CN1690221B - Method and kit for detecting susceptibility of cholelithiasis - Google Patents
Method and kit for detecting susceptibility of cholelithiasis Download PDFInfo
- Publication number
- CN1690221B CN1690221B CN 200410017887 CN200410017887A CN1690221B CN 1690221 B CN1690221 B CN 1690221B CN 200410017887 CN200410017887 CN 200410017887 CN 200410017887 A CN200410017887 A CN 200410017887A CN 1690221 B CN1690221 B CN 1690221B
- Authority
- CN
- China
- Prior art keywords
- plastosome
- seq
- rrna
- chololithiasis
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method of diagnosing cholelithiasis, which contains mitochondria 12s rRNA gene order detecting individual, whether expression varying comparing to normal, especially comparing the nucleotide at the following site in SEQ ID NO: 1 sequence: the 827, 4820,13590 and 15534 site. Existing variation expresses that the individual has more probability of suffering from an illnessof cholelithiasis than normal community doing. The invention also discloses the reagent box detecting cholelithiasis.
Description
Technical field
The present invention relates to molecular biology and medical field.More specifically, the present invention relates to utilize the method for plastosome 12s rRNA (plastosome 12s rRNA) gene and coded product diagnosis and treatment chololithiasis, and the pharmaceutical composition that contains plastosome 12s rRNA gene and/or coded product.
Background technology
Chololithiasis is a kind of common disease, and it causes owing to gall-bladder or choledoch-calculus.General chololithiasis is divided three classes by the composition of cholelith: cholesterol calculus, bile pigment calculus and combination calculus.Wherein common with cholesterol calculus.Epigastrium generally can appear in the patient who suffers from chololithiasis vexed bloated discomfort, feels sick, and often with dyspeptic symptom, when pressing belly deeply with hand, the sensation of pain is arranged.The sickness rate of chololithiasis is about 7%-10% in the Chinese population, and wherein women's sickness rate is higher more than 2 times than the male sex, and is more general with the elderly's morbidity more than 50 years old.
Mitochondrial disease is a more special class genetic diseases, and it is to be undergone mutation and the genetic diseases that causes by gene on the plastosome.It is characterized in that matrilinear inheritance, promptly can only entail child by mother.Because chondriogen all is the relevant gene of energy metabolism, at oxidative phosphorylation and sugar, play crucial effects in the metabolism of lipid, so the mitochondrial inheritance disease mostly is the disease relevant with metabolism greatly, typical in non-insulin-depending type diabetes of chondriosome, neuromyasthenia etc.Some degenerative disease is also relevant with the sudden change of Mitochondrial DNA (mtDNA), as Alzeimer syndromes, Parkinson syndromes, Huntington chorea, aging etc.Mitochondrial disease can be because the sudden change of chondriogen causes, also can be because coded tRNA of plastosome or relative risk NA undergo mutation causes.
Up to now, this area also lacks the effective ways of diagnosing chololithiasis and the effective means of non-operative treatment chololithiasis.Therefore, this area presses for the effective ways of new diagnosis of exploitation and treatment chololithiasis, and relevant medicine, diagnostic techniques and reagent.
Summary of the invention
One object of the present invention just provides a kind of method and detection kit of new diagnosis (especially early diagnosis) chololithiasis.
Another object of the present invention provides a kind of method of new treatment chololithiasis.
A further object of the present invention provides a kind of pharmaceutical composition for the treatment of chololithiasis.
In a first aspect of the present invention, a kind of method that the chololithiasis susceptibility of individuality is diagnosed is provided, it comprises step:
(a) detect this individual plastosome 12s rRNA gene, transcription product, and compare with normal plastosome 12srRNA gene, transcription product,
Wherein, the possibility that there are differences with regard to showing this individuality trouble chololithiasis is higher than normal population; Perhaps the method comprising the steps of:
(b) detect shown in the SEQ ID NO:1 of this individual Mitochondrial DNA the Nucleotide in following site in the sequence: 827,4820,13590,15534;
Wherein, the Nucleotide in 827 sites is G, and the Nucleotide in 4820 sites is A, and the Nucleotide in 13590 sites is A, or the Nucleotide in 15534 sites is T, suffers from the possibility of chololithiasis and is higher than normal population with regard to showing this individuality.
In another preference, detection be gene or the transcript of plastosome 12s rRNA, and with NM 12s rRNA nucleotide sequence comparing difference.
In another preference, described difference is selected from down group:
827 A → G among the SEQ ID NO:1,4820 G → A, 13590 G → A and 15534 C → T.
In a second aspect of the present invention, provide a kind of nucleic acid primer that detects the cholelithiasis susceptibility right, its length is 15-50bp, and hybridizes specifically and amplify shown in the SEQ ID NO:1 that contains human mitochondrion 12s rRNA the amplified production of the 827th, 4820,13590 or 15534 single nucleotide polymorphism in the sequence.
In a third aspect of the present invention, a kind of oligonucleotide probe is provided, its length is 15-500bp, and hybridizes specifically and detect shown in the SEQ ID NO:1 that contains human mitochondrion 12s rRNA the 827th, 4820,13590 or 15534 single nucleotide polymorphism in the sequence.
In a fourth aspect of the present invention, a kind of test kit that detects chololithiasis is provided, it comprises the primer of specific amplification plastosome 12s rRNA gene or transcript, and the amplified production of described primer contains the mutational site that is selected from down group: among the SEQ ID NO:1 the 827th, 4820,13590 or 15534.
In another preference, described test kit also contains and mutational site bonded probe.
In another preference, the sudden change that described test kit detects is selected from:
827 A → G among the SEQ ID NO:1,4820 G → A, 13590 G → A, 15534 C → T.
In another preference, the sudden change that described test kit detects is that 827A → G among the SEQ ID NO:1,4820 G → A, 13590 G → A, the sudden change of 15534 C → T take place simultaneously.
In a fifth aspect of the present invention, a kind of method for the treatment of chololithiasis is provided, it comprises step: NM 12s rRNA transcription product or the coded product of using safe and effective amount to the patient of the described treatment of needs.A kind of pharmaceutical composition also is provided, and it contains plastosome 12s rRNA or its coded product and the pharmaceutically acceptable carrier of safe and effective amount.
Description of drawings
Fig. 1 has shown the phylogeny relation of B4b.Wherein, P1-P15 is patient, and C1-C17 is contrast.The Position Number of each SNP refers to that corresponding base changes among the SEQ ID NO:1, is G as 827G representative No. 827 base mutation in SEQ IDNO:1.
Embodiment
Plastosome is an important organoid in the eukaryotic cell, is oxidative phosphorylation, the place that energy generates.The oxidative phosphorylation of energy substance provides precursor substance NADPH and acetyl-CoA for the synthetic of steroid, and the meta-bolites of steroid also will be finished metabolism completely by the oxidative phosphorylation approach.Chondriogen is by the direct or indirect metabolism of controlling steroid of controlled oxidation phosphorylation process.Therefore, chondriogen may cause comprising the many of chololithiasis and steroid metabolism class disease unusually.The inventor finds first and has proved that through going deep into for many years and extensive studies plastosome 12s rRNA (plastosome 12s rRNA) and chololithiasis are closely related, and the change of plastosome 12s rRNA will directly cause chololithiasis.Finished the present invention on this basis.
Plastosome has the relatively independent genetic system of a cover, and it has independently genes encoding and protein-synthesizing system, the control of also receiving cell chromosome DNA simultaneously.The mitochondrial ribosome-RNA(rRNA) that two absolute codings are arranged, be respectively 16s rRNA and 12s rRNA.rRNA gene and produce sophisticated rRNA through transcribing and transcribe post-treatment, having mitochondrial protein synthetic function. research of the present invention confirms that at first sudden change and the chololithiasis of plastosome 12s rRNA are closely related.
As used herein, term " gene of the present invention " refers to plastosome 12s ribosomal rna gene, i.e. plastosome 12s rRNA gene.
As used herein, term " coded product of the present invention " refers to the RNA product of plastosome 12s ribosomal rna gene coding, i.e. the RNA product of plastosome 12s rRNA gene.
In the present invention, about plastosome 12s rRNA sequence and some other useful informations, can in following electronic data library information, find:
GenBank Overview，http://www.ncbi.nlm.nih.gov/Genebank/GenbankOverview.html[NC_001807(GI：13959823)](SEQ ID NO：1)
Based on discovery of the present invention, plastosome 12s rRNA coded product is of use in many ways.These purposes include, but is not limited to: directly as pharmacological agent or auxiliary chololithiasis be used for screening and promote plastosome 12s
The antibody of rRNA coded product function, polypeptide or other part.The peptide molecule that can stimulate human mitochondrion 12s rRNA coded product function that can be used for seeking therapeutic value with the recombinant human plastosome 12s rRNA coded product screening peptide library of expressing.
On the other hand, the present invention also comprises human mitochondrion 12s rRNA DNA or the product of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.Antibody of the present invention can be prepared by the known various technology of those skilled in that art.
Utilize coded product of the present invention,, can filter out with plastosome 12s rRNA coded product interactional material takes place, as inhibitor, agonist or antagonist etc. by various conventional screening methods.
Normal plastosome 12s rRNA coded product can be directly used in disease treatment, for example, is used for the treatment of chololithiasis aspect.When using plastosome 12s rRNA coded product of the present invention, also can use the medicament of other treatment chololithiasis simultaneously.
Chololithiasis can be alleviated or eliminate to plastosome 12s rRNA coded product of the present invention when using (administration) in treatment.Usually, plastosome 12s rRNA coded product can be formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can change to some extent with being prepared Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intramuscular, intravenously, subcutaneous or topical.
The present invention also provides a kind of pharmaceutical composition, and it contains plastosome 12srRNA coded product of the present invention and the pharmaceutically acceptable carrier or the vehicle of safe and effective amount.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as ointment, tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as ointment, injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 0.1 microgram/kg body weight-Yue 5 mg/kg body weight.
When making pharmaceutical composition, be that plastosome 12s rRNA or its coded product with safe and effective amount is applied to Mammals, wherein this safe and effective amount is usually at least about 0.1 microgram/kg body weight, and in most of the cases be no more than about 10 mg/kg body weight, preferably this dosage is about 0.1 microgram/kg body weight-Yue 100 micrograms/kg body weight. certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
The sudden change of detection line plastochondria 12s rRNA gene also can be used for the relevant disease of diagnostics lines plastochondria 12s rRNA coded product.The form of plastosome 12s rRNA coded product sudden change comprises that the point mutation compared with normal wild type plastosome 12srRNA dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence the expression of coded product, therefore uses reverse transcription PCR, and methods such as Westen blotting can judge indirectly that coded product has or not sudden change.
Being used for specimen of the present invention and being not particularly limited, for detecting SNP, can be Mitochondrial DNA or the RNA that extracting goes out from samples such as blood, tissue.
Those skilled in the art will appreciate that a large amount of analytical technologies can be used for detecting site described in the gene and whether has single nucleotide polymorphism.These technology comprise (but being not limited to): dna sequencing, sequencing by hybridization; Enzymatic mispairing cutting, heteroduple analysis, dot blot, oligonucleotide arrays (DNA chip), Mini-sequencing, Taqman technology, molecular beacon etc., sex change high performance liquid chromatography (DHPLC).
The method of the detection SNP of the present invention of most convenient is by the plastosome 12s rRNA gene with plastosome 12s rRNA gene-specific primer amplification sample, obtains amplified production; Detect whether there is following single nucleotide polymorphism: 827 A → G in the amplified production then, 4820 G → A, 13590 G → A, 15534 C → T, wherein, nucleotide position is numbered based on SEQ ID NO:1.
Should understand, after the present invention has disclosed the dependency of the SNP of plastosome 12s rRNA gene and cholelithiasis first, but those skilled in the art can design the amplified production that specific amplification goes out to contain this SNP position easily, determine whether to exist 827 A → G by methods such as order-checkings then, 4820 G → A, 13590 G → A, or 15534 C → T.Usually, the length of primer is 15-50bp, preferably is 20-30bp.Though the complete complementation of primer and template sequence is preferred, one skilled in the art will appreciate that at primer and template to have under the situation of certain not complementary (especially 5 of primer ' end) also can increase specifically (promptly only amplifying required fragment).The method that contains the test kit of these primers and use these primers is all within the scope of the invention, as long as the amplified production that this primer amplification goes out contains the correspondence position of SNP of the present invention.The preferred primer of part is to having the sequence of SEQ ID N0:2-9.
Though the length of amplified production is not particularly limited, the length of amplified production is 100-3000bp usually, preferably is 150-2000bp, more preferably is 200-1000bp.These amplified productions should contain among the SEQID NO:1 the 827th, 4820,13590 and/or 15534.
Because SNP of the present invention and cholelithiasis have very high cognation, therefore not only can be used in early days diagnosing primary cholelithiasis more exactly, and can make the carrier just take reasonable precautions against a rainy day at premorbid not, thereby improve carrier's lifetime and life quality, therefore have earth shaking using value and social benefit.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1
The dependency of plastosome 12s rRNA and chololithiasis
In the present embodiment, gathered 104 routine chololithiasis patient blood samples from the area, Shanghai, and contrasted, attempted to carry out the correlation analysis of Mitochondrial DNA and chololithiasis with 473 crowd's samples of randomly drawing.473 random samples of control group, and do not know whether they are chololithiasis patients.
Detected plastosome 12s ribosomal rna gene (plastosome 12s rRNA) in the present embodiment.12s rRNA in this genes encoding mitochondrial ribosome is the various proteic critical function genes of synthetic thread plastochondria.
Check order by conventional PCR reaction amplification and 377 sequenators, to the higher mononucleotide polymorphic (SNP) of the intragenic frequency ratio of plastosome 12s rRNA: 827 A → G (seeing SEQ ID NO:1) have carried out the comparison of frequency in patient and contrast crowd.
Found that the frequency of this SNP in the chololithiasis patient is apparently higher than the contrast crowd.Be respectively at chololithiasis patient medium frequency: 14.4% (15/104).And be 3.6% (17/473) at contrast crowd medium frequency.
Through Fisher ' s rigorous examination, both have significant difference p＜0.000, thereby have confirmed that plastosome 12s rRNA and chololithiasis have dependency.
Embodiment 2
The dependency of single doubly group of B4b and plastosome 12s rRNA transgenation
From the angle of evolving, any one morbific sudden change all is to produce under certain genetic background.If sudden change has taken place in a certain women's mtDNA in human evolution's process, increased the possibility of suffering from some disease, under the situation that does not influence reproductive performance, this sudden change might be spread to the modern times, and the individuality that causes carrying the type mtDNA all has the height susceptibility of this disease.MtDNA does not recombinate in the process of going down to posterity, and therefore relatively easily reviews a certain specific mitochondrial disease patient common ancestor's mtDNA combined sequence state.
Research also shows, has the individuality of 827 A → G sudden change, also can have 4820 G → A simultaneously, 13590G → A, and 15534 C → sudden changes such as T are so further detected 4820 G → A in the present embodiment, 13590G → A, 15534 C → three sites of T.
Found that these three SNP appear on the individuality that has 827A → G simultaneously, and relevant with cholelithiasis.These four whole SNP have formed a mitochondrial haplotype, that is: 827 A → G, 4820 G → A, 13590 G → A, 15534 C → T.In the genetic evolution of plastosome in China, the crowd who has this haplotype is called as the single doubly group of plastosome B4b.There is closely related property in the single doubly group of plastosome B4b with cholelithiasis.
Embodiment 3
Phylogeny relation between the B4b mtDNA
The phylogeny of illustrating between the B4b mtDNA for a nearly step concerns, in the present embodiment, plastosome first hypervariable region (HVS1) to all B4b groups' individuality checks order, add the sequencing result that embodiment 1 obtains, utilize NETWORK software (Fluxus Technology Ltd.) to make up the Median-joining network chart.
The result shows that the single doubly group of whole B4b has the risk (as Fig. 1) of very high trouble chololithiasis.
Embodiment 4
The single doubly group of B4b compares with the relative risk that normal population is suffered from chololithiasis
Relative risk (the Relative risk that the comparative analysis of patient and contrast is shown B4b, relative risk) be 4.518 (P＜0.0001), the possibility that the crowd who promptly has a B4b plastosome type suffers from chololithiasis is not have 4.518 times of the type plastosome crowd.
Therefore, carry among the Chinese B4b plastosome list doubly group's the colony risk level of suffering from chololithiasis have very obviously and increase, be the chololithiasis high risk population.By detection to plastosome 12s rRNA gene, the early warning of chololithiasis can be proposed the individual and relevant family members with B4b haplotype, by conditioning or the medical means of being careful in one's diet, reduce the possibility of its morbidity.And this is found to be the direction of investigating thoroughly that finally pathogenetic genetic cause of cholelith and pathogeny provide clue and can further study.The single doubly group of plastosome B4b (being characterized as 827A → G, 4820 G → A, 13590 G → A, 15534 C → T sudden change) can be used as an effective warning index of chololithiasis morbid risk.
Embodiment 5
The detection kit of chololithiasis susceptibility
As described in embodiment 1-4,827 A → G among the SEQ ID NO:1,4820 G → A, 13590 G → A, the sudden change of 15534 C → T, closely related with chololithiasis.Therefore, can be that template increases and detects at mtDNA based on these sudden change design primers with patient, SEQ ID NO:2 and 3 for example, SEQ ID NO:4 and 5, SEQ ID NO:6 and 7, SEQ ID NO:8 and 9.
| Sequence (5 '-3 ') | SEQ ID NO： | |
| Primer is to 1 | CAAAGAACCCTAACACCAGCC | 2 |
| CTGTGGCTCGTAGTGTTCTGG | 3 | |
| Primer is to 2 | TTCCCCCTCAAACCTAAGAAA | 4 |
| GCGTAGCTGGGTTTGGTTTA | 5 | |
| Primer is to 3 | CACTCTGTTCGCAGCAGTCT | 6 |
| CGGTGTGTGATGCTAGGGTA | 7 | |
| Primer is to 4 | ACATCGGCATTATCCTCCTG | 8 |
| GGAGGATGGGGATTATTGCT | 9 |
Preparation one detects the sudden change test kit (100 person-times) of 827 A → G among the SEQ ID NO:1, and it contains:
Title numbering quantity
Forward primer SEQ ID NO:2 100pmol
Reverse primer SEQ ID NO:3 100pmol
The PCR damping fluid is some
Preparation one detects the test kit (100 person-times) of 4820 G → A among the SEQ ID NO:1, and it contains following component:
Title numbering quantity
Forward primer SEQ ID NO:4 100pmol
Reverse primer SEQ ID NO:5 100pmol
The PCR damping fluid is some
Preparation one detects the sudden change test kit (100 person-times) of 13590 G → A among the SEQ ID NO:1, and it contains:
Title numbering quantity
Forward primer SEQ ID NO:6 100pmol
Reverse primer SEQ ID NO:7 100pmol
The PCR damping fluid is some
Preparation one detects the sudden change test kit (100 person-times) of 15534 C → T among the SEQ ID NO:1, and it contains:
Title numbering quantity
Forward primer SEQ ID NO:8 100pmol
Reverse primer SEQ ID NO:9 100pmol
The PCR damping fluid is some
Extract patients'blood 3ml to be detected, use ordinary method (or using specific test kit) from blood, to extract DNA.PCR primer in the cholelithiasis detection kit is diluted to 1 μ mol/ μ l, is that template is carried out the PCR reaction with the primer that is provided with the DNA that is extracted.Behind the PCR product purification, use ABI-PRISM
TMThe 377DNA sequenator carries out the two-way order-checking of the terminal cessation method of fluorescent mark, and the interpretation and the SNP that carry out sequence with Polyphred software confirm.
Perhaps, amplified production and normal control are carried out stratographic analysis with sex change high performance liquid chromatograph (DHPLC), also can detect the SNP in above-mentioned 4 sites.
Detected result shows that the cholelithiasis susceptibility that belongs to the single doubly detected object of group (being characterized as 827 A → G, 4820 G → A, 13590G → A, 15534 C → T sudden change) of plastosome B4b is apparently higher than normal population.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Research Center of Shanghai Human Genome
Fudan University
Ruijin Hospital Attached to Shanghai Medical Univ No.2
＜120〉chololithiasis method for testing susceptibility and test kit
<130>042150
<160>9
<170>PatentIn version 3.1
<210>1
<211>16568
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<400>1
gatcacaggt ctatcaccct attaaccact cacgggagct ctccatgcat ttggtatttt 60
cgtctggggg gtatgcacgc gatagcattg cgagacgctg gagccggagc accctatgtc 120
gcagtatctg tctttgattc ctgcctcatc ctattattta tcgcacctac gttcaatatt 180
acaggcgaac atacttacta aagtgtgtta attaattaat gcttgtagga cataataata 240
acaattgaat gtctgcacag ccactttcca cacagacatc ataacaaaaa atttccacca 300
aaccccccct cccccgcttc tggccacagc acttaaacac atctctgcca aaccccaaaa 360
acaaagaacc ctaacaccag cctaaccaga tttcaaattt tatcttttgg cggtatgcac 420
ttttaacagt caccccccaa ctaacacatt attttcccct cccactccca tactactaat 480
ctcatcaata caacccccgc ccatcctacc cagcacacac acaccgctgc taaccccata 540
ccccgaacca accaaacccc aaagacaccc cccacagttt atgtagctta cctcctcaaa 600
gcaatacact gaaaatgttt agacgggctc acatcacccc ataaacaaat aggtttggtc 660
ctagcctttc tattagctct tagtaagatt acacatgcaa gcatccccgt tccagtgagt 720
tcaccctcta aatcaccacg atcaaaaggg acaagcatca agcacgcagc aatgcagctc 780
aaaacgctta gcctagccac acccccacgg gaaacagcag tgattaacct ttagcaataa 840
acgaaagttt aactaagcta tactaacccc agggttggtc aatttcgtgc cagccaccgc 900
ggtcacacga ttaacccaag tcaatagaag ccggcgtaaa gagtgtttta gatcaccccc 960
tccccaataa agctaaaact cacctgagtt gtaaaaaact ccagttgaca caaaatagac 1020
tacgaaagtg gctttaacat atctgaacac acaatagcta agacccaaac tgggattaga 1080
taccccacta tgcttagccc taaacctcaa cagttaaatc aacaaaactg ctcgccagaa 1140
cactacgagc cacagcttaa aactcaaagg acctggcggt gcttcatatc cctctagagg 1200
agcctgttct gtaatcgata aaccccgatc aacctcacca cctcttgctc agcctatata 1260
ccgccatctt cagcaaaccc tgatgaaggc tacaaagtaa gcgcaagtac ccacgtaaag 1320
acgttaggtc aaggtgtagc ccatgaggtg gcaagaaatg ggctacattt tctaccccag 1380
aaaactacga tagcccttat gaaacttaag ggtcgaaggt ggatttagca gtaaactaag 1440
agtagagtgc ttagttgaac agggccctga agcgcgtaca caccgcccgt caccctcctc 1500
aagtatactt caaaggacat ttaactaaaa cccctacgca tttatataga ggagacaagt 1560
cgtaacatgg taagtgtact ggaaagtgca cttggacgaa ccagagtgta gcttaacaca 1620
aagcacccaa cttacactta ggagatttca acttaacttg accgctctga gctaaaccta 1680
gccccaaacc cactccacct tactaccaga caaccttagc caaaccattt acccaaataa 1740
agtataggcg atagaaattg aaacctggcg caatagatat agtaccgcaa gggaaagatg 1800
aaaaattata accaagcata atatagcaag gactaacccc tataccttct gcataatgaa 1860
ttaactagaa ataactttgc aaggagagcc aaagctaaga cccccgaaac cagacgagct 1920
acctaagaac agctaaaaga gcacacccgt ctatgtagca aaatagtggg aagatttata 1980
ggtagaggcg acaaacctac cgagcctggt gatagctggt tgtccaagat agaatcttag 2040
ttcaacttta aatttgccca cagaaccctc taaatcccct tgtaaattta actgttagtc 2100
caaagaggaa cagctctttg gacactagga aaaaaccttg tagagagagt aaaaaattta 2160
acacccatag taggcctaaa agcagccacc aattaagaaa gcgttcaagc tcaacaccca 2220
ctacctaaaa aatcccaaac atataactga actcctcaca cccaattgga ccaatctatc 2280
accctataga agaactaatg ttagtataag taacatgaaa acattctcct ccgcataagc 2340
ctgcgtcaga ttaaaacact gaactgacaa ttaacagccc aatatctaca atcaaccaac 2400
aagtcattat taccctcact gtcaacccaa cacaggcatg ctcataagga aaggttaaaa 2460
aaagtaaaag gaactcggca aatcttaccc cgcctgttta ccaaaaacat cacctctagc 2520
atcaccagta ttagaggcac cgcctgccca gtgacacatg tttaacggcc gcggtaccct 2580
aaccgtgcaa aggtagcata atcacttgtt ccttaaatag ggacctgtat gaatggctcc 2640
acgagggttc agctgtctct tacttttaac cagtgaaatt gacctgcccg tgaagaggcg 2700
ggcataacac agcaagacga gaagacccta tggagcttta atttattaat gcaaacagta 2760
cctaacaaac ccacaggtcc taaactacca aacctgcatt aaaaatttcg gttggggcga 2820
cctcggagca gaacccaacc tccgagcagt acatgctaag acttcaccag tcaaagcgaa 2880
ctactatact caattgatcc aataacttga ccaacggaac aagttaccct agggataaca 2940
gcgcaatcct attctagagt ccatatcaac aatagggttt acgacctcga tgttggatca 3000
ggacatcccg atggtgcagc cgctattaaa ggttcgtttg ttcaacgatt aaagtcctac 3060
gtgatctgag ttcagaccgg agtaatccag gtcggtttct atctacttca aattcctccc 3120
tgtacgaaag gacaagagaa ataaggccta cttcacaaag cgccttcccc cgtaaatgat 3180
atcatctcaa cttagtatta tacccacacc cacccaagaa cagggtttgt taagatggca 3240
gagcccggta atcgcataaa acttaaaact ttacagtcag aggttcaatt cctcttctta 3300
acaacatacc catggccaac ctcctactcc tcattgtacc cattctaatc gcaatggcat 3360
tcctaatgct taccgaacga aaaattctag gctatataca actacgcaaa ggccccaacg 3420
ttgtaggccc ctacgggcta ctacaaccct tcgctgacgc cataaaactc ttcaccaaag 3480
agcccctaaa acccgccaca tctaccatca ccctctacat caccgccccg accttagctc 3540
tcaccatcgc tcttctacta tgaacccccc tccccatacc caaccccctg gtcaacctca 3600
acctaggcct cctatttatt ctagccacct ctagcctagc cgtttactca atcctctgat 3660
cagggtgagc atcaaactca aactacgccc tgatcggcgc actgcgagca gtagcccaaa 3720
caatctcata tgaagtcacc ctagccatca ttctactatc aacattacta ataagtggct 3780
cctttaacct ctccaccctt atcacaacac aagaacacct ctgattactc ctgccatcat 3840
gacccttggc cataatatga tttatctcca cactagcaga gaccaaccga acccccttcg 3900
accttgccga aggggagtcc gaactagtct caggcttcaa catcgaatac gccgcaggcc 3960
ccttcgccct attcttcata gccgaataca caaacattat tataataaac accctcacca 4020
ctacaatctt cctaggaaca acatatgacg cactctcccc tgaactctac acaacatatt 4080
ttgtcaccaa gaccctactt ctaacctccc tgttcttatg aattcgaaca gcataccccc 4140
gattccgcta cgaccaactc atacacctcc tatgaaaaaa cttcctacca ctcaccctag 4200
cattacttat atgatatgtc tccataccca ttacaatctc cagcattccc cctcaaacct 4260
aagaaatatg tctgataaaa gagttacttt gatagagtaa ataataggag cttaaacccc 4320
cttatttcta ggactatgag aatcgaaccc atccctgaga atccaaaatt ctccgtgcca 4380
cctatcacac cccatcctaa agtaaggtca gctaaataag ctatcgggcc cataccccga 4440
aaatgttggt tatacccttc ccgtactaat taatcccctg gcccaacccg tcatctactc 4500
taccatcttt gcaggcacac tcatcacagc gctaagctcg cactgatttt ttacctgagt 4560
aggcctagaa ataaacatgc tagcttttat tccagttcta accaaaaaaa taaaccctcg 4620
ttccacagaa gctgccatca agtatttcct cacgcaagca accgcatcca taatccttct 4680
aatagctatc ctcttcaaca atatactctc cggacaatga accataacca atactaccaa 4740
tcaatactca tcattaataa tcataatagc tatagcaata aaactaggaa tagccccctt 4800
tcacttctga gtcccagagg ttacccaagg cacccctctg acatccggcc tgcttcttct 4860
cacatgacaa aaactagccc ccatctcaat catataccaa atctctccct cactaaacgt 4920
aagccttctc ctcactctct caatcttatc catcatagca ggcagttgag gtggattaaa 4980
ccaaacccag ctacgcaaaa tcttagcata ctcctcaatt acccacatag gatgaataat 5040
agcagttcta ccgtacaacc ctaacataac cattcttaat ttaactattt atattatcct 5100
aactactacc gcattcctac tactcaactt aaactccagc accacgaccc tactactatc 5160
tcgcacctga aacaagctaa catgactaac acccttaatt ccatccaccc tcctctccct 5220
aggaggcctg cccccgctaa ccggcttttt gcccaaatgg gccattatcg aagaattcac 5280
aaaaaacaat agcctcatca tccccaccat catagccacc atcaccctcc ttaacctcta 5340
cttctaccta cgcctaatct actccacctc aatcacacta ctccccatat ctaacaacgt 5400
aaaaataaaa tgacagtttg aacatacaaa acccacccca ttcctcccca cactcatcgc 5460
ccttaccacg ctactcctac ctatctcccc ttttatacta ataatcttat agaaatttag 5520
gttaaataca gaccaagagc cttcaaagcc ctcagtaagt tgcaatactt aatttctgta 5580
acagctaagg actgcaaaac cccactctgc atcaactgaa cgcaaatcag ccactttaat 5640
taagctaagc ccttactaga ccaatgggac ttaaacccac aaacacttag ttaacagcta 5700
agcaccctaa tcaactggct tcaatctact tctcccgccg ccgggaaaaa aggcgggaga 5760
agccccggca ggtttgaagc tgcttcttcg aatttgcaat tcaatatgaa aatcacctcg 5820
gagctggtaa aaagaggcct aacccctgtc tttagattta cagtccaatg cttcactcag 5880
ccattttacc tcacccccac tgatgttcgc cgaccgttga ctattctcta caaaccacaa 5940
agacattgga acactatacc tattattcgg cgcatgagct ggagtcctag gcacagctct 6000
aagcctcctt attcgagccg agctgggcca gccaggcaac cttctaggta acgaccacat 6060
ctacaacgtt atcgtcacag cccatgcatt tgtaataatc ttcttcatag taatacccat 6120
cataatcgga ggctttggca actgactagt tcccctaata atcggtgccc ccgatatggc 6180
gtttccccgc ataaacaaca taagcttctg actcttacct ccctctctcc tactcctgct 6240
cgcatctgct atagtggagg ccggagcagg aacaggttga acagtctacc ctcccttagc 6300
agggaactac tcccaccctg gagcctccgt agacctaacc atcttctcct tacacctagc 6360
aggtgtctcc tctatcttag gggccatcaa tttcatcaca acaattatca atataaaacc 6420
ccctgccata acccaatacc aaacgcccct cttcgtctga tccgtcctaa tcacagcagt 6480
cctacttctc ctatctctcc cagtcctagc tgctggcatc actatactac taacagaccg 6540
caacctcaac accaccttct tcgaccccgc cggaggagga gaccccattc tataccaaca 6600
cctattctga tttttcggtc accctgaagt ttatattctt atcctaccag gcttcggaat 6660
aatctcccat attgtaactt actactccgg aaaaaaagaa ccatttggat acataggtat 6720
ggtctgagct atgatatcaa ttggcttcct agggtttatc gtgtgagcac accatatatt 6780
tacagtagga atagacgtag acacacgagc atatttcacc tccgctacca taatcatcgc 6840
tatccccacc ggcgtcaaag tatttagctg actcgccaca ctccacggaa gcaatatgaa 6900
atgatctgct gcagtgctct gagccctagg attcatcttt cttttcaccg taggtggcct 6960
gactggcatt gtattagcaa actcatcact agacatcgta ctacacgaca cgtactacgt 7020
tgtagcccac ttccactatg tcctatcaat aggagctgta tttgccatca taggaggctt 7080
cattcactga tttcccctat tctcaggcta caccctagac caaacctacg ccaaaatcca 7140
tttcactatc atattcatcg gcgtaaatct aactttcttc ccacaacact ttctcggcct 7200
atccggaatg ccccgacgtt actcggacta ccccgatgca tacaccacat gaaacatcct 7260
atcatctgta ggctcattca tttctctaac agcagtaata ttaataattt tcatgatttg 7320
agaagccttc gcttcgaagc gaaaagtcct aatagtagaa gaaccctcca taaacctgga 7380
gtgactatat ggatgccccc caccctacca cacattcgaa gaacccgtat acataaaatc 7440
tagacaaaaa aggaaggaat cgaacccccc aaagctggtt tcaagccaac cccatggcct 7500
ccatgacttt ttcaaaaagg tattagaaaa accatttcat aactttgtca aagttaaatt 7560
ataggctaaa tcctatatat cttaatggca catgcagcgc aagtaggtct acaagacgct 7620
acttccccta tcatagaaga gcttatcacc tttcatgatc acgccctcat aatcattttc 7680
cttatctgct tcctagtcct gtatgccctt ttcctaacac tcacaacaaa actaactaat 7740
actaacatct cagacgctca ggaaatagaa accgtctgaa ctatcctgcc cgccatcatc 7800
ctagtcctca tcgccctccc atccctacgc atcctttaca taacagacga ggtcaacgat 7860
ccctccctta ccatcaaatc aattggccac caatggtact gaacctacga gtacaccgac 7920
tacggcggac taatcttcaa ctcctacata cttcccccat tattcctaga accaggcgac 7980
ctgcgactcc ttgacgttga caatcgagta gtactcccga ttgaagcccc cattcgtata 8040
ataattacat cacaagacgt cttgcactca tgagctgtcc ccacattagg cttaaaaaca 8100
gatgcaattc ccggacgtct aaaccaaacc actttcaccg ctacacgacc gggggtatac 8160
tacggtcaat gctctgaaat ctgtggagca aaccacagtt tcatgcccat cgtcctagaa 8220
ttaattcccc taaaaatctt tgaaataggg cccgtattta ccctatagca ccccctctac 8280
cccctctaga gcccactgta aagctaactt agcattaacc ttttaagtta aagattaaga 8340
gaaccaacac ctctttacag tgaaatgccc caactaaata ctaccgtatg gcccaccata 8400
attaccccca tactccttac actattcctc atcacccaac taaaaatatt aaacacaaac 8460
taccacctac ctccctcacc aaagcccata aaaataaaaa attataacaa accctgagaa 8520
ccaaaatgaa cgaaaatctg ttcgcttcat tcattgcccc cacaatccta ggcctacccg 8580
ccgcagtact gatcattcta tttccccctc tattgatccc cacctccaaa tatctcatca 8640
acaaccgact aatcaccacc caacaatgac taatcaaact aacctcaaaa caaatgataa 8700
ccatacacaa cactaaagga cgaacctgat ctcttatact agtatcctta atcattttta 8760
ttgccacaac taacctcctc ggactcctgc ctcactcatt tacaccaacc acccaactat 8820
ctataaacct agccatggcc atccccttat gagcgggcac agtgattata ggctttcgct 8880
ctaagattaa aaatgcccta gcccacttct taccacaagg cacacctaca ccccttatcc 8940
ccatactagt tattatcgaa accatcagcc tactcattca accaatagcc ctggccgtac 9000
gcctaaccgc taacattact gcaggccacc tactcatgca cctaattgga agcgccaccc 9060
tagcaatatc aaccattaac cttccctcta cacttatcat cttcacaatt ctaattctac 9120
tgactatcct agaaatcgct gtcgccttaa tccaagccta cgttttcaca cttctagtaa 9180
gcctctacct gcacgacaac acataatgac ccaccaatca catgcctatc atatagtaaa 9240
acccagccca tgacccctaa caggggccct ctcagccctc ctaatgacct ccggcctagc 9300
catgtgattt cacttccact ccataacgct cctcatacta ggcctactaa ccaacacact 9360
aaccatatac caatgatggc gcgatgtaac acgagaaagc acataccaag gccaccacac 9420
accacctgtc caaaaaggcc ttcgatacgg gataatccta tttattacct cagaagtttt 9480
tttcttcgca ggatttttct gagcctttta ccactccagc ctagccccta ccccccaatt 9540
aggagggcac tggcccccaa caggcatcac cccgctaaat cccctagaag tcccactcct 9600
aaacacatcc gtattactcg catcaggagt atcaatcacc tgagctcacc atagtctaat 9660
agaaaacaac cgaaaccaaa taattcaagc actgcttatt acaattttac tgggtctcta 9720
ttttaccctc ctacaagcct cagagtactt cgagtctccc ttcaccattt ccgacggcat 9780
ctacggctca acattttttg tagccacagg cttccacgga cttcacgtca ttattggctc 9840
aactttcctc actatctgct tcatccgcca actaatattt cactttacat ccaaacatca 9900
ctttggcttc gaagccgccg cctgatactg gcattttgta gatgtggttt gactatttct 9960
gtatgtctcc atctattgat gagggtctta ctcttttagt ataaatagta ccgttaactt 10020
ccaattaact agttttgaca acattcaaaa aagagtaata aacttcgcct taattttaat 10080
aatcaacacc ctcctagcct tactactaat aattattaca ttttgactac cacaactcaa 10140
cggctacata gaaaaatcca ccccttacga gtgcggcttc gaccctatat cccccgcccg 10200
cgtccctttc tccataaaat tcttcttagt agctattacc ttcttattat ttgatctaga 10260
aattgccctc cttttacccc taccatgagc cctacaaaca actaacctgc cactaatagt 10320
tatgtcatcc ctcttattaa tcatcatcct agccctaagt ctggcctatg agtgactaca 10380
aaaaggatta gactgaaccg aattggtata tagtttaaac aaaacgaatg atttcgactc 10440
attaaattat gataatcata tttaccaaat gcccctcatt tacataaata ttatactagc 10500
atttaccatc tcacttctag gaatactagt atatcgctca cacctcatat cctccctact 10560
atgcctagaa ggaataatac tatcgctgtt cattatagct actctcataa ccctcaacac 10620
ccactccctc ttagccaata ttgtgcctat tgccatacta gtctttgccg cctgcgaagc 10680
agcggtgggc ctagccctac tagtctcaat ctccaacaca tatggcctag actacgtaca 10740
taacctaaac ctactccaat gctaaaacta atcgtcccaa caattatatt actaccactg 10800
acatgacttt ccaaaaaaca cataatttga atcaacacaa ccacccacag cctaattatt 10860
agcatcatcc ctctactatt ttttaaccaa atcaacaaca acctatttag ctgttcccca 10920
accttttcct ccgaccccct aacaaccccc ctcctaatac taactacctg actcctaccc 10980
ctcacaatca tggcaagcca acgccactta tccagtgaac cactatcacg aaaaaaactc 11040
tacctctcta tactaatctc cctacaaatc tccttaatta taacattcac agccacagaa 11100
ctaatcatat tttatatctt cttcgaaacc acacttatcc ccaccttggc tatcatcacc 11160
cgatgaggca accagccaga acgcctgaac gcaggcacat acttcctatt ctacacccta 11220
gtaggctccc ttcccctact catcgcacta atttacactc acaacaccct aggctcacta 11280
aacattctac tactcactct cactgcccaa gaactatcaa actcctgagc caacaactta 11340
atatgactag cttacacaat agcttttata gtaaagatac ctctttacgg actccactta 11400
tgactcccta aagcccatgt cgaagccccc atcgctgggt caatagtact tgccgcagta 11460
ctcttaaaac taggcggcta tggtataata cgcctcacac tcattctcaa ccccctgaca 11520
aaacacatag cctacccctt ccttgtacta tccctatgag gcataattat aacaagctcc 11580
atctgcctac gacaaacaga cctaaaatcg ctcattgcat actcttcaat cagccacata 11640
gccctcgtag taacagccat tctcatccaa accccctgaa gcttcaccgg cgcagtcatt 11700
ctcataatcg cccacgggct tacatcctca ttactattct gcctagcaaa ctcaaactac 11760
gaacgcactc acagtcgcat cataatcctc tctcaaggac ttcaaactct actcccacta 11820
atagcttttt gatgacttct agcaagcctc gctaacctcg ccttaccccc cactattaac 11880
ctactgggag aactctctgt gctagtaacc acgttctcct gatcaaatat cactctccta 11940
cttacaggac tcaacatact agtcacagcc ctatactccc tctacatatt taccacaaca 12000
caatggggct cactcaccca ccacattaac aacataaaac cctcattcac acgagaaaac 12060
accctcatgt tcatacacct atcccccatt ctcctcctat ccctcaaccc cgacatcatt 12120
accgggtttt cctcttgtaa atatagttta accaaaacat cagattgtga atctgacaac 12180
agaggcttac gaccccttat ttaccgagaa agctcacaag aactgctaac tcatgccccc 12240
atgtctaaca acatggcttt ctcaactttt aaaggataac agctatccat tggtcttagg 12300
ccccaaaaat tttggtgcaa ctccaaataa aagtaataac catgcacact actataacca 12360
ccctaaccct gacttcccta attcccccca tccttaccac cctcgttaac cctaacaaaa 12420
aaaactcata cccccattat gtaaaatcca ttgtcgcatc cacctttatt atcagtctct 12480
tccccacaac aatattcatg tgcctagacc aagaagttat tatctcgaac tgacactgag 12540
ccacaaccca aacaacccag ctctccctaa gcttcaaact agactacttc tccataatat 12600
tcatccctgt agcattgttc gttacatggt ccatcataga attctcactg tgatatataa 12660
actcagaccc aaacattaat cagttcttca aatatctact catcttccta attaccatac 12720
taatcttagt taccgctaac aacctattcc aactgttcat cggctgagag ggcgtaggaa 12780
ttatatcctt cttgctcatc agttgatgat acgcccgagc agatgccaac acagcagcca 12840
ttcaagcaat cctatacaac cgtatcggcg atatcggttt catcctcgcc ttagcatgat 12900
ttatcctaca ctccaactca tgagacccac aacaaatagc ccttctaaac gctaatccaa 12960
gcctcacccc actactaggc ctcctcctag cagcagcagg caaatcagcc caattaggtc 13020
tccacccctg actcccctca gccatagaag gccccacccc agtctcagcc ctactccact 13080
caagcactat agttgtagca ggaatcttct tactcatccg cttccacccc ctagcagaaa 13140
atagcccact aatccaaact ctaacactat gcttaggcgc tatcaccact ctgttcgcag 13200
cagtctgcgc ccttacacaa aatgacatca aaaaaatcgt agccttctcc acttcaagtc 13260
aactaggact cataatagtt acaatcggca tcaaccaacc acacctagca ttcctgcaca 13320
tctgtaccca cgccttcttc aaagccatac tatttatgtg ctccgggtcc atcatccaca 13380
accttaacaa tgaacaagat attcgaaaaa taggaggact actcaaaacc atacctctca 13440
cttcaacctc cctcaccatt ggcagcctag cattagcagg aatacctttc ctcacaggtt 13500
tctactccaa agaccacatc atcgaaaccg caaacatatc atacacaaac gcctgagccc 13560
tatctattac tctcatcgct acctccctgg caagcgccta tagcactcga ataattcttc 13620
tcaccctaac aggtcaacct cgcttcccca cccttactaa cattaacgaa aataacccca 13680
ccctactaaa ccccattaaa cgcctggcag ccggaagcct attcgcagga tttctcatta 13740
ctaacaacat ttcccccgca tcccccttcc aaacaacaat ccccctctac ctaaaactca 13800
cagccctcgc tgtcactttc ctaggacttc taacagccct agacctcaac tacctaacca 13860
acaaacttaa aataaaatcc ccactatgca cattttattt ctccaacata ctcggattct 13920
accctagcat cacacaccgc acaatcccct atctaggcct tcttacgagc caaaacctgc 13980
ccctactcct cctagaccta acctgactag aaaagctatt acctaaaaca atttcacagc 14040
accaaatctc cacctccatc atcacctcaa cccaaaaagg cataattaaa ctttacttcc 14100
tctctttctt cttcccactc atcctaaccc tactcctaat cacataacct attcccccga 14160
gcaatctcaa ttacaatata tacaccaaca aacaatgttc aaccagtaac tactactaat 14220
caacgcccat aatcatacaa agcccccgca ccaataggat cctcccgaat caaccctgac 14280
ccctctcctt cataaattat tcagcttcct acactattaa agtttaccac aaccaccacc 14340
ccatcatact ctttcaccca cagcaccaat cctacctcca tcgctaaccc cactaaaaca 14400
ctcaccaaga cctcaacccc tgacccccat gcctcaggat actcctcaat agccatcgct 14460
gtagtatatc caaagacaac catcattccc cctaaataaa ttaaaaaaac tattaaaccc 14520
atataacctc ccccaaaatt cagaataata acacacccga ccacaccgct aacaatcaat 14580
actaaacccc cataaatagg agaaggctta gaagaaaacc ccacaaaccc cattactaaa 14640
cccacactca acagaaacaa agcatacatc attattctcg cacggactac aaccacgacc 14700
aatgatatga aaaaccatcg ttgtatttca actacaagaa caccaatgac cccaatacgc 14760
aaaactaacc ccctaataaa attaattaac cactcattca tcgacctccc caccccatcc 14820
aacatctccg catgatgaaa cttcggctca ctccttggcg cctgcctgat cctccaaatc 14880
accacaggac tattcctagc catgcactac tcaccagacg cctcaaccgc cttttcatca 14940
atcgcccaca tcactcgaga cgtaaattat ggctgaatca tccgctacct tcacgccaat 15000
ggcgcctcaa tattctttat ctgcctcttc ctacacatcg ggcgaggcct atattacgga 15060
tcatttctct actcagaaac ctgaaacatc ggcattatcc tcctgcttgc aactatagca 15120
acagccttca taggctatgt cctcccgtga ggccaaatat cattctgagg ggccacagta 15180
attacaaact tactatccgc catcccatac attgggacag acctagttca atgaatctga 15240
ggaggctact cagtagacag tcccaccctc acacgattct ttacctttca cttcatcttg 15300
cccttcatta ttgcagccct agcaacactc cacctcctat tcttgcacga aacgggatca 15360
aacaaccccc taggaatcac ctcccattcc gataaaatca ccttccaccc ttactacaca 15420
atcaaagacg ccctcggctt acttctcttc cttctctcct taatgacatt aacactattc 15480
tcaccagacc tcctaggcga cccagacaat tataccctag ccaacccctt aaacacccct 15540
ccccacatca agcccgaatg atatttccta ttcgcctaca caattctccg atccgtccct 15600
aacaaactag gaggcgtcct tgccctatta ctatccatcc tcatcctagc aataatcccc 15660
atcctccata tatccaaaca acaaagcata atatttcgcc cactaagcca atcactttat 15720
tgactcctag ccgcagacct cctcattcta acctgaatcg gaggacaacc agtaagctac 15780
ccttttacca tcattggaca agtagcatcc gtactatact tcacaacaat cctaatccta 15840
ataccaacta tctccctaat tgaaaacaaa atactcaaat gggcctgtcc ttgtagtata 15900
aactaataca ccagtcttgt aaaccggaga tgaaaacctt tttccaagga caaatcagag 15960
aaaaagtctt taactccacc attagcaccc aaagctaaga ttctaattta aactattctc 16020
tgttctttca tggggaagca gatttgggta ccacccaagt attgactcac ccatcaacaa 16080
ccgctatgta tttcgtacat tactgccagc caccatgaat attgtacggt accataaata 16140
cttgaccacc tgtagtacat aaaaacccaa tccacatcaa aaccccctcc ccatgcttac 16200
aagcaagtac agcaatcaac cctcaactat cacacatcaa ctgcaactcc aaagccaccc 16260
ctcacccact aggataccaa caaacctacc cacccttaac agtacatagt acataaagcc 16320
atttaccgta catagcacat tacagtcaaa tcccttctcg tccccatgga tgacccccct 16380
cagatagggg tcccttgacc accatcctcc gtgaaatcaa tatcccgcac aagagtgcta 16440
ctctcctcgc tccgggccca taacacttgg gggtagctaa agtgaactgt atccgacatc 16500
tggttcctac ttcagggtca taaagcctaa atagcccaca cgttcccctt aaataagaca 16560
tcacgatg 16568
<210>2
<211>21
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>2
caaagaaccc taacaccagc c 21
<210>3
<211>21
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>3
ctgtggctcg tagtgttctg g 21
<210>4
<211>21
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>4
ttccccctca aacctaagaa a 21
<210>5
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>5
gcgtagctgg gtttggttta 20
<210>6
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>6
cactctgttc gcagcagtct 20
<210>7
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>7
cggtgtgtga tgctagggta 20
<210>8
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>8
acatcggcat tatcctcctg 20
<210>9
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>9
ggaggatggg gattattgct 20
Claims (6)
1. a nucleic acid primer is right, it is characterized in that, its length is 15-50bp, and hybridizes specifically and amplify shown in the SEQ ID NO:1 that contains human mitochondrion 12s rRNA gene the amplified production of the 827th, 4820,13590 and 15534 single nucleotide polymorphism in the sequence.
2. an oligonucleotide probe is characterized in that, its length is 15-500bp, and hybridizes specifically and detect shown in the SEQ ID NO:1 that contains human mitochondrion 12s rRNA gene the 827th, 4820,13590 and 15534 single nucleotide polymorphism in the sequence.
3. test kit that detects chololithiasis, it is characterized in that, it comprises the primer of specific amplification plastosome 12srRNA gene or its transcript, and the amplified production of described primer contains the down mutational site of group: among the SEQID NO:1 the 827th, 4820,13590 and 15534.
4. test kit as claimed in claim 3 is characterized in that, it also contains and mutational site bonded probe.
5. test kit as claimed in claim 4 is characterized in that, described sudden change is selected from:
827A → G among the SEQ ID NO:1,4820G → A, 13590G → A, and 15534C → T.
6. test kit as claimed in claim 4 is characterized in that, described sudden change is that 827A → G among the SEQ IDNO:1 takes place simultaneously, 4820G → A, 13590G → A, and the sudden change of 15534C → T.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200410017887 CN1690221B (en) | 2004-04-23 | 2004-04-23 | Method and kit for detecting susceptibility of cholelithiasis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200410017887 CN1690221B (en) | 2004-04-23 | 2004-04-23 | Method and kit for detecting susceptibility of cholelithiasis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1690221A CN1690221A (en) | 2005-11-02 |
| CN1690221B true CN1690221B (en) | 2010-05-05 |
Family
ID=35345975
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200410017887 Expired - Fee Related CN1690221B (en) | 2004-04-23 | 2004-04-23 | Method and kit for detecting susceptibility of cholelithiasis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1690221B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010127499A1 (en) * | 2009-05-08 | 2010-11-11 | Gui Yaoting | Detecting means for urinary calculus using human methylation information and method thereof |
| JP7106490B2 (en) * | 2019-04-23 | 2022-07-26 | ジェネシスヘルスケア株式会社 | How to Determine Gallstone Risk |
-
2004
- 2004-04-23 CN CN 200410017887 patent/CN1690221B/en not_active Expired - Fee Related
Non-Patent Citations (8)
| Title |
|---|
| HAN T..Apolipoprotein B-100 gene Xba I polymorphism andcholesterol gallstone disease.CLIN. GENET57.2000,57304-308. |
| HAN T..Apolipoprotein B-100 gene Xba I polymorphism andcholesterol gallstone disease.CLIN. GENET57.2000,57304-308. * |
| 喻荣彬.载脂蛋白B基因Xba I、EcoR I位点多态性与胆石病关系的研究.中华临床医学9 6.2002,9(6),608-610. |
| 喻荣彬.载脂蛋白B基因Xba I、EcoR I位点多态性与胆石病关系的研究.中华临床医学9 6.2002,9(6),608-610. * |
| 谈永飞.载脂蛋白B基因多态性及血脂成分与胆石病关系的研究.中华医学杂志83 10.2003,83(10),844-847. |
| 谈永飞.载脂蛋白B基因多态性及血脂成分与胆石病关系的研究.中华医学杂志83 10.2003,83(10),844-847. * |
| 陈海菊.胆结石成因的基因研究.肝胆胰外科杂志15 1.2003,15(1),68-69. |
| 陈海菊.胆结石成因的基因研究.肝胆胰外科杂志15 1.2003,15(1),68-69. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1690221A (en) | 2005-11-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20090130660A1 (en) | Single Nucelotide Polymorphism (SNP) | |
| ES2367566T3 (en) | USE OF GENETIC POLYMORPHISMS THAT ARE ASSOCIATED WITH THE EFFECTIVENESS OF THE TREATMENT OF AN INFLAMMATORY DISEASE. | |
| US11214834B2 (en) | Methods of detecting Charcot-Marie tooth disease type 2A | |
| Knight et al. | Spinocerebellar ataxia type 15 (sca15) maps to 3p24. 2-3pter:: exclusion of the ITPR1 gene, the human orthologue of an ataxic mouse mutant | |
| AU2011249763B2 (en) | A new combination of eight risk alleles associated with autism | |
| JP2010519895A (en) | Methods for determining genotypes at Crohn's disease locus | |
| US20030129596A1 (en) | Chemical compounds | |
| CN1690221B (en) | Method and kit for detecting susceptibility of cholelithiasis | |
| KR102543907B1 (en) | A genetic marker for evaluating risk of periodontitis | |
| KR102039529B1 (en) | Single nucleotide polymorphism for predicting the risk factor of metabolic syndrome and the use thereof | |
| KR102115941B1 (en) | Single nucleotide polymorphism for predicting the risk factor of metabolic syndrome and the use thereof | |
| KR102115948B1 (en) | Single nucleotide polymorphism for predicting the risk factor of metabolic syndrome and the use thereof | |
| KR20110110758A (en) | A polynucleotide associated with a colon cancer comprising single nucleotide polymorphism, microarray and diagnostic kit comprising the same and method for diagnosing a colon cancer using the polynucleotide | |
| JP4657757B2 (en) | Diagnosis and treatment of pulmonary hypertension using genes related to pulmonary hypertension | |
| KR102115933B1 (en) | Single nucleotide polymorphism for predicting the risk factor of metabolic syndrome and the use thereof | |
| KR102115938B1 (en) | Single nucleotide polymorphism for predicting the risk factor of metabolic syndrome and the use thereof | |
| KR20100036718A (en) | Marker for the diagnosis of susceptibility to prostate cancer using retn gene and method for predicting and analyzing susceptibility to prostate cancer using the same | |
| KR100695147B1 (en) | 2 2 A method for diagnosing type II diabetes mellitus using multilocus marker polynucleotide comprising a marker associeated with type II diabetes mellitus and microarray having immobilized the polynucleotide set | |
| US7488582B2 (en) | Nucleic acids and associated diagnostics | |
| US20200095638A1 (en) | Methods for identifying and treating kawasaki disease patients with intravenous immunoglobulin resistance | |
| TW202012634A (en) | Methods for identifying and treating kawasaki disease patients with intravenous immunoglobulin resistance | |
| KR20110043100A (en) | Polynucleotides derived from ankrd15, hpd, psmd9, wdr66, gpc6, pax9, lrrc28, tns4, axl, and hnrpul1 genes comprising single nucleotide polymorphisms, microarrays and diagnostic kits comprising the same, and analytic methods using the same | |
| KR20050081405A (en) | Hnf-1a gene having novel single nucleotide polymorphism, a variant hnf-1a protein encoded by the same, polynucleotide, microarray, kit and method for diagnosing mody3 | |
| US20040175706A1 (en) | Genomic dnas participating in rheumatoid arthritis, method of diagnosing the same, method of judging onset risk and diagnostic kit for detecting the same | |
| KR20100055368A (en) | Polynucleotides comprising single nucleotide polymorphism, microarrays and diagnostic kits comprising the same, and detection methods using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20100505 Termination date: 20110423 |