CN1692701A - Method for promoting plant growth and/or increasing plant resistance - Google Patents
Method for promoting plant growth and/or increasing plant resistance Download PDFInfo
- Publication number
- CN1692701A CN1692701A CN 200510069380 CN200510069380A CN1692701A CN 1692701 A CN1692701 A CN 1692701A CN 200510069380 CN200510069380 CN 200510069380 CN 200510069380 A CN200510069380 A CN 200510069380A CN 1692701 A CN1692701 A CN 1692701A
- Authority
- CN
- China
- Prior art keywords
- plant
- zmgst7
- expression vector
- glutathione transferase
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
A method for promoting growth of plant and increasing the resistance of plant features that the coding gene ZmGSTT of glutathione trarnsferase, which comes from corn, is introduced to the target plant.
Description
Technical field
The present invention relates to a kind of method that promotes plant growing and/or improve plant resistance to environment stress in the biological technical field.
Background technology
The abiotic environment factor (as arid, saline and alkaline etc.) has a strong impact on the normal growth of crops and grows and output, and environmental pollution and population explosion then make the supply of grain more be becoming tight.Thereby needs are cultivated the cereal crops of high resistance and high yield and high quality.The Molecular Study of under adverse circumstance, reacting for plant, present difficult point is known to coerce response gene very little, therefore study the mechanism of plant to the adverse circumstance response, most important is exactly to find more to coerce response gene, and studies their effects in adverse circumstance.
(glutathione S-transferase GST) is the very abundant enzyme of a class to the plant glutathione transferase in plant, and the gene family coding of height difference ancient by.The major function of GST is the electrophilic group of the harmful substance of some endogenous or external source in the catalysis biological body and thin basic combination of glutathione, makes its decomposition, or forms material soluble in water, excretes.
Liu Xinfang etc. find that a GST of arabidopsis is relevant to the tolerance of ultraviolet radiation damage with plant; Liping Wangs etc. are from saline land cloning a GST relevant with salt tolerant the alkali paulin.The homologous gene GST8 of Bianchi etc. research tobacco Nt107 gene in arabidopsis, in dehydration fast and progressive when arid, the expression of GST8 increases gradually.Infer that the possible effect of GST8 is the murder by poisoning of eliminating the active oxygen that is caused by drought stress.
To corn GST research, start from Frear the research to corn antiweed atrazine GST in 1970, find that corn GST has the conjugation that promotes interior GSH of corn body and triazine herbicide atrazine, thereby eliminate its toxicity rapidly corn.BZ2 discovers to corn glutathione transferase gene, and the BZ2 encoded protein works in the biosynthetic final step of anthocyan, finally makes anthocyanidin aggegation in the vacuole of corn.At present, have been found that 42 glutathione transferases in corn, be divided three classes according to the similitude of sequence: type i, II, III, the functional study of wherein most corn glutathione transferase genes is report not.Corn glutathione transferase ZmGST7 is made up of 227 amino acid residues, its encoding gene ZmGST7, and by 840 base compositions, its coded sequence is 25-708 bit base (GenBank AJ010440).At present, do not find that it has the report that promotes plant growing and/or have degeneration-resistant function.
Summary of the invention
The purpose of this invention is to provide a kind of method that promotes plant growing and/or improve plant resistance to environment stress.
Promotion plant growing provided by the present invention and/or improve the method for plant resistance to environment stress is that the encoding gene with the plant glutathione transferase imports the purpose plant, obtains growing accelerating and/or transfer-gen plant that resistance improves.
Described plant glutathione transferase can derive from corn, arabidopsis, saline land alkali paulin or paddy rice, is preferably corn, and described plant glutathione transferase is preferably ZmGST7.
The encoding gene of described plant glutathione transferase imports the purpose plant by plant expression vector; Described plant expression vector is Ti class plasmid vector or viral vectors.
The encoding gene of described plant glutathione transferase can add any general promotor, strengthen promotor or inducible promoter in being building up to plant expression vector the time before its transcription initiation nucleotide.
In described expression vector, start the promotor that the encoding gene of described plant glutathione transferase transcribes and can be the cauliflower mosaic virus 35S promoter.Described expression vector is preferably 35S-ZmGST7.
In described expression vector, start the promotor that the encoding gene of described plant glutathione transferase transcribes and also can be arabidopsis rd29A gene promoter.Described expression vector is preferably RD29AP-ZmGST7.
For the ease of genetically modified plants or transgenic plant cells being identified and being screened, can process employed carrier, as the antibiotic marker gene (gentamicin, kanamycin etc.) that adds alternative mark (gus gene, GFP and luciferase gene etc.) or have resistance.For the safety that genetically modified plants discharge, when making up plant expression vector, also can not carry any marker gene, carry out specific PCR molecular marker screening in seedling stage.
Contain the expression vector of the encoding gene of described plant glutathione transferase can be by using conventional biological method transformed plant cells or tissues such as Ti-plasmids, Ri plasmid, plant viral vector, directly DNA conversion, microinjection, electricity be led, agriculture bacillus mediated or particle gun, and the plant transformed tissue cultivating become plant.
Experimental result shows that corn gene ZmGST7 can promote the growth of transgenic arabidopsis under normal operation, and can improve plant resistance to environment stress under the osmotic stress of low concentration.Method of the present invention has important practical value and economic benefit for cultivating novel anti-contrary ornamental plant and crops.
Description of drawings
Figure 1A for BamHI, the HindIII of 35S-ZmGST7, Xhol respectively enzyme cut qualification result
Figure 1B for EcoRI, the NcoI of RD29AP-ZmGST7, KpnI, SalI respectively enzyme cut qualification result
Embodiment
Experimental technique among the following embodiment is conventional method if no special instructions.
Percentage composition among the following embodiment if no special instructions, is the quality percentage composition.
T
0Expression is through being stained with the plant after flower infects, T
1Expression T
0The seed that produces for selfing reaches by the plant that it grew up to T
2Expression T
1The seed that produces for selfing and by plant that it grew up to.
Embodiment 1, utilize ZmGST7 to promote the arabidopsis growth and improve the arabidopsis resistance
1, changes the acquisition of ZmGST7 plant
(1) plant expression vector of structure ZmGST7
The ZmGST7 clone that contains who is utilized comes from suppressing the subtracted library that difference subtracts the cross method structure.Concrete library constructing method is all according to the PCR-select of Clontech company
TMThe condition that cDNA Subtraction Kit kit is recommended is carried out, and the ZmGST7 cDNA fragment that obtains is connected on the pGEM T-easy carrier and (purchases the company in Promega), and is transformed into DH5 α Bacillus coli cells.All clones find that through the order-checking back one of them clone comprises complete ZmGST7 gene coded sequence, called after pGEM T-easy-ZmGST7.
Cut pGEM T-easy-ZmGST7 plasmid with the EcoRI enzyme, obtain the ZmGST7 fragment, be connected between the EcoRI recognition site of pGEM-7Zf (+) carrier (purchasing company) in Promega, evaluation through the gene direction, with XbaI and SacI double digestion, must arrive two ends and contain the ZmGST7 fragment of XbaI and SacI restriction enzyme site, this fragment is connected to restriction enzyme XbaI and SacI removes between the recognition site of restriction enzyme XbaI on pBI221 (the purchasing company) carrier of gus gene and SacI in BioLabs, cut evaluation through restriction enzyme EcoRI and HindIII enzyme, obtain containing the recombinant vector pBI221-ZmGST7-35S of ZmGST7 gene order.PBI221-ZmGST7-35S cuts with the PstI enzyme, EcoRI is partially digested, obtain containing the ZmGST7 fragment of 35S promoter and NOS terminator, at last this fragment is connected between the recognition site that plant expression vector p3301 goes up the restriction enzyme PstI of (p3301 available from Australian CAMBIA company) and EcoRI, again with BamHI, HindIII, Xhol respectively enzyme cut evaluation, enzyme is cut qualification result shown in Figure 1A, the band that the BamHI enzyme is cut and obtained a size is 13kb; Band that the HindIII enzyme is cut and obtained a size is 11.5kb and the band of a 2kb; The band that the Xhol enzyme is cut and obtained a size is 10.6kb, the band of the band of a 1.8kb and a 560bp; Show obtain structure correct start the recombinant expression carrier 35S-ZmGST7 that ZmGST7 transcribes by the cauliflower mosaic virus 35S promoter.
Cut pGEM T-easy-ZmGST7 with the NotI enzyme, obtain the ZmGST7 fragment, be connected between the recognition site of restriction enzyme NotI of pBluescriptIIKS/SK (+) (purchasing company) carrier in MBI Fermentas, evaluation through the gene direction, with Xbal and SacI double digestion, must arrive two ends and contain the ZmGST7 fragment of Xbal and SacI restriction enzyme site, this fragment is connected to restriction enzyme Xbal and SacI removes between the recognition site of restriction enzyme Xbal on pBI221 (the purchasing company) carrier of gus gene and SacI, obtain containing the recombinant vector pBI221-ZmGST7 of ZmGST7 gene order in BioLabs.Cut 35S promoter with HindIII and Xbal enzyme except that the pBI221-ZmGST7 carrier.According to (MOLECULAR AND GENERAL GENETICS such as Yamaguchi Shinozaki, 1993,5 ' terminal sequence of the rd29A gene of 236:331-340) delivering, designed the special primer that a pair of two ends have HindIII and Xbal restriction enzyme site respectively (P1:5 '-AAAAGCTTACGCATGATTTGATGGAG-3 ' (sequence 1), P2:5 '-AGTCTAGAAACCCTTTATTCCTGATGATTG-3 ' (sequence 2)), synthetic by Shanghai bio-engineering corporation.Carry out pcr amplification from arabidopsis thaliana genomic dna, reaction system comprises 1 μ l dna profiling for being 25 μ l, 2.5 μ l10 * buffer, 2.5 μ l dNTPs (2mM), 1 μ l primer P1 (10mM), 1 μ l primer P2 (10mM), 0.3 μ lTaq enzyme (5U/ μ l), 16.7 μ l ddH
2O.Reaction condition is 94 ℃ of pre-sex change 3 minutes; 94 ℃, 45 seconds, 65 ℃, 45 seconds, 72 ℃, 1 minute, extended 10 minutes in 72 ℃ of insulations after 35 circulations.The PCR product is cut with HindIII and Xbal enzyme, obtain containing the RD29A Promoter fragment of HindIII and Xbal restriction enzyme site, this fragment is connected on the pBI221-ZmGST7 that contains ZmGST7 that removes 35S promoter, cut through the HindIII enzyme, EcoRI is partially digested, obtain containing the ZmGST7 fragment of RD29A promotor and NOS terminator, be connected at last between the recognition site of restriction enzyme HindIII on the plant expression vector p3301 and EcoRI, use EGoRI again, NcoI, KpnI, SalI enzyme respectively cuts evaluation, enzyme is cut qualification result shown in Figure 1B, band that the NcoI enzyme is cut and obtained a size is 11.5kb and the band of a 1.92kb; Band that the KpnI enzyme is cut and obtained a size is 11.2kb and the band of a 2.27kb; Band that the EcoRI enzyme is cut and obtained a size is 12.26kb and the band of a 1.2kb; The band that the SalI enzyme is cut and obtained a size is 10.9kb, the band of the band of a 2.26kb and a 280bp; Show obtain structure correct start the recombinant expression carrier RD29AP-ZmGST7 that ZmGST7 transcribes by arabidopsis rd29A gene promoter.
(2) transform plant
Recombinant expression plasmid 35S-ZmGST7 or RD29AP-ZmGST7 are transformed Agrobacterium GV3101, and extract plasmid and do that enzyme is cut and pcr amplification detects, the screening positive strain is used to transform plant.
Positive agrobacterium strains is inserted the YEB medium respectively, cultivated OD 5～6 hours for 28 ℃
600About 0.5 o'clock, 5000g, collected somatic cells in centrifugal 15 minutes,, add volumn concentration and be 0.02% surfactant silwet L-77 (available from GE Silicones company) and be used to transform plant with the solution re-suspended cell that contains 1 * MS macroelement and 5% sucrose.Arabidopsis thaliana transformation adopts is stained with the method that flower infects (floral dipping), transforms the dark low temperature in back (16 degrees centigrade) cultivation and changes growth under the normal condition of culture after 24 hours over to, is T
0For plant.Results T
0For the seed (T on the plant
1For seed), with 7000 T
1For the seed vernalization 3 days of tiling on the MS medium, directly be seeded in the nutrition soil then and grow, normal growth is after 20 days, with weed killer herbicide grass fourth phosphine (PPT) the spraying screening transformed plant of 0.5 ‰ (percents by volume).Transformed plant still can normal growth after spraying antiweed, extract the genomic DNA of transformed plant simultaneously, utilize primer AAGACCTGGGCAACAAGAGCGA and TGGCGAAGAAATAGAGACACACCTTA to carry out pcr amplification ZmGST7 gene, utilize primer CCAGAAACCCACGTCATGCC and CAGGAACCGCAGGAGTGGA to carry out pcr amplification herbicide resistance gene bar gene, further identify transformed plant (no corresponding Z mGST7 gene and herbicide resistance gene amplified band in the unconverted plant), the result obtains 100 strain T
1For transformed plant.T
1Gather in the crops T for transformed plant respectively according to strain system
2For seed.T
2After the seed plantation, the evaluation transformed plant that uses the same method, and results T
3For seed, the result obtains the T of 50 35S-ZmGST7 transformation plants
3T for seed (each 1000 in each strain system) and 50 RD29AP-ZmGST7 transformation plants
3For seed (each 1000 in each strain system).
2, the growth traits of changeing the ZmGST7 plant is observed
The T that will contain the commentaries on classics 35S-ZmGST7 of ZmGST7
3T for seed, commentaries on classics RD29AP-ZmGST7
3At first be seeded on the MS medium that contains 7mg/L grass fourth phosphine 4 ℃ of vernalization 3 days, illumination cultivation growth 4 days, the seedling that screening can be survived for seed (respectively getting 10 transformation plants, each 30 in each strain system); The seed of unconverted plant (30) be seeded on the MS medium, 4 ℃ of vernalization 3 days, illumination cultivation growth 4 days, seedling in contrast.The transgenosis seedling and the contrast seedling of screening are transferred on the MS medium simultaneously, and culture dish is uprightly placed, and the arabidopsis seedling was inverted growth after 4 days, and each strain system gets 10 strains and observes relatively plant root, and the result shows the T of the commentaries on classics 35S-ZmGST7 that contains ZmGST7
3Root long (average out to 2.74cm) for the plant seedling is obviously compared the length of shining (average out to 2.15cm), and variance analysis reaches utmost point significance level (1% significance level), and contains the T of the commentaries on classics RD29AP-ZmGST7 of ZmGST7
3Grow (average out to 2.26cm) difference little (table 1) compared with the control for the root of plant seedling.
Table 1. contains the T of the commentaries on classics 35S-ZmGST7 of ZmGST7
3T for plant, commentaries on classics RD29AP-ZmGST7
3Be inverted the root of growth after 4 days long (cm) relatively for plant and unconverted plant
| ??T 3For strain be | ??1 | ??2 | ??3 | ??4 | ??5 | ??6 | ??7 | ??8 | ??9 | ??10 | On average |
| Change 35S-ZmGST7 | ??2.43 | ??2.40 | ??2.5 | ??3.33 | ??2.73 | ??3.23 | ??2.80 | ??2.67 | ??2.67 | ??2.63 | ??2.74 |
| Change RD29AP-ZmGST7 | ??2.13 | ??2.33 | ??2.23 | ??2.53 | ??2.35 | ??2.46 | ??2.35 | ??2.17 | ??1.96 | ??2.10 | ??2.26 |
| Unconverted | ??2.20 | ??1.98 | ??2.15 | ??2.10 | ??2.03 | ??2.13 | ??2.20 | ??2.17 | ??1.95 | ??2.12 | ??2.15 |
With the above-mentioned T that contains the commentaries on classics 35S-ZmGST7 of ZmGST7
3T for seed, commentaries on classics RD29AP-ZmGST7
3At first be seeded on the MS medium that contains 7mg/L grass fourth phosphine 4 ℃ of vernalization 3 days, illumination cultivation growth 7 days, the seedling that screening can be survived for seed (respectively getting 10 transformation plants, each 30 in each strain system); The seed of unconverted plant (30) be seeded on the MS medium, 4 ℃ of vernalization 3 days, illumination cultivation growth 4 days, seedling in contrast.Be seeded in the transgenosis seedling and the contrast seedling of screening in the small flower simultaneously, after growing into 20 days, obviously observe the commentaries on classics 35S-ZmGST7 plant comparison that contains ZmGST7 and shine bolting, bloomed 3-4 days in advance, it is then consistent with the contrast bolting time to change the RD29AP-ZmGST7 plant.Table 2 shows the difference of the Ahau measurement plant bolting height after transplanting.The difference of changeing 35S-ZmGST7 plant and contrast reaches utmost point significance level (p＜0.01).
Table 2. contains the T of the commentaries on classics 35S-ZmGST7 of ZmGST7
3T for plant, commentaries on classics RD29AP-ZmGST7
3Comparison for the Ahau plant bolting height (cm) behind plant and the unconverted plantlet of transplant
| ??T 3For strain be | ?1 | ?2 | ?3 | ?4 | ?5 | ?6 | ?7 | ?8 | ?9 | ?10 | On average |
| Change 35S-ZmGST7 | ?6.00 | ?7.16 | ?7.34 | ?8.20 | ?7.70 | ?6.50 | ?7.98 | ?6.66 | ?6.58 | ?6.30 | ?7.04 |
| Change RD29AP-ZmGST7 | ?5.22 | ??4.98 | ??5.56 | ??3.80 | ??3.32 | ??3.80 | ??4.76 | ??3.26 | ??3.30 | ??3.46 | ??4.15 |
| Unconverted | ?2.63 | ??3.83 | ??3.50 | ??2.50 | ??2.46 | ??3.00 | ??2.67 | ??3.10 | ??4.60 | ??4.50 | ??3.28 |
3, the resistance of changeing the ZmGST7 plant is observed
The T that will contain the commentaries on classics 35S-ZmGST7 of ZmGST7
3For seed, contain the T of the commentaries on classics RD29AP-ZmGST7 of ZmGST7
3(respectively get 10 transformation plants for seed, each 30 in each strain system) at first is seeded on the MS medium that contains 7mg/L grass fourth phosphine, (30 in the seed of unconverted plant, contrast) is seeded in the MS medium, 4 ℃ of vernalization 3 days, illumination cultivation growth 4 days, the seedling that can survive is transferred on the MS medium of the mannitol (100mmol/L, 200mmol/L, 300mmol/L, 400mmol/L) that contains variable concentrations again, culture dish is uprightly placed, the arabidopsis seedling is inverted growth, and the root of measuring crooked growth downwards after 4 days is long.The result shows the T of the commentaries on classics RD29AP-ZmGST7 that contains ZmGST7
3Seedling for plant is coerced the long comparison of down relative root according to longer at the mannitol of low concentration, especially reaches utmost point significance level when 200mmol/L mannitol.The T that contains the commentaries on classics 35S-ZmGST7 of ZmGST7
2Coerce the long comparison of down relative root according to long for plant at the mannitol of low concentration, but that the amplitude of difference is not changeed the seedling of RD29AP-ZmGST7 is obvious, only when 200mmol/L mannitol, reaches significance level (table 3-table 6).
Table 3. contains the T of the commentaries on classics 35S-ZmGST7 of ZmGST7
3T for plant, commentaries on classics RD29AP-ZmGST7
34 days root of growth long (cm) under the mannitol of 100mmol/L is coerced compares for plant and unconverted plant
| ???T 3For strain be | ??1 | ??2 | ??3 | ??4 | ??5 | ??6 | ??7 | ??8 | ??9 | ??10 | On average |
| Change 35S-ZmGST7 | ??1.73 | ??2.03 | ??1.83 | ??1.10 | ??1.70 | ??2.13 | ??2.27 | ??2.07 | ??1.90 | ??1.83 | ??1.86 |
| Change RD29AP-ZmGST7 | ??1.67 | ??2.03 | ??2.07 | ??2.00 | ??1.90 | ??1.97 | ??2.17 | ??2.00 | ??1.93 | ??1.83 | ??1.96 |
| Unconverted | ??1.10 | ??1.80 | ??1.93 | ??1.80 | ??1.50 | ??1.23 | ??1.20 | ??1.40 | ??2.07 | ??1.86 | ??1.59 |
Table 4. contains the T of the commentaries on classics 35S-ZmGST7 of ZmGST7
3T for plant, commentaries on classics RD29AP-ZmGST7
34 days root of growth long (cm) under the mannitol of 200mmol/L is coerced compares for plant and unconverted plant
| ??T 3For strain be | ??1 | ??2 | ??3 | ??4 | ??5 | ??6 | ??7 | ??8 | ??9 | ??10 | On average |
| Change 35S-ZmGST7 | ??1.53 | ??1.90 | ??1.37 | ??1.50 | ??1.13 | ??1.83 | ??1.47 | ??1.80 | ??1.57 | ??1.40 | ??1.55 |
| Change RD29AP-ZmGST7 | ??1.63 | ??1.53 | ??1.63 | ??1.77 | ??2.33 | ??2.03 | ??1.53 | ??1.70 | ??1.60 | ??1.43 | ??1.72 |
| Unconverted | ??0.83 | ??1.03 | ??1.17 | ??1.63 | ??0.90 | ??1.53 | ??1.17 | ??1.23 | ??1.30 | ??0.67 | ??1.15 |
Table 5. contains the T of the commentaries on classics 35S-ZmGST7 of ZmGST7
3T for plant, commentaries on classics RD29AP-ZmGST7
34 days root of growth long (cm) under the mannitol of 300mmol/L is coerced compares for plant and unconverted plant
| ??T 3For strain be | ??1 | ??2 | ?3 | ?4 | ?5 | ?6 | ??7 | ??8 | ??9 | ??10 | On average |
| Change 35S-ZmGST7 | ??0.87 | ??0.87 | ?1.20 | ?1.00 | ?0.70 | ?1.20 | ??1.07 | ??1.10 | ??1.00 | ??1.13 | ??1.01 |
| Change RD29AP-ZmGST7 | ??1.07 | ??0.80 | ??0.80 | ??0.80 | ??0.93 | ??0.77 | ??0.70 | ??1.03 | ??0.97 | ??0.90 | ??0.88 |
| Unconverted | ??0.80 | ??0.83 | ??0.70 | ??0.53 | ??0.50 | ??0.83 | ??0.70 | ??0.80 | ??0.60 | ??0.85 | ??0.71 |
Table 6. contains the T of the commentaries on classics 35S-ZmGST7 of ZmGST7
3T for plant, commentaries on classics RD29AP-ZmGST7
34 days root of growth long (cm) under the mannitol of 400mmol/L is coerced compares for plant and unconverted plant
| ??T 3For strain be | ??1 | ??2 | ??3 | ??4 | ??5 | ??6 | ??7 | ??8 | ??9 | ??10 | On average |
| Change 35S-ZmGST7 | ??0.40 | ??0.53 | ??0.50 | ??0.57 | ??0.33 | ??0.47 | ??0.53 | ??0.50 | ??0.43 | ??0.40 | ??0.47 |
| Change RD29AP-ZmGST7 | ??0.43 | ??0.50 | ??0.50 | ??0.57 | ??0.50 | ??0.60 | ??0.43 | ??0.50 | ??0.30 | ??0.53 | ??0.49 |
| Unconverted | ??0.30 | ??0.53 | ??0.37 | ??0.37 | ??0.37 | ??0.50 | ??0.40 | ??0.37 | ??0.37 | ??0.40 | ??0.40 |
The result of present embodiment shows that corn gene ZmGST7 can obviously promote plant growing, and can improve the resistance of plant under low-level osmotic stress.
Sequence table
<160>2
<210>1
<211>26
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>1
aaaagcttac?gcatgatttg?atggag??????????????????????????????????????????26
<210>2
<211>30
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>2
agtctagaaa?ccctttattc?ctgatgattg??????????????????????????????????????30
Claims (9)
1, a kind of method that promotes plant growing and/or improve plant resistance to environment stress is that the encoding gene with the plant glutathione transferase imports the purpose plant, obtains growing accelerating and/or transfer-gen plant that resistance improves.
2, method according to claim 1 is characterized in that: described plant glutathione transferase derives from corn, arabidopsis, saline land alkali paulin or paddy rice.
3, method according to claim 2 is characterized in that: described plant glutathione transferase derives from corn.
4, method according to claim 3 is characterized in that: described plant glutathione transferase is ZmGST7.
5, according to arbitrary described method among the claim 1-4, it is characterized in that: the encoding gene of described plant glutathione transferase imports the purpose plant by plant expression vector; Described plant expression vector is Ti class plasmid vector or viral vectors.
6, method according to claim 5 is characterized in that: in described expression vector, starting the promotor that the encoding gene of described plant glutathione transferase transcribes is the cauliflower mosaic virus 35S promoter.
7, method according to claim 6 is characterized in that: described expression vector is 35S-ZmGST7.
8, method according to claim 5 is characterized in that: in described expression vector, starting the promotor that the encoding gene of described plant glutathione transferase transcribes is arabidopsis rd29A gene promoter.
9, method according to claim 8 is characterized in that: described expression vector is RD29AP-ZmGST7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100693805A CN100388878C (en) | 2005-05-16 | 2005-05-16 | Method for promoting plant growth and/or increasing plant resistance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100693805A CN100388878C (en) | 2005-05-16 | 2005-05-16 | Method for promoting plant growth and/or increasing plant resistance |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1692701A true CN1692701A (en) | 2005-11-09 |
| CN100388878C CN100388878C (en) | 2008-05-21 |
Family
ID=35351962
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100693805A Expired - Fee Related CN100388878C (en) | 2005-05-16 | 2005-05-16 | Method for promoting plant growth and/or increasing plant resistance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100388878C (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101748144B (en) * | 2010-01-22 | 2011-12-28 | 昆明理工大学 | Torch pear haloduric gene PpGST and application thereof |
| CN102958346A (en) * | 2010-07-16 | 2013-03-06 | 花王株式会社 | Method for imparting stress tolerance to plant, composition for imparting stress tolerance to plant and utilization thereof |
| CN101798340B (en) * | 2009-02-09 | 2013-06-19 | 中国科学院遗传与发育生物学研究所 | Plant growth coordinating and disease-resistant related gene, coded protein and application thereof |
| CN103703131A (en) * | 2011-07-25 | 2014-04-02 | 国立大学法人奈良先端科学技术大学院大学 | Novel gene inducing elongation of roots or increasing biomass, and use therefor |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1314484A (en) * | 2001-02-23 | 2001-09-26 | 山东师范大学 | Suaeda salsa qlutathione s-transferase (GST) full length cDNA |
| GB0220038D0 (en) * | 2002-08-29 | 2002-10-09 | Univ Durham | Novel Protein Design |
-
2005
- 2005-05-16 CN CNB2005100693805A patent/CN100388878C/en not_active Expired - Fee Related
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101798340B (en) * | 2009-02-09 | 2013-06-19 | 中国科学院遗传与发育生物学研究所 | Plant growth coordinating and disease-resistant related gene, coded protein and application thereof |
| CN101748144B (en) * | 2010-01-22 | 2011-12-28 | 昆明理工大学 | Torch pear haloduric gene PpGST and application thereof |
| CN102958346A (en) * | 2010-07-16 | 2013-03-06 | 花王株式会社 | Method for imparting stress tolerance to plant, composition for imparting stress tolerance to plant and utilization thereof |
| CN102958346B (en) * | 2010-07-16 | 2014-03-05 | 花王株式会社 | Method for imparting stress tolerance to plant, composition for imparting stress tolerance to plant and utilization thereof |
| US8841236B2 (en) | 2010-07-16 | 2014-09-23 | Kao Corporation | Method for imparting stress tolerance to plant, plant stress tolerance imparting composition and use thereof |
| CN103703131A (en) * | 2011-07-25 | 2014-04-02 | 国立大学法人奈良先端科学技术大学院大学 | Novel gene inducing elongation of roots or increasing biomass, and use therefor |
| CN103703131B (en) * | 2011-07-25 | 2016-08-17 | 国立大学法人奈良先端科学技术大学院大学 | Induce the elongation of root or the new gene of the amount of increase biomass and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100388878C (en) | 2008-05-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109536509B (en) | Sesame drought-resistant, moisture-resistant and salt-tolerant gene SiNAC56, protein coded by same and application of sesame drought-resistant, moisture-resistant and salt-tolerant gene SiNAC56 | |
| CN110128516B (en) | Barley moisture-resistant regulatory gene HvERF2.11, protein and application thereof in breeding | |
| CN102482681B (en) | Stress tolerant plants | |
| CN113388017B (en) | Drought-resistant protein and application of coding gene thereof in cultivating drought-resistant plants | |
| JP5273624B2 (en) | Method for improving salt tolerance of plants by overexpressing SyFBP / SBPase gene isolated from Synechocystis and plant produced by the method | |
| CN100388878C (en) | Method for promoting plant growth and/or increasing plant resistance | |
| CN110358772A (en) | The OsEBP89 gene and preparation method of raising rice abiotic stress resistance and application | |
| CN102154337B (en) | Gossypium hirsutum mitogen-activated protein kinas 6 (GhMAPK6) gene and application thereof | |
| CN115851821B (en) | Application of BBX16 gene in improving plant salt tolerance | |
| JP5787413B2 (en) | A method for producing a toothpick-forming plant in which the ability to produce tubers or the ability to form a toothpick is improved compared to a wild strain, and a toothpick-forming plant produced by the method | |
| CN102154338B (en) | Gene GhMKK5 capable of improving bacterial resistance of transgenic crops and application thereof | |
| CN107630021A (en) | The albumen and application of asparagus resistant gene of salt AoSOS2 and its coding | |
| CN112409467B (en) | Application of plant stress tolerance related protein GmDof41 in regulation and control of plant stress tolerance | |
| CN113755510A (en) | Encoding soybean FtsH metalloprotease gene GmFtsH25 and application thereof | |
| CN113604475A (en) | Application of cotton GH _ D03G1517 gene in drought resistance promotion and salt tolerance promotion | |
| CN102191267B (en) | Plant-mediated insect RNA (Ribonucleic Acid) interference reinforced by using cysteine protease | |
| KR101326017B1 (en) | Salt-resistant SyGT gene from Synechocystis and uses thereof | |
| CN111411113A (en) | Pear guard cell potassium ion absorption channel gene PbrKAT1 and application thereof | |
| CN118064453B (en) | Application of GhTLP gene in improving salt stress tolerance of plants | |
| CN116121298B (en) | Application of inhibiting expression of HSRP1 gene in improving heat resistance of plants | |
| CN116622725B (en) | Hybrid tulip tree LhMFT2 gene and application | |
| CN113621038B (en) | Oligopeptide capable of improving germination rate of plant seeds under salt stress and application of oligopeptide | |
| CN114645057B (en) | Caragana microphylla drought-tolerant gene Chr8.229 and application thereof in preparation of drought-tolerant transgenic plants | |
| CN112608371B (en) | Pleiotropic gene SbSnf4 and application thereof in improving sugar content and biological yield of sorghum stalks | |
| KR20190051565A (en) | Complex insect-resistant rice and method for producing the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080521 Termination date: 20110516 |