CN1680601A - Micro-satellite triple PCR family identification of China peneid - Google Patents

Abstract

The invention belongs to molecular genetic breeding technology for agricultural part. Augment parameter for three micro-satelloid primers in one PCR reaction system is obtained by adjusting PCR reaction system and using Touch-down PCR reaction process. Then ternary PCR technology is found.

Description

Crustin micro-satellite triple PCR family recognition technology

1 technical field the invention belongs to the molecular biology part in the biology, and concrete is the molecule ancillary technique of a genetic breeding, is at the cultivation of Crustin family and the family molecular recognition technology of developing;

2 background technology the present invention have mainly utilized three micro-satellite primers RS1101, RS0683 and H081, relate to the development technique of these three micro-satellite primers, are that we develop at the design of the tumor-necrosis factor glycoproteins in the Crustin genome random sequencing sequence.

The sequence of three micro-satellite primers of 3 primer sequences is as follows:

RS1101 forward sequence is CGAGTGGCAGCGAGTCCT, and reverse sequence is TATTCCCACGCTCTTGTC

RS0683 forward sequence is ACACTCACTTATGTCACACTGC, and reverse sequence is TACACACCAACACTCAATCTCC

H081 forward sequence is ACAAACACATTCTGTCCATT, and reverse sequence is GATAGAGAGGTCAACAAACG

4 summary of the invention make up this three primers, by adjusting the PCR reaction system, obtained the parameter that these three primers can increase simultaneously in same PCR reaction system, these parameters are: 10*Buffer 2.5 μ l (include 20mM Tris-HCl, 100mM KCl, 0.1mMEDTA, 1mM DTT, 0.5% Tween20), MgCl ₂2.5 μ l (2.5mM), dNTP 2.0 μ l (2.5mM), template DNA 2 μ l (50ng/ μ l), ddH ₂O 12.1 μ l, Taq archaeal dna polymerase 0.4 μ l (5U/ μ l), forward and reverse each the 1.0 μ l of primer RS1101, forward and reverse each the 1.5 μ l of primer RS0683, forward and reverse each the 2.0 μ l of primer H081.The program that reaction is adopted is a Touch-down PCR program: carry out following procedure behind 94 ℃ of sex change 5min, circulation 1; 94 ℃ of sex change 40S, 66 ℃ of annealing 1min, 72 ℃ are extended 1min, totally 6 circulations; Circulate 2 subsequently; 94 ℃ of sex change 40S, 66 ℃ of annealing 1min, each circulation reduces by 0.5 ℃, and 72 ℃ are extended 1min, carry out 12 circulations; The 3:94 ℃ of sex change 40S that circulate again, 60 ℃ of annealing 1min, 72 ℃ are extended 1min, totally 14 circulations.Last 72 ℃ are extended 10min..

5 technical indicator RS1101 gene locuss have 6 allelotrope, the RS0683 gene locus has 8 allelotrope, the H081 gene locus has 11 allelotrope, the parentage exclusion probability of Zu He this triple PCR technology (the accumulation parentage exclusion probabilities of three primers) is 0.9679 thus, and individual recognition power is 0.999327

6 description of drawings

Fig. 1 is the amplification figure of RS1101 primer in 30 individualities, two allelotrope of the arrow among the figure has been indicated respectively the longest (No. 4 individualities) and the shortest (No. 27 individualities).

Fig. 2 is the amplification figure of RS0683 primer in 30 individualities, two allelotrope of the arrow among the figure has been indicated respectively the longest (No. 8 individualities) and the shortest (No. 23 individualities).

Fig. 3 is the amplification figure of H081 primer in 30 individualities, two allelotrope of the arrow among the figure has been indicated respectively the longest (No. 5 individualities) and the shortest (No. 1 individuality).

Fig. 4 is by RS1101, the triple PCR technology that three micro-satellite primers of RS0683 and H081 combine is to male (♂) in 35191 familys and female (♀) parent and 10 " filial generation " individual amplification thereof, arrow has been indicated RS1101 from top to bottom respectively among the figure, the amplification of three primers of RS0683 and H081 in two parents, 1-10 is two parents' doubtful filial generation, wherein No. 10 individualities are identified the offspring who is not these two parents by this triple PCR technology, because it does not meet the Mendelian inheritance law of segregation of parent at these three microsatellite locus.This figure has illustrated that this triple PCR technology is of very high actual application value.

7 ranges of application can be passed through this triple PCR technology, Chinese bright through on three microsatellite locus of the disposable acquisition of pcr amplification of usual manner The hereditary information of prawn individuality, and then come they are distinguished and identify by the difference of this hereditary information that shows between these Different Individual. As Fruit is used in the parentage identification, and after the hereditary information of three microsatellite locus that obtained parent (Parent), we just can be to the offspring who raises together with Whether carry out genetic analysis, determining or getting rid of these offsprings is offspring individuals of the parent that detects.

Claims (2)

1, the implementation sequence of the sequence of three primers: RS1101 is: the forward sequence is CGAGTGGCAGCGAGTCCT, and reverse sequence is TATTCCCACGCTCTTGTC; RS0683, the forward sequence is ACACTCACTTATGTCACACTGC, reverse sequence is TACACACCAACACTCAATCTCC; H081 primer, forward sequence are ACAAACACATTCTGTCCATT, and reverse sequence is GATAGAGAGGTCAACAAACG, require not strive to such an extent that we agree and authorize, and must not directly use or change the sequence title and use in any public occasion.

2, the triple PCR technology of protecting RS1101, RS0683 and three combination of primers of H081 to form is authorized and agreement without us, must not utilize this triple PCR technology to carry out any fundamental research or applied research.

Images