CN1690207A - Multi-epitope gene of hepatitis C and its nucleic acid vaccine - Google Patents

Abstract

A hepatitis C poly-epitope antibody gene and its nucleic acid vaccine, particularly relating to a hepatitis C vaccine, belong to the biotechnology field. Tabling six highly conservative dominance T/B cell epitope genes optimized from HCV with an auxiliary T lymphocyte epitope gene of tetanus(TT), and an auxiliary T lymphocyte epitope gene from malignant protozoon spore antigens, at the same time introducing hIL-2 ER signal peptide guidance sequence to 5' end of the fused gene above-mentioned, finally it can construct new HCV poly-epitope nucleic acid vaccine with safety nucleic acid vaccine expression carrier p VAXI. The vaccine can stimulate BALB/c mouse producing effective specific genic immunity and humoral immunity, and can be a therapeutic vaccine against HCV and a preventive vaccine from hepatitis C. The vaccine has a lot of specialty, highly effective, safe, cheap and so on.

Description

Polyepitope hepatitis C antigen gene and nucleic acid vaccine thereof

Technical field:

The invention belongs to biological technical field, particularly relate to a kind of hcv vaccine.

Background technology:

HCV be the main diseases that causes outer post-transfusion hepatitis of propagating of enteron aisle or sporadic non-A non-B hepatitis because of, belong to flaviviridae, be the sub-thread positive chain RNA virus.At present to the understatement road complete genome sequence of 16 strain HCV because the genotype difference, isolating HCV genome length is also inconsistent, be generally 9400-10000b with between, 3010～3033 the amino acid whose polyprotein precursors of encoding.Precursor protein is under the splitting action of proteolytic enzyme, generate sophisticated viral protein, comprise being positioned at virus genomic N-terminal nucleocapsid protein (C) and envelope protein (E1, E2), be positioned at the Nonstructural Protein (NS1/E2, NS2, NS3, NS4a, NS4b, NS5a, NS5b) of carboxyl terminal.Albumen that contains 191 amino-acid residues of C district genes encoding, the core particle of main composition HCV is so claim this district to be the core protein gene district.This gene regions is the most conservative zone in the HCVRNA single open reading frame, conservative degree is tightly inferior to 5 ' non-coding region, in its synthetic nucleoprotein, only there is the individual amino acid of 2-8 (1.0-9.4%) to change, and in its aminoacid sequence, having two high conservative hydrophilic areas at least, is stable antigenic determinant.The C end of E2/NS1 district gene is conservative relatively, and the variation of N end is bigger, and it is HVR1 (384-473aa) and HVR2 (474-480aa) that two hypervariable regions (hypervariableregion) are arranged, and HVR1 is than the easier variation of HVR2, and HVR1 had an amino acid change in average every month.And E1 district genovariation is very big, make the membranin of its coding have high sex change, help escaping the attack of body immune system, but should also there be metastable zone in the zone, for example 315-327 password subarea is in high conserved region, the epitope peptide of its coding has more stable antigenicity, is the available section of development HCV vaccine.Encode one and contain 277 amino acid whose albumen in the genomic 730-1006 bit codon of NS2 position HCVRNA district, this albumen contains more hydrophobic amino acid.Therefore have stronger hydrophobicity, its function may be relevant with the film keying action.NS3 is positioned at the genomic 1007-1615 bit codon of HCVRNA district, encodes one to contain 60 amino acid whose albumen, and this district's variability is less, and is relevant with the expression of rna helicase enzyme.NS3 albumen contains stronger dominant antigen expresses the district, not only do not have type specificity, and corresponding antibody occurs early.HCVRNA genome 1616-2013 bit codon district, NS4 position, the albumen of being made up of 398 amino acid of encoding becomes two albumen: NS4a (1616-1862) and NS4b (1863-2013) through hydrolysis.This district's encoded protein has better hydrophobicity, may with film in conjunction with relevant.NS5 is positioned at the genomic 2014-3010 bit codon of HCVRNA district (6372-9362nt), the albumen that contains 997 amino-acid residues of encoding, and there is higher conservative property in this district, is the rna polymerase gene district that depends on RNA, and is relevant with virus replication.

The HCV virus strain very easily makes a variation, and the homology of nucleotide sequence only is 60%～92% between different HCV strains.Because the homology of nucleotide sequence is as adhering to different genotype separately less than 80% between the different mutant strains of similar virus, therefore the present HCV virus strain that obtains mainly is divided into 4 oligogene types (HCV I, II, III, IV), and Chinese HCV genotype is based on the II type.HCV infects the back and lacks effective protective immunity.Possible reason is: (1) HCV highly makes a variation, and escapes the immune clearance of body; (2) HCV content in hepatic tissue and blood is low and induce body to produce a little less than the antigenicity of protectiveness; (3) virion and low-density lipoprotein or immunoglobulin (Ig) close-coupled cause antigenic determinant to be covered; (4) peripheral blood lymphocyte has the effect of HCV storage vault.Infection does not also have a kind of effective treatment means at present to HCV, therefore, is badly in need of the safe and effective vaccine of exploitation and infects with control HCV.

The research of new generation vaccine must have new strategy; at scrutiny viruses molecule structure biological function extremely; analyze the molecule that virus suppresses host immune response; activate host's cell of exempting from service and produce the molecule of protective immune response, modify and combination, remove the component that suppresses immunne response thereby shear the enterprising pedestrian worker of virogene level; keep the protectiveness fragment of inducing coding different; be reconstructed into artificial vaccine, then can improve immune effect, suppress the immunologic escape of virus mutation.Dna vaccination based on epitope has promptly possessed These characteristics.Measuring of HCV whole genome sequence makes the research of HCV gene vaccine launch and progressively deeply in recent years.Nucleic acid vaccine is a kind of brand-new vaccine that grows up from the gene therapy research field, and some nucleic acid vaccine is induce immune response efficiently, and the obvious treatment effect is arranged.Along with to nucleic acid vaccine immunity mechanism understanding deepen continuously and to the updating of nucleic acid vaccine structure and immunization method, this new generation vaccine will become effective therapeutic vaccine.After the dna vaccination inoculation, proteantigen is at host cell inner expression, the natural infection similar process of its processing treatment process and cause of disease.Therefore, can give expression to the antigen similar to pathogenic agent.Simultaneously, both angtigen presentation processes are also identical, thereby, can equally with natural infection induce the inoculation animal not only to produce cellular immunization but also produce humoral immunization.This be inactivated vaccine and subunit vaccine can not compare.In addition, the immunne response of dna vaccination initiation is lasting.Because can there be the long period in vivo in foreign gene, and constantly expresses foreign protein, can effectively continue stimulating immune system.

Technology contents:

The objective of the invention is to, the conformation characteristics according to the HCV epitope are provided, design, the best vaccine antigen conformation of structure, exploitation is based on the polyepitope hepatitis C antigen gene and the nucleic acid vaccine thereof of HCV epitope.

The gene order of polyepitope hepatitis C antigen gene of the present invention is:

gccaccatgt?acaggatgca?actcctgtct?tgcattgcac?taagtcttgc?acttgtcaca?60

aacagtgcag?gcttcgccga?cctcatgggg?tacattccgc?tcgtcggcgc?ccccttggcc?120

gccgctgcca?agttcgtggc?tgcctggacc?ctgaaggccg?ccgctacggg?cgactttgac?180

tcagtgatcg?actgtaacgc?cgccgctcag?tacatcaagg?ctaatagcaa?attcatcgga?240

atcaccgagc?tggccgccgc?tgaattcgat?atcctcgagg?ccgccgctga?cctcatgggg?300

tacattccgg?ccgtcgccgc?cgctaggctc?tggcactacc?cctgcactgt?cgccgccgct?360

tgtgcctcac?acctccctta?catcgaacag?ggaatgcagc?tcgccgagca?gttcaagcag?420

aaggcggccg?ccgcttccta?tacatggaca?ggcgccttga?tcacgccatg?tgctgcggag?480

gaggccgccg?cttagtaa?498

The immunodominance epi-position of six high conservatives in the preferred HCV genome of the present invention, add the helper T cell epitope gene of a Toxoid,tetanus----TT and one and derive from the antigenic helper T cell epi-position of pernicious cruel protozoon ring spore, connect with three L-Ala between each epi-position, introduce human IL-2 ER signal peptide homing sequence at 5 ' end of above-mentioned fusion gene simultaneously, and base makes it to meet the Kozak rule before and after optimizing ATG, before and after designed gene, introduce BamHI and two restriction enzyme sites of XbaI at last respectively, obtain HCV composite multi-epitope antigen gene----CEG.

The immunodominance epi-position of six high conservatives is in the HCV genome of the present invention:

1.HCV?C：129-144

ggcttcgccg?acctcatggg?gtacattccg?ctcgtcggcg?cccccttg?48

2.HCV?NS3：439～449

acgggcgact?ttgactcagt?gatcgactgt?aac?33

3.HCV?C：132-140

gacctcatgg?ggtacattcc?ggccgtc?27

4.HCV?E2(614-622)

aggctctggc?actacccctg?cactgtc?27

5.HCV?NS4：1711-1732

tgtgcctcac?acctccctta?catcgaacag?ggaatgcagc?tcgccgagca?gttcaagcag?aaggcg?66

6.HCV?NS5(2422-2437)

tcctatacat?ggacaggcgc?cttgatcacg?ccatgtgctg?cggaggag?48

Polyepitope hepatitis C nucleic acid vaccine of the present invention is to obtain with above-mentioned that HCV composite multi-epitope antigen gene reclaims, purifying, is connected reorganization with the pMD18-T carrier, obtains pMD18-T-CEG; Use BamHI/XbaI double digestion pVAX1 vector plasmid and pMD18-T-CEG plasmid again, connection is reassembled as pVAX1-CEG HCV composite multi-epitope DNA vaccine.

The gene order of polyepitope hepatitis C nucleic acid vaccine of the present invention is:

gactcttcgc?gatgtacggg?ccagatatac?gcgttgacat?tgattattga?ctagttatta?60

atagtaatca?attacggggt?cattagttca?tagcccatat?atggagttcc?gcgttacata?120

acttacggta?aatggcccgc?ctggctgacc?gcccaacgac?ccccgcccat?tgacgtcaat?180

aatgacgtat?gttcccatag?taacgccaat?agggactttc?cattgacgtc?aatgggtgga?240

ctatttacgg?taaactgccc?acttggcagt?acatcaagtg?tatcatatgc?caagtacgcc?300

ccctattgac?gtcaatgacg?gtaaatggcc?cgcctggcat?tatgcccagt?acatgacctt?360

atgggacttt?cctacttggc?agtacatcta?cgtattagtc?atcgctatta?ccatggtgat?420

gcggttttgg?cagtacatca?atgggcgtgg?atagcggttt?gactcacggg?gatttccaag?480

tctccacccc?attgacgtca?atgggagttt?gttttggcac?caaaatcaac?gggactttcc?540

aaaatgtcgt?aacaactccg?ccccattgac?gcaaatgggc?ggtaggcgtg?tacggtggga?600

ggtctatata?agcagagctc?tctggctaac?tagagaaccc?actgcttact?ggcttatcga?660

aattaatacg?actcactata?gggagaccca?agctggctag?cgtttaaact?taagcttggt?720

accgagctcg?gatccgccac?catgtacagg?atgcaactcc?tgtcttgcat?tgcactaagt?780

cttgcacttg?tcacaaacag?tgcaggcttc?gccgacctca?tggggtacat?tccgctcgtc?840

ggcgccccct?tggccgccgc?tgccaagttc?gtggctgcct?ggaccctgaa?ggccgccgct?900

acgggcgact?ttgactcagt?gatcgactgt?aacgccgccg?ctcagtacat?caaggctaat?960

agcaaattca?tcggaatcac?cgagctggcc?gccgctgaat?tcgatatcct?cgaggccgcc?1020

gctgacctca?tggggtacat?tccggccgtc?gccgccgcta?ggctctggca?ctacccctgc?1080

actgtcgccg?ccgcttgtgc?ctcacacctc?ccttacatcg?aacagggaat?gcagctcgcc?1140

gagcagttca?agcagaaggc?ggccgccgct?tcctatacat?ggacaggcgc?cttgatcacg?1200

ccatgtgctg?cggaggaggc?cgccgcttag?taatctagag?ggcccgttta?aacccgctga?1260

tcagcctcga?ctgtgccttc?tagttgccag?ccatctgttg?tttgcccctc?ccccgtgcct?1320

tccttgaccc?tggaaggtgc?cactcccact?gtcctttcct?aataaaatga?ggaaattgca?1380

tcgcattgtc?tgagtaggtg?tcattctatt?ctggggggtg?gggtggggca?ggacagcaag?1440

ggggaggatt?gggaagacaa?tagcaggcat?gctggggatg?cggtgggctc?tatggcttct?1500

actgggcggt?tttatggaca?gcaagcgaac?cggaattgcc?agctggggcg?ccctctggta?1560

aggttgggaa?gccctgcaaa?gtaaactgga?tggctttctc?gccgccaagg?atctgatggc?1620

gcaggggatc?aagctctgat?caagagacag?gatgaggatc?gtttcgcatg?attgaacaag?1680

atggattgca?cgcaggttct?ccggccgctt?gggtggagag?gctattcggc?tatgactggg?1740

cacaacagac?aatcggctgc?tctgatgccg?ccgtgttccg?gctgtcagcg?caggggcgcc?1800

cggttctttt?tgtcaagacc?gacctgtccg?gtgccctgaa?tgaactgcaa?gacgaggcag?1860

cgcggctatc?gtggctggcc?acgacgggcg?ttccttgcgc?agctgtgctc?gacgttgtca?1920

ctgaagcggg?aagggactgg?ctgctattgg?gcgaagtgcc?ggggcaggat?ctcctgtcat?1980

ctcaccttgc?tcctgccgag?aaagtatcca?tcatggctga?tgcaatgcgg?cggctgcata?2040

cgcttgatcc?ggctacctgc?ccattcgacc?accaagcgaa?acatcgcatc?gagcgagcac?2100

gtactcggat?ggaagccggt?cttgtcgatc?aggatgatct?ggacgaagag?catcaggggc?2160

tcgcgccagc?cgaactgttc?gccaggctca?aggcgagcat?gcccgacggc?gaggatctcg?2220

tcgtgaccca?tggcgatgcc?tgcttgccga?atatcatggt?ggaaaatggc?cgcttttctg?2280

gattcatcga?ctgtggccgg?ctgggtgtgg?cggaccgcta?tcaggacata?gcgttggcta?2340

cccgtgatat?tgctgaagag?cttggcggcg?aatgggctga?ccgcttcctc?gtgctttacg?2400

gtatcgccgc?tcccgattcg?cagcgcatcg?ccttctatcg?ccttcttgac?gagttcttct?2460

gaattattaa?cgcttacaat?ttcctgatgc?ggtattttct?ccttacgcat?ctgtgcggta?2520

tttcacaccg?catacaggtg?gcacttttcg?gggaaatgtg?cgcggaaccc?ctatttgttt?2580

atttttctaa?atacattcaa?atatgtatcc?gctcatgaga?caataaccct?gataaatgct?2640

tcaataatag?cacgtgctaa?aacttcattt?ttaatttaaa?aggatctagg?tgaagatcct?2700

ttttgataat?ctcatgacca?aaatccctta?acgtgagttt?tcgttccact?gagcgtcaga?2760

ccccgtagaa?aagatcaaag?gatcttcttg?agatcctttt?tttctgcgcg?taatctgctg?2820

cttgcaaaca?aaaaaaccac?cgctaccagc?ggtggtttgt?ttgccggatc?aagagctacc?2880

aactcttttt?ccgaaggtaa?ctggcttcag?cagagcgcag?ataccaaata?ctgtccttct?2940

agtgtagccg?tagttaggcc?accacttcaa?gaactctgta?gcaccgccta?catacctcgc?3000

tctgctaatc?ctgttaccag?tggctgctgc?cagtggcgat?aagtcgtgtc?ttaccgggtt?3060

ggactcaaga?cgatagttac?cggataaggc?gcagcggtcg?ggctgaacgg?ggggttcgtg?3120

cacacagccc?agcttggagc?gaacgaccta?caccgaactg?agatacctac?agcgtgagct?3180

atgagaaagc?gccacgcttc?ccgaagggag?aaaggcggac?aggtatccgg?taagcggcag?3240

ggtcggaaca?ggagagcgca?cgagggagct?tccaggggga?aacgcctggt?atctttatag?3300

tcctgtcggg?tttcgccacc?tctgacttga?gcgtcgattt?ttgtgatgct?cgtcaggggg?3360

gcggagccta?tggaaaaacg?ccagcaacgc?ggccttttta?cggttcctgg?gcttttgctg?3420

gccttttgct?cacatgttct?t?3441........?..........?....................

Antigen gene of the present invention is fit to multiple eucaryon and prokaryotic expression carrier simultaneously.Advantage of the present invention and positively effect are:

1, the present invention obtains the HCV composite multi-epitope DNA vaccine for manually designing, and the immunodominance T/B cell epitope gene of preferred high conservative in the HCV expression product is deleted the gene order that produces immunosuppression and immunopathogenesis.

2, the present invention obtains the HCV composite multi-epitope DNA vaccine and has introduced a nonrestrictive helper T cell epitope gene of MHC, has strengthened the cellular immunization and the humoral immunity level of vaccine.

3, the present invention obtains 5 ' end introducing hIL-2 ER signal peptide homing sequence of HCV composite multi-epitope DNA vaccine antigen gene, has strengthened the cellular immune level of vaccine.

4, the present invention obtains the HCV composite multi-epitope DNA vaccine and can induce specific humoral immunity and the cell immune response of BALB/c mouse generation at selected epi-position.

5, to obtain the HCV composite multi-epitope DNA vaccine be safe to laboratory animal in the present invention, do not have any pathological phenomena.

6, the present invention obtain the HCV composite multi-epitope DNA vaccine gene order from HCV II type Chinese epidemic strain, this vaccine can be further used as the dna vaccination that the treatment hepatitis C is held concurrently in China prevention.

Embodiment:

1.HCV multi-epitope gene is synthetic

1.1 primer is synthetic:

Primer name: CEG-1 F01; CEG-1 R01; CEG-1 F02; CEG-1 R02; CEG-1F03; CEG-1 R03; CEG-1 F04; CEG-1 R04; CEG-1 F05; CEG-1 R05.Concrete sequence is seen accompanying drawing one.

1.2 Taq enzymatic polymerization reaction:

1.2.1 DNA chain extension reaction: the F01 in 10 oligonucleotide fragments of above-mentioned synthetic and R01 (frag.I-1), F05 and R05 (frag.II-1) are carried out chain extension reaction respectively.The following reaction solution of modulation in Microtube

Primer 1 (0.010D/ μ l) 5ul

Primer 2 (0.010D/ μ l) 5ul

10×LA?BUffer 10ul

dNTP 16ul

H20 63ul

94 ℃ of insulations are after 5 minutes, at 10 minutes internal cooling to 55 ℃, add TaKaRa LA Taq enzyme 1ul after, be incubated 5 minutes, 72 ℃ are incubated 5 minutes.

This reaction solution is that DNA extends liquid.

If 1. DNA extends liquid a surname when tapping into the row clone: extend liquid with DNA and carry out ethanol sedimentation, be dissolved in then among the TE Buffer of 100ul (this solution is called PCR Frag. solution).

When 2. further carrying out the PCR reaction with DNA extension liquid if desired, carry out the PCR reaction by following condition.

1.2.2 PCR reaction: get each 1 μ l of Frag.-I and Frag.-II reaction product respectively, the former is with F02 and R02 (frag.I-2), the latter is that primer carries out the PCR reaction with F04 and R04 (frag.II-2), each primer dosage optical density value is 0.01, reaction volume 100 μ l, the PCR condition is: 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 30s, 30 circulations. get each 1 μ l of Frag.I-2 FragII-2 reaction product more respectively, with F03 and R03 is that primer carries out the PCR reaction, and reaction system and PCR condition are the same.Reaction product is dissolved among the 200 μ lTE Buffer after with ethanol sedimentation.

The PCR product of above-mentioned gained is reclaimed, and purifying is connected with the pMD18-T carrier.Connect product called after pMD18-T-CEG.

1.2.3 determined dna sequence:

Use F primer (M13-47): CGC CAG GGT TTT CCC AGT CAC GAC carries out sequencing to above-mentioned connection product, and sequencing result is seen accompanying drawing two.

2. the preparation of competent escherichia coli cell (Calcium Chloride Method)

Scrape with the aseptic inoculation ring and to get frozen intestinal bacteria bacterial classification in-70 ℃ of refrigerators, streak inoculation is cultivated about 16h for 37 ℃ in the LB agar plate that does not contain penbritin (Amp).The single bacterium colony of picking, be inoculated in the 100ml LB substratum, 37 ℃, 250r/min jolting are cultivated OD600=0.4～0.6, under aseptic condition, inoculum transferred in two aseptic and polypropylene centrifuge tubes (following operation all needs aseptic) with the ice precooling, ice bath 10min makes culture be cooled to 0 ℃; 4 ℃, the centrifugal 10min of 2000r/min, abandon supernatant, with the ice-cold 75mmol/L CaCl2 of 10ml, the resuspended precipitation of 10mmol/L (pH6.5) solution, ice bath 10min, 4 ℃, the centrifugal 10min of 2000r/min, abandon supernatant, ice-cold with 2ml, the resuspended every pipe of 75mmol/L CaCl2,10mmol/L TrisCl (pH6.5) solution that contains 15% (v/v) glycerine precipitates, competent cell is sub-packed in the aseptic Eppendorf tube every pipe 200 μ l with aseptic suction nozzle; Indicate bacterial strain, volume and date, it is frozen standby to put-70 ℃ of refrigerators.

3. transform

(volume: plasmid＜1 μ l connects product＜10 μ l, DNA＜50ng) add in the 200 μ l competent cells, mixing gently, ice bath 30min with an amount of plasmid DNA; 42 ℃ of water-bath thermal shocking 90s, ice bath cooling 2min; The LB substratum that adds 200 μ l37 ℃ preheatings, 50min is cultivated in 37 ℃ of 150r/min joltings; Get nutrient solution and coat the LB agar plate that contains Amp (50 μ g/ml), behind 37 ℃ of cultivation 14～16h, bacterium colony occurs transforming.

4. the extraction of plasmid

4.1 a small amount of of plasmid preparation (alkaline lysis)

The single conversion bacterium colony of picking is inoculated into 2ml and contains in the LB nutrient solution (down together) of 50 μ g/ml Amp, and 12～16h are cultivated in 37 ℃ of 250r/min joltings; 1.5ml is changed in the Eppendorf tube, and the centrifugal 30s of 12000r/min abandons supernatant.Solution I (50mmol/L glucose with the precooling of 200 μ l ice; 25mmol/L TrisCl, pH8.0; 10mmol/L EDTA, pH8.0) resuspended precipitation, add the new preparation of 200 μ l solution II (0.2mol/L NaOH, 1%SDS), put upside down mixing for several times, add the ice-cold solution III of 200 μ l (3mol KAc, 5mol/L glacial acetic acid), put upside down mixing, 4 ℃ of centrifugal 10min of 12000r/min, get supernatant, use the saturated phenol/chloroform of equivalent/primary isoamyl alcohol (25: 24: 1) respectively, each extracting of chloroform/primary isoamyl alcohol (24: 1) once; Add 2 times of cold dehydrated alcohols of volume, mix, put-20 ℃ of 30min, 4 ℃ of centrifugal 10min of 12000r/min abandon supernatant, and precipitation is drained with 70% cold washing with alcohol.With 20 μ l contain final concentration 20 μ g/ml RNA enzymes (no DNA enzyme) TE (10mmol/LTrisHCl, pH8.0,1mmol/L EDTA, pH8.0, down with) dissolution precipitation, and in 37 ℃ of water-baths, act on 30min, agarose gel electrophoresis inspection or-20 ℃ of preservations.

4.2 a large amount of preparations and the purifying of plasmid

The microbionation that will contain the purpose plasmid is in 100ml LB nutrient solution, and 16～18h is cultivated in 37 ℃ of 250r/min joltings; Ice bath 10min, 4 ℃ of centrifugal 10min of 4000r/min abandon supernatant, precipitation special TE (STE, 10mmol/L TrisCl, the pH8.0 of 20ml precooling; 50mmol/L EDTA pH8.0) washs once, and the centrifugal 10min of 4000r/min abandons supernatant; With the resuspended precipitation of the solution I of 4ml precooling, add the abundant mixing of solution II that 8ml newly joins, behind the ice bath 10min, the solution III stopped reaction that adds the 6ml precooling, ice bath 10min, 4 ℃ of centrifugal 15min of 7000r/min, get the Virahol of resetting and adding 0.6～0.7 times of volume, 37 ℃ of effect 30min; 4 ℃, the centrifugal 15min of 7000r/min abandons supernatant, behind an amount of TE (pH8.0) dissolution precipitation, adds fully mixing of isopyknic lithium chloride (5mol/L), the centrifugal 10min of 8000r/min; Get supernatant, add 2 times of volumes, 100% cold ethanol ,-20 ℃ of 30min, 4 ℃ of centrifugal 10min of 12000r/min; Abandon supernatant, precipitation is with 70% cold washing with alcohol and drain.With an amount of TE (pH8.0) dissolution precipitation, the RNA enzyme (10mg/ml) that adds no DNA enzyme is to final concentration 20 μ g/ml, 37 ℃ of water-bath 30min; Add equal-volume 13% polyglycol solution (PEG8000,2.5mol/L NaCl), 4 ℃ of standing over night; 4 ℃ of centrifugal 10min of 12000r/min abandon supernatant; Add 400 μ l TE (pH8.0) dissolution precipitations, with equal-volume phenol, phenol/chloroform/primary isoamyl alcohol (25: 24: 1), each extracting of chloroform/primary isoamyl alcohol (24: 1) once, add 0.1 times of volume 3MNaAC (pH5.2), 2 times of volume 100% cold ethanol, behind the mixing-20 ℃ more than the 30min, 4 ℃ of centrifugal 10min of 12000r/min, abandon supernatant, precipitation is dissolved among an amount of TE (pH8.0)-20 ℃ of preservations with 70% cold washing with alcohol and drain.

4.3 plasmid DNA is quantitative

With TE (pH8.0) is blank, and the nucleic acid solution optical density(OD) of measuring under wavelength 260nm and the 280nm with TZK-800Z type ultraviolet-visible pectrophotometer (OD) is worth.OD ₂₆₀=1 is equivalent to contain the about 50 μ g/ml of plasmid, the OD of the pure product of double-stranded DNA ₂₆₀/ OD ₂₈₀Value is 1.8, as sample OD ₂₆₀/ OD ₂₈₀Value is starkly lower than 1.8, then has protein or phenol and pollutes, and need be further purified.

5. agarose gel electrophoresis

Join 0.8-1.2% (w/v) sepharose solution with 0.5 * TBE electrophoretic buffer (0.045mol/L Tris-boric acid, 0.001mol/L EDTA), be heated to after agarose dissolves fully, add EB (10mg/ml) to final concentration 0.5 μ g/ml; Mixing is poured in the good rubber moulding of sealing, insert corresponding comb, comb is apart from about the base plate 1.0mm, treat that gel solidifies fully, carefully remove comb, gel is put into the electrophoresis chamber that 0.5 * TBE electrophoretic buffer is housed, getting an amount of DNA sample is sealing on the film and an amount of volume sample loading buffer (0.25% tetrabromophenol sulfonphthalein, the blue or green FF of 0.25% dimethylbenzene, 40% sucrose) mixing, with micro sample adding appliance sample is added in the comb hole, voltage electrophoresis with 5v/cm, when the tetrabromophenol sulfonphthalein electrophoresis to the appropriate location, observations and taking pictures under long-wave ultra violet lamp.

6.DNA operation

6.1 digestion with restriction enzyme reaction

Single endonuclease digestion reaction: with 1.0 μ g plasmid DNA and suitable quantity of water mixing, making its cumulative volume is 18 μ l, add 2-3 unit limit restriction endonuclease and the corresponding 10 * restriction enzyme reaction damping fluid of 1 μ l, flick tube wall mixing and centrifugal, put optimal reactive temperature water-bath 2～3h, the agarose gel electrophoresis inspection.To the endonuclease reaction of a large amount of plasmid DNA, corresponding expansion restriction enzyme enzyme dosage and reaction volume, the reaction solution electrophoretic examinations that takes a morsel, behind the complete degestion ,-20 ℃ of preservations are in order to further identifying or reclaim the usefulness of fragment.

The double digestion reaction: the selective reaction activity equals or carries out the double digestion reaction near 100% same buffering system, if temperature or buffering system difference, then by high temperature behind the first low temperature, the order of high salt is carried out behind the first less salt; Or first after enzyme cuts, and phenol/imitative extracting behind the ethanol sedimentation, carries out second endonuclease reaction again.

6.2 the recovery of dna fragmentation

Enzyme is cut the solution that contains target DNA fragment completely to be mixed with sample-loading buffer, electrophoresis to target DNA fragment separates fully in the agarose gel plate of adding proper concn, use TaKaRa PCR Fragment Recovery Kit (Code No.D301) to cut glue and reclaim carrier and insert fragment, be dissolved in the dH of 20ml ₂Among the O ,-20 ℃ of preservations.

6.3 the ligation of exogenous dna fragment and plasmid vector

Get the carrier DNA that 0.5 μ g reclaims, add the exogenous dna fragment of 3～5 times of molar weights, 2 μ l5 * connection damping fluid adds water and is settled to 10ul, adds 1 T of Weiss unit at last ₄Dna ligase, mixing is also centrifugal, and 16 ℃ connect 1～4h, get 7 μ l ligation liquid Transformed E .coli competent cells.

6.4 the enzyme of recon is cut screening and is identified

Product be will connect and DH5 α, 37 ℃ of overnight incubation transformed.Get single colony inoculation in 2ml AmpLB nutrient solution, prepare plasmid DNA in a small amount.Select 1～2 kind of suitable restriction enzyme to digest the agarose gel electrophoresis analysis alone or in combination.Select enzyme and cut the result and estimate identical person further with the digestion of the restriction endonuclease more than 2 kinds, all enzymes cut the result all with the identical person of expectation, be the purpose recombinant plasmid.

7. the structure of recombinant expression plasmid

With BamHI and XbaI double digestion pMD18-T-CEG, be connected with pVAXI carrier segments with the same restrictions enzymes double zyme cutting, be built into pVAX1-CEG HCV recombinant expression plasmid.

8. the double digestion of recombinant expression plasmid is identified

Use BamH I/Xba I double digestion to identify plasmid pVAXI-CEG, agarose gel electrophoresis the results are shown in accompanying drawing three, proves that construction of recombinant expression plasmid is correct.

9. recombinant expression plasmid transfection mammalian cell

2.2.1 inoculating cell:

To be in the P815 (the mastocyte oncocyte of mouse) and HeLa (human cervical carcinoma cell) cell of logarithmic phase.Attached cell with trysinization after, be prepared into 3 * 10 ⁵/ ml cell suspension adds the 3ml cell suspension, in 37 ℃, 5%CO on the 3cm Tissue Culture Plate ₂Following overnight incubation.

2.2.2 transfection:

Get and treat transfection plasmid 5-10ug, add serum-free 1640 substratum 500ul mixings, incubation 30 minutes, other gets liposome solutions (Lipofectamine) 2mg/ml10ul, adds serum-free 1640 substratum 500ul, incubation is 30 minutes behind the mixing, above-mentioned two kinds of solution are dropwise added, the air blowing mixing, leave standstill 30 minutes under the room temperature after, add in the Hela cell culture fluid of transfection 37 ℃, 5%CO ₂After following cultivation is hatched 10-12 hour, add 1640 cell culture fluids that 3ml contains 10%FBS, 37 ℃, 5%CO ₂The following cultivation.

The recombinant expression plasmid that obtains is infected P815 (the mastocyte oncocyte of mouse) and HeLa cell.In infecting back 48h harvested cell, the proteic expression of testing goal.

10. the detection of recombinant expression plasmid expression product

10.1 indirect immunofluorescence identifies that expression product detects

In 6 * 30mm culture plate, put into cover glass, go down to posterity and cultivate P815 and Hela cell.Next day, in 500ml serum-free MEM, add the plasmid that 10mg desires transfection, mixing.Other gets 500ml serum-free MEM, adds 10ml transfection reagent (Lipofectin Reagent), mixing.The 500ml MEM that will contain plasmid dropwise adds among the 500ml MEM that contains transfection reagent, mixing gently, and room temperature left standstill 30 minutes.To grow up to the nutrient solution MEM sucking-off of 40%-60% individual layer Hela cell, wash twice with serum-free MEM, add the above-mentioned 1ml MEM that contains the plasmid of liposome, after 37 ℃, 5%CO2 sense are done 16-18 hour, add 3ml and contain 5% calf serum MEM, continue to cultivate 48 hours.More than operation all needs to carry out under aseptic condition.

Take out cover glass, PBS (pH7.2) rinsing once, cold acetone fixedly 10-15 minute.PBS washing 3 times, with the anti-HCV CEG of rabbit multi-epitope antigen positive serum (1: 300) reaction 1.5 hours, PBS washing 3 times, the goat anti-rabbit igg with fluorescein isothiocyanate (FITC) mark reacted 1.5 hours then.Glycerine damping fluid (50% glycerine PBS) is dripped in PBS washing 3 times on slide glass, the cover glass that is loaded with cell is inverted on the slide glass, and under fluorescent microscope, observe and takes pictures at wavelength 495nm place.

Indirect immunofluorescence (IFA) detects and shows, the Hela cell of transfection recombinant dna vaccine plasmid pVAX1-CEG, at the yellow-green fluorescence that occurs around the nuclear and in the cytoplasm reacting with specificity fluorescent antibody, and control plasmid pVAXI cells transfected be can't see yellow-green fluorescence.Presentation of results, the nucleic vaccine plasmid of structure has been expressed CEG albumen.

10.2 immunoblotting (Western blot)

With Hela cell and P815 cell 1mlTEN (40mmol/L Tris.Cl pH7.5,1mmol/L EDTA, the 150mmol/L NaCl) wash-out of transfection recombinant dna vaccine plasmid pVAX1-CEG, the centrifugal 5min of 3000r/min abandons supernatant.Sedimentation cell is with 50 μ l lysis buffers (10mmol/L Tris.Cl pH7.4,1mmol/L MgCl2,0.5%NP40,20 μ g/mlDNase I) cracking, ice-water bath 30min, the centrifugal 5min of 5000r/min, add equivalent 2 * SDS sample-loading buffer, boil and boil 3min, carry out the SDS-polyacrylamide gel electrophoresis.Behind the SDS-PAGE protein isolate, with its electrotransfer to nitrocellulose filter.5% skimming milk or 3% bovine serum albumin damping fluid (10mmol/L TrisCl, pH7.5,150mmol/LNaCl, 0.05%Tween20) 37 ℃ of sealing 2h, lavation buffer solution (10mmol/L TrisClpH7.5,150mmol/L NaCl, 0.05%Tween20) washing is 3 times, each 5～10min, respectively with on the anti-HCV CEG of rabbit multi-epitope antigen positive serum (1: the 300) mulch film, 2h is made in the room temperature sense, washs 3～5 times, and 2h is made in the goat anti-human igg of alkali phosphatase enzyme mark (1: 1000) room temperature sense, after washing 3～5 times, each 5～10min is with 10ml alkaline phosphatase damping fluid (100mmol/L NaCl, 5mmol/L MgCl ₂, 100mmol/L TrisCl pH9.5) and add 66 μ l NBT (0.5g NBT, 70% dimethyl formamide), add 33 μ lBCIP (0.5gBCIP, 100% dimethyl formamide) behind the mixing again, colour developing 10～20min uses the distilled water stopped reaction.The result confirms that expression product can react with the anti-HCV CEG of rabbit multi-epitope antigen positive serum, proves that recombinant dna vaccine plasmid pVAX1-CEG can successfully be expressed at mammalian cell.

11.HCV the experimental immunization study of composite multi-epitope DNA vaccine

11.1 nucleic acid vaccine immunity mouse

36 of BALB/c female mices, female, in 6～8 ages in week, belong to SPF (III) level animal, the equal tool certification of fitness of above laboratory animal.Divide three groups at random, inject empty plasmid pVAXI control group, pVAX1-CEG immune group and PBS immune group respectively.Every mouse is directly annotated PBS plasmid solution or the 100 μ l PBS solution that total volume is 100 μ l (1 μ g/ μ l) in the bilateral tibialis anterior.Altogether immunity is three times, for the first time, the timed interval is 25 days for the second time.For the second time, the timed interval is 20 days for the third time.Last immunity back was plucked eyeball on the 7th day and is got blood, and the cervical vertebra dislocation is put to death, and the blood coagulation separation of serum detects the antigenic IgG antibody of anti-HCV for ELISA.Asepticly get that its spleen detects cytotoxic t cell activity respectively and with the quantity of flow cytometry analysis t lymphocyte subset class.

11.2 the detection of spleen amynologic index

11.2.1 spleen list lymphocyte suspension preparation

Sacrificed by decapitation mouse, aseptic condition are taken out spleen down, place the plate that fills RPMI 1640 substratum, grind with slide, and 200 order nylon net filters are made single cell suspension, 1500r/min, and centrifugal 5min abandons supernatant.With the centrifugal cell twice of washing of Hanks liquid, be resuspended in the RPMI RPMI-1640 that contains 10%NBS, counting transfers to 2 * 10 ⁷Individual/ml is standby.

11.2.2 the detection of spleen t lymphocyte subset class quantity

Extracting spleen cell suspension 0.1ml adds 5ml PBS, 1500r/min, and centrifugal 10min washes cell twice, adds fluorescent mark rat anti-mouse CD3 in 0.5ml PBS cell suspending liquid respectively ⁺, CD4 ⁺And CD8 ⁺Monoclonal antibody (this antibody dilutes by 1: 10 with PBS) room temperature lucifuge is placed 30min, adds 5ml PBS again and washes once, and the centrifugal 10min of 1500r/min will manage floor cells and suspend with 200 μ l PBS, treats that the upflowing cell instrument detects.FACS detects 10000 cells, and the gained data are carried out statistical procedures.

As a result, the CD3 of pVAX1-CEG immune group ⁺CD4 ⁺With CD3 ⁺CD8 ⁺Lymphocyte number all is significantly higher than blank plasmid pVAXI control group and PBS control group, all recombinant plasmid immune mouses are described after, all expressed foreign protein, and the good immune response of induction of immunity mouse.

11.2.3 splenocyte Specific CTL Cells cytotoxic activity detects

1) preparation of target cell:

The restricted HCV of H-2d is discerned epitope polypeptide GlyPheAlaAspLeuMetGlyTyrIleProLeuValGlyAlaProLeu and SerTyrThrTrpThrGlyAlaLeuIleThrProCysAlaAlaGluGlu and P815 cell at 37 ℃, the 5%CO2 incubator is hatched 2h altogether, is prepared into the target cell of corresponding peptides mark.

2) the Specific CTL Cells cytotoxic activity detects:

With two kinds of epitope polypeptides of GlyPheAlaAspLeuMetGlyTyrIleProLeuValGlyAlaProLeu, SerTyrThrTrpThrGlyAlaLeuIleThrProCysAlaAlaGluGlu and irrelevant control peptide AlaGlyCysLysAsnPhePheTrpLysThrPheThrSerCys is that stimulated in vitro is former, with the splenocyte of mouse in 37 ℃, the 5%CO2 incubator is hatched 2h altogether, adding ametycin to final concentration is 40mg/L, use PBS washed cell 4 times after cultivating 2h, to remove mitomycin.Be prepared into the irritation cell of corresponding peptides mark.The splenocyte suspension of preparation immune mouse is adjusted cell concn to 5 * 10 ⁷Individual/ml.Each 1ml of target cell and irritation cell adds the 60mm Tissue Culture Dish, adds 2ml RPMI1640, adds IL2 to final concentration 10u/ml behind the cultivation 24h, continues to cultivate 5 days.The centrifugal 5min of 2000r/min.Precipitation suspends with RPMI1640, adjusts cell concn to 10 ⁷Individual/ml.The action effect cell.Detect ctl response with the mould method for releasing of lactic dehydrogenase.Divided sample on 96 microwell plates, discharged naturally and maximum release aperture, imitating target cell ratio (E/T) is 20: 1,50: 1,100: 1, RPMI1640 to 200 μ l is added in every hole, establish 3 multiple holes for every group, imitate target cell and hatch 4h jointly, get supernatant 50 μ l in 37 ℃ of 5%CO2, add LDH effect substrate 50 μ l, add 50 μ l stop buffer termination reactions behind room temperature, the lucifuge reaction 30min, 490nm surveys absorbancy down, and calculation formula is as follows:

Killing activity (%)=(experimental port OD value-target cell nature release aperture OD value-effector cell's nature release aperture OD value)/(maximum release pore OD value-target cell discharges pore OD value naturally) * 100%

The result shows, the pVAX1-CEG immune group has produced the strong ctl response at selected epi-position GlyPheAlaAspLeuMetGlyTyrIleProLeuVal GlyAla ProLeu and SerTyrThrTrpThrGlyAlaLeu IleThrProCysAlaAlaGluGlu, compare significant difference (P＜0.01) with pVAXI control group, PBS control group and uncorrelated control peptide AGCKNFFWKTFTSC group.

11.3 the ELISA method is measured in the immune serum specific antibody (anti-HCV-CEG IgG) with the CEG albumen bag quilt of escherichia coli expression, two anti-ly are HRP-rabbit anti-mouse igg, dilution in 1: 10 000.Measure each hole OD value at enzyme linked immunological instrument 450nm, the OD450 value that microplate reader records is carried out statistical analysis.

The result shows, pVAX1-CEG immune group antibody horizontal is apparently higher than pVAXI control group and PBS control group, significant difference (P＜0.05).

The concrete sequence of the synthetic required primer of CEG gene:

CEG-1?F01：GGATCCGCCACCATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACAAACAGTGCA

CEG-1?R01：GCCAAGGGGGCGCCGACGAGCGGAATGTACCCCATGAGGTCGGCGAAGCCTGCACTGTTTGTGACAAGTG

CEG-1?F02：CTCGTCGGCGCCCCCTTGGCCGCCGCTGCCAAGTTCGTGGCTGCCTGGACCCTGAAGGCCGCCGCTACGG

CEG-1?R02：CTTGATGTACTGAGCGGCGGCGTTACAGTCGATCACTGAGTCAAAGTCGCCCGTAGCGGCGGCCTTCAGG

CEG-1?F03：CCGCCGCTCAGTACATCAAGGCTAATAGCAAATTCATCGGAATCACCGAGCTGGCCGCCGCTGAATTCGATATCC

CEG-1?R03：AGCCTAGCGGCGGCGACGGCCGGAATGTACCCCATGAGGTCAGCGGCGGCCTCGAGGATATCGAATTCAGCGGCG

CEG-1?F04：GCCGTCGCCGCCGCTAGGCTCTGGCACTACCCCTGCACTGTCGCCGCCGCTTGTGCCTCACACCTCCCTT

CEG-1?R04：GGCCGCCTTCTGCTTGAACTGCTCGGCGAGGTGCATTCCCTGTTCGATGTAAGGGAGGTGTGAGGCACAA

CEG-1?F05：AGTTCAAGCAGAAGGCGGCCGCCGCTTCCTATACATGGACAGGCGCCTTGATCACGCCAT

CEG-1?R05：TCTAGATTACTAAGCGGCGGCCTCCTCCGCAGCACATGGCGTGATCAAGGCGCCT

Claims (6)

1, a kind of polyepitope hepatitis C antigen gene, its gene order is:

gccaccatgt?acaggatgca?actcctgtct?tgcattgcac?taagtcttgc?acttgtcaca 60

aacagtgcag?gcttcgccga?cctcatgggg?tacattccgc?tcgtcggcgc?ccccttggcc 120

gccgctgcca?agttcgtggc?tgcctggacc?ctgaaggccg?ccgctacggg?cgactttgac 180

tcagtgatcg?actgtaacgc?cgccgctcag?tacatcaagg?ctaatagcaa?attcatcgga 240

atcaccgagc?tggccgccgc?tgaattcgat?atcctcgagg?ccgccgctga?cctcatgggg 300

tacattccgg?ccgtcgccgc?cgctaggctc?tggcactacc?cctgcactgt?cgccgccgct 360

tgtgcctcac?acctccctta?catcgaacag?ggaatgcagc?tcgccgagca?gttcaagcag 420

aaggcggccg?ccgcttccta?tacatggaca?ggcgccttga?tcacgccatg?tgctgcggag 480

gaggccgccg?cttagtaa?498

2, polyepitope hepatitis C antigen gene according to claim 1, it is characterized in that: the immunodominance epi-position of six high conservatives in the preferred HCV genome, add the helper T cell epitope gene of a Toxoid,tetanus----TT and one and derive from the antigenic helper T cell epi-position of pernicious cruel protozoon ring spore, connect with three L-Ala between each epi-position, introduce human IL-2 ER signal peptide homing sequence at 5 ' end of above-mentioned fusion gene simultaneously, and base makes it to meet the Kozak rule before and after optimizing ATG, before and after designed gene, introduce BamHI and two restriction enzyme sites of XbaI at last respectively, obtain HCV composite multi-epitope antigen gene----CEG.

3, polyepitope hepatitis C antigen gene according to claim 2 is characterized in that: the immunodominance epi-position of six high conservatives is in the described HCV genome:

1.HCV?C：129-144

ggcttcgccg?acctcatggg?gtacattccg?ctcgtcggcg?cccccttg?48

2.HCV?NS3：439～449

acgggcgact?ttgactcagt?gatcgactgt?aac?33

3.HCV?C：132-140

gacctcatgg?ggtacattcc?ggccgtc?27

4.HCV?E2(614-622)

aggctctggc?actacccctg?cactgtc?27

5.HCV?NS4：1711-1732

tgtgcctcac?acctccctta?catcgaacag?ggaatgcagc?tcgccgagca?gttcaagcag?aaggcg?66

6.HCV?NS5(2422-2437)

tcctatacat?ggacaggcgc?cttgatcacg?ccatgtgctg?cggaggag?48

4, a kind of polyepitope hepatitis C nucleic acid vaccine, it is characterized in that: obtain with above-mentioned that HCV composite multi-epitope antigen gene reclaims, purifying, be connected reorganization with the pMD18-T carrier, obtain pMD18-T-CEG and use BamHI/XbaI double digestion pVAX1 vector plasmid and pMD18-T-CEG plasmid again, connection is reassembled as pVAX1-CEG HCV composite multi-epitope DNA vaccine.

5, polyepitope hepatitis C nucleic acid vaccine according to claim 4, its gene order is:

gactcttcgc?gatgtacggg?ccagatatac?gcgttgacat?tgattattga?ctagttatta?60

atagtaatca?attacggggt?cattagttca?tagcccatat?atggagttcc?gcgttacata?120

acttacggta?aatggcccgc?ctggctgacc?gcccaacgac?ccccgcccat?tgacgtcaat?180

aatgacgtat?gttcccatag?taacgccaat?agggactttc?cattgacgtc?aatgggtgga?240

ctatttacgg?taaactgccc?acttggcagt?acatcaagtg?tatcatatgc?caagtacgcc?300

ccctattgac?gtcaatgacg?gtaaatggcc?cgcctggcat?tatgcccagt?acatgacctt?360

atgggacttt?cctacttggc?agtacatcta?cgtattagtc?atcgctatta?ccatggtgat?420

gcggttttgg?cagtacatca?atgggcgtgg?atagcggttt?gactcacggg?gatttccaag?480

tctccacccc?attgacgtca?atgggagttt?gttttggcac?caaaatcaac?gggactttcc?540

aaaatgtcgt?aacaactccg?ccccattgac?gcaaatgggc?ggtaggcgtg?tacggtggga?600

ggtctatata?agcagagctc?tctggctaac?tagagaaccc?actgcttact?ggcttatcga?660

aattaatacg?actcactata?gggagaccca?agctggctag?cgtttaaact?taagcttggt?720

accgagctcg?gatccgccac?catgtacagg?atgcaactcc?tgtcttgcat?tgcactaagt?780

cttgcacttg?tcacaaacag?tgcaggcttc?gccgacctca?tggggtacat?tccgctcgtc?840

ggcgccccct?tggccgccgc?tgccaagttc?gtggctgcct?ggaccctgaa?ggccgccgct?900

acgggcgact?ttgactcagt?gatcgactgt?aacgccgccg?ctcagtacat?caaggctaat?960

agcaaattca?tcggaatcac?cgagctggcc?gccgctgaat?tcgatatcct?cgaggccgcc?1020

gctgacctca?tggggtacat?tccggccgtc?gccgccgcta?ggctctggca?ctacccctgc?1080

actgtcgccg?ccgcttgtgc?ctcacacctc?ccttacatcg?aacagggaat?gcagctcgcc?1140

gagcagttca?agcagaaggc?ggccgccgct?tcctatacat?ggacaggcgc?cttgatcacg?1200

ccatgtgctg?cggaggaggc?cgccgcttag?taatctagag?ggcccgttta?aacccgctga?1260

tcagcctcga?ctgtgccttc?tagttgccag?ccatctgttg?tttgcccctc?ccccgtgcct?1320

tccttgaccc?tggaaggtgc?cactcccact?gtcctttcct?aataaaatga?ggaaattgca?1380

tcgcattgtc?tgagtaggtg?tcattctatt?ctggggggtg?gggtggggca?ggacagcaag?1440

ggggaggatt?gggaagacaa?tagcaggcat?gctggggatg?cggtgggctc?tatggcttct?1500

actgggcggt?tttatggaca?gcaagcgaac?cggaattgcc?agctggggcg?ccctctggta?1560

aggttgggaa?gccctgcaaa?gtaaactgga?tggctttctc?gccgccaagg?atctgatggc?1620

gcaggggatc?aagctctgat?caagagacag?gatgaggatc?gtttcgcatg?attgaacaag?1680

atggattgca?cgcaggttct?ccggccgctt?gggtggagag?gctattcggc?tatgactggg?1740

cacaacagac?aatcggctgc?tctgatgccg?ccgtgttccg?gctgtcagcg?caggggcgcc?1800

cggttctttt?tgtcaagacc?gacctgtccg?gtgccctgaa?tgaactgcaa?gacgaggcag?1860

cgcggctatc?gtggctggcc?acgacgggcg?ttccttgcgc?agctgtgctc?gacgttgtca?1920

ctgaagcggg?aagggactgg?ctgctattgg?gcgaagtgcc?ggggcaggat?ctcctgtcat?1980

ctcaccttgc?tcctgccgag?aaagtatcca?tcatggctga?tgcaatgcgg?cggctgcata?2040

cgcttgatcc?ggctacctgc?ccattcgacc?accaagcgaa?acatcgcatc?gagcgagcac?2100

gtactcggat?ggaagccggt?cttgtcgatc?aggatgatct?ggacgaagag?catcaggggc?2160

tcgcgccagc?cgaactgttc?gccaggctca?aggcgagcat?gcccgacggc?gaggatctcg?2220

tcgtgaccca?tggcgatgcc?tgcttgccga?atatcatggt?ggaaaatggc?cgcttttctg?2280

gattcatcga?ctgtggccgg?ctgggtgtgg?cggaccgcta?tcaggacata?gcgttggcta?2340

cccgtgatat?tgctgaagag?cttggcggcg?aatgggctga?ccgcttcctc?gtgctttacg?2400

gtatcgccgc?tcccgattcg?cagcgcatcg?ccttctatcg?ccttcttgac?gagttcttct?2460

gaattattaa?cgcttacaat?ttcctgatgc?ggtattttct?ccttacgcat?ctgtgcggta?2520

tttcacaccg?catacaggtg?gcacttttcg?gggaaatgtg?cgcggaaccc?ctatttgttt?2580

atttttctaa?atacattcaa?atatgtatcc?gctcatgaga?caataaccct?gataaatgct?2640

tcaataatag?cacgtgctaa?aacttcattt?ttaatttaaa?aggatctagg?tgaagatcct?2700

ttttgataat?ctcatgacca?aaatccctta?acgtgagttt?tcgttccact?gagcgtcaga?2760

ccccgtagaa?aagatcaaag?gatcttcttg?agatcctttt?tttctgcgcg?taatctgctg?2820

cttgcaaaca?aaaaaaccac?cgctaccagc?ggtggtttgt?ttgccggatc?aagagctacc?2880

aactcttttt?ccgaaggtaa?ctggcttcag?cagagcgcag?ataccaaata?ctgtccttct?2940

agtgtagccg?tagttaggcc?accacttcaa?gaactctgta?gcaccgccta?catacctcgc?3000

tctgctaatc?ctgttaccag?tggctgctgc?cagtggcgat?aagtcgtgtc?ttaccgggtt?3060

ggactcaaga?cgatagttac?cggataaggc?gcagcggtcg?ggctgaacgg?ggggttcgtg?3120

cacacagccc?agcttggagc?gaacgaccta?caccgaactg?agatacctac?agcgtgagct?3180

atgagaaagc?gccacgcttc?ccgaagggag?aaaggcggac?aggtatccgg?taagcggcag?3240

ggtcggaaca?ggagagcgca?cgagggagct?tccaggggga?aacgcctggt?atctttatag?3300

tcctgtcggg?tttcgccacc?tctgacttga?gcgtcgattt?ttgtgatgct?cgtcaggggg?3360

gcggagccta?tggaaaaacg?ccagcaacgc?ggccttttta?cggttcctgg?gcttttgctg?3420

gccttttgct?cacatgttct?t?3441........?..........?..........?..........

6, according to claim 1,2 described polyepitope hepatitis C antigen genes, it is characterized in that: described antigen gene is fit to multiple eucaryon and prokaryotic expression carrier simultaneously.