviral nucleic acid in wild-type adenovirus provides, neither provide by adenovirus nucleic acid sequence in the wild-type adenovirus in this site.The present invention includes, in the adenoviral gene group, partially or even wholly deleted the nucleic acid that in one or more coding E1B albumen, E4 albumen and/or the proteic expression cassette of E1A, contains.In one embodiment, for example in adenovirus XvirPSJL1 according to the present invention or 2, partly delete the adenoviral nucleic acid of coding E4orf6, but contained its complete nucleic acid of to encode in the expression cassette.Preferably, this also can realize at E1B55k (being also referred to as E155Kd) albumen and/or E1A12S albumen.The degree of disappearance will be selected in preferred embodiments, so that the maximum packing size reaches maximum packing size about 103% of wild-type adenovirus, although this boundary is a preferred boundary.The possible disappearance of making in the adenoviral gene group only limits in preferred embodiments, to guarantee producing particle infective and packing.On the basis of content disclosed herein and standard test, those skilled in the art can determine the levels of precision that lacks.

As the starting point that makes up adenovirus as herein described, can use any wild-type adenovirus, but also can use other adenovirus, as long as they are according to technology constructed of the present invention.Particularly preferably use C subgroup adenovirus, in this group, preferably use adenovirus 2 and adenovirus 5 again.

If there is not opposite explanation, the proteic single plural form of term E1B albumen, E4 albumen and E1A uses in the mode of synonym in this article.

Term as used herein " removes to regulate " YB-1 and is meant YB-1 molecule as used herein or YB-1 albumen, and its existence form and the YB-1 that in cell, preferably exists usually in non-tumor cell are quantitatively and/or different qualitatively.Can will go the YB-1 that regulates to characterize and discriminating is by special virus: can be in containing such cell background of removing the YB-1 that regulates, go in existence to duplicate under the situation of the YB-1 that regulates.Relative special virus is such, E1A albumen wherein be sudden change and show the trans-activation function.The example of these special viruses is: AD δ 24, dl 922-947, E1 Ad/01/07 and CB 016 and/or [MolecularTherapy 2 for Howe, J.A etc., 485-495,2000; Fueyo J. etc., Oncogene 19,2-12,2000; Heise C. etc., Nature Medicine 6,1134-1139,2001; Balague, C etc., J.Virol.75,7602-7611,2001; Bautista, D.S. etc., Virology 1991,182,578-596; Jelsma T.N. etc., Virology1988,163,494-502; Wong, H.K. and Ziff E.B., J.of Virology 1994,68,4910-4920] described those.Such cell can be respectively applied for duplicating of I group adenovirus and/or II group adenovirus with the cell with such background.In addition, the tumour that can cracking contains this cell according to adenovirus of the present invention.

And the present invention is based on unexpected discovery, i.e. the dna replication dna of the adenovirus of E1A-modification in YB-1 nuclear male tumour cell is based on the activation of E2-late promoter.It is such that the adenovirus that E1A-modifies should be understood to, its (a) duplicating in the cell of YB-1 nuclear-feminine gender compared with wild-type to some extent and reduced, or do not duplicate, (b) at least a virogene had transactivation activity, wherein this gene is selected from the group that comprises E1B-55kDa, E4orf6, E4orf3 and E3ADP especially, and/or (c) can not be transferred in the nuclear by the YB-1 of adenovirus with cell.Randomly, adenovirus used according to the invention has further feature, i.e. the proteic combination meeting of the E1A of adenovirus coding interference E2F combines with Rb's, and can decompose the mixture of being made up of E2F and Rb separately.Have one or several aforesaid features a) to c), preferred all features are a) to c) adenovirus not contain in the cell of YB-1 in nuclear be replication defective.

In one embodiment, the duplicating of remarkable minimizing used herein is meant particularly with wild-type to be compared, and duplicates and has reduced by 2 times, preferred 5 times, more preferably 10 times and most preferably 100 times.In preferred embodiments, use same or analogous clone, the virus titer of same or analogous infection (infection multiplicity, MOI, or plaque-forming unit, pfu) and/or same or analogous normal experiment condition relatively duplicate.Used herein duplicating is meant that especially particulate forms.The measurement of duplicating in another embodiment, can be a viral nucleic acid synthetic degree.Measure viral nucleic acid synthetic degree methods and measure granuloplastic method known for those skilled in the art.

Discovery as herein described, method, application or nucleic acid, albumen, dubbing system etc. not necessarily are limited to adenovirus.In principle, these systems also are present in other virus, and they are also contained in herein.

Use is according to virus of the present invention or use application according to virus of the present invention, and compares according to prior art 10-100pfu/ cell, when using the infection rate of 1-10pfu/ cell, can realize being comparable to duplicating of wild-type.

The YB-1 of cell should be meant that wherein this YB-1 exists in the cell by cell coding and preferred also by any YB-1 of cell expressing, particularly before each cell infection adenovirus, and preferred adenovirus as herein described of described adenovirus and/or helper virus.Yet the present invention also comprises, the YB-1 of cell be introduce cell or by only applying the YB-1 of outside measure (for example using virus, preferred adenovirus infection) by these cells produce.

Below do not wish fettered by this, the present inventor supposes that E2-early promoter (being early stage E2 promotor) is not to open by people's cell E2F transcription factor, described E2F transcription factor is relevant with duplicating of virus used according to the invention, and also the application according to the present invention with adenovirus of the present invention is relevant.Under such environment, the Rb state that begins to be independent of cell that duplicates, promptly use virus infection disclosed herein and preferred cracked tumour cell subsequently can comprise the Rb albumen of functional and non-activity.In addition, the duplicating of adenovirus of using adenovirus disclosed herein or using condition disclosed herein without any need for functional p53 albumen, but be not subjected to the negative impact of its existence yet.So, this technology instruction has deviated from the principle of using the adenovirus that can clear up tumour or energy cracking tumour, the type of described adenovirus is Ad Δ 24, dl922-947, E1Ad/01/07, CB016, or those adenovirus of for example in European patent EP 0 931 830, describing, introducing one or several disappearances under the following hypothesis in E1A albumen: intact functional Rb albumen can effectively duplicate in the baffle, and therefore duplicating of adenovirus only be provided in the body in Rb-feminine gender and Rb-mutant cell.These adenovirus systems of prior art are based on E1A, so that duplicate in the body by early stage E2 promotor (E2 early promoter) and " free E2F " control adenovirus.Yet, these known viruses of the prior art can be used for duplicating of cell according to the present invention, described cell contains YB-1 at the nuclear that is independent of the cell cycle, perhaps contains the YB-1 that regulates.

Can use the virus of in described European patent EP 0 931 830, describing, particularly adenovirus according to the present invention.More specifically, the virus of describing in described patent is replication defective, and can not express the virus of viral cancer protein, the Rb tumor suppressor gene product that this cancer protein can combined function.Adenovirus can be in particular any adenovirus that can not express viral E1A cancer protein, the tumor inhibitor gene product that this E1A cancer protein can combined function, Rb more specifically.Virus E1A cancer protein can show the inactivation sudden change, for example at the CR1 structural domain of the amino acid sites 30-85 of adenovirus Ad5 (being also referred to as Ad5 in this article), at the amino acid sites 120-130CR2 of nucleotide site 697-790 and/or Ad5 structural domain, nucleotide site 920-967, it relates to p105 Rb albumen, p130 and the proteic combination of p107.But the present invention comprises that also adenovirus is the dl 312 of type 2 or the NT dl 1010 of type 5.

Prepare medicine about adenovirus according to the present invention, the particularly application of the medicine of preparation treatment neoplastic disease and other disease disclosed herein, the application of in cell, duplicating about the application and the adenovirus of the present invention of adenovirus of the present invention, described cell contains YB-1 at nuclear, preferably contain YB-1 at the nuclear that is independent of the cell cycle, perhaps contain the YB-1 that regulates, preferably in tenuigenin, duplicate and finally occur in such cell, it contains YB-1 at nuclear, preferably is independent of the cell cycle, in other words, they are YB-1 nuclear-male, perhaps occur in the cell that contains the YB-1 that regulates.It should be noted that especially so adenovirus is not duplicated or duplicated with significantly reduced level in following cell: do not contain YB-1 and only in tenuigenin, contain YB-1 in its nuclear, perhaps do not contain any YB-1 of regulating of going.Therefore, the success of these viruses is duplicated and need be had YB-1 in nuclear, preferably is independent of the cell cycle, perhaps exists to remove the YB-1 that regulates.As will be described below in more detail, this can apply measure by for example pair cell and realize, this measure can cause expression or the existence of YB-1, preferably is independent of the cell cycle, or removing the YB-1 that regulates in the nuclear, or goes the expression of the YB-1 that regulates.Various measures can for example be respectively that this adenovirus is also carried the genetic information of coding YB-1 and the YB-1 that particularly encodes expression except adenoviral gene by used according to the invention or experience coding and the expression of adenovirus YB-1 of the present invention.Other measure that causes YB-1 transhipment in the nucleus, induces or express be adopt stress, as apply cytostatic agent, irradiation, overheated etc. to cell and the organism that comprises this cell.In a preferred embodiment, irradiation can be any radiation, and it is for example employed in the treatment neoplastic disease.

Characterized in preferred embodiments used according to the invention, especially for tumour cracked adenovirus and according to adenovirus of the present invention, it is characterized in that, they do not duplicate in following cell: its be independent of do not contain in the nuclear of cell cycle YB-1 and thereby be YB-1 nuclear-feminine gender, perhaps do not contain any YB-1 of regulating of going.

Another feature of a part of adenovirus (they are different with adenovirus of the present invention) that will be used according to the invention is that they are coded in the viral oncogene that this is also referred to as oncogene protein, wherein oncogene protein is preferably E1A, and wherein oncogene protein can activate at least one influential virogene of lysis to the virus replication and/or the cell that is infected by the virus.Preferably, be such to the influence of duplicating, to compare with the situation of the oncogene protein disappearance of various viruses wherein, virus is duplicated better in the presence of oncogene protein.This process is also referred to as trans-activation in this article, when trans-activation is when mediating by E1A, is called the E1A trans-activation particularly.Following process preferably described in term " trans-activation ", be that various viral cancer proteins are different from other expression of gene of the own gene of the viral cancer protein gene of coding and/or transcribe influential one or more, promptly control its expression and/or translation, particularly activate.These virogenes are preferably E1B55kDa, E4orf6, E4orf3 and E3ADP, and aforementioned gene and gene product any combination separately.

Although the just optional feature of another of adenovirus used according to the invention and adenovirus of the present invention be respectively them to tumor inhibitor Rb in conjunction with feature, and in their encoded protein more concrete to tumor inhibitor Rb in conjunction with feature.In principle, the present invention includes adenovirus energy used according to the invention or can not combine with Rb.The application of any of two kinds of adenovirus alternative embodiment is independent of the Rb state that maybe will handle cell of processing.

In order to give the ability of E1A debond Rb, can carry out following deletion: the disappearance of the disappearance of CR1 zone (amino acid sites 30-85 among the Ad5) and CR2 zone (amino acid sites 120-139 among the AD5) to the E1A cancer protein.In the process of carrying out, the CR3 zone is retained, and can have the trans-activation function to other early stage virogene.

But in order to give E1A ability in conjunction with Rb, following disappearance to the E1A cancer protein is possible in principle: the disappearance of CR3 zone (amino acid sites 140-185); The disappearance of N-end (amino acid sites 1-29); The disappearance of amino acid sites 85-1 19; Disappearance with C-end (amino acid sites 186-289).Above-mentioned zone of listing does not influence combining of E2F and Rb.The trans-activation function is kept perfectly, and still compares with wild-type Ad5 to decrease.

The present invention also comprises, particularly about adenovirus of the present invention, E1A albumen, particularly E1A12S albumen are designed to like this, in one embodiment, it can be incorporated into Rb, in different embodiments, it not can be incorporated into Rb, wherein such E1A12S albumen is E1A albumen, the E1A12S albumen on the meaning of the present invention more specifically, however it is called the E1A12S of modification in the prior art sometimes.The proteic various designs of E1A12S more specifically about the aforementioned disappearance of E1A albumen (it also abbreviates E1A in this article as), are known to those skilled in the art.

Substantially known in the prior art and these adenovirus that do not demonstrate any trans-activation are commonly referred to be replication defect type.Yet the present inventor's contribution is, has been found that they still can suitably particularly duplicate under the cell background under the background.The existence of YB-1 in nuclear, the existence that be independent of cell cycle of preferred YB-1 in examining, or remove the YB-1 that regulates, can produce or provide this suitable cell background.The fragment or the fraction that comprise cell extract at the used term cell of and any others of the present invention or cell system, and in external, the body or the cell of original position.On this degree, term cell system or cell also comprise be present in cell culture, tissue culture, organ cultures or any body respectively and former bit organization or organ in cell, its be isolating, in groups or as the part of tissue, organ or organism, but also in preferred live body, exist like this.Organism is preferably any vertebra biology, more preferably Mammals.More preferably, organism is the people organism.Other preferred organism is according to all respects those disclosed of the present invention.

In addition, also the present invention comprises, based on technology instruction provided herein, in cell, produced new virus, this virus can show adenovirus as herein described and those replication described in the prior art, described cell is a YB-1 nuclear-male, preferably is independent of the YB-1 nuclear-male of cell cycle, or comprises the YB-1 that regulates.In other words, preferably especially from known adenovirus, can design other virus, it has the feature of using relevant this paper definition according to the present invention.

Related to the present invention, opposite with virus of the present invention, want the E1A cancer protein of the modification of various adenovirus used according to the invention to examine at YB-1-positive cells in or comprise the early stage virogene of trans-activation in the cell of the YB-1 that regulates, E1B55K for example, E4orf3, E4orf6, E3ADP.Preferably, viral genome is not had other changes, various adenovirus can be in addition on this degree corresponding to the adenovirus or derivatives thereof of wild-type.

Disclosed in this article coding or comprise the virus of the oncogene protein on the trans-activation meaning of the present invention, comprise for example adenovirus Ad Δ 24, dl922-947, E1Ad/01/07, CB106 and/or in the adenovirus described in the European patent EP 0 931 830, it separately can the trans-activation early gene, as E1B, E2, E3 and/or E4, and be comparable to wild-type adenovirus, particularly wild-type Ad5.In these cases, trans-activation is responsible in the proteic specific region of E1A.In the serotype of various adenovirus, in E1A albumen, there is the zone of 3 high conservatives.The CR1 zone of amino acid sites 41-80, the CR2 zone of amino acid sites 120-139 and the CR3 zone of amino acid sites 140-188.The trans-activation function is mainly based on the existence in CR3 zone in the E1A albumen.The aminoacid sequence of CR3 exists in unaltered mode in aforementioned adenovirus.This causes early gene E1B, E2, and the trans-activation of E3 and E4, it is independent of whether YB-1 is present in nuclear or the tenuigenin.

In contrast, in recombinant adenovirus dl520, the CR3 zone lacks.Therefore, dl520 expresses so-called E1A12S albumen, and it does not comprise the aminoacid sequence in CR3 zone.As a result, dl520 only can bring into play extremely weak trans-activation function, particularly in the E2 zone, does not therefore duplicate in the cell of YB-1 nuclear-feminine gender.In YB-1 nuclear-positive cells, YB-1 trans-activation E2 zone, and therefore allow effectively duplicating of dl520.For the system that resembles dl520 of purpose described herein and be derived from they system application based on this.Another important difference between two kinds of aforementioned adenovirus groups (for example δ 24 (this paper is also referred to as Ad Δ 24) and for example dl520) is, compare with the cell of YB-1 nuclear-feminine gender or the cell that do not contain the YB-1 that regulates, early gene E1B, E3 and E4 are independent of the cell of cell cycle or contain in the cell of the YB-1 that regulates by trans-activation more fully at YB-1 nuclear-male.In contrast, in δ 24, there is not or only has fine difference.Yet, compare with wild-type adenovirus, dl520 and more specifically the proteic transactivation of E1A12S significantly reduce.Yet this trans-activation is enough to provide effectively duplicating in the YB-1 nuclear-positive cells, also shown in embodiment 10.In the proteic design of particularly described in this respect E1A as herein described, design with their nucleic acid of coding, so that comparing with wild-type oncogene protein E1A, E1A albumen has one or several disappearances and/or sudden change, comprise and preferred especially as with dl520 or Ad Δ 24, dl922-947, E1Ad/01/07, CB106 and/or proteic those designs of described E1A of being correlated with in adenovirus described in the European patent EP 0 931 830, it is the particularly embodiment of adenovirus of virus, it duplicates and is controlled, and preferably significantly controls by activating the E2-late promoter.Preferably, disappearance is the group that is selected from the disappearance of the disappearance of the disappearance that comprises the CR3 zone and N-end and C-end.Based on disclosure provided herein, those skilled in the art can produce proteic other of E1A and allow the embodiment of this adenoviral replication form.The proteic embodiment of foregoing E1A is also can be according to the embodiment of adenovirus use of the present invention, and described adenovirus is also referred to as adenovirus of the present invention or I group adenovirus in this article.

Adenovirus of the present invention, particularly I group adenovirus are also referred to as derivative in this article, and can be used according to the invention, they typically comprise E1 disappearance, E1/E3 disappearance and/or E4 disappearance, and promptly corresponding adenovirus can not produce E1 and/or E3 and/or the E4 expression product and the corresponding product of functionally active respectively.Perhaps in other words, these adenovirus only can be created in E1, E3 and/or the E4 expression product of non-activity on the function, wherein the E1 of non-activity, E3 and/or E4 expression product are such expression products on the function, itself or do not exist as expression product, no matter be transcriptional level and/or translation skill, perhaps it exists with the form that lacks a kind of function (in wild-type adenovirus owing to it) at least.The expression product inherent of wild-type adenovirus this/these functions are that those skilled in the art are known, for example at Russell, W.C., Journal of Virology, 81,2573-2604 describes in 2000.Russell (above) has also described the principle of design of adenovirus and adenovirus carrier, and it is hereby expressly incorporated by reference.Also the present invention comprises, the E1A cancer protein of modifying, the i.e. albumen of the E1A albumen of trans-activation and other no longer, E1A12S, E1B-55K, E4orf6 and/or E3ADP (adenovirus dead albumen (ADP)) (Tollefson for example, A. etc., J.Virology, 70,2296-2306,1996) in such carrier individually or arbitrary combination ground express.Gene of mentioning separately and transgenosis disclosed herein can be cloned in E1 and/or E3 and/or the E4 zone independently of each other, and can use suitable promotor or express under the control of suitable promotor.Basically, each zone of E1, E3 and E4 is suitable as the cloning site in the adenoviral nucleic acid.In some embodiments, suitable promotor is respectively with the control of E1A, the preferred E1A that modifies and expresses relevant those disclosed in this article.

At last, in one embodiment, II used according to the invention group adenovirus is the E1B defective type, particularly E1B 19 kDa defective typies.Usually use as this paper, the term defective type typically refers to a kind of situation, and wherein E1B can not show all features of wild-type E1B, and lacks in these features at least one.

At least some embodiments of the II group adenovirus of using according to the present invention disclosed herein are like this known in the art.Adenovirus used according to the invention is recombinant adenovirus preferably, more specifically, if compare with wild-type, changes on the meaning of technology instruction provided herein.The adenovirus nucleic acid sequence that has nothing to do of deletion or mutagenesis and the present invention is known to those skilled in the art respectively.As described herein, these disappearances are can be for example relevant with the part of the nucleic acid of coding E3 and E4.If these disappearances do not extend to albumen E4orf6, in other words, the adenovirus used according to the invention E4orf6 that can encode, particularly preferably be the E4 disappearance.In preferred embodiments, these adenoviral nucleic acids can also be packaged in the viral capsid, and therefore form infective particle.Like this equally to application according to nucleic acid of the present invention.Usually should be noted that adenovirus system can lack single or several expression products.Relevant therewith, this is relevant with II group adenovirus with I group adenovirus, should consider that this may be that the sudden change or the disappearance of nucleic acid by this expression product of coding causes, wherein such sudden change and disappearance are respectively completely, perhaps reach the degree that no longer forms expression product, perhaps the element of being expressed by controlling element and control causes, and for example in the mode that is different from wild-type disappearance or activatory promotor and transcription factor takes place, and it (lacks promotor respectively on nucleic acid level; Cis-functional element) or the translation and the re-reading system level on (trans-functional element).Particularly the back may depend on the background of each cell on the one hand.

Except using known like this adenovirus, can also use new adenovirus according to the present invention, for example II organizes adenovirus, and it can be used for disclosed in the purpose for other adenovirus described herein.New adenovirus of the present invention is instructed from technology provided herein.Particularly preferred representative is, for example, the viral Xvir03 and the Xvir03/01 that in Figure 16 and Figure 17, describe, its principle of design is further explanation in embodiment 11 and 12 also.

In the situation of carrier Xvir03, the CMV promotor is cloned in the E1 zone E1B 55K that this E1 regional control is separated by the IRES sequence and the nucleic acid of E4orf6.Owing to respectively these two gene clones are advanced virus and because the gene product of its generation, keep and duplicate efficacy outcomes so that duplicate in those cells of the YB-1 that occurs in the YB-1 nuclear-positive cells especially, more specifically regulates comprising on meaning disclosed by the invention, described result wherein optionally duplicates in cell, particularly tumour cell in fact corresponding to a kind of wild-type virus.In one embodiment, wherein exist the cell remove the YB-1 that regulates to demonstrate the YB-1 that compares increase with the cell of normal or non-tumour and express, the compartment of preferred YB-1 is independently expressed.

Kai Fa viral Xvir03 is viral Xvir03/01 in addition, in preferred embodiments, has wherein cloned therapeutic gene or transgenosis under promotor control specific promotor, especially tumour-specific or tissue-specific.Relevant with this virus, the E4 zone also is a non-activity on the function, preferred disappearance.Transgenosis as herein described also can be cloned in the E4 zone, and wherein this can be used as alternative or except transgene clone is in the E3 zone and take place.

Transgenosis as herein described and described especially below, can also be respectively by adenovirus of the present invention (being I group adenovirus and their nucleic acid) or dubbing system of the present invention or associated the expression, and be included in the expression cassette that contains promotor and nucleotide sequence one or more described transgenosiss of this nucleic acid sequence encoding wherein thus.E1, E3 and/or E4 district are specially suitable cloning sites in the adenoviral gene group, and still, cloning site is not limited thereto.

This therapeutic gene can be the gene of prodrug gene, cytokine, gene, tumor suppressor gene, inhibitors of metalloproteinase and/or the angiogenesis inhibitor of cell death inducing and the gene of tyrosine kinase inhibitor.In addition, can express siRNA, fit, antisense molecule and ribozyme, it is preferably directly at the target molecule relevant with cancer.Preferably, single or multiple target molecules are selected from the group of the plasminogen activator that comprises resistance correlation factor, the anti-apoptotic factor, oncogene, angiogenesis factor, DNA synthetic enzyme, DNA repair enzyme, somatomedin and their acceptor, transcription factor, metalloprotease, particularly matrix metalloproteinase and urokinase type.Its embodiment preferred is in this article about others those disclosed of the present invention.

The possible prodrug gene that can be used for embodiment preferred is, for example, and Isocytosine deaminase, thymidine kinase, carboxypeptidase, uracil phosphoribosyl transferase; Or purine nucleoside phosphorylase (PNP); [Kirn etc., Trends in Molecular Medicine, volume 8, No.4 (supplementary issue), 2002; Wybranietz W.A. etc., Gene Therapy, 8,1654-1664,2001; Niculescu-Duvaz etc., Curr.Opin.Mol.Therapy, 1,480.486,1999; Koyama etc., Cancer GeneTherapy, 7,1015-1022,2000; Rogers etc., Human Gene Therapy, 7,2235-2245,1996; Lockett etc., Clinical Cancer Res., 3,2075-2080,1997; Vijayakrishna etc., J.Pharmacol. and Exp.Therapeutics, 304,1280-1284,2003].

The possible cytokine that can be used for embodiment preferred is, for example, GM-CSF, TNF-α, Il-1 2, Il-2, Il-6, CSF, interferon-; [Gene Therapy, Advances inPharmacology, volume 40, editor: J.Thomas August, Academic Press; Zhang and Degroot, Endocrinology, 144,1393-1398,2003; Descamps etc., J.Mol.Med., 74,183-189,1996; Majumdar etc., Cancer Gene Therapy, 7,1086-1099,2000].

The possible apoptosis-inducing gene that can be used for embodiment preferred is, for example, and decorin: [Tralhao etc., FASEB J, 17,464-466,2003]; Retinoblastoma 94:[Zhang etc., Cancer Res., 63,760-765,2003]; Bax and Bad[Zhang etc., Hum.GeneTher., 20,205 1-2064,2002]; Apoptosis element (apoptin) [Noteborn and Pietersen, Adv.Exp.Med.Biol., 465,153-161,2000]]; ADP[Toth etc., Cancer GeneTherapy, 10,193-200,2003]; Bcl-xs[Sumantran etc., Cancer Res, 55,2507-25 12,1995]; E4orf4[Braithwaite and Russell, Apoptosis, 6,359-370,2001]; FasL, Apo-1 and Trail[Boehringer Manheim, Guide to Apoptotic Pathways, Arai etc., PNAC, 94,13862-13867,1997]; Bims[Yamaguchi etc., Gene Therapy, 10,375-385,2003; GNR163:Oncology News, 17June, 2000].

The possible tumor suppressor gene that can be used for embodiment preferred is, for example, and E1A, p53, p16, p21, p27, or MDA-7.[Opalka etc., Cell Tissues Organs, 172,126-132,2002, Ji etc., Cancer Res., 59,3333-3339,1999, Su etc., Oncogene, 22,1164-1180,2003].

The possible angiogenesis inhibitor that can be used for embodiment preferred is, for example, blood vessel endothelium chalone (endostatin) or angiostatin (angiostatin) [Hajitou etc., FASEB J., 16,1802-1804,2002], with antibody (Ferrara, N., Semin Oncol 2002Dec at VEGF; 29 (6 Suppl 16): 10-4).

The possible inhibitors of metalloproteinase that can be used for embodiment preferred is, for example, and Timp-3[Ahonen etc., Mol Therapy, 5,705-715,2002]; PAI-1; [Soff etc., J.Clin.Invest., 96,2593-2600,1995]; Timp-1, [Brandt K.Curr.Gene Therapy, 2,255-271,2002].

Other transgenosis that can organize on the meaning of the present invention of adenovirus and II group gland virus expression by I also is a tyrosine kinase inhibitor.Exemplary Tyrosylprotein kinase is EGFR (EGF-R ELISA) [Onkologie, Entstehung und Progression maligner Tumoren; Author:Christoph Wagner, Georg Thieme Verlag, Stuttgart, 1999].Preferred tyrosine kinase inhibitor is trastuzumab (herceptin) [Zhang H etc., Cancer Biol Ther.2003, Jul-Aug; 2 (4 suppl 1): S122-6].

SiRNA (short interfering rna) is made up of 2, preferred 2 RNA chains that separate, its hybridization each other owing to base complement, this complementarity is meant that they exist on base pairing ground basically, and preferably have up to 50 Nucleotide, preferred 18-30 Nucleotide, more preferably less than 25 Nucleotide and the length of 21,22 or 23 Nucleotide most preferably, wherein these numerals are meant the strand of siRNA, the length of one section single stranded sequence particularly, this strand and one, more specifically with the hybridization of second strand or with its base pairing.SiRNA induces or mediates the degraded of mRNA specifically.Its required specificity is by the sequence of siRNA and its binding site mediation thus.Target sequence to be degraded forms first or the complementation of second chain of chain basically with siRNA.Really the butt formula is not clear although act on, and infers that on behalf of cell, siRNA suppress allelotrope (distinct allele) separately and the viral biology strategy of himself antagonism of protection between the growth period.The RNA of siRNA mediation disturbs can be as suppressing or reject fully the method for proteic expression specifically by the double-stranded RNA of introducing gene specific.For higher organism, the siRNA that comprises 19-23 Nucleotide is specially suitable like this, because it can not activate nonspecific defensive raction, for example interleukin is replied.The double-stranded RNA with 3 ' long overhang of symmetric 2 Nucleotide of 21 Nucleotide of direct transfection is applicable to that the RNA in the mediate mammalian cell disturbs, and comparing with antisense molecule with other technology such as ribozyme is (Elbashir efficiently, S.Harborth J.Lendeckel W. Yalvcin, A.WeberK Tuschl T:Duplexes of 21-nucleotide RNAs mediate RNA interference incultured mammalian cells.Nature 2001,411:494-498).Only need few siRNA molecule can suppress target gene expression.The restriction of the siRNA that uses for fear of external source, the instantaneous character that this restriction is transmitted particularly in interference phenomenon and siRNA molecular specificity, prior art is used the carrier that allows autogenous siRNA to express.For this purpose, for example, the oligonucleotide that will have 64 length of nucleotides is introduced the carrier that comprises the long target sequence of 19 Nucleotide so that justice and antisense orientation to be arranged, and it by the intervening sequence of for example 9 Nucleotide length separately.The transcript that produces is folded into hairpin structure, and its stem structure has for example 19 base pairs.Ring is degraded fast in cell, so that produce functional siRNA (Brummelkamp etc., Science, 296,550-553,2002).

The nucleic acid of coding YB-1 can comprise mediation YB-1 and be transported to the interior nucleotide sequence of nuclear, described YB-1 can be an adenovirus used according to the invention, and particularly II group adenovirus also can be an adenovirus of the present invention, be I group adenovirus, an embodiment in the part of adenovirus.According to nucleic acid of the present invention, adenovirus and adenovirus system and the known adenovirus of prior art, Onyx-015 for example, Ad Δ 24, dl922-947, E1Ad/01/07, CB016, dl 520 and the adenovirus of describing in patent EP 0 931830 can be used separately as adenovirus and adenovirus system, and corresponding nucleic acids, in conjunction with these nucleic acid according to the present invention.The suitable nucleotide sequence of mediation nuclear translocation is that those skilled in the art are known, for example in (Whittaker, G.R. etc., Virology, 246,1-23,1998; Friedberg, E.C., TIBS 17,347, and 1992; Jans, D.A. etc., Bioassays 2000 Jun; 22 (6): 532-44; Yoneda, Y., J.Biocehm. (Tokyo) 1997 May; 121 (5): 811-7; Boulikas, T., Crit.Rev.Eukaryot.Gene Expr.1993; 3 (3): 193-227; Lyons RH, Mol.Cell Biol., 7,2451-2456,1987) the middle description.The nucleotide sequence of mediation nuclear translocation can use different principles.A kind of such principle is that YB-1 forms fusion rotein with signal peptide, or for it provides such signal peptide, with in its transfered cell nuclear, duplicating according to adenovirus of the present invention is taken place whereby by this signal peptide.

Can be in adenovirus used according to the invention, II group adenovirus more specifically, but also be according to adenovirus of the present invention, be that another principle of using in the design of I group adenovirus is, provide transit sequence to YB-1, it is the synthetic beginning from tenuigenin preferably, YB-1 is shifted or is displaced in the nucleus, and promote virus replication there.The especially effectively example of nucleotide sequence that mediation is transported to nuclear is the TAT sequence of HIV, and it for example is documented in Efthymiadis with other such suitable nucleotide sequence, A., and Briggs, LJ, Jans, DA., JBC 273,1623-1628,1998.The present invention includes, adenovirus used according to the present invention, II group adenovirus particularly, but also be according to adenovirus of the present invention, i.e. I group adenovirus comprising the nucleotide sequence of the peptide of coding mediation nuclear translocation.

The present invention includes, YB-1 with its total length, particularly exist with form corresponding to wild-type YB-1.And, the present invention includes, YB-1 is as derivative, for example to shorten or clipped form uses or exists.Can the use YB-1 derivative that maybe can exist relevant with the present invention is preferably can be in conjunction with E2-late promoter and the YB-1 that therefore activates the expression of adenovirus E2 regional gene.This derivative comprises YB-1 derivative disclosed herein especially.By the N-end, at C-terminal or in aminoacid sequence single or several amino acid of disappearance can produce other derivative.The present invention includes, also the YB-1 fragment is used as the YB-1 albumen on the meaning of the present invention.In the paper of [JBC2003,278,27988-27996] such as J ü rchott K, disclose multiple YB-1 fragment, it is characterized in that disappearance at C-and N-end.The segmental distribution of various YB-1 is verified, and cold shock territory (CSD) is all relevant with the transhipment that YB-1 is entered in the nucleus of Cycle Regulation with the C-end.Therefore the present invention includes, compare with natural YB-1, the YB-1 of the brachymemma relevant with the creative expression of E1B55k and E4orf6 (this paper is also referred to as YB-1 albumen) moves in the nuclear better and mediates stronger CPE thus, and do not need better in conjunction with the E2-late promoter, what wherein can not get rid of is, the YB-1 of brachymemma also moves in the nuclear better and causes two kinds of effects, promptly induces CPE and is attached to the E2-late promoter.At last, the YB-1 fragment of this brachymemma also can be moved better into and also more effectively is attached to the E2-late promoter in the nuclear, and does not induce better CPE.The present invention comprises that also the YB-1 albumen of brachymemma comprises other sequence relevant with total length YB-1 disclosed herein, particularly cellular localization signal sequence (NLS) etc. respectively with fragment.

About aforementioned various other genes with respectively by adenovirus coding and the gene product expressed, they can also be distinguished and encode in any combination way and express in principle.

The present invention includes, term adenovirus and adenovirus system should be understood to have essentially identical implication.The term adenovirus should be interpreted as especially, and is relevant with the complete virion that comprises capsid and nucleic acid.The term adenovirus system concentrates on a fact especially, and promptly nucleic acid is compared with wild-type to some extent and changed.Preferably, these variations comprise the variation of adenoviral gene group structure, as by disappearance and/or increase and/or the sudden change promotor, regulate sequence and/or encoding sequence such as open reading-frame (ORF) and produce.In addition, the term adenovirus system uses more preferably as carrier, and it can for example be used for gene therapy.

The explanation of front comprises any application and any design of adenovirus and adenovirus system, also is applicable to their nucleic acid of coding, and vice versa.

Possiblely according to the present invention be, adenovirus used according to the invention, II group adenovirus but also comprise I group adenovirus and their nucleic acid of encoding can be respectively any adenoviral nucleic acid separately more specifically, this adenoviral nucleic acid causes duplicate event after this manner or with other nucleotide sequence combination.Explain as this paper, may provide by helper virus and duplicate required sequence and/or gene product.Mentioning aspect the nucleic acid sequence encoding and, the present invention includes and not only use identical sequence, and use its deutero-sequence aspect the known nucleotide sequence of this nucleotide sequence.The term derived sequence should be meant any sequence that still produces gene product (nucleic acid or polypeptide) especially, and it has corresponding to the function of non-derived sequence or the function of non-derived sequence.This can determine by routine test well known by persons skilled in the art.The example of this deutero-nucleotide sequence is those nucleotide sequences of coding homologous genes product, particularly same acid sequence, yet, owing to the degeneracy of genetic code has different base sequences.

In one embodiment, respectively about II adenovirus according to the present invention and/or according to the adenoviral replication system of correspondence of the present invention with according to their application of the present invention, adenoviral nucleic acid lacks for expressing oncogene protein, E1A protein delation particularly, promptly, the 12S E1A albumen (this paper is also referred to as E1A12S albumen) of neither the encoding 13S E1A albumen (this paper is also referred to as E1A13S albumen) of also not encoding, perhaps its all do not encode 12S E1A albumen and 13S E1A albumen, or it is adorned, as defined herein, if there is not opposite explanation, the adenoviral replication system also comprises the nucleic acid of helper virus in addition, wherein the nucleic acid of helper virus comprises the coding oncogene protein, the proteic nucleotide sequence of E1A particularly, it has following feature respectively and gives adenovirus following feature: it does not preferably duplicate in the cell of YB-1 nuclear-feminine gender, and in being independent of the YB-1 nuclear-positive cells of cell cycle or performance go to duplicate in the cell of the YB-1 that regulates, at least a virogene of trans-activation, E1B55kDa particularly, E4orf6, E4orf3 and/or E3ADP, in YB-1 nuclear-positive cells, and/or cell YB-1 is not transferred in the nuclear.The present invention includes, transgenosis described herein is by helper virus individually or concentrated area coding and/or express.All use helper virus for I group adenovirus and II group adenovirus.

And in an embodiment of this adenoviral replication according to the present invention system, the nucleic acid of adenoviral nucleic acid and/or helper virus is to exist as reproducible carrier.

The present invention comprises that also the nucleic acid of coding I group adenovirus and/or II group adenovirus preferably is present in the expression vector, and this expression vector is used according to the invention.

On the other hand, the invention still further relates to the vehicle group that comprises at least two carriers, wherein vehicle group comprises the adenoviral replication system that is used for I group adenovirus and/or II group adenovirus as described herein altogether, and vehicle group is used according to the invention.In one embodiment, each element arrangements of adenoviral replication system is on single carrier, preferred expression carrier.

At last, another aspect of the present invention also relates to the application of cell, described cell contains one or several nucleic acid, the I of described nucleic acid encoding group adenovirus and/or II group adenovirus are preferably used according to the invention and will be used according to the invention, and/or corresponding adenoviral replication system and/or corresponding carrier and/or support according to the present invention group, be used for this paper about the described very identical purpose of various adenovirus.

Aforementioned adenovirus construct and particularly their nucleic acid and their nucleic acid of coding, also can be with in many parts form transfered cell, the preferred tumour cell, so because existence of various individual components, they can such one work, and derive from single nucleic acid and single or several adenovirus respectively as discrete component.

The adenovirus system of coding I group adenovirus used according to the invention and/or II group adenopathy, correspondence or the nucleic acid of its part also can be used as carrier and exist.Preferably, these carriers are virus vector.When nucleic acid comprised adenoviral nucleic acid, preferably virion was a carrier.Yet the present invention comprises that also described nucleic acid exists with plasmid vector.In each situation, carrier comprises and allows and the element of the optional expression of the nucleic acid of the propagation (promptly duplicating) of the nucleic acid that control is inserted and insertion.Appropriate carriers, preferred expression carrier and element separately are well known by persons skilled in the art, for example at Grunhaus, A., Horwitz, M.S., 1994, Adenoviruse as cloning vectors.In Rice, C., editor., Seminars in Virology describes among the London:Saunders Scientific Publications.

Previous embodiments is considered in the aspect that relates to vehicle group, and both the various elements of described nucleic acid not necessarily only were included in the carrier.Therefore, vehicle group is made up of at least two carriers.In addition, carry out any argumentation about carrier and also be applicable to carrier and vehicle group respectively.

The feature of I group adenovirus and/or II group adenopathy is various nucleic acid disclosed herein and gene product respectively, and can comprise well known by persons skilled in the art in addition and be wild-type adenovirus inherent all that element (Shenk, T.:Adenoviridae:The virus and their replication.FieldsVirology, the 3rd volume, editor .Fields, B.N., Knipe, D.M., Howley, P.M. etc., Lippincott-Raven Publishers, Philadelphia, 1996, the 67 chapters).

In order to explain rather than limit the present invention, below duplicating of adenovirus will be discussed simply.

Duplicating of adenovirus is very complicated process, normally based on human transcription factor E2F.During virus infection, at first express " early gene " E1, E2, E3 and E4." late gene " group is responsible for the structural protein of synthetic virus.For the activation of early gene and late gene, play crucial effect by the E1 zone that encode different E1A and proteic two the transcriptional units E1A of E1B and E1B form, because they induce E2, E3 and E4 gene transcription (Nevins, J.R., Cell 26,213-220,1981).In addition, the DNA that E1A albumen can start in the resting cell is synthetic, and therefore impels them to enter the S phase (referring to Boulanger and Blair, 1991).In addition, the tumor inhibitor of they and Rb class interact (Nature 334 for Whyte, P. etc., 124-127,1988).In this case, discharge cell transcription factor E2F.The E2F factor can be subsequently in conjunction with the corresponding promoter region (particularly adenovirus E2 early promoter) of cytogene and virogene, and cause and transcribe and duplicating thus (Science 258 for Nevins, J.R., 424-429,1992).The activity of pRb and E2F is regulated by phosphorylation.The low phosphorylation form of pRb mainly is present in G1 and M phase.On the contrary, the super phosphorylation form of pRb is present in S and G2 phase.By the phosphorylation of pRb, from the complex body that the pRb by E2F and low phosphorylation forms, discharge E2F.E2F is from causing the dependent gene transcription of E2F by the release the complex body of the pRb of E2F and low phosphorylation.Only in conjunction with the pRb of low phosphorylation form, wherein E1A takes place by the proteic CR2 of E1A zone with combining of pRb is most of E1A albumen.In addition, it also combines with the CR1 zone, although avidity lower (Ben-Israel and Kleiberger, Frontiers in Bioscience, 7,1369-1395,2002; Helt and Galloway, Carcinogenesis, 24,159-169,2003).

The initiation of duplicating and finish the gene product that needs the E2 zone especially is because three key proteins of they codings.Proteic the transcribing of E2 controlled by two promotors, " the early stage E2F-dependent form of E2-" promotor, it is also referred to as E2-early promoter or early stage E2 promotor in this article, " E2-late period " promotor (Swaminathan and Thimmapaya, The Molecular Repertoire ofAdenoviruses III:Current Topics in Microbiology and Immunology, volume 199,177-194, Springer Verlag 1995).In addition, the product in E4 zone plays an important role to the activity of E2F and the stability of p53 with E1A and E1B-55kDa albumen.For example, by by the E4orf6/7 of E4 regional code and the heterodimer direct interaction of forming by E2F and DP1 trans-activation E2 promotor (Swaminathan and Thimmapaya, JBC 258,736-746,1996) more.In addition, p53 makes the complex body inactivation of being made up of E1B-55kDa and E4orf6 (Oncogene 16 for Steegenga, W.T. etc., 349-357,1998), so that successfully finish the infectious cycle of cracking performance.In addition, E1B-55kDa albumen has another critical function, and promptly when with the E4orf6 protein-interacting, it promotes viral RNA output from nuclear, and wherein the RNA of cell remains in the nuclear (Bridge and Ketner, Virology 174,345-353,1990).Another important discovery is that the protein complexes of being made up of E1B-55kDa/E4orf6 is positioned so-called " viral inclusion body ".Infer that these structures are the sites (Ornelles and Shenk, J.Virology 65,424-429,1991) of duplicating and transcribing.

For duplicate, particularly another important area for the release of adenovirus is the E3 zone.The E3 zone more specifically comprises the genetic information of multiple relative small protein, and this albumen is not that the adenovirus Infection in Vitro cycle (promptly in cell cultures) is necessary.Yet the survival of their virus during for acute in the body and/or latent infection plays an important role, because they especially have immunomodulatory and apoptosis function (Marshall S.Horwitz, Virololgie, 279,1-8,2001; Russell, above).Can confirm that the albumen with about 11.6 kDa sizes can inducing cell death.Because its function, this albumen is called ADP-english term adenovirus death protein-(Tollefson, J.Virology, 70,2296-2306,1996).This albumen mainly forms in the late period of infectious cycle.And proteic overexpression causes the better cracking (Doronin etc., J.Virology, 74,6147-6155,2000) of cells infected.

And, the virus of the known disappearance of the present inventor E1A, promptly do not express any 12S E1A albumen particularly and do not express proteic those viruses of any 13S E1A yet, they can duplicate (Nevins J.R. very efficiently under higher MOI, Cell 26,213-220,1981), yet it can not be realized in clinical application.This phenomenon is called " class E1A activity " in the literature.Also known from 5 albumen of E1A coding, two albumen, i.e. 12S and 13S albumen, (Cell 26 for Nevins, J.R., 213-220,1981 to control and induce the expression of other adenoviral gene respectively; Boulanger, P. and Blair, E.; Biochem.J.275,281-299,1991).This has confirmed that the proteic CR3 of 13S zone shows trans-activation function (Wong HK and Ziff EB., J Virol., 68,4910-20,1994) particularly.Yet, in the proteic CR1 of 13S and/or CR2 zone and/or the adenovirus of CR3 zone with particular hole be replication defect type basically, still trans-activation virogene and promotor in other clone, E2 zone (Wong HK, Ziff EB., J Virol.68 particularly, 4910-20,1994; Mymryk, J.S. and Bayley, S.T., Virus Research 33,89-97,1994).

Use the wild-type adenovirus cells infected, typically after the tumour cell, by E1A, E1B-55K and E4orf6 YB-1 is imported in the nuclear, be positioned viral inclusion body altogether with E1B-55K in nuclear, it allows, and ground effectively duplicates in nucleus in virosome other places and the body.Had been found that before that E4orf6 also can be in conjunction with E1B-55K (Weigel, S. and Dobbelstein, M.J.Virology, 74,764-772,2000; Keith N.Leppard, Seminars in Virology, 8,301-307,1998), and therefore mediate the E1B-55K transhipment respectively and be assigned in the nuclear, it guarantees best virus production and adenoviral replication.Pass through E1A respectively, the synergy of E1B-55K and YB-1, by the complex body of forming by E1B-55K/E4orf6 and YB-1, YB-1 and E1B-55K are in the common location of so-called viral inclusion body in nuclear, according to effectively duplicating of virus of the present invention is possible, therefore virus described herein is used for duplicating at cell, described cell is a YB-1 nuclear-male, the cell that preferably in being independent of the nuclear of cell cycle, contains YB-1, and/or contain or show the cell that removes the YB-1 that regulates, and/or preparation medicine, be used for the treatment of disease, wherein relate to YB-1 nuclear-positive cells, preferably in being independent of the nuclear of cell cycle, contain the cell of YB-1, and/or contain or show the cell that removes the YB-1 that regulates.Therefore, it is possible being replicated in this cell background, causes the cracking of cell, the release of virus and the infection and the cracking of flanking cell, and therefore in the situation of difference infected tumor's cell and tumour, oncolysis promptly takes place the final cracking of tumour.

YB-1 belongs to the classification of the high conservative factor, and it is in conjunction with reverse CAAT sequence, and it is called the Y-box.They can with the mode of regulating transcribe and translation skill on work (Wolffe, A.P.Trends in Cell Biology 8,318-323,1998).In growth and the activation of gene participating in apoptosis and inhibition, found the dependent adjusting approach of increasing Y-box (Swamynathan, S.K. etc., FASEB J.12,515-522,1998).For example, YB-1 is direct and p53 interacts, and (Oncogene 19,6194-6202 for Okamoto, T. etc., 2000), (Gene 252,1-13 for Lasham, A. etc. in Fas genetic expression, 2000), in genetic expression (Stein, U. etc., JBC276,28562-69,2001 of MDR and MRP; Bargou, R.C. etc., Nature Medicine 3,447-450,1997) and the activation of topoisomerase and metalloprotease (Mertens.P.R. etc., JBC 272,22905-22912,1997; Shibao, K. etc., Int.J.Cancer 83,732-737,1999) in play the essence effect.In addition, YB-1 also participates in regulating mRNA stability (Genes﹠Development 14 for Chen, C-Y. etc., 1236-1248,2000) and repair process (Ohga, T. etc., Cancer Res.56,4224-4228,1996; Izumi H. etc., Nucleic Acid Research 2001,29,1200-1 207; IseT. etc., Cancer Res., 1999,59,342-346).

By being present in the YB-1 in the nuclear that is independent of the cell cycle, or by transferring to the YB-1 that going in the tenuigenin regulated that is present in the nuclear by I group adenovirus and/or II group adenovirus, YB-1 locatees in the nuclear of tumour cell, cause in not expressing and use any 12S E1A albumen or any 13S E1A protein process, being independent of the virus replication (Holm of E1A, P.S. wait JBC 277,10427-10434,2002), and in the situation of protein Y B-1 overexpression, cause multi-medicine resistance.In addition, known adenovirus protein for example E4orf6 and E1B-55K has active effect (Goodrum, F.D. and Ornelles, D.A to virus replication, J.Virology 73,7474-7488,1999), wherein function E1A albumen is responsible for activating other virogene product (as E4orf6, E3ADP and E1B-55K) (Nevins J.R., Cell 26,213-220,1981).Yet this adenovirus for the known E1A-feminine gender of prior art does not take place, and does not have 13S E1A albumen in this adenovirus.YB-1 allows duplicating with particle of the negative virus of this E1A-to form respectively in the position of appraising and deciding that nuclear contains in the cell of multi-medicine resistance of YB-1.Yet in this case, Ad5 compares with wild-type, and virus replication and granuloplastic efficient reduce several times.In contrast to this, the combination of YB-1 allows the extremely effectively virus replication and the particle of YB-1 mediation to form, therefore and provide oncolysis, wherein YB-1 is Already in the nuclear of tumour cell, it may be from the YB-1 that is positioned at the nuclear that is independent of the cell cycle, perhaps wherein being present in the YB-1 that going in the tenuigenin regulate is transferred in the nuclear by I group adenovirus and/or II group adenovirus, perhaps introduce nucleus by external factor (for example dosed cells growth inhibitor or irradiation or overheated), promptly induce and be present in the nuclear, particularly be independent of the cell cycle, perhaps as transgenosis by the carrier system, preferred adenovirus system imports, and this adenovirus system can start adenoviral gene but not show virus replication.This also is applicable to according to adenovirus of the present invention, the I group adenovirus that promptly can duplicate effectively because of their specific design, and result of use, be E1B albumen, preferred E1B55K albumen and/or E4 albumen, preferably E4orf6 albumen provides YB-1, the preferably effective mobilization in nuclear.According to all respects of the present invention, the suitable cytostatic agent that can use with adenovirus disclosed herein is for example to belong to those of following group: anthracycline, as daunomycin and Dx; Alkylating agent is as endoxan; Alkaloids is as Etoposide; The vinca-alkaloid class is as vincristine(VCR) and vinealeucoblastine(VLB); Antimetabolite such as 5 FU 5 fluorouracil and methotrexate (methrothrexat); Platinum derivatives, for example cis-platinum; Topoisomerase enzyme inhibitor, as camphothecine, CPT-11; Taxanes, for example taxol (taxole), taxol (paclitaxel); Histone-deacetylase inhibitors, FR901228 for example, MS-27-275, trichostatine A; The MDR adjusting control agent, MS-209 for example, VX-710, and geldanamycin derivant, for example 17-AAG.Adenovirus disclosed herein, particularly recombinant adenovirus, only can examine at YB-1-positive cells in and containing, preferably in tenuigenin, containing in the cell of the YB-1 that regulates and duplicating, compare with the corresponding trans-activation ability of wild-type adenovirus, particularly wild-type Ad5, they are at trans-activation virogene E1B-55K, E4orf6, the ability aspect of E4orf3 and E3ADP is limited.The present inventor is surprised to find that now, and these limited trans-activation abilities can be by expressing corresponding gene, particularly E1B-55K and E4orf6 and overcoming in conjunction with the position of appraising and deciding of YB-1.Shown in this paper embodiment, the virus replication under this condition forms with particle and increases to respectively and can form the level that activity is compared with particle with the replication activity of wild-type adenovirus.

Adenovirus used according to the invention and as herein described medicine relevant or that prepare it is intended to common systemic administration, although topical application or transmit this medicine also within the scope of the present invention.This application is intended to use especially those cells of adenovirus infection, and be intended to take place especially therein duplicating of adenovirus, it preferably participates in illness, the typically formation of disease in the mode of cause and effect, in order to diagnose and/or to prevent and/or treat them, has used according to medicine of the present invention.

This medicine is preferred for treatment: malignant diseases, neoplastic disease, carcinous disease, cancer and tumour, if wherein not opposite explanation, these terms use in the mode of synonym in fact in this article.Neoplastic disease is preferably: wherein the mechanism of neoplastic disease, particularly because pathology mechanism causes YB-1 to be positioned in the nuclear, preferably to be independent of the cell cycle, perhaps wherein because the external source measure causes YB-1 to be present in the nucleus, wherein said external source measure is suitable for YB-1 is transferred in the nucleus, or induces or express YB-1 there.Term tumour used herein or neoplastic disease should comprise pernicious and benign tumour, solid tumor and diffusion knurl and various diseases.In one embodiment, this medicine comprises at least a other pharmaceutical active compounds.This other the character of pharmaceutical active compounds and the kind that quantity will depend on the indication of drug use.Medicine be used for the treatment of and/or the situation of prophylaxis of tumours disease in, typically use cytostatic agent, for example cis-platinum and taxol, daunoblastin, daunorubicin (daunorubicin), Dx and/or mitoxantrone or other cytostatic agent as herein described or cytostatic agent group, preferably as about the YB-1 of cytostatic agent mediation appraise and decide the position described those.

Can there be the preferred liquid form with various preparations according to medicine of the present invention.And medicine will comprise adjuvant, for example stablizer, buffer reagent, sanitas and formulation art known to the skilled those.

The present inventor is surprised to find that, virus as herein described, preferred I group adenovirus and/or II group adenovirus can be applied to tumour with very high success ratio according to application of the present invention, they can be used for the medicine of this tumour of production for treating, and described tumour contains YB-1 at the nuclear that is independent of the cell cycle.Usually, YB-1 is arranged in tenuigenin, particularly exists in all kytoplasms of nuclear.In the G1/S-phase of cell cycle, in the nucleus of normal cell and tumour cell, can find YB-1, wherein part YB-1 remains in [J ü rchott K etc., JBC 2003,278,27988-27996] in the tenuigenin.Yet, use the adenovirus of modifying so also to be not enough to provide the oncolysis of virus.The low relatively effect of this attenuation adenovirus described in the prior art finally is because their mistake is used.In other words,, preferably use I group adenovirus and/or II group adenovirus, when the molecular biology prerequisite of viral oncolysis is provided, can use these adenovirus systems especially with higher effect when the virus of these attenuations of use as described herein or modification.When wanting adenovirus as herein described used according to the invention, as Ad Δ 24, dl922-947, E1Ad/01/07, CB016, dl520 and the recombinant adenovirus of describing in European patent EP 0 931 830, prerequisite is provided in following tumour: its cell demonstrates the position of appraising and deciding that is independent of the cell cycle of YB-1.The position of appraising and deciding of this form can be that character by tumour self causes, and maybe can be to be caused according to measure of the present invention or reagent of the present invention by disclosed herein.Therefore the present invention has defined one group of new tumour and neoplastic disease, therefore also defined one group of patient, its can be used according to virus of the present invention, as preferred I group adenovirus and/or II group adenovirus, but also use the adenovirus of the attenuation described in the prior art or modification and successfully treatment.

Another group patient guarantees by applying or realizing that actual conditions makes YB-1 move in the nuclear or introduce or transfer to wherein, or wherein there are those patients remove the YB-1 that regulates, it can organize adenovirus and/or II group adenovirus by I used according to the invention, or for example prior art is known and want adenovirus used according to the invention, perhaps use the adenovirus of describing for the first time in this article, preferred these adenovirus that in E1A albumen, have sudden change and disappearance respectively of using, it does not disturb the combination of Rb/E2f or its not to duplicate in the cell of YB-1 nuclear-feminine gender, perhaps demonstrate the duplicating as defined herein of remarkable minimizing, and/or has and/or shows a cancer protein of disappearance, E1A particularly, for example at virus of A d Δ 24, dl922-947, E1Ad/01/07 is in the situation of CB106 and the adenovirus described in European patent EP 0 931 830.Be based on discovery with application of this group patient relevant I group adenovirus and/or II group adenovirus, promptly virus replication induce the position of appraising and deciding that is based on YB-1, YB-1 combines with the E2-late promoter subsequently.Because discovery disclosed herein, adenovirus such as Ad Δ 24, dl922-947, E1Ad/01/07, the adenovirus that CB106 and/or European patent EP 0 931 830 described also can be duplicated in following cell: YB-1 nuclear-male, and/or YB-1 is defined the cell that the mode of regulating exists with the present invention therein.Therefore, these adenovirus can be used for the treatment of disease and the patient group according to the present invention, and it comprises the cell with these features, particularly during the formation of the various diseases that will treat when these cells participations.This is an Ad Δ 24, dl922-947, E1Ad/01/07, the successful basis for the treatment of these tumours according to the present invention of CB016 and the adenovirus of in patent EP0 931 830, describing and I group adenovirus and/or II group adenovirus, these tumours contain YB-1 at the nuclear that is independent of the cell cycle, perhaps contain the YB-1 that going on the present disclosure meaning regulated.Virus, particularly I group adenovirus that the virus that can use by the present invention can be used according to the invention described herein and using is described in this article for the first time and/or the treatment of II group adenovirus are YB-1 nuclear-male patients according to another group patient of the present invention's treatment, and/or because what follows treatment causes YB-1 nuclear-male patient, and/or will experience a kind of following measure, preferably on the treatment meaning, before using adenovirus, follow and use each adenovirus or use patient after the adenovirus.The present invention includes, YB-1 nuclear-positive patient is that the nuclear at the cell of many formation tumours that are independent of the cell cycle contains YB-1 and/or contain the patient of the YB-1 that regulates in such cell.A kind of in these measures be, as a whole and/or as use cytostatic agent as described herein used in the oncotherapy.In addition, irradiation, particularly used irradiation belongs to this class measure in oncotherapy.Irradiation particularly refers to use the irradiation of high-energy radiation, and preferred radioactive radiation is preferably as used in oncotherapy.Other measure is respectively overheated overheated with application, and that preferably uses in oncotherapy is overheated.In particularly preferred embodiments, the part apply overheated.At last, other measure is hormonotherapy, particularly the hormonotherapy as using in oncotherapy.In the process of such hormonotherapy, use anti-estrogen agent and anti--male sex hormone agent.Relevant with it, estrogen antagonist is tamoxifen for example, is used in the treatment of mammary cancer especially and androgen antagonist for example flutamide or cyproterone acetate, is used in the treatment of prostate cancer especially.

Adenovirus as herein described can also be used for the treatment of tumour, and wherein said tumour is selected from the group that comprises primary tumor, inferior property tumour, third stage tumour and metastatic tumo(u)r.Relevant therewith, tumour preferably shows at least one following characteristics, promptly has YB-1 in their nuclear that is independent of the cell cycle, and regardless of its reason, and/or they contain the YB-1 that regulates.

The present invention includes, cell and tumour comprise such cell respectively, adenovirus according to the present invention is duplicated therein, perhaps can duplicate therein, described cell or tumour have one or more feature as herein described, feature is more specifically, they contain YB-1 in being independent of the nuclear of cell cycle, regardless of its reason, and/or they contain the feature of the YB-1 that regulates, and these cells and tumour can be used respectively according to I of the present invention group adenovirus and/or II group adenovirus and treat, and described adenovirus can be used for their medicine of production for treating, and wherein said adenovirus can be expressed the nucleic acid of the YB-1 that encodes.Therefore, 3 types cell and tumour are therefore arranged preferably, can duplicate therein according to I of the present invention group adenovirus and/or II group adenovirus, and use these adenovirus to treat respectively, preferred cracking they:

A group: the cell that in being independent of the nuclear of cell cycle, contains YB-1;

B group: in nuclear, particularly do not contain YB-1 in the non-nuclear that is independent of the cell cycle, but contain the cell of the YB-1 that regulates; With

C group: in nuclear, particularly do not contain YB-1 in the non-nuclear that is independent of the cell cycle, and do not contain the cell of the YB-1 that regulates.

For A group cell, that does not express other YB-1 organizes adenovirus according to adenovirus of the present invention, particularly I, can be used to duplicate or cracking.But that expresses other YB-1 organizes adenovirus according to this class adenovirus of the present invention, particularly I, also can be used to duplicate or cracking.This also is applicable to the B group.Wish not limitedly, its reason seems, because E1B albumen, concrete E1B55K albumen and/or E4 albumen, the concrete proteic effect of E4orf6 have been guaranteed respectively effectively to duplicate by the location and the transfer YB-1 in this nuclear of YB-1 in nuclear.The YB-1 that adenovirus is expressed has in addition supported this process.

Under the situation of C group, preferably, will be used to duplicate or cracking according to those adenovirus of the present invention, particularly I group adenovirus, they express YB-1 in addition.Its reason seemingly wishes that still not limited, above-mentioned virus replication is not activated in specific cell background, so that can take place effectively to duplicate.Only respectively by YB-1 being provided and expressing YB-1, will take place effectively to duplicate, mechanism wherein is seemingly such, and the overexpression of YB-1 causes the position of appraising and deciding of YB-1, as also being documented in Bargou[Bargout R.C. etc., Nature Medicine 1997,3,447-450] and J ü rchott[J ü rchott K. etc., JBC 2003,278,27988-27966] in.

The present invention includes, some form tumours cell this in nuclear, contain YB-1 or do like this or inducing and activating and contain YB-1 after importing in the nuclear, or comprise the YB-1 that going on the present disclosure meaning regulated.Preferably, about 5% or any tumour than its bigger per-cent (promptly 6%, 7%, 8% etc.) to form cell be this YB-1 nuclear-positive cells, or wherein the cell of the YB-1 that regulates is removed in existence.For other tumour, for example mastadenoma, osteosarcoma, ovarian cancer, arthrocarcinoma or lung cancer, containing the YB-1 that regulates or show the per-cent that the YB-1 that is independent of the cell cycle examines localized tumour cell can be about 30～50%[Kohno K. etc., BioEssays 2003,25,691-698].Such tumour can preferably be used according to adenovirus treatment of the present invention.Coerce by the outside respectively and apply and coerce the position of appraising and deciding that to induce YB-1 by the part.This inducing can for example be passed through irradiation, particularly UV irradiation, uses as especially disclosed in this article cytostatic agent and overheated the generation.About overheated, importantly now can be in very specific mode, more specifically realize in partial mode, therefore can also cause the specific nuclear translocation of YB-1 in nuclear, therefore, therefore adenoviral replication and cell and tumour cracked prerequisite are provided, it is (Stein U, Jurchott K, the Walther W of partial restriction preferably, Bergmann S, Schlag PM, Royer HD.J Biol Chem.2001,276 (30): 28562-9; Hu Z, Jin S, Scotto KW.JBiol Chem.2000 Jan 28; 275 (4): 2979-85; Ohga T, Uchiumi T, Makino Y, Koike K, Wada M, Kuwano M, Kohno K.J Biol Chem.1998,273 (11): 5997-6000).

Therefore medicine of the present invention also can be applied to patient and patient group, maybe can design for them, wherein by before the suitable treatment or treatment back or follow treatment to realize the transhipment of YB-1 respectively, the transhipment in various tumour cells especially, and in cell, generate and remove the YB-1 that regulates.

Based on this technology instruction provided herein, those skilled in the art carry out suitable improvement in its technical scope, particularly to E1A, for example it can comprise and produces disappearance or point mutation so that therefore produce the various embodiments of adenovirus, and it can use in application according to the present invention.

Explain that as above I group adenovirus and/or II group adenovirus can contain in these cells of YB-1 and the cell system duplicates in nuclear.Whether can duplicate and problem that therefore can the cracking tumour about adenovirus used according to the invention, the state that contains or do not contain the cell of Rb (being retinoblastoma inhibitor product) is incoherent.In addition, about described adenovirus according to application of the present invention, when using the adenovirus system relevant disclosed herein with YB-1 nuclear-positive cells (promptly containing the cell of YB-1) at the nuclear that is independent of the cell cycle, do not need the state considering cells infected, treat the p53 of cells infected or cell to be treated, this p53 state and Rb state have no effect to the duplicating of adenovirus of implementing technology instruction disclosed herein.

The oncogene of trans-activation and oncogene protein, particularly E1A, preferred II group adenovirus can be respectively under the control of all natural adenovirus promoters and/or by promotor control tumour-specific or tissue-specific.Suitable non-adenovirus promoter can be selected from comprise cytomegalovirus promoter, RSV (Rous sarcoma virus) promotor, based on the promotor Va I of adenovirus and YB-1 promotor (the Makino Y. etc. of non-virus, Nucleic Acids Res.1996,15,1 873-1878).Other promotor that can use aspect any in the present invention disclosed herein is telomerase promoter, alpha-fetoprotein (AFP) promotor, caecinoembryonic antigen promotor (CEA) (Cao, G., Kuriyama, S., Gao, J., Mitoro, A., Cui, L., Nakatani, T., Zhang, X., Kikukawa, M., Pan, X., Fukui, H., Qi, Z.Int.J.Cancer, 78,242-247,1998), L-fimbrin promotor (Chung, I., Schwartz, PE., Crystal, RC., Pizzorno, G, Leavitt, J., Deisseroth, AB.Cancer Gene Therapy, 6,99-106,1999), arginine vasopressin promotor (Coulson, JM, Staley, J., Woll, PJ.British J.Cancer, 80,1935-1944,1999), the E2f promotor (Cancer Res. such as Tsukada, 62,3428-3477), uroplakin II promotor (Zhang etc., Cancer Res., 62,3743-3750,2002) and PSA promotor (Hallenbeck PL, Chang, YN, Hay, C, Golightly, D., Stewart, D., Lin, J., Phipps, S., Chiang, YL.HumanGene Therapy, 10,1721-1733,1999), tyrosine oxidase promotor (Nettelbeck, DM.Anti-Cancer Drugs, 14,577-584,2003), cyclo-oxygenase 2 promotors (Nettelbeck, DM., Rivera, AA, Davydova, J., Dieckmann, D., Yamamoto, M., Curiel, DT.Melanoma Res., 13,287-292,2003) and inducible system tsiklomitsin (Xu, XL. for example, Mizuguchi, H., Mayumi, T., Hayakawa, T.Gene, 309,145-151,2003).In addition, the YB-1 dependency E2-late promoter as German patent application DE 101 50 984.7 described adenovirus is to be used for promotor of the present invention.

Known telomerase promoter is of crucial importance in the human cell.Therefore, telomerase activation is by the regulating and controlling of transcribing of telomerase reverse transcriptase gene (hTERT), and hTERT is the catalytic subunit of enzyme.Telomerase to be expressed among 85% the human tumor cell be activatory.In contrast, its non-activity in most of normal cells.Sexual cell and embryonic tissue do not contain its (Braunstein, I. etc., CancerResearch, 61,5529-5536,2001; Majumdar, A.S. etc., Gene Therapy 8,568-578,2001).More detailed research confirms to the hTERT promotor, and the fragment away from the promotor of initiator codon 283bp and 82bp is enough to (Braunstein I. etc. specific expressed in tumour cell respectively; Majumdar AS etc., above).Therefore, this promotor and specific fragment are fit to specific expressed in tumour cell of one of gene and particularly transgenosis, preferred transgenosis disclosed herein respectively.Promotor should allow the oncogene of modifying, preferred E1A oncogene protein only to express in tumour cell.In addition, in one embodiment, under the control that is expressed in these promotors of transgenosis in this adenovirus carrier, described transgenosis is preferably selected from and comprises E4orf6, E1B55kD, the group of ADP and YB-1.The present invention also comprises, the proteic open reading-frame (ORF) of trans-activation oncogene protein, particularly E1A is in the framework of the gene product of or several adenovirus systems.Yet the proteic open reading-frame (ORF) of trans-activation E1A also can be therefrom independently.

The present invention includes, above-mentioned various promotors also are used for each embodiment according to adenovirus of the present invention, preferred I group adenovirus, particularly in the promotor of the promotor that will use and each proteic expression of control or expression product in wild-type adenovirus not simultaneously.Aforementioned promotor thereby be allogeneic promoter on the suitable meaning of the present invention.In the preferred embodiment of adenovirus according to the present invention, particularly I group adenovirus, when adenovirus being applied to above-mentioned A group and B group cell, think that the proteic expression of E1B albumen and/or E4 is from such allogeneic promoter, wherein preferably but be not exclusively, the proteic expression of E1A is controlled by YB-1.In the embodiment of this embodiment and other, E1A is proteic to be expressed under the control of the controllable promotor of YB-1, for example adenovirus 2-late promoter.When E1B albumen and/or E4 albumen are when expressing in an expression cassette, this also is suitable for.

In the preferred embodiment of adenovirus according to the present invention, particularly I group adenovirus, when adenovirus being applied to above-mentioned C group cell, each promotor is tumour-specific, organ specific or tissue-specific promotor independently.Relevant therewith, when at least one control E1B albumen, E4 albumen and/or the proteic expression promoter of E1A are enough when being such specificity promoter.By such tumour, organ and tissue specificity, guaranteed according to the duplicating in the cell that only occurs over just corresponding tumour, organ and tissue of adenovirus of the present invention, and, in addition, there is not other tissue to be subjected to the destruction of adenoviral replication, for example cleaved.Preferably, also have second and more preferably, control by such tumour-specific, organ specific or tissue-specific promotor for all 3 kinds.Use such adenovirus, can also cracking can not form the cell that tumour maybe can not develop into such tumour, but for other reason medical reasons for example, destroy them or they are removed from organism, the preferred mammal organism, more preferably the people organism for example produces undesirable factor or produces such factor with too high level because of them.

In one embodiment, think that using described adenovirus cracked cell according to the present invention is resistance, preferably shows multiple resistance.

Resistance is tumour and the patient's that will treat a feature as mentioned here, and they still are not limited to them: MDR, MRP, topoisomerase, BCL2, gsh-2-transferring enzyme (GST), protein kinase C (PKC) by following gene mediated.Because cytostatic agent is especially based on cell death inducing, the expression of gene relevant with apoptosis plays a crucial role in the generation of any resistance, make that the following factor also is relative, be Fas, BCL2 family, HSP 70 and EGFR[Kim etc., Cancer Chemther.Pharmacol.2002,50,343-352].

Levenson etc. [Levenson, V.V. etc., Cancer Res., 2000,60,5027-5030] put down in writing, and the expression ratio of YB-1 in the tumour cell of resistance significantly improves in nonresistant tumour cell.

Resistance preferably is meant the resistance to cytostatic agent as herein described as used herein.This multi-medicine resistance resistance is preferably consistent with the expression of film binding transport albumen P-glycoprotein, preferred overexpression, and it can be as the mark of determining various cells, therefore can also be as the mark of tumour with this mark and all kinds of patient group.Term resistance used herein also comprises the resistance of P-glycoprotein mediation, and it is also referred to as typical resistance, and the resistance that is called the atypia resistance, and it is the MRP mediation, or other, the resistance of non-P-glycoprotein mediation.Another expresses relevant mark with YB-1 is topoisomerase II α.Therefore, whether can use adenovirus to count on one's card with acquisition, can in replacement or the screening method except determining the YB-1 in nuclear, use topoisomerase II α according to the present invention's treatment in order to determine the patient.In principle, a kind of can similar mark as P-glycoprotein be MRP.At least with regard to the patient of colorectal cancer cell or trouble colorectal cancer, another mark is PCNA (proliferating cell nuclear antigen) (Hasan S. etc., Nature, 15,387-391,2001), described (Shibao K etc., Int.Cancer such as Shibao K. for example, 83,732-737,1999).At last, in breast cancer cell and osteosarcoma cell field, the expression of MDR (multiple medicine resistance) is the mark (Oda Y etc., Clin.Cancer Res., 4,2273-2277,1998) on above-mentioned meaning at least.Another feasible mark that can be used according to the invention is p73 (Kamiya, M., Nakazatp, Y., J Neurooncology 59,143-149 (2002); Stiewe etc., J.Biol.Chem., 278,14230-14236,2003).

At last, also YB-1 should be thought the omen mark of mammary cancer, it can use in the present invention.Only have among the patient that the YB-1 of rising expresses, can after operation and chemotherapy, occur recurring Int.J.Cancer 2002,97 such as [, 278-282] Janz M. in primary tumo(u)r.

A peculiar advantage of the present invention also is, use and as herein describedly also can treat those patients according to adenovirus of the present invention, otherwise it is no longer medicable that these patients are considered to be on the clinical meaning, therefore utilize art methods treatment neoplastic disease no longer may expect to succeed, particularly when cytostatic agent and radiating use no longer be rationally possible and no longer can influence or the meaning of minimizing tumour on successfully carry out the time.The term tumour typically refers to any tumour or Cancerous disease at this paper, its inherently in nucleus, preferably be independent of the nuclear of cell cycle and contain YB-1, or contain YB-1 by using as the measure of adding disclosed herein, and/or they contain the YB-1 that regulates.

And virus as herein described can be used for the treatment of tumour in principle.Preferably, these tumours are selected from the group that comprises mammary cancer, ovarian cancer, prostate cancer, osteosarcoma, glioblastoma, melanoma, small cell lung cancer and colorectal cancer.Other tumour is those of resistance of having as described herein, preferably has those of multiple resistance, especially still those tumours of above-mentioned group.Particularly preferred tumour is to be selected from the group that comprises breast tumor, bone tumor, gastric tumor, intestinal tumor, tumor of gallbladder, carcinoma of the pancreas, liver tumor, tumor of kidney, brain tumor, ovarian tumor, skin and cutaneous appendage tumour, head/neck tumour, hysteroma, pass plethora, laryngeal tumor, salivary gland tumor, esophagus knurl, glossoncus knurl and prostate tumor.Be correlated with therewith, preferably whole as described herein being expressed of these tumours.

Adenovirus of the present invention, preferably I organizes adenovirus and wants adenovirus used according to the invention, preferably II group adenovirus.

The application as medicine of adenovirus as herein described, particularly I group adenovirus and/or II group adenovirus, relevant with the whole body administration especially, can improve by the suitable target of adenovirus.The infection of tumour cell is depended on especially to a certain extent the existence of the integrin of coxackievirus-adenovirus receptor CAR and uniqueness by adenovirus.They in case in tumour cell strong expression, it is possible taking place to infect at unusual low liter (pfu/ cell).In order to realize the target again of so-called recombinant adenovirus, attempted multiple strategy so far, for example respectively by heterologous sequence being inserted into the fiber tuberal area, use the antibody of dual specific, use the polymer coating adenovirus, part is imported the Ad fiber, serotype 5 tubercles (knob) and serotype 5 fibre axis (shaft) and tubercle are replaced by serotype 3 tubercles and Ad 35 fibre axis and tubercle, modify penton substrate (penton base) (Nicklin S.A. etc., Molecular Therapy 2001,4,534-542; Magnusson, M.K. etc., J.of Virology 200 1,75,7280-7289; Barnett B.G. etc., Biochimica etBiophysicaActa 2002,1575,1-14).The present invention includes, organize in the adenovirus in adenovirus according to the present invention and adenovirus, particularly I group adenovirus and II used according to the invention respectively, realize other the such embodiment and all respects of the present invention of feature.

On the other hand, the present invention relates to screen patient's method, this patient can use a kind of adenovirus treatment of modification, it is for example Ad Δ 24 of adenovirus used according to the invention, dl922-947, E1Ad/01/07, the virus of describing in CB016 or the European patent EP 0 931 830, and/or I group adenovirus and/or II group adenovirus, wherein said method comprises the following step:

-analyze tumor tissues sample and

-determine whether YB-1 is positioned in the nuclear that is independent of the cell cycle, and perhaps whether this cell contains the YB-1 that regulates.

Replace or, can detect the existence of above-mentioned mark except YB-1.

Contain YB-1, particularly be independent of the cell cycle at nuclear in tumor tissues or its part, or contain in the situation of the YB-1 that regulates, can adenovirus disclosed herein used according to the invention, particularly I group adenovirus and II group adenovirus.

In an embodiment of the method according to this invention, finish the analysis of tumor tissues by using reagent, this reagent is selected from the antibody that comprises at YB-1, at the fit of YB-1 with at the spiegelmer of YB-1 and at the group of the anti-caline (anticaline) of YB-1.In principle, can also prepare the reagent of identical type, and be respectively applied for mark separately.Antibody, particularly MONOCLONAL ANTIBODIES SPECIFIC FOR are well known by persons skilled in the art.The another kind of reagent of specific detection YB-1 or mark be with their target structure with high-affinity bonded peptide, the target structure in situation of the present invention is YB-1 or described mark.In order to produce such peptide, known in the prior art its method, for example phage-displaying.For this purpose, from the peptide storehouse, wherein single peptide has about 8-20 amino acid whose length, and the size in storehouse has 10 approximately ²-10 ¹⁸, preferred 10 ⁸-10 ¹⁵Plant different peptides.A kind of can be so-called anti-caline in conjunction with the target molecule of the special shape of polypeptide, and it is for example described in German patent application DE 197 42 706.

Be used for specifically in conjunction with YB-1 or respective markers disclosed herein, and detect therefore that to be independent of the YB-1 of cell cycle be so-called fit at endonuclear localized another kind of reagent, be D-nucleic acid, it is based on RNA or DNA, as strand or double-stranded the existence, and combine with target molecule specifically.Fit generation is for example described in European patent EP 0 533 838.Fit a kind of specific embodiments is so-called aptazyme, and it is for example at Piganeau, N. etc. (2000), and Angew.Chem.Int.Ed., 39, no.29 describes in the 4369-4373 page or leaf.They are fit specific embodiments, because they also comprise the ribozyme part except comprising fit part, after the target molecule in conjunction with fit part, ribozyme partly obtains catalytic activity and shears nucleic acid primer in combination or release, and this is accompanied by the generation of signal.

Another kind of the fit of form is so-called spiegelmer, i.e. the target molecule bind nucleic acid of being made up of L-nucleic acid.The method for preparing this spiegelmer is for example described in WO 98/08856.

Can or obtain the sample of tumor tissues by surgical operation by puncture.Whether YB-1 is positioned to be independent of assessment in the nuclear of cell cycle often by using microscopy and/or immunohistology analysis to carry out, typically uses antibody or any other aforementioned agents to finish.Known other method of those skilled in the art detects YB-1 existence and its location therein in nuclear and is independent of the cell cycle.For example, when scanning needle during, can easily detect the location of YB-1 to the painted tissue slice of YB-1.With having frequency become in nuclear the be independent of cell cycle localized indication of YB-1 in nuclear.Another possibility that detects the YB-1 in the nuclear is to dye and detect YB-1 whether be positioned to examine the stage interior and definite cell at YB-1 with being independent of the cell cycle.Yet the detection of this and YB-1 also can realize by using aforementioned reagent at YB-1.Carry out the detection of reagent by method known to those skilled in the art.Because described reagent points to other structure of other structure, particularly cell in the sample that YB-1 so debond will analyze specifically, by means of the appropriate flags of reagent and since they be attached to YB-1 specifically, can detect and analyze the location of described reagent, also have the location of YB-1.The method of labelled reagent is known to those skilled in the art.Contain in the cell for test sample and how much remove the YB-1 that regulates, can also use identical technology.Whether also showed expression owing to the YB-1 that goes to regulate compares with the YB-1 that does not go to regulate, YB-1 also can use with respect to the relative expression of reference sample, go to regulate in the cell of analyzing so that detect YB-1.

Now, utilize drawings and Examples to further specify the present invention, therefrom will obtain new feature, embodiment and advantage.With its relatively,

Fig. 1 has shown the structure design of adenovirus carrier, and this carrier is referred to herein as the adenovirus carrier of AdE1/E3-feminine gender, is the adenovirus of the E1/E3-of wild-type adenovirus and adenovirus dl520 disappearance;

Fig. 2 shown E1A albumen about in conjunction with p300, p107 and p105 in conjunction with the territory;

Fig. 3 has shown the U2OS cell, behind adenovirus Ad5 (this paper is called the Ad5 of E1/E3-feminine gender) and dl520 infection with the E1/E3-disappearance, does not contain YB-1 in its nuclear;

Fig. 4 has shown the 257RDB cell, behind adenovirus Ad5 (this paper is called the negative Ad5 of E1/E3-) and adenovirus dl520 infection with the E1/E3-disappearance, contains YB-1 at its nuclear;

Fig. 5 has shown at usefulness metainfective 257RDB cell of adenovirus dl1119/1131 and U2OS cell;

Fig. 6 has shown the result that EMSA analyzes, and it has confirmed that YB-1 is present in the cell and the clone 257RDB of multiresistance, 181 RDB, and in the nucleus of MCF-7Ad, and YB-1 is not present in the nuclear of U2OS and HeLa cell;

Fig. 7 has shown the proteic structure design of E1A of wild-type adenovirus, adenovirus dl520 and adenovirus dl1119/113 1;

Fig. 8 is the histogram that has shown adenoviral replication efficient in the presence of the viral protein of expressing in addition, is absolute figure;

Fig. 9 is the histogram that has shown that adenoviral replication efficient increases in the presence of the viral protein of expressing in addition;

Figure 10 has shown in violet staining and after with the dl520 infection of 10 and 30 pfu/ cells and the hole of the U2OS cell growth of contrast (K), does not use daunorubicin respectively and uses 40 ng daunorubicin/ml;

Figure 11 has shown in violet staining and after with the dl520 infection of 10 and 30 pfu/ cells and the hole of the HeLa cell growth of contrast (K), does not use daunorubicin respectively and uses 40 ng daunorubicin/ml;

Figure 12 be the gross tumor volume of tumour of different sources (RDB257 and HeLa) as the figure of the function of time, it is respectively after handling with PBS and dl520;

Figure 13 has shown the photo of the mouse that kills, is using PBS and 5 * 10 respectively ⁸Pfu dl520 has developed tumour based on this mouse of RDB257 cell after handling;

Figure 14 is the result of DNA hybridization engram analysis who has infected the cell extract (subcutaneous growth tumour) of later RDB257 cell of dl520 and HeLa cell;

Figure 15 is tumour cell (HeLa, U2OS) duplicating efficiency of the dl520 in and wild-type adenovirus and the granuloplastic histogram that has shown YB-1 nuclear-male tumour cell (257RDB and 181RDB) and YB-1 nuclear-feminine gender;

Figure 16 has shown the structure design of wild-type adenovirus and adenovirus carrier AdXVir03;

Figure 17 has shown the structure design of adenovirus carrier AdXVir03/01; With

Figure 18 A/B has shown in violet staining and after with Ad3 12 (20 pfu/ cell), Xvir03 (5 pfu/ cell) infection and the hole of the 18RDB cell (Figure 18 A) of contrast (infecting) and 272RDB cell (Figure 18 B) growth, wherein carries out violet staining in back 5 days in infection;

Figure 19 has shown the A549 cell of raq gene after having infected wild-type adenovirus Ad5 and adenovirus Ad3 12 and the result of the rna blot analysis of expression in the U2OS cell;

Figure 20 has shown the result of the rna blot analysis of the expression of raq gene in having infected 12 and 24 hours U2OS cell of wild-type adenovirus and adenovirus δ 24 backs;

Figure 21 has shown the structure design of adenovirus carrier XvirPSJL1;

Figure 22 has shown the structure design of adenovirus carrier XvirPSJL2;

Figure 23 has shown in violet staining and the hole of growing with the adenovirus dl520 infection back HeLa cell of different pfu/ cells;

Figure 24 has shown the active histogram of expression luciferase in the segmental U2OS cell of different promoters, HeLa cell and the 257RDB cell that use adenovirus 2-late promoter;

Figure 25 has shown that expression infects the histogram of the U2OS cells virion quantity after 2 days and 5 days with the adenovirus of expressing YB-1 and virus of A d3 12, wherein distinguishes between residual virion (being represented by black) and the extracellular virion (horizontal bar) that discharges in cell.Embodiment 1: the type that the E1A that adenovirus used according to the invention can comprise modifies

Fig. 1 has shown the structure design of adenovirus carrier AdE1/E3-feminine gender (being the adenovirus of E1/E3-disappearance), wild-type adenovirus and adenovirus dl520.

Adenovirus AdE1/E3-feminine gender does not contain the zone of E1A or the functional E1B or the E3 of encoding function, in this experiment as the toxicity contrast.

Wild-type e1a gene coding is 5 albumen altogether, and it is that selection montage by E1ARNA produces.Wherein, produce 2 different albumen, i.e. 289 amino acid whose albumen and 243 amino acid whose albumen.Dl520 289 the amino acid whose albumen of not encoding because there is disappearance in it in the CR3 zone of e1a gene, cause lacking the gene product of 13S.Operable adenovirus dl520 is called 12S-E1A virus by those skilled in the art according to the present invention.Adenovirus dl347 well known in the prior art (Wong und Ziff, J.Virol., 68,4910-4920,1994) also be can be used according to the invention 12S-E1A virus.

In 289 amino acid whose albumen, exist in 3 conservative between various adenovirus subclass zones by 13S-E1A mRNA coding.These are called CR1, CR2 and CR3.Although CR1 and CR2 exist in two kinds of E1A albumen (E1A 12S and E1A 13S), promptly in 289 amino acid and 243 amino acid whose albumen, the CR3 zone exists only in one bigger in aforementioned two albumen.

The virogene particularly activation of E1B, E2, E3 and E4 needs the CR3 zone.Only contain only trans-activation virogene pianissimo of less (promptly 243 amino acid whose) proteic virus, and do not promote in nuclear, not contain duplicating of adenovirus in those cells of YB-1.Because YB-1 exists only in the nuclear of tumour cell and only can detect there, this carrier is fit to duplicating of inducing tumor-specific.

Because the disappearance of CR3 among the dl520, this adenovirus can not be transferred to cell YB-1 in the nuclear of cell, it is also referred to as displacement in this article, therefore not the position of in the cell of YB-1 nuclear-feminine gender, duplicating, therefore be can be used according to the invention virus, wherein said virus comprises according to trans-activation required for the present invention.

Embodiment 2: the mode of action of adenovirus depends on the Rb state of cell

Fig. 2 has shown that E1A is proteic relevant to the combination of p300, p107 and p105 the territory.P300 and p107 are that cell is conjugated protein.Retinoblastoma protein (pRb) is a kind of tumor suppressor protein, and it is in conjunction with mediating by CR1 and CR2.Research shows, pRb and p107/p300 be combined in regulate transcribe in effective cell transcription factor E2F.Wild-type E1A albumen can disturb combining of E2F and Rb.So the E2F that discharges can be in conjunction with the E2 early promoter, and induces duplicating of adenovirus thus.

From known in the state of the art, some disappearance in the E1A cancer protein may produce as those the recombinant adenoviral vector of mentioning below, and it can duplicate to advantage in the cell of Rb-feminine gender and can be used according to the invention.For example, adenovirus carrier dl922-947 comprises the disappearance (amino acid sites 122-129) in the CR2 zone, and support C B016 has disappearance (amino acid sites 122-129) in CR1 zone (amino acid sites 27-80) and CR2 zone.Carrier E1Adl01/07 contains disappearance (amino acid sites 111-123) in the CR2 zone.In addition, because other disappearance of locating at N-end (amino acid sites 4-25) in addition, does not combine with albumen p300.Adenovirus carrier Ad Δ 24 contains disappearance (amino acid sites 120-127) in the CR2 zone.The adenovirus carrier of describing in patent EP 0 931 830 contains disappearance in CR1 zone and CR2 zone.

The releasing mechanism of the E2F of the binding mechanism of E2F/RB and E1A mediation is fundamentally different than the mechanism that constitutes basis of the present invention.Being different from and supposing in the prior art, is not the release of E2F from Rb albumen, though Rb albumen do not say for virus replication be critical also be necessary, but human transcription factor YB-1 appraise and decide the position.This transcription factor exists only in the tenuigenin in the cycle in most cells in normal cell.After with adenovirus infection, it is induced in the nuclear or has existed in the nuclear in different cell systems in some cases, as different neoplastic diseases, it comprises such as but not limited to mammary cancer, ovarian cancer, prostate cancer, the osteosarcoma cancer, glioblastoma, melanoma, small cell lung cancer and colorectal cancer.

The infection of embodiment 3:U2OS cell

100,000 U2OS cells of every hole tiling.Inferior daily different adenovirus infection cells as shown in Figure 3.In the DMEM substratum of 500 μ l serum-frees, infected 1 hour down at 37 ℃.Subsequently, remove and infect substratum, and replace with 2ml perfect medium (10%FCS/DMEM).After 3 days, use violet staining to analyze.

As from Fig. 3, obtaining, in nuclear, do not contain the U2OS cell of YB-1 in the cracking that does not show later on two kinds of different adenovirus infections shown in violet staining, described adenovirus promptly is called the adenovirus and the adenovirus dl520 of the E1/E3-disappearance of E1/E3-feminine gender, and it can be used according to the invention.Relevant with it, at first remove substratum.Subsequently, cover cell, at room temperature hatched 5-10 minute with Viola crystallina (50%ETOH, 3% formaldehyde, 5% acetate, 1% Viola crystallina).Subsequently, the abundant rinsing of water has the flat board in 6 holes, drying at room temperature.

The discovery that this confirms to constitute basis of the present invention promptly needs the existence of YB-1 so that the cell of inducing virus used according to the invention to come cracking to infect.

The infection of embodiment 4:257RDB cell

100,000 257RDB cells of every hole tiling.Inferior daily different adenovirus infection cells as shown in Figure 4.In the DMEM substratum of 500 μ l serum-frees, infected 1 hour down at 37 ℃.Subsequently, remove and infect substratum, and replace with 2ml perfect medium (10%FCS/DMEM).After 3 days, use violet staining to analyze.

This result of experiment is described in Fig. 4.After infection nuclear contains the 257RDB cell of YB-1, be called the adenovirus negative Ad5 of E1/E3-, the E1/E3-disappearance and under low MOI (pfu/ cell), do not show any cracking.In contrast, dl520 shown in embodiment 3, in the cell of YB-1 nuclear-feminine gender, do not duplicate, encode simultaneously and be used for the E1A of trans-activation oncogene protein according to the present invention, under the MOI of 40pfu/ cell (infection multiplicity), cause cracking virtually completely and under the MOI of 10pfu/ cell, still cause remarkable cracking.Can therefrom reach a conclusion, dl520 and similarly virus as herein by as described in dl1119/1131 or the AdXvir 03, need compare the MOI that reduces about 1 order of magnitude (ten times) with the adenovirus of E1-disappearance or E1/E3-disappearance, this has proved their clinical application.

As shown in Figure 7, the albumen E1A of dl520 is characterised in that its disappearance CR3 zone, causes duplicating in required trans-activation of application according to the present invention and the YB-1 nuclear-positive cells.

Embodiment 5: infect 257RDB and U2OS cell with dl1119/1131

As shown in Figure 5, after infecting YB-1 nuclear-negative U2OS cell, under the MOI of 20pfu/ cell, there is not cracking with adenovirus dl1119/1131, described adenovirus dl1119/1131 proteic amino acid 4-138 of disappearance E1A and their nucleic acid of coding, and behind amino acid 218, comprise terminator codon in addition, wherein the E1A albumen of the brachymemma of Biao Daing comprises the proteic CR3 of complete E1A zone.As negative control, use the cellular layer that does not infect.

Opposite with it, containing YB-1, be in the cell system of YB-1 nuclear-male 257RDB that as nuclear under the influence of adenovirus dl1119/1131, cellular layer is virtually completely cracking under the MOI of 20pfu/ cell.Therefore this embodiment is another evidence, it has proved that the E1A oncogene protein of modification as shown in Figure 7 for example only comprises the CR3 zone and lacks CR1 zone and CR2 zone, in YB-1 nuclear-positive cells, can provide required trans-activation, this is required according to duplicating of adenovirus of the present invention, has caused virus replication.Therefore adenovirus dl1119/1131 is operable another kind of adenovirus according to the present invention.The present invention includes, also can use the design that is similar to dl1119/1131 in the CR3 zone but the virus in zone of the opposite CR1 of having with it and/or CR2 zone.

Embodiment 6: the nuclear YB-1 in the cell of detection multi-medicine resistance

Present embodiment is based on following consideration, and promptly examining YB-1 should be as transcription factor in conjunction with the Y-box (CAAT sequence) in the mdr1 promotor (English is multiple drug resistance promoter, the multi-medicine resistance promotor).In order to detect, to carry out so-called EMSA and analyze (electrophoretic mobility shift assay).Relevant with it, isolated nuclei albumen is hatched with short dna fragment (widow) 1-10 μ g albumen subsequently under 37 ℃.In order to measure nuclear YB-1, used following oligonucleotide: the mdr1 promotor relative (site-86 is to-67): TGAGGCTGATTGGCTGGGCA (the X-box underlines) with U2O3.

Before this, 5 ' terminal using ³²This dna fragmentation of P radio-labeling.Subsequently, in the natural polypropylene acrylamide gel, separate.In the situation of sequence, can detect it in protein Y B-1 oligonucleotide binding, (JBC 277,10427-10434,2002 for Holm, P. S. etc. soon because the migration of any unconjugated oligonucleotide in gel is than the migration of bonded oligonucleotide; Bargou, R.C. etc., Nature Medicine 3,447-450,1997).

As shown in Figure 6, EMSA analyzes and can confirm, forms contrast with clone U2OS and HeLa cell, has YB-1 in cell 257RDB, the 181RDB of multi-medicine resistance and the nuclear of MCF-7Ad cell.

Embodiment 4 and 5 result confirm, form contrast with U205, and adenovirus dl520 and dl1119/1131 for example duplicate among the 257RDB in YB-1 nuclear-positive cells, and induce its cracking.This has confirmed about the discovery according to the application of adenovirus of the present invention.In addition, this result is verified, compare with wild-type adenovirus, in YB-1 nuclear-positive cells, come trans-activation virogene faintly by the e1a gene product of modifying or lack, in nuclear, cause the cracking with these cells of duplicating of success in the presence of the YB-1, these cells comprise for example cell of multi-medicine resistance, and therefore adenovirus as herein described can be used for these tumours of cracking.

Embodiment 7: the duplicating efficiency that improves the negative adenovirus of E1-

Present embodiment confirms that early stage virogene E1B-55K and E4orf6 can infect by the adenovirus Ad-55K with plasmid pE4orf6 transfection and E1/E3-disappearance to substitute.Ad-55K is the virus of disappearance E1/E3, E1B-55K is cloned among the E1 and under the control of CMV thus.Should substitute according to the following fact is needs, be that AdYB-1 (expressing the adenovirus of YB-1) does not express these early genes, the present inventor has realized that, contain in the dubbing system of YB-1 at nuclear, substituting of these early genes can improve duplicating efficiency and particle formation efficient respectively, and its degree is comparable to the wild-type adenovirus of one type of Ad5.

Carry out and the following:

Use fat transfection amine, with plasmid pE4orf6 transfection each 10 ⁵The U2OS cell.Plasmid pE4orf6 is carried at the dna sequence dna of the early stage virogene E4orf6 of coding under the CMV control.

With after the plasmid pE4orf6 transfection 24 hours, E1B-55K adenovirus Ad-55K (the 50 pfu/ cell) cells infected that lacks with E1/E3-deleted adenovirus AdYB-1 (50 pfu/ cell) that expresses YB-1 and E1/E3-.Ad-55K is the virus of E1/E3-disappearance, and it is carried at the genetically modified virogene E1B-55K of conduct under the CMV control.

Subsequently, from substratum (2ml), remove cell in back 5 days of infection (=infection back).By replacing freezing and thawing 3 times (melting/freeze) releasing virus particle from isolated cells.Subsequently, 293 cells are carried out the plaque test, to measure the infectious particles (plaque-forming unit/ml (pfu/ml)) that produces.The result represents in Fig. 8 and 9.Fig. 8 has shown the result of plaque test, represents with absolute figure.By with plasmid pE4orf6 transfection with shown with two kinds of virus of A dYB-1 and Ad-55K coinfection and only infected the marked difference of comparing with AdYB-1.Fig. 9 has shown the result of Fig. 8, and wherein the raising of duplicating efficiency is expressed as the multiple that duplicates to AdYB-1 mensuration.With plasmid pE4orf6 with use AdYB-1 subsequently and cell that E1B-55K (Ad-55K) infects produces up to the pfu/ml more than 25 times.

Can reach a conclusion based on these results, the alternative adenovirus AdYB-1 that has improved with the E1/E3-disappearance of E1B-55K and E4orf6 infects the viral load (pfu/ml) of back formation up to 25 times.Compare with two kinds of gene products effect separately, E1B-55K and E4orf6 are significantly higher to the adjection that generates plaque-forming unit (pfu).

Use the control experiment of a plasmid of expressing EGFP to confirm that clearly in selected experimental technique, only 10% cell is by successfully transfection of plasmid pE4orf6.The amounts of particles that forms in the cell that can express E1B-55K and E4orf6 is comparable to a kind of adenovirus hominis type 5 (wild-type).This has confirmed to constitute the discovery on basis of the present invention, i.e. the expression of E4orf6 and E1B-55K, again in conjunction with the position of appraising and deciding of YB-1 can provide adenoviral replication and particle to form, the adenovirus of E1A-disappearance particularly, and it is comparable to a kind of wild-type Ad5.

Embodiment 8: the adenopathy that improves after the dosed cells growth inhibitor in YB-1 nuclear-positive cells

Poison duplicates, and this adenovirus is not duplicated in the negative cell of YB-1 nuclear

Known in the state of the art, add the position of appraising and deciding that different cytostatic agents can be induced human transcription factor YB-1.Have been found that as the present inventor the YB-1 that is positioned in the nuclear controls adenoviral replication by activating adenovirus 2-late promoter.For specific tumour cracking is provided, can be used in combination two kinds of effects.

In the enforcement that oncolytic is measured, according to the following step: 200,000 cells (being respectively HeLa and U2OS) are inoculated in every hole of 6 orifice plates.Next day, add the daunorubicin of 40 ng/ml (final concentration).After hatching 3 hours, use 10 and 30 pfu dl520/ cell infection cells respectively.Subsequently, cell is hatched in the substratum of acellular growth inhibitor.After 3-5 days, use Viola crystallina with cell dyeing.

As knowing from Figure 10 and 11, the affiliation that adds of daunorubicin is induced duplicating of dl520 by the position of appraising and deciding of YB-1.Therefore, and only compare with daunorubicin, be used in combination with the cytostatic agent daunorubicin, dl520 produces bigger tumour lytic effect.

The in-vivo tumour cracking of embodiment 9:dl520

Under aseptic cell culture condition, breeding is used for the HeLa (YB-1 nuclear-feminine gender) and 257RDB (YB-1 the examines positive) cell of research in the body.With injection cell in the mouse (CD1NuNu strain) so that before producing Subcutaneous tumor,, put into DMEM substratum (10%FCS) by the trypsin treatment collecting cell, counting and once with the PBS washing.Subsequently, with cell centrifugation, sucking-off PBS, with the expectation cell number with cell portioning in fresh PBS.In this research, hypodermic cell count be two clones each 5 * 10 ⁶Individual cell.Carry out the side of subcutaneous injection, wherein the HeLa injection cell is arrived the right side, the 257RDB injection cell is arrived the left side, with better differentiation to animal.1 week, 2 contrasts growth of tumor are wherein used the length and the width of vernier caliper measurement tumour.Based on this, calculate gross tumor volume based on following mathematical formula:

3/4 π * a/2* (b/2) ²A=length, the b=width

In case tumour has reached 200-520mm ³Volume, in tumour, use virus respectively and as the PBS of negative control.The volume of injection equates, each 50 μ l.Duplicate injection for three days on end.The total dose of using virus is 5 * 10 ⁸Pfu.Subsequently, continue 1 week, 2 records tumor growth, volume calculated.When research finishes, kill mouse, take out tumour and be used for further analysis.

The result represents in Figure 12 and 13.

Figure 12 has shown that expression is as the gross tumor volume of the function of time and the chart of different treatment plans.Forming by RDB257 in the situation of tumour, tumour significantly grows to about 438mm after injection PBS ³-1466mm ³Under the influence of carrier dl520 used according to the invention, growth of tumor significantly reduces.From 344mm ³Average tumor size beginning, the tumour size has only increased by 21%, reaches 543mm altogether ³

In the present embodiment, the tumour that will be made up of the HeLa cell is with comparing, and it is similar to and is using the later tumour based on RDB257 of PBS using the later behavior of PBS.Yet, still shown the remarkable increase of tumor growth based on the HeLa cell with the tumour that dl520 handles, from 311mm ³Begin to increase to 1954mm ³

Figure 13 has shown the photo of the nude mice that kills, and described nude mice has the RDB257 of use growing tumors.Can clearly see, use adenovirus dl520 according to the present invention after, the remarkable minimizing of tumour occur.In this situation even also have the reducing of gross tumor volume (to use behind the viral dl520 the 1st day: 515mm ³After using viral dl520 the 30th day: 350mm ³).

Embodiment 10: the southern blotting technique of tumour DNA

Extract DNA from tumor sample, this tumor sample is taken from the middle of the tumour of breeding among the embodiment 9.In order to separate, use the Dneasy Tissue Kit of Qiagen.Finishing DNA according to the operation instruction of manufacturers separates.According to it, from cell, discharge DNA by alkaline lysis.Subsequently, through the column purification separated DNA.Subsequently, measure the concentration of separated DNA at 260 nm by photometry.Use 2 μ gDNA samples to analyze, this DNA sample was handled with the restriction enzyme KpnI of 10 units.Subsequently, in 0.8% sepharose, carry out the electrophoretic separation of sample.Subsequently, southern blotting technique (is carried out according to the Schleicher﹠Schuell system) on nylon membrane.With the dna probe hybridization of the DNA of trace on film to specific 1501bp.The dna probe of 1501bp is specifically in conjunction with the Kpn I fragment of 3369bp in the Ad5 sequence of coding E2A.Before by PCR (primer: preparation probe 5 ' GTC GGA GAT CAG ATC CGC GT (SEQ.ID.No.2), 5 ' GAT CCT CGT CGT CTT CGC TT (SEQ.ID.No.3)), and using ³²P is mark radioactively.Subsequently, washing film and be exposed to film.

The southern blotting technique result of tumour DNA represents in Figure 14.Analysis confirmed, dl520 replication in vitro in resistant cell RDB257 only is shown in swimming lane 3,4 and 5.Swimming lane 1 has shown positive control Ad-5d, and swimming lane 6,7 and 8 has shown the DNA of HeLa cell of dl520 that come self-infection.Because the HeLa cell is not a YB-1 nuclear male, viral dl520 does not duplicate, and therefore cannot detect the E2A sequence in view of the above.

Other result of dl520 represents in Figure 15.Based on the plaque test, the research particle forms (pfu/ml) after infecting with dl520 and wild-type adenovirus.The tumour cell of the various YB-1 nuclear-positives (257RDB and 181RDB) and the tumour cell of YB-1 nuclear-feminine gender have been infected with dl520 and wild-type adenovirus.

Implement the following step:

With 100,000-200,000 cell are inoculated into the L15 substratum (cell of resistance) in the so-called flat board (i.e. 6 hole flat boards) with 6 holes separately and contain the DMEM (non-resistance cell) of 10%FCS.After 24 hours, infect (10pfu/ cell) with dl520 and wild-type adenovirus.Infected back (after the infection) 3 days, by replacing freezing and the releasing virus particle from cell suspending liquid (3ml) that thaws 3 times.Subsequently, 293 cells are carried out the plaque test, to measure the infectious particles (plaque-forming unit/ml (pfu/ml)) that forms.The result shows in Figure 15.The result of plaque test shows that be similar to wild-type adenovirus, dl520 duplicates in YB-1 nuclear-positive cells (257RDB and 181RDB).Therefore, when adenovirus as herein described used according to the invention, can observe the duplicating efficiency that is similar to a kind of wild-type adenovirus.

Embodiment 11: the structure design of adenovirus carrier Xvir03

Figure 16 has shown the structure design of adenovirus carrier Xvir03.Adenovirus Xvir03 is a kind of adenovirus of so-called E1/E3-disappearance.This means and to prepare E1A, E1B and the E3 albumen that in adenoviral replication, works.The disappearance in E1 zone extends to 3528 from 342; The E3 zone disappearance of amino acid sites 27865-30995.As shown here, term " virus of E1-disappearance " is meant that E1 no longer includes the virus of functionally active.This can realize by in addition most of complete nucleic acid and the aminoacid sequence of inactivation, yet this also can mean the disappearance of the coding E1 region protein with different sizes.In default of E1A and E1B albumen and their nucleic acid of coding, E4 zone (as E4orf6) only faint expression (comparing about 1-5% with wild-type adenovirus) or expression.Virogene E1B55k and E4orf6 express in the E1 zone by the allos CMV promotor (Clontech:PlasmidpShuttle) of introducing Xvir03.Replaced C MV promotor can be used with E1A and express relevant disclosed herein various and any promotor.The open reading-frame (ORF) of two genes by so-called IRES sequence (English is internal ribosomal entry site, internal ribosome entry site) (Pelletier, J. and Sonenberg, N.Nature, 1 988,334,320-325) be connected to each other.This element (Novagen:pCITE) provides 2 proteic expression from 1 mRNA.

Be prepared as follows carrier:

Produce plasmid E1B55k-pShuttle by being cloned into XbaI and BfrI in the pShuttle carrier of Clontech from the E1B55k open reading-frame (ORF) of the pCGNE1B of M.Dobelstein (University of Marburg).Subsequently, with the E1B55k linearizing among the pShuttle, end-filling is also sheared with NheI with ApaI.

Second carrier pcDNA3.1 (+) (Invitrogen) in, each other continuously, the pCITE-4a (+) that uses Novagen company is as template, to be cloned into the EcoRV shearing site as the IRES element of PCR product by the TA clone, by the E4orf6=IRES-E4orf6-pcDNA3.1 (+) of BamHI clone from plasmid pCMV-E4orf6 (M.Dobelstein, University of Marburg).With the IRES-E4orf6 among the NotI linearizing pcDNA3.1 (+), end-filling cuts away fragment IRES-E4orf6 with NheI subsequently.With open carrier E1B55k-pShuttle (flush end, NheI) junction fragment IRES-E4orf6.Use I-Ceu I and PI-SceI subsequently, from E1B55k-IRES-E4orf6-pShuttle and CMV promotor and Trobest (BGH)-PolyA box is cloned in Δ E1, the Δ E3 Adeno-X-plasmid (Clontech), it is called AdcmvE1B/IRES/E4orf6.Subsequently, the operation instruction (Clontech) according to manufacturers prepares adenovirus.Will be to the HEK293 cell with the linearizing gland plasmid transfection that contains Expression element CMV-E1B55k-IRES-E4orf6-BGH polyA of PacI, after the transfection 11 days, come along with substratum and to remove the cell that breaks away from, so that discharge adenovirus by the multigelation circulation.

Above-mentioned carrier is fit to other virus used according to the invention described herein in principle.Particularly above-mentioned carrier is adapted at duplicating in the cell and causing cracking, described cell be respectively YB-1 nuclear-positive cells and wherein YB-1 removed to regulate the cell of (promptly comparing overexpression with non-tumor cell) with normal cell.The use of this carrier is specially adapted to those diseases and patient's group or patient collective, and it is open with describing other adenovirus used according to the invention and other adenovirus disclosed by the invention in this article.

Embodiment 12: the structure design of adenovirus carrier Xvir03/01

As can obtaining from Figure 17, Xvir03/01 is the further development of Xvir03.Therapeutic gene (gene for example as herein described) and transgenosis can be cloned into the E3 zone.In addition, will lack and introduce the E4 zone, with E4orf6 homologous recombination take place from the Xvir03 expression cassette so that avoid.This can be cloned in this construct bigger transgenosis.The E3 zone of disappearance comprises the SacI that is used to introduce box, and NdeI and NheI restriction site for example wherein can be cloned the transgenosis of treatment.

The preparation plasmid, it is used for therapeutic gene being cloned into the E3 zone and being used for lacking in the E4 region generating:

Has restriction site after 3 ' the ITR district that the pAdenoX-Plasmid of Clontech lacks at SfuI in wild-type adenovirus.Use SpeI (site 23644) and SfuI from pAdenoX (Clontech), to obtain the E3-E4 zone, and be transferred to pcDNA3.1 (+) (Invitrogen)=pcDNA3.1-E3 Δ 27865-30995-E4.Remove the major part of E4ORF6 by PstI, i.e. 33241-33875=pcDNA3.1-E3 Δ 27865-30995, E4 Δ 33241-33875.For further exploitation Xvir03, with SfuI and SpeI from pcDNA3.1-E3 Δ 27865-30995, among the E4 Δ 33241-33875 with the E3/E4 regional cloning of disappearance in plasmid pAdenoX=pAdenoX E3 Δ 27865-30995, E4 Δ 33241-33875.

As described in about Xvir03, use I-Ceu I and PI-SceI from E1B55k-IRES-E4orf6-pShuttle, expression cassette to be cloned into pAdenoX E3 Δ 27865-30995 together with CMV promotor and Trobest (BGH)-PolyA subsequently, among the E4 Δ 33241-33875, it is called AdcmvE1B/IRES/E4orf6-Δ E4.Subsequently, the operation instruction (Clontech) according to manufacturers prepares adenovirus.

Above-mentioned carrier is the same useful with other virus used according to the invention described herein in principle.Particularly above-mentioned carrier is adapted at duplicating in the cell and causing cracking, described cell be YB-1 nuclear-positive cells and wherein YB-1 removed to regulate the cell of (promptly comparing overexpression with non-tumor cell) with normal cell.This carrier can also be used for those diseases and patient's group and patient collective, and it is about other adenovirus used according to the invention and open in this article according to adenovirus of the present invention.

The oncolytic effect of embodiment 13:Xvir03 in 257RDB and 181RDB cell

In every hole of the flat board with 6 holes (6 hole flat board), inoculate 100,000 cells (257RDB and 181RDB).Next day, as shown in figure 18, with Ad312 (20pfu/ cell) and Xvir03 (5pfu/ cell) cells infected.In 500 μ l serum-free DMEM substratum, infected 1 hour down at 37 ℃.Subsequently, remove and infect substratum, and substitute with 2ml perfect medium (10%FCS/DMEM).Finish analysis by violet staining after 5 days.The result represents in Figure 18 A and 18B.

As can obtaining from Figure 18 A and 18B, after infecting Ad312 and Xvir03, only in the situation of Xvir03, the cell that contains the multi-medicine resistance of YB-1 at nuclear has shown cracking, shown in the violet staining of cell.Relevant with it, at first remove substratum.Subsequently, cover cell, at room temperature hatched 5-10 minute with Viola crystallina (50%ETOH, 3% formaldehyde, 5% acetate, 1% Viola crystallina).Subsequently, the abundant rinsing of water 6 holes are dull and stereotyped and at room temperature dry.

The virus (for example Ad312) of the known E1A-disappearance of the present inventor, however it is not the trans-activation adenovirus on meaning of the present invention, may duplicate (Nevins J.R. under higher MOI very effectively, Cell 26,213-220,1981), but can not in clinical application, realize.This phenomenon is called " class E1A activity " in the literature.Adenovirus Ad3 12 used herein is the virus of E1A-disappearance.Under used tiring (20 pfu/ cell), this is tired and still is higher than clinical ideal and tires, and early stage adenoviral gene such as E1B55k and E4orf6 do not express or can only very little express (Nevins J.R., Cell 26,213-220,1981).Describe as this paper, these genes and albumen play an important role in virus replication.Opposite with it, these genes and albumen are expressed (Figure 16) by adenovirus Xvir03 respectively.As from Figure 18 A and 18B, can obtaining, will cause effective virus replication and lysis in the expression of following the gene E1B55k that (is expressed as the pfu/ cell) under the required lower infectious titer and E4orf6.This has confirmed to constitute the discovery on basis of the present invention, i.e. the expression of E4orf6 and E1B-55K (with lacking E1A) is enough induced very effective adenoviral replication in conjunction with the potential energy of appraising and deciding of YB-1.Tiring of its required only 1-5 pfu/ cell now can clinical application.

This has confirmed to constitute the discovery on basis of the present invention, and promptly in order to make the cell of virolysis infection used according to the invention, the existence of YB-1 in nuclear particularly is independent of the existence of cell cycle, is essential.

Embodiment 14: the rna blot analysis that the raq gene of adenovirus Ad312 is expressed

In each case, with 1,000,000 A549 and U2OS cell inoculation in 10cm Petri dish.Next day is with Ad312 (50pfu/ cell) and Adwt (5pfu/ cell in contrast) cells infected.The high virus titer of the Ad312 that uses causes being independent of duplicating of E1 in the tumour cell.In the DMEM substratum of 1-2 ml serum-free, infected 1 hour at 37 ℃.Subsequently, remove and infect substratum, replace with 10ml perfect medium (10%FCS/DMEM).After 3 days, isolation of RNA.Subsequently, in photometer, detect the concentration of isolating RNA at 260nm.Then, electrophoretic separation RNA sample in 0.8% formaldehyde agarose gel.Subsequently, with RNA trace (system according to Schleicher﹠Schuell carries out) on nylon membrane.The RNA of trace on film hybridized " early stage probe " E2 and " probe in late period " E2." probe in late period " of 1501bp can be specifically in conjunction with the E2 late promoter.Prepare probe by PCR (primer: 5 '-GTC GGA GAT CAG ATC CGC GT (SEQ.ID.NO.4), 5 '-GAT CCT CGT CGT CTT CGC TT (SEQ.ID.NO.5)) before, and use ³²P is mark radioactively.On the contrary, early stage probe can be combined in (position: 226791-227002) between E2-early promoter and the E2-late promoter, and also be to produce by means of PCR (primer: 5 '-AGCTGATCTTCGCTTTTG (SEQ.ID.NO.6), 5 '-GGATAGCAAGACTCTGAC AAAG (SEQ.ID.NO.7)).Subsequently, washing film and be exposed to film.

The result represents in Figure 19.The specific signals early stage and late period, probe all provided the wild-type adenovirus contrast to infect, and the tumour cell that has infected Ad312 only provides the specific signals when use probe in late period.This has confirmed to constitute the discovery on basis of the present invention, be the expression of E4orf6 and E1B55K and E1A disappearance respectively with overexpression and go the YB-1 that regulates to be transported in the nuclear, and induce thus as the effectively expression of the raq gene of the prerequisite of adenoviral replication.Embodiment 15: the rna blot analysis that the raq gene of adenovirus Ad δ 24 is expressed

In each case, with 1,000,000 U2OS cell inoculations in 10cm Petri dish.Next day is with adenovirus δ 24 (Ad δ 24) (10pfu/ cell) and wild-type adenovirus (Adwt) (10pfu/ cell in contrast) cells infected.The recombinant adenovirus Ad δ 24 (Oncogene 19 for Fueyo, J. etc., 2-12,2000) that uses has the specificity disappearance in the proteic CR2 of E1A district, thereby only can duplicate in the tumour of Rb-feminine gender.In addition, this virus energy expression ratio must be gone up the gene E1B55k and the E4orf6 of wild-type adenovirus.In the DMEM of 1-2ml serum-free substratum, infected 1 hour at 37 ℃.Subsequently, remove and infect substratum, replace with 10ml perfect medium (10%FCS/DMEM).After 12 and 24 hours, isolation of RNA.Subsequently, in photometer, detect the concentration of isolating RNA at 260nm.Then, electrophoretic separation RNA sample in 0.8% formaldehyde agarose gel.Subsequently, with RNA trace (system according to Schleicher﹠Schuell carries out) on nylon membrane.The RNA of trace on film hybridized " early stage probe " and " probe in late period "." probe in late period " that comprise 1501bp can be specifically in conjunction with the E2 late promoter.Prepare probe by PCR (primer: 5 '-GTC GGA GAT CAGATC CGC GT (SEQ.ID.NO.4), 5 '-GAT CCT CGT CGT CTT CGC TT (SEQ.ID.NO.5)) before, and use ³²P is mark radioactively.But, early stage probe can be combined between E2-early promoter and the E2-late promoter, and also be to produce by means of PCR (primer: 5 '-AGCTGATCTTCGCTTTTG (SEQ.ID.NO.6), 5 '-GGATAGCAAGACTCTGAC AAAG (SEQ.ID.NO.7)).Subsequently, washing film and be exposed to film.

The result represents in Figure 20.

After 12 hours, only there is the late period probe that specific signals is provided.After 24 hours, only there is early stage probe in the cell that has infected Ad δ 24, to provide specific signals.But, to compare with wild-type adenovirus, signal significantly weakens.This result has also confirmed to constitute the discovery on basis of the present invention, i.e. that the expression of E4orf6 and E1B-55K will be crossed expression respectively and go the YB-1 that regulates to be transported in the nuclear, and it is attached to the E2-late promoter subsequently and induces raq gene to express.

Embodiment 16: the structure design of adenovirus carrier XvirPSJL1 and XvirPSJL2

Carrier is described: XvirPSJL group carrier is the embodiment that is called the virus of I group adenovirus herein, and respectively by carrier and adenovirus XvirPSJL1 and XvirPSJL2 example, they not only can resemble duplicates in YB-1 nuclear-positive cells, particularly tumour cell the adenovirus dl520, and can in tumour cell, duplicate, the YB-1 in the described tumour cell be respectively express and go to regulate.Although virogene E1B55k and E4orf6 only express in the YB-1 nuclear-positive cells that dl520 infects under E1B promotor and the influence of E4 promotor respectively, E1B55k among the XvirPSJL and E4orf6 express by means of cytomegalovirus (cmw) promotor.But, be not the cmw promotor, can also use other promotor, particularly tumour-specific, tissue-specific and organ specific promotor.Because the expression of E1B55k and E4orf6 is crossed the YB-1 that expresses and is gone the YB-1 that regulates to be transferred in the nuclear respectively, and starts duplicating of adenovirus.Thereby the adenovirus carrier of XvirPSJL as described herein group is combined in the various elements of adenovirus carrier dl520, Xvir03 in the same carrier and AdYB-1 and therefore their function.Dl520 is similar with carrier, and XvirPSJL virus contains the E1A12S gene.This gene and corresponding gene product are responsible for the S phase of the cell of inductive infection respectively, and promote the effect of the duplicating of virus, chemotherapy and irradiation.As Xvir03, XvirPSJL virus contains expression cassette CMV-E 1B55k/IRES/E4orf6, and it is required for effectively duplicating, and will go the YB-1 that regulates to be transferred in the nuclear indirectly or directly, and this nuclear is preferably included in the tumour cell.Thereby duplicating can be in cell, the particularly tumour cell of expressing or go to regulate at YB-1 only.In addition, with E1B55k/E4orf6 complex body degraded P53.The sequence of coding human transcription factor YB-1 is taken from virus of A dYB-1.Endogenous, promptly existed the YB-1 in the cell to enlarge duplicating of virus.The expression of E1A12S and YB-1 is by the adenovirus E2-late promoter control that depends on YB-1.Also relatively, can use specific promotor, particularly tumour-specific, tissue-specific or organ specific promotor.Another feature of these viruses is disappearance E4 district.Carrier contains restriction site, under the situation of adenovirus carrier XvirPSJL1 and XvirPSJL2, can express disclosed various transgenosiss in the specification sheets, for example ribozyme, antisense molecule, siRNA, apoptosis-inducing gene, cytokine and prodrug gene by these sites.Their expression can also be by promotor control disclosed tumour-specific in the specification sheets, tissue-specific or organ specific.The location of expression cassette is not a fixed, particularly is not in relation to or in E1, E3 and E4 district, still can arranges by any way.Carrier duplicate the Rb situation that is independent of p53 or tumour cell.

The structure design of recombinant adenovirus XvirPSJL1 and XvirPSJL2 is shown in Figure 21 and 22.

The generation of box E2-late period-YB1IRES/12S:

The pAdenoX plasmid of Clontech/BD Biosciences is as the raw material of this paper, and it comprises the genomic nucleic acids of adenovirus Ad5, and has in back, 3 ' ITR district (wild-type adenovirus does not have) and have the SfuI restriction site.Use SpeI (site 23644) and from pAdenoX (Clontech) SfuI with the E3-E4 zone-transfer to pcDNA3.1 (+) (Invitrogen), and be expressed as pcDNA3.1-E3 Δ 27865-30995-E4.By the major part of PstI removal E4ORF6, i.e. base 33241-33875.The fragment that obtains like this is called pcDNA3.1-E3 Δ 27865-30995, E4 Δ 33241-33875.

With SacI with NheI the E2-late promoter is separated from pGL3-EGFP (Holm etc., JBC2002,277,10427-10434), and the clone advances pcDNA3.1-E3 Δ 27865-30995, among the E4 Δ 33241-33875.In this process, further delete the E3 district in Δ 27593-3 1509 zones of base.The fragment that obtains like this is called E2-late period-pcDNA3.1-E3 Δ 27593-31509, E4 Δ 33241-33875.

Generate the cDNA that is used for the E1A-243AA product by RT-PCR, separate, checking sequence, and use BamHI and EcoRI to clone into pcDNA3.1 (+) carrier (Invitrogen).Make the E1A-12S-pcDNA3.1+ linearizing with NheI and BamHI, mend flat end, provide T overhang by Taq polysaccharase and dTTP by the T4 polysaccharase.(template=pCITE, Novagen) clone advances E1A-12S-pcDNA 3.1 (+) carrier (TA clones strategy) as the PCR product with the IRES element.

(Holm etc., JBC 2002,277,10427-10434), and mend flat terminal to isolate the YB-1-EcoRI fragment from carrier pHVad2c.Make carrier pShuttle (buying from BDBiosciences on the market) linearizing with XbaI, mend flat terminally, dephosphorylation is connected on the nucleic acid of coding YB-1 of previous generation.The carrier that obtains like this is called YB-1-pShuttle.Clone to the pShuttle carrier can provide coding YB-1 segmental nucleic acid, and it has the terminator codon in the framework.By means of NheI and BfrI, the nucleic acid of coding YB-1 is cloned carrier IRES-E1A-12S the pcDNA3.1 (+) into from YB-1-pShuttle.The carrier that obtains like this is called YB-1 (EcoRI-EcoRI that has terminator codon)-IRES-E1 A-12S-pcDNA3.1 (+).

Subsequently, with PmeI cutting box YB-1-IRES-E1A12S, the clone advances linearizing, flush end and the dephosphorylized carrier E2 of NheI late period-pcDNA3.1E3 Δ 27593-31509, among the E4 Δ 33241-33875.Like this, second box is just in the disappearance district in E3 district.

The transgenosis box comprises nucleic acid construct E2 late period-YB-1-IRES-E1A12S, by SfuI and SpeI, with itself and remaining adenoviral sequence E3 Δ 27593-31509, E4 Δ 33241-33875 clones into the carrier pAdenoX of Clontech (=AdenoX/E2 late period-YB-1-IRES-E1A12S/E3 Δ 27593-31509, E4 Δ 33241-33875) together.

By I-CeuI and PI-SceI, box CMV-E1B55k/IRES/E4orf6 is cut out about the described pShuttle of Xvir03 from top, and insert carrier A denoX/E2 late period-YB-1-IRES-E1A12S/E3 Δ 27593-31509, E4 Δ 33241-33875.

Subsequently, with Pac I linearized vector, 293 cells are advanced in transfection, according to manufacturer's explanation, separate genetically modified recombinant adenovirus XvirPSJL1 and the XvirPSJL2 that does not contain mark among the figure respectively.

Embodiment 17: infect the HeLa cell with adenovirus dl520

100.000 HeLa cells of every dish coating.Next day is with the tire adenovirus dl520 cells infected of (pfu/ml) of difference.In the DMEM substratum of 500 μ l serum-frees, infected 1 hour at 37 ℃.Subsequently, remove and infect substratum, and replace with 2ml perfect medium (10%FCS/DMEM).After 3-5 days, use violet staining to analyze.

Experimental result as shown in figure 23.Adenovirus dl520 does not demonstrate any cracking when low MOI (5-10pfu/ cell) infects the HeLa cell that does not have YB-1 in the nuclear, in contrast, dl520 shows cracking virtually completely when MOI (infection multiplicity) is the 100-200pfu/ cell, and still shows remarkable cracking when MOI is the 50pfu/ cell.Therefrom as can be seen, dl520 and the virus that similarly can open adenoviral gene E1B55k and E4orf6, when higher MOI, be suitable for directly or will cross expression indirectly or go the YB-1 that regulates to be transferred in the nuclear, and therefore inducing cell cracking.Embodiment 18: be used to detect the active luciferase test of E2-late promoter

Adenovirus 2-late promoter in the known YB-1 energy syncaryon (Holm etc., JBC 2002,277, and 10427-20434), and this promotor also is applicable to expression of nucleic acids preferably.By following true the promotion, promptly it can be controlled by YB-1 especially in the application of adenovirus 2-late promoter, and wherein YB-1 works as positive effector, promptly this promotor only in nuclear, exist be only under the situation of YB-1 activated.Therefore when not having the YB-1 of difference action effect thing and instrumentality in the nuclear, can regulate described adenovirus E2-late promoter in the mode of high selectivity, and exist in the system of YB-1 in therefore being applied to examine, in fact avoid any expression of the nucleic acid under the control of adenovirus 2-late promoter.The E2-late promoter comprises 3Y-box (CCAAT), and its activation with raq gene is relevant.Prepare different E2-late promoter constructs, and detected their specificity and activity.Analysis is carried out as follows.

Use 3 kinds of different cell concns, clone EPG-257RDB (epithelium cancer of the stomach), HeLa (epithelium cervical cancer) and the U2OS (osteosarcoma) that contains YB-1 in the nuclear is inoculated in the 6 hole flat boards.Carry out transfection with showing 70% hole of converging next day.For each hole, with 500ngSpinMiniprep (Qiagen) purifying at the luciferase carrier (on the market available from Promega, the beginning plasmid: the plasmid DNA of the different E2-late promoters the pGL3-enhanser) joins 500 μ l OptiMEM in the reaction conduit of 1.5ml band locking cap, and 5 μ l DOTAP are joined 500 μ l in the reaction conduit of another band locking cap.Merge 2 parts of solution, and mix.In incubated at room mixture 30 minutes, to form complex body.With PBS washed cell 3 times, cover with the transfection mixture layer.Flat board was hatched 5 hours at 37 ℃, use the PBS washed cell subsequently again 3 times, and perfect medium is provided.

Infected back 48 hours, luciferase analytical system test kit (Cat.No.E1500) with Promega is handled cell: the lysis buffer of one deck 500 μ l is provided for each hole, in room temperature after 10 minutes, with the 1ml suction pipe cell is flushed out from plate well, and transfer to 1, in the reaction conduit of 5ml band locking cap.Subsequently 4 ℃, 14.000rpm eccentric cell lysate 15 minutes.In per 50 μ l supernatant liquors, add 100 μ l luciferase substrates, in the black flat board in 96 holes, detect at the 945nm wavelength with TopCount (Canberra-PackardGmbH, 63303 Dreieich) microplate flicker ﹠ luminescent counter.

With catalog number (Cat.No.) be 23227 (PIERCE, Rockford, Illinois, BCA analysis of protein test kit USA) is at 570nm, at biological photometer (Biolumin ^TM960) detect proteic molecular dynamics in power fluorescence/absorption plate reader.The relative optical signal of sample is converted into protein content (RLU/ μ g albumen).

Use following plasmid: as the blank value of reading, from this pGL3-enhanser, remove enhanser with BamHI (2250 bp) and BsaBI (2003 bp) with pGL3-enhanser (Promega).By means of restriction site Apa I and Sac I, each E2 promoter construct is cloned among the MCS of the pGL3 carrier of disappearance enhanser into.With Bgl II and Hind III the hCMV promotor is cloned in the pGL3 enhanser, and as positive control.This positive control can be estimated transfection efficiency, also is used as the reference value of uciferase activity.For every kind of clone, the CMV contrast is set at 100%, the enzymic activity that the E2 promoter construct generates is related with it, and the histogram of making is as shown in figure 24.

Each construct of mentioning is as follows:

1. comprise Y-box I, II and III are corresponding to base 25932-26179 bp (about the wild-type adenovirus sequence, also referring to the adenovirus E2 district part that provides subsequently)

2. comprise Y-box II and III, corresponding to base 25932-26127bp (about the wild-type adenovirus sequence, also referring to the adenovirus E2 district part that provides subsequently)

3. comprise Y-box III, corresponding to base 25932-26004 bp (about the wild-type adenovirus sequence, also referring to the adenovirus E2 district part that provides subsequently)

4. do not contain the Y-box, as blank reading

Adenovirus E2 district part (is taken from Virology 1992,186,280-285)

(the YB-1 binding site prints to runic)

25561 aggaactttatcctagagcgctcaggaatcttgcccgccacctgctgtgcacttcctagc

25621 gactttgtgcccattaagtaccgcgaatgccctccgccgctttggggccactgctacctt

25681 ctgcagctagccaactaccttgcctaccactctgacataatggaagacgtgagcggtgac

25741 ggtctactggagtgtcactgtcgctgcaacctatgcaccccgcaccgctccctggtttgc

25801 aattcgcagctgcttaacgaaagtcaaattatcggtacctttgagctgcagggtccctcg

25861 cctgacgaaaagtccgcggctccggggttgaaactcactccggggctgtggacgtcggct

25921 taccttcgcaaatttgtacctgaggactaccacgcccacgagattaggttctacgaaga

25981

cccgcccgccaaatgcggagcttaccgcctgcgtcattacccagggccacattctt

26041 gg tgcaagccatcaacaaagcccgccaagagtttctgctacgaaagggacggggg

26101 gtttacttggacccccagtccggcgaggagctcaac ccccccgccgccgcagccc

26161 tatcagcagcagccgcgggcccttgcttcccaggatggcacccaaaaagaagctgcagct

26221 gccgccgccacccacggacgaggaggaatactgggacagtcaggcagaggaggttttgga

26281 cgaggaggaggaggacatgatggaagactgggagagcctagacgaggaagcttccgaggt

26341 cgaagaggtgtcagacgaaacaccgtcaccctcggtcgcattcccctcgccggcgcccca

26401 gaaatcggcaaccggttccagcatggctacaacctccgctcctcaggcgccgccggcact

26461 gcccgttcgccgacccaaccgtagatgggacaccactggaaccagggccggtaagtccaa

26521 gcagccgccgccgttagcccaagagcaacaacagcgccaaggctaccgctcatggcgcgg

26581 gcacaagaacgccatagttgcttgcttgcaagactgtgggggcaacatctccttcgcccg

26641 ccgctttcttctctaccatcacggcgtggccttcccccgtaacatcctgcattactaccg

26701 tcatctctacagcccatactgcaccggcggcagcggcagcggcagcaacagcagcggcca

26761 cacagaagcaaaggcgaccggatagcaagactctgacaaagcccaagaaatccacagcgg

(SEQ.ID.No.8)

The result who is presented among Figure 24 effectively confirmed, contains different E2-late period/each promoter fragment of Y-box and is applicable to the transgenosis of express therapeutic in YB-1 nuclear-male tumour cell, thereby can be as the promotor on the meaning of the present invention.

Embodiment 19: the YB-1 of gland virus expression is to the influence of particle release

With the adenovirus carrier AdYB-1 of disappearance E1/E3 with only lack the Ad312 infected person osteosarcoma cell (U2OS) of E1A, MOI is the 50pfu/ cell.AdYB-1 contains the sequence of Codocyte transcription factor YB-1 in its genome, thereby expresses Y-box binding protein 1 (YB-1).In order to estimate the release of metainfective conduct " plaque-forming unit " virion (pfu), 2 and 5 days isolation medium supernatant liquor or remaining cellular layers respectively after infection.Melt/freeze circulation by 3, discharge intracellular particle.Use the plaque analysis of experiments numbers of particles on 293 cells.

The result as shown in figure 25, wherein real bar is represented virion remaining in the cell, represents the extracellular virion that discharges and intersect lines.

Result shown in Figure 25 has confirmed that AdYB-1 can generate the more pfu than Ad312 as a whole, and discharges more particles.After 5 days, the cell that has infected AdYB-1 clearly shows the cytopathic effect (CPE) opposite with the cell that has infected Ad312.

The disclosed feature of the present invention of aforementioned specification, claim and accompanying drawing can be separately and arbitrary combination, are important for the realization of its various embodiments of the present invention.

Claims (36)

1. recombinant adenovirus, it expressed first kind of albumen before expressing second kind of albumen, described first kind of albumen is selected from the albumen by E1B, the group that the proteic combination of E4 albumen and E1B albumen and E4 is formed, described second kind of albumen is E1A-albumen, wherein said first kind of proteic expression controlled by promotor, wherein said promotor is selected from by tumor-specific promoters, organ specific promoters, tissue-specific promoter, the group that allogeneic promoter and adenovirus promoter are formed, if be adenovirus promoter wherein about the proteic promotor of E1B, then described adenovirus promoter is different from the E1B promotor, if and be adenovirus promoter about the proteic promotor of E4, then described adenovirus promoter is different from the E4 promotor, and wherein the proteic expression of E1A is controlled by promotor, and wherein controlling the proteic expression promoter of E1A is YB-1 control.

2. according to the recombinant adenovirus of claim 1, it is characterized in that described first kind of albumen is E1B albumen.

3. according to the recombinant adenovirus of claim 2, it is characterized in that described E1B albumen is E1B55kd albumen.

4. according to the recombinant adenovirus of claim 1, it is characterized in that described first kind of albumen is E4 albumen.

5. according to the recombinant adenovirus of claim 4, it is characterized in that described E4 albumen is E4orf6 albumen.

6. according to the recombinant adenovirus of claim 1, it is characterized in that described first kind of albumen is E1B albumen and the proteic combination of E4.

7. according to the recombinant adenovirus of claim 6, it is characterized in that described E1B albumen is that E1B55kD albumen and described E4 albumen are E4orf6 albumen.

8. according to the recombinant adenovirus of claim 1, it is characterized in that E1A albumen is E1A12S albumen.

9. according to the recombinant adenovirus of claim 1, it is characterized in that the proteic expression promoter of control E1A is an adenovirus E2 late promoter.

10. according to the recombinant adenovirus of claim 1, it is characterized in that E4 albumen is under the control of identical or common promotor with E1B albumen.

11. the recombinant adenovirus according to claim 1 is characterized in that, the nucleic acid of this adenovirus comprises the adenopathy contaminated area of non-activity at least one function, and wherein this district is selected from the group that comprises E1 district, E3 district, E4 district and combination thereof.

12. the recombinant adenovirus according to claim 11 is characterized in that, this district is the E1 district.

13. the recombinant adenovirus according to claim 11 is characterized in that, this district is the E3 district.

14. the recombinant adenovirus according to claim 11 is characterized in that, this district is the E4 district.

15. the recombinant adenovirus according to claim 11 is characterized in that, this district comprises E1 district, E3 district and E4 district.

16. the recombinant adenovirus according to claim 1 is characterized in that, this adenovirus comprises nucleic acid, wherein said nucleic acid encoding YB-1.

17. the recombinant adenovirus according to claim 16 is characterized in that, the nucleic acid of coding YB-1 is under the control of promotor.

18. according to the recombinant adenovirus of claim 17, wherein said promotor is the E2 late promoter.

19. the recombinant adenovirus according to claim 17 is characterized in that, the nucleic acid of coding YB-1 is under the control of promotor, and wherein said promotor is YB-1 control.

20. the recombinant adenovirus according to claim 16 is characterized in that, the nucleic acid of coding YB-1 is the part of expression cassette, and described expression cassette comprises the proteic nucleic acid of coding E1A.

21., it is characterized in that E1A albumen is E1A12S albumen according to the recombinant adenovirus of claim 20.

22. the recombinant adenovirus according to claim 20 is characterized in that, in described expression cassette, the proteic nucleic acid of coding E1A is by the separate nucleic acid of IRES sequence with coding YB-1.

23. recombinant adenovirus according to claim 1, it is characterized in that, this adenovirus comprises an expression cassette, and described expression cassette comprises a promotor and one section nucleotide sequence, and wherein said nucleotide sequence is selected from the group that comprises fit, ribozyme, suitable enzyme, antisense molecule and siRNA.

24. recombinant adenovirus according to claim 1, it is characterized in that, this adenovirus comprises an expression cassette, described expression cassette comprises a promotor and one section nucleotide sequence, wherein said nucleotide sequence is a coding nucleic acid, and the molecule of wherein said nucleic acid encoding is selected from the group that comprises peptide, polypeptide, albumen, anti-caline, antibody and antibody fragment.

25. recombinant adenovirus according to claim 1, it is characterized in that, this adenovirus comprises an expression cassette, wherein said expression cassette comprises a promotor and one section nucleotide sequence, and wherein said nucleotide sequence is selected from the group that comprises apoptosis-inducing gene, prodrug gene, proteinase inhibitor, tumor inhibitor gene, cytokine and angiogenesis inhibitor.

26. nucleic acid, its coding is according to the recombinant adenovirus of claim 1.

27. carrier, it comprises the nucleic acid according to claim 26.

28. the carrier according to claim 27 is characterized in that, described carrier is an expression vector.

29. the application of the recombinant adenovirus of claim 1 in producing the tumor disease medicine.

30. the application of the nucleic acid of claim 26 in preparation tumor disease medicine.

31., it is characterized in that forming cell to the small part tumour has YB-1 in being independent of the nuclear of cell cycle according to the application of claim 29.

32., it is characterized in that forming cell to the small part tumour has YB-1 in being independent of the nuclear of cell cycle according to the application of claim 30.

33., it is characterized in that forming cell to the small part tumour comprises the YB-1 that regulates according to the application of claim 29.

34., it is characterized in that forming cell to the small part tumour comprises the YB-1 that regulates according to the application of claim 30.

35. the application according to claim 29 is characterized in that, the cell of at least a portion formation tumour has the resistance to pharmaceutically active agents, wherein said resistance is multiple resistance, this resistance is at antitumour drug, the resistance of cytostatic agent, and/or this resistance is caused by radiation.

36. the application according to claim 30 is characterized in that, the cell of at least a portion formation tumour has the resistance to pharmaceutically active agents, wherein said resistance is multiple resistance, this resistance is at antitumour drug, the resistance of cytostatic agent, and/or this resistance is caused by radiation.

Images