CN1686565A - Hepatitis B nucleic acid vaccine, its preparation method and application - Google Patents

Abstract

A hepatitis B nucleic acid vaccine for preparing the medicine to prevent and treat hepatitis B is prepared from the pharmacologicaly acceptable eukaryotic expression plasmid carrier and the gene sequence for coding the antigenic detaminants of T cell and B cell through configuring multi-epitope genetic vaccine.

Description

A kind of hepatitis B nucleic acid vaccine, its preparation method and application thereof

[technical field]

The present invention relates to genetic engineering dna vaccination field, specifically a kind of hepatitis B nucleic acid vaccine with therapeutic effect the invention still further relates to the application of this vaccine as the pharmaceutical preparation of treatment hepatitis B.

[background technology]

Hepatitis B virus is a kind of very strong communicable virus that has, and the whole world has 300,000,000 5 thousand ten thousand population hepatitis b virus infections at present approximately, liver cirrhosis, hepatic necrosis and hepatocarcinoma that annual nearly 100 ten thousand the infecteds die from hepatitis B and brought out by hepatitis B.Hepatitis B can be divided into acute and chronic two kinds, and 95% left and right sides acute hepatitis b patient can fully recover by treatment; Be transformed into chronic hepatitis B about 5%.Most chronic viral hepatitis B patients become lifelong virus carrier.

China suffers from the most serious country of chronic viral hepatitis B in the world.Average 10% (about 100,000,000 people of surface antigen carrier) of whole nation hepatitis B virus surface antigen (HBsAg) carrying rate.Whole nation crowd's hepatitis B infection rate is up to 60% (having people more than 600,000,000 to be crossed by hepatitis B virus infection approximately).If the untimely hepatitis B virus (HBV) of removing effectively, about 25% hepatitis B virus carriers can develop into liver cirrhosis, and the patient of 5-10% can develop into hepatocarcinoma.People mainly use preventive measures to hepatitis B at present, promptly inoculate hepatitis B vaccine and prevent.Vaccine is mainly used in the body that never infected, so the virus protein of natural structure can be directly as vaccine antigen.But developed the Hepatitis B virus vaccine of application, though can infect the good preventing effect of playing to HBV, to infecting the body of HBV, the effect that but is difficult to bring into play treatment and removes virus.Main cause is that body has produced specific immunologic tolerance to hepatitis B virus, and immune system can not be removed virus effectively.Virus carrier and the infected to hepatitis B, especially chronic viral hepatitis B virus hepatitis such the patient, at present, the medicine that obtains universally acknowledged effective treatment chronic hepatitis B has two kinds: a kind of is alpha-interferon, and another kind is the analog lamivudine of nucleic acid.Though these two kinds of antiviral drugs all have the effect of certain reduction virus levels clinically, have very important shortcoming simultaneously: the toxicity height, and also side effect is big.In addition, alpha-interferon needs long-term subcutaneous or intramuscular injection; Lamivudine is only effective to about 1/3 chronic viral hepatitis B patient.After the drug withdrawal, it is the common drawback of above two kinds of medicines that patient's virus levels is gone up.Why two kinds of medicines have above shortcoming to be because medicine itself has only suppressed virus replication, but can not thoroughly remove by the cell of viral infection, thereby after can drug withdrawal occurring, the phenomenon that virus levels is gone up.Therefore, developing a kind of vaccine safe, that treat chronic viral hepatitis B effectively has very important significance to the human beings'health tool.

The Hepatitis B virus vaccine of using clinically mainly contains following several at present:

1. haematogenous Hepatitis B virus vaccine.Vaccine from blood once was extensive use of for many years in worldwide, but to be blood plasma with hepatitis B carriers after all prepare for it, its safety can not reach 100% standard theoretically, and the source of carrier blood plasma is restricted, and all can cause potential problem to the output and the cost of Hepatitis B virus vaccine.Simultaneously, this vaccine only can be as vaccine, can not play therapeutical effect to the body of infective virus.

2. genetic engineering subunit vaccine.It is a kind of feasible approach that the HBV vaccine is produced in the expression that utilizes eukaryotic cell to do short-term or secular hbs antigen.Yeast is a kind of unicellular eukaryote, is commonly used to prepare genetic engineering subunit vaccine.Represented the revolution second time of vaccine with the recombinant DNA hbs antigen of yeast preparation.Clinical trial proof genetic engineering hepatitis B surface antigen is a safety and effective, has also replaced previously used hepatitis B vaccine from blood with it in China.Be no more than 1% although it contains yeast protein, it produced allergic worry do not get rid of fully as yet.Simultaneously, this subunit vaccine is also just as vaccine.

3. artificial synthetic polypeptide hepatitis B subunit vaccine.There is bibliographical information to synthesize the immunogenic small peptide of tool according to the sequence of hbs antigen.The immunogenicity of these small peptides is all very limited, can not cause immunological memory but in general.These faint immunoreation may be relevant with shortage T cell antigen epitope.

4. hepatitis B DNA vaccine.Dna vaccination is a new technique of fast development in recent years.It is meant after containing the eukaryon expression plasmid dna direct inoculation body of coding exogenesis protein gene, at the cell inner expression foreign protein, produce a kind of novel immunization strategy of specific cell and humoral immunoresponse(HI) with excitating organism, have and be easy to make up, prepare advantages such as simple and good stability, simultaneously persistent specific cell of body and humoral immunoresponse(HI) can be brought out, prevention and therapeutic vaccine can be doublely done.At Nature, 1992, among the 356:152-154, people such as Tang DC disclose the dna vaccination technology.People such as Davis in 1993 the expression plasmid that contains HBV surface antigen (HBsAg) encoding gene through the muscle immune mouse, successfully brought out at the cell of HBsAg and humoral immunization (Davis HLet al, Vaccine, 1996,14:910-915).The hepatitis B of gene vaccine treatment afterwards becomes the focus that people fall over each other to study.Mancini M etc. find HBV dna vaccination immunity HBV transgenic mice, mice is reversed the immune tolerance state of HBV, produced HBsAg antibody, removed free virion in the blood, duplicating also of HBV suppressed in the liver, further show dna vaccination might become the new tool of hepatitis B control (Proc Natl Acad Sci USA, 1996,93:12496-12501).

The Hepatitis B virus vaccine based on activating immune system that present document is reported all concentrates on selects the HBV envelope protein for use, HBV cAg or HBV polymerase antigen whole protein, or single T cellular antigens determinant polypeptide fragment, though these preparations demonstrate certain curative effect to animal model or acute hepatitis b patient, and chronic hepatitis B patient is not had tangible curative effect.How breaking the formed immune tolerance state of body chronic infection, is the important topic of anti-HBV treatment research.

[summary of the invention]

Purpose of the present invention is exactly in order to overcome the shortcoming of present Hepatitis B virus vaccine, provide a kind of have strong cell immunogenicity can be used as treatment usefulness, be difficult for producing the tolerance of HBV infection immunity, vaccine safe in utilization; Simultaneously, the present invention also provide a kind of prepare simple, be easy to make up, the preparation method of the Hepatitis B virus vaccine of good stability, the invention still further relates to of the application of this Hepatitis B virus vaccine as the pharmaceutical preparation of treatment hepatitis B.

Epitope is the 26S Proteasome Structure and Function unit that antigen induces the minimum of specific immune response, comprises B cell antigen epi-position, t helper cell epi-position and killer T cell epi-position.Because downward modulation, shortage and the disorder of dissimilar immunne response are causes of disease of numerous disease, therefore the vaccine design based on epitope comes into one's own day by day.On epitope levels, antigenic understanding has been facilitated a kind of like this trend: no longer stay in pathogen or native antigen overall molecule level based on the immunologic intervention means of antigen molecule and begin to epitope levels excessive.Comprise polypeptide vaccine and be based gene vaccine and polyepitope vaccines etc. based on the vaccine of epi-position with the epi-position.Wherein be that the based gene vaccine is rich in potentiality most with the multi-epitope.

The present invention starts with in the mode of multi-epitope gene vaccine just, makes up the HBV gene vaccine.The present invention at first screens T cellular antigens determinant and B cell antigen determinant, Pre-S1 district in the known HBV gene and the S gene Pre-S1 antigen of encoding respectively, Pre-S2 antigen and S antigen, three kinds of albumen of combination HBV peplos, these three kinds of antigens all contain the antigenic determinant of inducing body to produce anti-HBV neutralizing antibody, because Pre-S1 antigen, Pre-S2 antigen plays an important role in the adhesion of HBV and the corresponding receptor of hepatocyte, and under the natural infection state, anti-Pre-S2 production of antibodies is early than anti-S antibody, may be closely related with virus sweep, so the gene order that the present invention chooses coding Pre-S2 antigenic determinant is inserted on the expression vector;

In addition, relation is closely arranged between HBcAg and the killer T cell, the present invention is when making up the HBV nucleic acid vaccine, and the HBcAg T cellular antigens determinant of also will encoding is inserted on the same recombinant expression carrier; Therefore the present invention is when making up the HBV nucleic acid vaccine, the sequence and the Pre-S2 sequence of coding T and B cell antigen determinant are inserted on the same recombinant expression carrier, induce body to produce the cellular immunization of specific humoral immunity and killer T cell activation mediation simultaneously.

The eukaryon expression plasmid of structure nucleic acid vaccine of the present invention adopts pharmaceutically acceptable eucaryon plasmid carrier, can select the universal support in present technique field for use, include but not limited to pVAX1 (production of American I nvitrogene company), also can adopt other eukaryon expression plasmid pIRESIneo, pCDNA3, pCI, pCMV; The present invention can also add adjuvant, as cationic-liposome, and interleukin IL-12, GM-CSF, gamma interferons etc. also can not add adjuvant.Described pharmaceutical composition can be applied to the mankind by the immunization route of routine, thereby causes immunne response.Described application approach includes but not limited to intramuscular injection, subcutaneous injection, intradermal injection, intravenous injection, particle gun bombardment and nasal mucosa instillation etc.

After having determined antigenic determinant, further determine the amino acid sequence that contains T cellular antigens determinant and B cell antigen determinant after the antigenic determinant combination, further design corresponding nucleotide fragments, and with chemical synthesis process synthetic after, connect with T4 dna ligase (production of U.S. NEB company), splicing obtains the target gene fragment of recombinating; With restricted enzyme EcoRI and AlfII digestion (production of U.S. NEB company) eukaryon expression plasmid, digestion product and splicing product carry out agarose gel electrophoresis and purification, and the product of two kinds of purification is connected with the T4 dna ligase, obtain recombiant plasmid.Its concrete steps are:

1) chooses a plurality of antigenic determinants, design polyvalent antigen determinant polypeptide;

2) with the synthesizing single-stranded oligonucleotide fragment of chemical synthesis, be connected, obtain the target gene fragment of recombinating with the T4DNA ligase;

3) use the digestion with restriction enzyme plasmid vector, digestion product is connected with ligase with the reorganization target gene fragment;

4) plasmid is transformed in the escherichia coli,, produces the engineering bacteria that contains dna vaccination with the method for fermentation culture;

5) with the method for business-like chromatographic column by affinity chromatograph, separation and purification 4) in bacterial lysate, obtain spissated plasmid.

Gene vaccine of the present invention can be induced the generation of HBV specific killing T cell effectively, therefore can be used as the chronic hepatitis B therapeutic DNA vaccine, is used to break the immunologic tolerance that HBV infects, and chronic hepatitis B is treated.The embodiment follow-up by the present invention shows that the dna gene vaccine HLA-A2 transgenic mice that makes up with the present invention has produced mouse T cell, the target cell that specific identification of energy and removing have the HBV polypeptide and transformed by hepatitis B surface protein D NA.Embodiments of the invention also show the secretion that HBV nucleic acid vaccine energy specificity is induced IFN-γ.

Describe the present invention in detail below with reference to drawings and Examples, should be noted that embodiment is to the further specifying of technical scheme of the present invention, but do not show that the present invention only limits to these embodiment.

[description of drawings]

Fig. 1 is the structural representation of hepatitis B nucleic acid vaccine of the present invention;

Fig. 2 is the restriction enzyme digestion and electrophoresis figure and the insertion segment sequencer map of pUV-3 plasmid of the present invention, and wherein a figure left side is the electrophoretogram behind enzyme action, and P1, P2 are the sub-clone of dna vaccination, and M1, M2 are the DNA standard; Figure is right for inserting segmental nucleotide sequence analysis;

The immunogenicity analysis of Fig. 3 killer T cell antigenic determinant, wherein T2+HBV-C18 is a cAg determinant C18 group, T2+HBV-S371 is a surface antigen determinant S371 group (experimental group of embodiment 2), and T2+Control peptide is non-specific polypeptide matched group.The result shows: when the effector lymphocyte is respectively with target cell ratio: 10: 1,30: 1 and 100: 1 o'clock, experimental group was that the T2+HBV-C18 group is organized with T2+HBV-S371 and compared with matched group, has tangible lethal effect.

Fig. 4 is the inductive result who removes the target cell that contains the HBV polypeptide at the specific killing T cell-specific of S371 epi-position of HBV nucleic acid vaccine of the present invention.Wherein M1 is the cell with the carbon oxygen fluorescent marker CFSE labelling of low concentration, M2 is the cell of CFSE labelling that has added the usefulness high concentration of S371 polypeptide, C-Mice is that mice in control group, I-Mice are the mice (experimental group of embodiment 2) of immune group, and the inductive specific killing T of presentation of results nucleic acid vaccine cell-specific is removed the target cell that contains the HBV polypeptide.

Fig. 5 is the inductive T cell of the HBV nucleic acid vaccine of the present invention result of specific recognition HBV-surface protein DNA transformant in vivo, wherein MEM+pGFP is the matched group transformant, MEM+pHBV-GFP is a HBV surface protein DNA cell transformed (experimental group of embodiment 2), and the inductive killer T cell specificity of presentation of results nucleic acid vaccine is removed HBV surface protein cell transformed.

Fig. 6 is the excretory sketch map that HBV nucleic acid vaccine specificity of the present invention is induced IFN-γ (gamma interferon), among the figure, C-peptide is contrast polypeptide group, HBV-S371 is a Hepatitis B virus vaccine S371 polypeptide group (experimental group of embodiment 2), the result shows the secretion of the specific IFN-of the inducing γ of Hepatitis B virus vaccine S371 polypeptide group energy, and contrast polypeptide group can not.

[specific embodiment]

The screening of embodiment 1 T cellular antigens determinant and B cell antigen determinant:

The present invention be based on epi-position vaccine design (english name is: EPITOPE-BASED VACCINE DESIGN, EBVD).At first screen target antigen, obtain the epi-position collection of illustrative plates by high-resolution immune Study of recognition.Carry out functional screening with multiple killer T cell experiment, choose combination with strong immunogenic one group of epi-position.Be aided with certain side these epi-positions that are linked in sequence and resolve into effective polypeptide fragment to guarantee in eukaryotic cell, can process.Method by chemosynthesis obtains this molecule.

The antigenic determinant that the present invention selects for use is:

Pre-S2 B cell antigen determinant:

S26-Asn?Ser?Asn?Asn?Pro?Asp?Trp?Asp?Phe

(SEQ?ID?NO.2)

The killer T cell antigenic determinant:

1, cAg HBcAg killer T cell antigenic determinant:

C18-Phe?Leu?Pro?Ser?Asp?Phe?Phe?Pro?Ser?Val

(SEQ?ID?NO.3)

2, surface antigen HBsAg killer T cell antigenic determinant:

①S183-Phe?Leu?Leu?Thr?Arg?Ile?Leu?Thr?Ile

(SEQ?ID?NO.4)

②S177-Val?Leu?Gln?Ala?Gly?Phe?Phe?Leu?Leu

(SEQ?ID?NO.5)

③S348-Gly?Lue?Ser?Pro?Thr?Val?Trp?Leu?Ser

(SEQ?ID?NO.6)

④S371-Ile?Leu?Ser?Pro?Phe?Leu?Pro?Leu?Leu

(SEQ?ID?NO.7)

Above antigenic determinant shows to have very strong immunogenicity by zoopery, the amino acid sequence of polypeptide of design is SEQ ID NO.8, according to amino acid sequence of polypeptide, designs its nucleotides sequence and classifies SEQ IDNO.9 as.

Embodiment 2 construction of recombinant plasmid

The eukaryon expression plasmid pVAX1 of the structure nucleic acid vaccine of present embodiment is available from American I nvitrogene company.The present invention adopts RT-PCR, enzyme action, connection, conversion and sequencing equimolecular biological experimental method, with reference to U.S.'s Sa nurse Brooker work " molecular cloning " second edition.

1. the preparation of genes of interest:

1) with the synthesizing single-stranded oligonucleotide fragment of chemical synthesis, its sequence is:

S1.

TTAAGCCACCATGGATAAGGCCAAGTTCGTGGCTGCCTGGACCCTGAAGGCTGCCGC

TTTCCTG

S2.

CCTAGCGATTTCTTTCCTAGCGTGAAGATCTTGAGTCCCTTTTTACCTCTAT

TAAAGTTCTTGTTGACAAG

S3.

AATCCTCACAATAAACTCAAACAATCCAGATTGGGACTTCAGAGTGTTACAGGCGGG

GTTTTTCTTGTTG

S4.

ACAAGAATCCTCACAATACCGCAGTTCGTAGGGCTTTCCCCCACTGTTTGGCTTTCAT

TATAAGAATCTTGAGTCCCTTTTTACCTCTTATTATTG

A1.

AGCGGCAGCCTTCAGGGTCCAGGCAGCCACGAACTTGGCCTTATCCATGGTGGC

A2.

AACAAGAACTTTAATAGAGGTAAAAAGGGACTCAAGATCTTCACGCTAGGAAAGAA

ATCGCTAGGCAGGAA

A3.

AAAAACCCCGCCTGTAACACTCTGAAGTCCCAATCTGGATTGTTTGAGTTTATTGTG

AGGATTCTTGTC

A4.

AATTCATAATAGAGGTAAAAAGGGACTCAAGATTCTTATAACTGAAAGCC

AAACAGTGGGGGAAAGCCCTACGAACTGCGGTTATTGTGAGGATTCTTGTC

AACAAG

2) with above-mentioned four pairs of two complementary oligonucleotide (S1+A1, S2+A2, S3+A3 and S4+A4) annealing respectively according to a conventional method.Then the annealing product behind four kinds of purification is connected with T4 dna ligase (U.S. NEB company product), obtain the target gene fragment of recombinating.

The component of DNA coupled reaction comprises:

Dna fragmentation 14ul after the annealing

5 * dna ligase buffer 4ul

T4 dna ligase 2ul

Behind the mixing, put 37 ℃ of water-bath 1.5h (hour), add dehydrated alcohol 50ul (microlitre) then, put in-70 ℃ and spend the night, with the maximum centrifugal force be the centrifugal 15min of 12000g (acceleration of gravity) (minute), get precipitation, 70% ethanol, the 200 μ l that add pre-cooling again, mixing, the same method is centrifugal, getting precipitation is suspended in TE (10mmo/L TrisCl (pH8.0), 1mmol/L EDTA (the pH8.0)) buffer of 20 μ l pH8.0.

2. eukaryon expression plasmid pVAX1 digests (U.S. NEB company product) with restriction endonuclease EcoRI and AlfII, and digestion product and splicing product carry out agarose gel electrophoresis and purification.Product with two kinds of purification connects with T4 dna ligase (U.S. NEB company product) then, obtains recombiant plasmid.

The component of DNA coupled reaction comprises:

pVAX1/EcoRI+AlfII?????????????????????????1ul

Splicing product 7ul

10 * dna ligase buffer 1ul

T4 dna ligase 1ul

3. the conversion of recombiant plasmid and evaluation

CaCl ₂Method transformed into escherichia coli DH ^{5 α}, specific embodiments is: earlier the host bacterium is added the 5mlLB culture fluid (contain 1% tryptone, 0.5% yeast extract and 1% sodium chloride, pH7.0) in, 37 ℃ of shaken cultivation are to OD ₆₀₀Value is 0.4 o'clock, and 4 ℃ of 5000rpm (commentaries on classics per minute) are centrifugal, collects the host bacterium; Ice the CaCl of ready-formed 100mmol/L (mM/liter) with 40ml ₂Solution is resuspended, ice bath 30 minutes; Centrifugal down with 4 ℃ of the rotating speeds of 5000rpm again, collect the host bacterium; Ice the CaCl of the 100mmol/L of pre-cooling with 1-2ml ₂Solution is resuspended, and it is standby to make competent cell.After getting 200 μ l competent cells and 2 μ l being connected the product mixing, ice bath 30 minutes, 42 ℃ of heat treatments 45 seconds, ice bath 2 minutes, the LB culture fluid that adds 800 μ l in 37 ℃ of cultivations 1 hour, is got 200 μ l converted products and is coated on the LB agar plate that contains kanamycin, cultivated 12-16 hour for 37 ℃, screening obtains the bacterial clone at recombiant plasmid pUV-3 place.After this bacterial strain amplification, the alkaline lysis extracting and purifying with classical can obtain recombiant plasmid pUV-3.Recombiant plasmid is carried out that enzyme action is identified and inserts fragment and carry out sequence analysis, and the result shows: the dna vaccination after purified is a size about 3.2k, behind EcoRI and AlfII double digestion, is 0.3 and two bands of 2.9k size; Sequencing result and designing requirement meet fully, show PUV-3 plasmid construction success (see figure 2).Its DNA sequence is SEQ ID NO.1.

4. fermentation culture contains the engineering bacteria of chronic hepatitis B therapeutic DNA vaccine:

To treat that with inoculating loop culture of bacteria draws to the LB agar plate that contains kanamycin, in 37 ℃ of overnight incubation.Picking list bacterium is inoculated in 5ml and contains in the LB culture fluid of kanamycin from solid medium, and concussion is cultivated (250r/min) and spent the night in 37 ℃ of air shaking tables; Next day, the LB culture fluid that 400ml is contained kanamycin is put into the conical flask of 2L, add the above-mentioned bacterium that spends the night of 1.2ml, after cultivating 5-8h, 37 ℃ of concussions are inoculated in the fermentation tank as seed liquor, fermentation medium is the solution that basal medium adds trace element, 37 ℃ of fermentation temperatures, pH value 7.0, the control dissolved oxygen is not less than 30%, and thalline OD value stops fermentation (12-16h) after rising to plateau.The results culture fluid, centrifugal collection thalline.

5. purifies and separates obtains the chronic hepatitis B therapeutic DNA vaccine:

PlasmidSelect with Amersham Biosciences company carries out purification.Behind the broken bacterium of alkaline lysis, remove RNA, exchange buffering liquid with Sepharose6 FF chromatographic column earlier.The special absorption super coiled DNA of reuse PlasimdSelect (ccc) .PlasimdSelect be a kind of be the gel of pedestal with Sepharose 6FF, covalent bond 2 sulfenyl pyrimidines on Sepharose 6FF.This gel is under 2M ammonium sulfate condition, and specific bond ccc does not combine with oc.Thereby improve the purity of ccc.The 3rd step adopted Source 30Q chromatographic column to remove endotoxin and concentrated plasmid.

To be processed into the injection plasmid through 1 * PBS (phosphate buffer) through spissated plasmid.

The immunogenicity of embodiment 3 antigenic determinants is analyzed (see figure 3):

S371 polypeptide and C18 polypeptide are dissolved in the PBS buffer, and making its concentration is 1mg/ml.With adding the 0.5mg/ml polyinosini as the polypeptide immune HLA-A2 transgenic mice of adjuvant three times, in age in 8-10 week, each 50 μ g are every biweekly, last is injected and was got mouse boosting cell in back ten days, discharges its immunogenicity of lethal measuring by external 4 hours chromium.Experimental result confirms S371 polypeptide group and the specific identification of energy of C18 polypeptide group mice immunized T cell and kills and wounds the target cell that has corresponding polypeptide, and the matched group polypeptide can not (see figure 3).

The immunogenicity analysis of embodiment 4 nucleic acid vaccines (seeing Fig. 4 and Fig. 5):

With the recombiant plasmid of embodiment 1 immunity HLA-A2 transgenic mice three times, age in 8-10 week, each 50 μ g, every biweekly, last is injected and was got mouse boosting cell in back ten days, by enzyme mark analyzing and testing, and the immunogenicity of CFSE (carbon oxygen fluorescence) lethal its nucleic acid vaccine of measuring of labelling in external 4 hours chromium release experiment and the body.Result of the test confirms the mouse T cell specific identification of energy of nucleic acid vaccine immunity and the target cell that removing has the HBV polypeptide and transformed by hepatitis B surface protein D NA.With recombiant plasmid p-UV3 immunity HLA-A2 transgenic mice, get its splenocyte after 14 days and find the specially secretion (see figure 6) of inducing IFN-γ of property of p-UV3 through the release of cytokines measuring.

The vivoexpression of embodiment 5 hepatitis B nucleic acid vaccines

With the experiment of high degree of specificity and susceptiveness detect transfection the cell of plasmid DNA in the expression of mRNA level, promptly test the mRNA of quantitative transfection to the plasmid DNA of HEK 293T cell to measure the expression product of plasmid DNA with RT-PCR.

Earlier the PUV-3 plasmid sample that changes purification with transfection reagent box Lipofectamine 2000 (Invitrogen) (ATCC) to the HEK 293T cell stops transfection after 48 hours, harvesting.Cell lysates Qiagen ' s Oligotex mini-kit separation and purification mRNA.Transcribe with Superscript III reverse transcription (Invitrogen) and to obtain the mRNA sample.Get the total RNA of 10 μ g, in 50 μ l volumes, do reverse transcription, reverse transcription primer 01ig-dT12-18.5 μ g/ml, dNTP 500mM, 10,000U/ml M-MLV, 37 ℃ 1 hour, transcriptase is turned in 75 ℃ of deactivations in 15 minutes, gets 1 μ l and transcribes the cDNA that obtains

Reverse transcription product is made template and make PCR in the volume of 50 μ l.Primer sequence is as follows:

Forward primer (RT 5 ') CGTTTAAACTTAAGCCAC and ATGGATAAGGCCAAGTTC

Downstream primer (RT3 ') AGAGGTAAAAAGGGACTC

PCR reaction system: DEPC water 39 μ l, 10XPCR buffer conditions 5 μ l, MgCl ₂1 μ l (50mM), dNTP 10mM, 1 μ l, each 1 μ l of upstream and downstream primer, taq archaeal dna polymerase 1 μ l, totally 50 μ l

The pre-degeneration of PCR reaction condition: cDNA 94 ℃-2min of 1 μ l, 94 ℃-15sec; 57 ℃-30sec; 72 ℃-30sec circulation 31 times; 72 ℃-5min annealing; Deposit for 4 ℃.

Get 10 μ l response samples and do the electrophoresis evaluation.

The right cells in vitro of the commentaries on classics of the hepatitis B nucleic acid vaccine of table 1. polyvalent antigen determinant is expressed

Cell lysate	The expression of mRNA
		The HEK cell lysate	-
The HEK-pUV3 cell lysate	+++

Above result shows that the nucleic acid vaccine that we design and make up is the inducing cell immunne response effectively.Because vaccine contains the B cell antigen determinant, this vaccine can produce neutrality antibody, induces certain humoral immunization.Therefore, it has an important potential using value clinical.

Hepatitis B gene vaccine of the present invention has following characteristics:

1. with the approach such as intramuscular injection, intracutaneous injection inoculations nucleic acid vaccine, be immunization method easily, the T cell immunity that can induce many antigens of anti-HBV reply and in and antibody.

2. take synthetic fusion gene as the basis, carry out again suitable modification, transformation, can carry out to the hepatitis B patient in the different course of disease stage specific aim immunity treatment.

3. above immunization method can surpass present restructuring hepatitis B vaccine aspect the prevention HBV infection, overcomes part population to the reactionless and hypoergia of restructuring hepatitis B vaccine, these crowds great using value is arranged.

4. the HBV antigen fusion gene being carried out protokaryon or eucaryon expresses; as recombinant vaccine, its immanoprotection action will and can induce strong T cell immunity to reply at chronic hepatitis B patient above the restructuring hepatitis B vaccine that has used at present with the recombinant antigen of purifying.

5. with near the approach lymph node, injected inoculation nucleic acid vaccine, be a kind of effectively immunization method, during the T cell immunity that can induce efficiently many antigens of anti-HBV is replied and antibody

Hepatitis B nucleic acid vaccine of the present invention can be for the preparation of the preparation of hepatitis b precaution, treatment hepatitis B vaccine. As can be for the preparation of the preparation for the treatment of chronic type b hepatitis vaccine.

＜110〉Zhuhai United Laboratories Ltd

＜120〉a kind of hepatitis B nucleic acid vaccine, its preparation method and application thereof

<160>9

<170>PatentIn?Version?3.1

<210>1

<211>2955

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>

gactcttcgc?gatgtacggg?ccagatatac?gcgttgacat?tgattattga?ctagttatta?60

atagtaatca?attacggggt?cattagttca?tagcccatat?atggagttcc?gcgttacata?120

acttacggta?aatggcccgc?ctggctgacc?gcccaacgac?ccccgcccat?tgacgtcaat?180

aatgacgtat?gttcccatag?taacgccaat?agggactttc?cattgacgtc?aatgggtgga?240

ctatttacgg?taaactgccc?acttggcagt?acatcaagtg?tatcatatgc?caagtacgcc?300

ccctattgac?gtcaatgacg?gtaaatggcc?cgcctggcat?tatgcccagt?acatgacctt?360

atgggacttt?cctacttggc?agtacatcta?cgtattagtc?atcgctatta?ccatggtgat?420

gcggttttgg?cagtacatca?atgggcgtgg?atagcggttt?gactcacggg?gatttccaag?480

tctccacccc?attgacgtca?atgggagttt?gttttggcac?caaaatcaac?gggactttcc?540

aaaatgtcgt?aacaactccg?ccccattgac?gcaaatgggc?ggtaggcgtg?tacggtggga?600

ggtctatata?agcagagctc?tctggctaac?tagagaaccc?actgcttact?ggcttatcga?660

aattaatacg?actcactata?gggagaccca?agctggctag?cgtttaaaca?attctgcaga?720

tatccagcac?agtggcggcc?gctcgagtct?agagggcccg?tttaaacccg?ctgatcagcc?780

tcgactgtgc?cttctagttg?ccagccatct?gttgtttgcc?cctcccccgt?gccttccttg?840

accctggaag?gtgccactcc?cactgtcctt?tcctaataaa?atgaggaaat?tgcatcgcat?900

tgtctgagta?ggtgtcattc?tattctgggg?ggtggggtgg?ggcaggacag?caagggggag?960

gattgggaag?acaatagcag?gcatgctggg?gatgcggtgg?gctctatggc?ttctactggg?1020

cggttttatg?gacagcaagc?gaaccggaat?tgccagctgg?ggcgccctct?ggtaaggttg?1080

ggaagccctg?caaagtaaac?tggatggctt?tctcgccgcc?aaggatctga?tggcgcaggg?1140

gatcaagctc?tgatcaagag?acaggatgag?gatcgtttcg?catgattgaa?caagatggat?1200

tgcacgcagg?ttctccggcc?gcttgggtgg?agaggctatt?cggctatgac?tgggcacaac?1260

agacaatcgg?ctgctctgat?gccgccgtgt?tccggctgtc?agcgcagggg?cgcccggttc?1320

tttttgtcaa?gaccgacctg?tccggtgccc?tgaatgaact?gcaagacgag?gcagcgcggc?1380

tatcgtggct?ggccacgacg?ggcgttcctt?gcgcagctgt?gctcgacgtt?gtcactgaag?1440

cgggaaggga?ctggctgcta?ttgggcgaag?tgccggggca?ggatctcctg?tcatctcacc?1500

ttgctcctgc?cgagaaagta?tccatcatgg?ctgatgcaat?gcggcggctg?catacgcttg?1560

atccggctac?ctgcccattc?gaccaccaag?cgaaacatcg?catcgagcga?gcacgtactc?1620

ggatggaagc?cggtcttgtc?gatcaggatg?atctggacga?agagcatcag?gggctcgcgc?1680

cagccgaact?gttcgccagg?ctcaaggcga?gcatgcccga?cggcgaggat?ctcgtcgtga?1740

cccatggcga?tgcctgcttg?ccgaatatca?tggtggaaaa?tggccgcttt?tctggattca?1800

tcgactgtgg?ccggctgggt?gtggcggacc?gctatcagga?catagcgttg?gctacccgtg?1860

atattgctga?agagcttggc?ggcgaatggg?ctgaccgctt?cctcgtgctt?tacggtatcg?1920

ccgctcccga?ttcgcagcgc?atcgccttct?atcgccttct?tgacgagttc?ttctgaatta?1980

ttaacgctta?caatttcctg?atgcggtatt?ttctccttac?gcatctgtgc?ggtatttcac?2040

accgcataca?ggtggcactt?ttcggggaaa?tgtgcgcgga?acccctattt?gtttattttt?2100

ctaaatacat?tcaaatatgt?atccgctcat?gagacaataa?ccctgataaa?tgcttcaata?2160

atagcacgtg?ctaaaacttc?atttttaatt?taaaaggatc?taggtgaaga?tcctttttga?2220

taatctcatg?accaaaatcc?cttaacgtga?gttttcgttc?cactgagcgt?cagaccccgt?2280

agaaaagatc?aaaggatctt?cttgagatcc?tttttttctg?cgcgtaatct?gctgcttgca?2340

aacaaaaaaa?ccaccgctac?cagcggtggt?ttgtttgccg?gatcaagagc?taccaactct?2400

ttttccgaag?gtaactggct?tcagcagagc?gcagatacca?aatactgtcc?ttctagtgta?2460

gccgtagtta?ggccaccact?tcaagaactc?tgtagcaccg?cctacatacc?tcgctctgct?2520

aatcctgtta?ccagtggctg?ctgccagtgg?cgataagtcg?tgtcttaccg?ggttggactc?2580

aagacgatag?ttaccggata?aggcgcagcg?gtcgggctga?acggggggtt?cgtgcacaca?2640

gcccagcttg?gagcgaacga?cctacaccga?actgagatac?ctacagcgtg?agctatgaga?2700

aagcgccacg?cttcccgaag?ggagaaaggc?ggacaggtat?ccggtaagcg?gcagggtcgg?2760

aacaggagag?cgcacgaggg?agcttccagg?gggaaacgcc?tggtatcttt?atagtcctgt?2820

cgggtttcgc?cacctctgac?ttgagcgtcg?atttttgtga?tgctcgtcag?gggggcggag?2880

cctatggaaa?aacgccagca?acgcggcctt?tttacggttc?ctgggctttt?gctggccttt?2940

tgctcacatg?ttctt??????????????????????????????????????????????????2955

<210>2

<211>9

<212>PRT

＜213〉hepatitis B virus

<400>Asn?Ser?Asn?Asn?Pro?Asp?Trp?Asp?Phe

1????????????????5

<210>3

<211>10

<212>PRT

＜213〉hepatitis B virus

<400>Phe?Leu?Pro?Ser?Asp?Phe?Phe?Pro?Ser?Val

1???????????????5

<210>4

<211>9

<212>PRT

＜213〉hepatitis B virus

<400>Phe?Leu?Leu?Thr?Arg?Ile?Leu?Thr?Ile

1???????????????5

<210>5

<211>9

<212>PRT

＜213〉hepatitis B virus

<400>Val?Leu?Gln?Ala?Gly?Phe?Phe?Leu?Leu

1???????????????5

<210>6

<211>9

<212>PRT

＜213〉hepatitis B virus

<400>Gly?Lue?Ser?Pro?Thr?Val?Trp?Leu?Ser

1?????????????????5

<210>7

<211>9

<212>PRT

＜213〉hepatitis B virus

<400>Ile?Leu?Ser?Pro?Phe?Leu?Pro?Leu?Leu

1????????????????5

<210>8

<211>94

<212>PRT

＜213〉artificial sequence

<220>

<221>misc-feature

<400>

Met?Asp?Lys?Ala?Lys?Phe?Val?Ala?Ala?Trp?Thr?Leu?Lys?Ala?Ala?Ala

1??????????????5???????????????????10??????????????????15

Phe?Leu?Pro?Ser?Asp?Phe?Phe?Pro?Ser?Val?Lys?Ile?Leu?Ser?Pro?Phe

20??????????????????25??????????????????30

Leu?Pro?Leu?Leu?Lys?Phe?Leu?Leu?Thr?Arg?Ile?Leu?Thr?Ile?Asn?Ser

35??????????????????40??????????????????45

Asn?Asn?Pro?Asp?Trp?Asp?Phe?Arg?Val?Leu?Gln?Ala?Gly?Phe?Phe?Leu

50??????????????????55??????????????????60

Leu?Thr?Arg?Ile?Leu?Thr?Ile?Pro?Gln?Val?Gly?Lue?Ser?Pro?Thr?Val

65??????????????????70??????????????????75??????????????????80

Trp?Leu?Ser?Val?Ile?Ile?Leu?Ser?Pro?Phe?Leu?Pro?Leu?Leu

81??????????????85??????????????????90

<210>9

<211>294

<212>DNA

＜213〉artificial sequence

<220>

<221>misc-feature

<400>

ttaagccacc?atggataagg?ccaagttcgt?ggctgcctgg?accctgaagg?ctgccgcttt?60

cctgcctagc?gatttctttc?ctagcgtgaa?gatcttgagt?ccctttttac?ctctattaaa?120

gttcttgttg?acaagaatcc?tcacaataaa?ctcaaacaat?ccagattggg?acttcagagt?180

gttacaggcg?gggtttttct?tgttgacaag?aatcctcaca?ataccgcagg?tagggctttc?240

ccccactgtt?tggctttcag?ttataatctt?gagtcccttt?ttacctctat?tatg???????294

Claims (6)

1, a kind of hepatitis B nucleic acid vaccine for adopting pharmaceutically acceptable eukaryon expression plasmid, is selected the gene order of a plurality of antigenic determinants of coding for use, and the multi-epitope gene vaccine of structure is characterized in that the antigenic determinant of selecting for use is: SEQ ID NO.2～7.

2, a kind of hepatitis B nucleic acid vaccine according to claim 1, the gene order that it is characterized in that a plurality of antigenic determinants of said coding are SEQ ID NO.9.

3, a kind of hepatitis B nucleic acid vaccine according to claim 1 is characterized in that said eukaryon expression plasmid is pVAX1, and the nucleic acid vaccine of structure is pUV-3, and its gene order is SEQ ID NO.1.

4, require the preparation method of 1 described hepatitis B nucleic acid vaccine according to profit, may further comprise the steps:

1) chooses a plurality of antigenic determinants, design polyvalent antigen determinant polypeptide;

2) with the synthesizing single-stranded oligonucleotide fragment of chemical synthesis, be connected, obtain the target gene fragment of recombinating with the T4DNA ligase;

3) use the digestion with restriction enzyme plasmid vector, digestion product is connected with ligase with the reorganization target gene fragment;

4) plasmid is transformed in the escherichia coli,, produces the engineering bacteria that contains dna vaccination with the method for fermentation culture;

5) with the method for business-like chromatographic column by affinity chromatograph, separation and purification 4) in bacterial lysate, obtain spissated plasmid.

5, hepatitis B nucleic acid vaccine according to claim 1 is used to prepare the preparation for the treatment of Hepatitis B virus vaccine.

6, hepatitis B nucleic acid vaccine according to claim 5 is used to prepare the preparation for the treatment of Hepatitis B virus vaccine, it is characterized in that this vaccine is used for preparation treatment chronic viral hepatitis B bacterin preparation.

Images