CN1680450A - Fusion protein, coding gene and use thereof - Google Patents

Abstract

The invention opened a fused protein and its genes. The protein has the sequence of SEQ ID No: 2 or the sequence which has the same activity with the SEQ ID No:2. The fused protein will be the best choice to the cTnI detection system, it also can improve the standardization of the cTnI, and it has the good future for the application of industry.

Description

A kind of fusion rotein and encoding gene thereof and application

Technical field

The present invention relates to a kind of fusion rotein and encoding gene thereof and application, the fusion rotein of particularly a kind of human cardiac troponin I and TnC and encoding gene thereof and the application in human cardiac troponin I detects.

Background technology

Cardiac troponin (cTn, cardiac Troponin) molecule is spherical in shape, participates in regulating the muscle contraction movement.Cardiac troponin contains three subunits, i.e. cardiac troponin C (cTnC, cardiac TroponinC), cardiac muscle troponin I (cTnI, cardiac Troponin I) and serum cardiac troponin T (cTnT, cardiac TroponinT).The main effect of cTnC is to Ca in the sarcoplasm ²⁺Provide binding site, the activation thin filament; CTnI is the inhibition subunit of Actin muscle; The effect of cTnT is that whole troponin molecule is incorporated into actotropomyosin.When the myocardial cell was impaired, cTn can be released into from cell in the blood circulation, and existing method can detect cTnT and cTnI from periphery serum.

Early stage assess suspicious acute myocardial injury exactly and mainly depend on the sensitivity that is released into composition in the myocardial cell behind the blood, special detection by quantitative, need the fatal event of emergent management and the situation of no fatal threat with the difference potential, as acute myocardial infarction and NCCP such as maldigestion.It is also insensitive that early stage electrocardiogram(ECG variation had not both had specificity, and therefore, the clinician relies on the biochemical marker of cardiac muscular tissue to carry out early diagnosis for foundation gradually.At first, use be creatine kinase (CK) and MB isozyme (CK-MB), myohaemoglobin (Mb) became more sensitive myocardial damage early sign thing afterwards, so but owing to be subjected to the influence specificity of Skeletal muscle injury relatively poor.CTnI and cTnT be because of having higher myocardium specificity in recent years, and go into definite mark that blood becomes the diagnosis myocardial damage more already after the myocardial damage.

CTnI is as definite mark of diagnosis myocardial damage, and it is good to have specificity, highly sensitive advantage.Present American National medicine and food control office (FDA) be 16 kinds of cTnI detection reagent of approved (Ravkilde J.Riskstratificationin acute coronary syndrome using cardiac troponin I.Clin Chem at least, 2000,46:443-444), but different test kit tens of times difference can occur to the measurement result with a sample.The principal element that causes difference has: cTnI in human serum instability easily by protease hydrolysis; Different reagent place use monoclonal antibody at cTnI epi-position difference; The cTnI measuring method is learned different; Measure not equal (the Katrukha AG of cTnI existence form in the supporting correction product of reagent place, Bereznikova AV, Filatov VL, Esakova TV, Kolosova OV, Pettersson K, Lovgren T, Bulargina TV, Trifonov IR, GratsianskyNA, Pulkki K, Voipio-Pulkki LM, Gusev NB.Degradat ion of cardiac troponinI:implication for reliable immunodetection.ClinChem, 1998,44 (12): 2433-2440.Wu AH, Feng YJ, Moore R, Apple FS, McPherson PH, Buechler KF, Bodor G.Characterization of cardiac troponin subunitrelease into serum after acutemyocardial infarction and comparison of assaysfor troponin T and I.ClinChem1998; 44:1198-1208.Newman DJ, Olabiran Y, Bedzyk WD, et al.Impact ofantibody specificity and calibration material on the measure of agreementbetween methods for cardiac troponin I.Clin Chem, 1999,45:822-828 etc.).The stdn that solves cTnI mensuration is a problem demanding prompt solution with the difference of dwindling between each method measurement result.CTnI proofreaies and correct product and mostly is myocardium extract, and cTnI per-cent free and composite form is inequality and stable undesirable in the correction product, and the cTnI reference material of tracing to the source of preparation Stability Analysis of Structures, molecule homogeneous is the key of cTnI bioassay standardization.Canada scholar Liu SG (Liu S, Zhang MY, Gong Q, et al.Recombinant single chaincardiac troponin I-C polypeptides:superior calibration and controlmaterials for cardiac troponin I immunoassays.Clin Lab, 2001; 47 (1-2): 19-27) exist with the I-C composite form according to cTnI among the myocardial damage patients serum is many, and be difficult for by the characteristics of protease hydrolysis behind cTnI and the TnC formation mixture, Linker with one section codified neutral amino acids (mostly being glycine) polypeptide connects together I-C by engineered method, is used for the correction of cTnI detection system.They utilize the pET21 plasmid to obtain two kinds of fusion rotein ScTnI-C and ScTnI-C-2 that contain I and C at expression in escherichia coli, wherein ScTnI-C contains total length cTnI (totally 210 amino-acid residues) and TnC, but expressing the albumen that obtains exists with the inclusion body form, need elder generation's slow again renaturation after denaturing treatment to make protein folding again, carry out purifying then.Wherein renaturation process is comparatively complicated, and can metaprotein the correctly folding again influence that is subjected to many factors, and difficulty is bigger.ScTnI-C-2 is that cTnI stablizes fragment (28-110 amino acid) and total length TnC binary complex, energy solubility expression in expressing bacterium, and protein stability is better, and the correction that is used for cTnI has effect preferably.But this binary complex can only be done the product of correction for the monoclonal antibody detection reagent of discerning this district's epi-position.

For guaranteeing to measure between the laboratory result's comparability, the stdn of Interventions Requested comprises that methodological stdn and tracing to the source of thing of correction are subjected to great attention, the correction product of cTnI immunologic assay are traced to the source nowhere at present, and this is because still there is not the reference material of generally acknowledging at present.Ideal cTnI reference substance or standard substance should uniform component, stable, no matrix effect also at least can be by the antibody recognition in all reagent.Yet natural cTnI standard substance are very unstable, and the product of proofreading and correct are in the calibration that must finish instrument after the dissolving in very short time, and this kind proofreaied and correct the not reproducible use of product.Someone attempts producing separately I, C subunit, externally then makes the two in conjunction with to prepare stable cTnI standard substance.But in such cases, I and C bonded what, not only depend on subunit's concentration separately, also be subjected to Ca ²⁺The influence of concentration (QinWei Shi, Mingfu Ling, Xiaochen ZHang, et al.Degredation of cardiactroponin I in serum complicates comparisons of cardiac troponin I assays.ClinChem.1999; 45 (7): 1018-1025.).Liu SG etc. are used for the calibration that some cTnI measure systems with ScTnI-C-2 and have obtained effect preferably, but ScTnI-C-2 remains in the deficiency that can not be discerned by all reagent.

Because cTnI measures the reference material that system does not still have ideal, so the standard substance and the quality control product of each test macro are traced to the source nowhere, hindered the standardized process that cTnI measures, therefore need to produce the good internationally recognized reference material of traceability, also cTnI measures the system calibration product and quality control product provides ideal to select material in order to prepare simultaneously, solves the difficult point in the standardization effort.

The innovation and creation content

The fusion rotein and the encoding gene thereof that the purpose of this invention is to provide a kind of human cardiac troponin I and TnC.

The fusion rotein of human cardiac troponin I provided by the present invention and TnC, name is called cTnI-C, be to have SEQ ID № in the sequence table: the protein of 2 amino acid residue sequences, or with SEQ ID №: 2 amino acid residue sequence is through replacement, disappearance or the interpolation of one or several amino-acid residue and have the № with SEQ ID: 2 amino acid residue sequence is identical active by SEQ ID №: 2 deutero-protein.

The protein that the amino acid residue sequence of sequence 2 is made up of 411 amino-acid residues in the sequence table.

The fusion rotein encoding gene of human cardiac troponin I and TnC, name is called cTnI-C, is one of following nucleotide sequences:

1) SEQ ID № in the sequence table: 1 dna sequence dna;

2) SEQ ID № in the code sequence tabulation: the polynucleotide of 2 protein sequences;

3) with sequence table in SEQ ID №: 1 dna sequence dna that limits has 95% above homology, and the identical function protein DNA sequence of encoding.

The dna sequence dna of sequence 1 is by 1236 based compositions in the sequence table, and the open reading frame of this gene is from 5 ' end the 1st to the 1236th bit base; From the sequence of 5 ' end the 13rd to the 30th bit base for 6 Histidines of coding; From 5 ' end the 61st to the 690th bit base is the encoding sequence of human cardiac troponin I, 210 amino acid of encoding; From the sequence of 5 ' end the 691st to the 750th bit base for coding connection peptides (Linker), 20 amino acid of encoding; From 5 ' end the 751st to the 1233rd bit base is the encoding sequence of human cardiac troponin C, 161 amino acid of encoding.

Contain expression carrier of the present invention and clone and all belong to protection scope of the present invention.

Increase arbitrary segmental primer in this fusion rotein encoding gene to also within protection scope of the present invention.

The inventor joins end to end cTnI and the cTnC gene Linker sequence with one section codified small peptide by engineered method, made up the prokaryotic expression system of total length cTnI-C fusion rotein, and finally in intestinal bacteria, obtained the stable meltable that the N end has histidine-tagged total length cTnI-C fusion rotein and express, shake that expression amount reaches 11mg/L in the bottle.This fusion rotein has histidine-tagged and solubility expression, makes the quick and easy easy row of purge process, through a step Ni ²⁺-Sepharose post carries out affinitive layer purification, and to reach PAGE pure, and can be by all cTnI detection reagent identification, overcome many and a kind of can not the identification of two kinds of IC fusion rotein purification steps that Liu SG etc. obtains, a kind of deficiency that is difficult to purifying for inclusion body by all reagent.Experimental results show that to place serum matrix to hatch for 37 ℃ fusion rotein of the present invention, content only descends 8% behind the 48h, is better than the stability (48h after content descend 50%) of ScTnI-C-2 in serum matrix.

Fusion protein molecule amount of the present invention is 46.1kD, iso-electric point is 5.41, advantage with the easy purifying of good stability, and can be by all cTnI detection reagent identification, this albumen contains the cTnI sequence of total length, may become candidate's reference material that cTnI measures system, the magnitude tracing that is used for various cTnI reagent calibration objects and Quality Control thing, also can become the ideal of producing cTnI detection reagent calibration object and Quality Control thing selects, the standardized process of cTnI detection method will be advanced greatly, and can be used as the production domesticization work that antigen prepd antibody is used for the cTnI detection reagent, have wide prospect in industrial application.

Description of drawings

Fig. 1 total RNA agarose gel electrophoresis of cardiac muscle of behaving is identified collection of illustrative plates

Fig. 2 is that cTnI and cTnC PCR product agarose gel electrophoresis are identified collection of illustrative plates

Fig. 3 is the physical map of pPIC9 plasmid

Fig. 4 is the physical map of pET15b plasmid

Fig. 5 is that cTnI-C PCR product is identified collection of illustrative plates

Fig. 6 is the SDS-PAGE electrophoretogram of the expression product of cTnI-C in the host

Fig. 7 is the Western blot collection of illustrative plates of the expression product of cTnI-C in the host

Fig. 8 is the electrophoretogram of the cTnI-C fusion rotein of purifying

Embodiment

The expression of embodiment 1, cTnI-C and purifying

Material

1. carrier and bacterial classification: pPIC9 plasmid (available from Invitrogen company), pET-15b plasmid and BL21 (DE3) pLysS bacterial classification (available from Novagen company), Ecoli Top10F ' bacterial classification (available from Invitrogen company).

2. reagent and instrument: Snab I restriction endonuclease (Takara company), other restriction endonucleases commonly used (NEB company), pfu polysaccharase, T ₄Ligase enzyme (Promega company), reverse transcription test kit (GIBCO company), the anti-people cTnI of rabbit polyclonal antibody (Santa Cruz company), goat anti-rabbit igg/HRP (Sigma company), synthetic and the sequencing (Beijing AudioCodes company) of DNA, Acta-FPLC protein purification system (Amersham Pharmacia company).

One, the structure of cTnI-C

1, total RNA extracts:

1) gets under the 100mg of the fresh fetal cardiac muscular tissue low temperature of liquid nitrogen cryopreservation grind into powder in mortar, add 1ml TRIzol reagent mixing, move in the Ep pipe of a no RNA enzyme.

2) leave standstill and add chloroform 0.2ml behind the 5min, violent jolting 20sec leaves standstill 3min.

3) 4 ℃, the centrifugal 10min of 15000rpm.The part supernatant is transferred in the new Eppendorf tube, added Virahol 0.5ml.Put upside down mixing, room temperature leaves standstill 15min.

4) once more 4 ℃ centrifugal, 15000rpm, 15min.

5) remove supernatant, add 1ml 75% ethanol, 4 ℃ of centrifugal 1min of 15000rpm in the precipitation.Remove supernatant, be deposited in 37 ℃ of incubators dry.

6) add 20ul DEPC water (diethylpyrocarbonate) dissolving.Get 1ul and measure OD260 and OD280 absorbancy, calculate RNA concentration; Getting 5ul carries out 1% agarose gel electrophoresis and identifies that electrophoresis result as shown in Figure 1.

2, reverse transcription (obtaining the cDNA of cardiac muscular tissue)

1) gets the total RNA of the 5ul that obtains in the step 1, oligo dT (oligo (dT) ₁₅Primer) 1ul, 70 ℃ of heating 10min put cooled on ice behind the DEPC water 4ul mixing.

2) add

10 * PCR damping fluid 2ul

25mM?MgCl ₂ 2ul

10mM?dNTP 1ul

0.1M?DTT 2ul

The rearmounted 42 ℃ of 5min of mixing.

3) add SuperScript reversed transcriptive enzyme 1ul, 42 ℃ of reverse transcription 50min.

4) 70 ℃ of rearmounted cooled on ice of 15min inactivator.

5) add RNase H 1ul, 37 ℃ of 20min.Reverse transcription product (cDNA) is frozen in-20 ℃.

3, the preparation of cTnI, Linker and cTnC gene

(1) PCR primer and Linker sequence:

Multiple clone site design primer and Linker sequence according to the gene order of cTnI and cTnC and pPIC9 are as follows:

CTnI PCR primer (upstream and downstream is introduced Snab I and EcoR I restriction enzyme site respectively):

Upstream primer cTnI-UP 5 ' AT TACGTAATGGCGGATGGGAGCAGC 3 '

Downstream primer cTnI-DOWN 5 ' CCGAATTCGCTCTCAAACTTTTTCTTGCGGCC 3 ';

CTnC PCR primer (upstream and downstream is introduced Avr II and Not I restriction enzyme site respectively):

Upstream primer cTnC-UP 5 ' CCTAGGATGGATGACATCTACAAGGC 3 '

Downstream primer cTnC-DOWN 5 ' ACGTCTAGACTACTCCACACCCTTCATG 3 ';

The Linker sequence:

Positive-sense strand (5 ' and 3 ' end divides introducing EcoR I and Avr II restriction enzyme site), antisense strand (5 ' and 3 ' end is introduced Avr II and EcoR I restriction enzyme site respectively).Sequence is synthetic by AudioCodes company, and the cohesive end mode after restriction enzyme site is cut with enzyme respectively is synthetic:

5’--AATTCAGTGGTGGTGGTGGTTCTGGTGGGGGGGGTTCTGGTGGCGGTGGTTCTC------3’

3’------GTCACCACCACCACCAAGACCACCCCCCCCAAGACCACCGCCACCAAGAGGATC--5’。

(2) pcr amplification and purifying:

Pcr amplification carries out on PE2400 PCR instrument by following system.

1) amplification of cTnI gene

Amplification system (50ul):

$\left\{\begin{array}{cc}{H}_{2}O& 37.57\mathrm{ul}\\ \mathrm{dDTP}& 4\mathrm{ul}\\ \mathrm{cTnI}-\mathrm{<figure-callout\; id="1"\; label="up"\; filenames="A20041002997500152.png,A20041002997500161.png"\; state="\{\{state\}\}">up</figure-callout>}& 1\mathrm{ul}\\ \mathrm{cTnI}-\mathrm{<figure-callout\; id="1"\; label="down"\; filenames="A20041002997500152.png,A20041002997500161.png"\; state="\{\{state\}\}">down</figure-callout>}& 1\mathrm{ul}\\ \mathrm{pfuBffer}& 5\mathrm{<figure-callout\; id="1"\; label="ul\; cDNA"\; filenames="A20041002997500152.png,A20041002997500161.png"\; state="\{\{state\}\}">ul</figure-callout>}& \\ \mathrm{cDNA}& 1\mathrm{ul}\\ \mathrm{pfuase}& 0.43\mathrm{ul}\end{array}\right.$

The pcr amplification condition is as follows:

Product is accredited as (swimming lane 1 among Fig. 2) about 650bp through 1% agarose gel electrophoresis, and is consistent with expection.

2) amplification of cTnC gene

The same step 1) of method and condition, product is accredited as (swimming lane 2 among Fig. 2) about 500bp through 1% agarose gel electrophoresis, and is consistent with expection.Among Fig. 2, M is a dna molecular amount standard; 1 is cTnI PCR product; 2 is cTnC PCR product.

3) the PCR product is concentrated and purified:

The PCR product of the 4 pipe 50ul systems that will increase simultaneously is bonded to the 3M NaAc (pH5.2) that adds 1/10 volume in 1 Ep pipe, the dehydrated alcohol of 3 times of volumes, and mixing postposition-20 ℃ precipitation is about 30 '.15,000rpm is centrifugal 10 ', supernatant discarded adds 1ml75% ethanol, rotates gently cleaning tube wall, careful supernatant discarded, 15,000rpm centrifugal 5 ", blot the rearmounted 55 ℃ of dryings of supernatant, add 20ulTE dissolving and quantitatively.

4) preparation of double-stranded Linker

Get mole mixing such as Linker justice and antisense strand, 95 ℃ 5 ' after slowly reduce to room temperature and make it polymerization.

4, utilize the pPIC9 plasmid to connect the cTnI-Linker-cTnC gene

CTnI pcr amplification product behind the purifying and plasmid pPIC9 (its physical map as shown in Figure 3) are carried out double digestion with Snab I and EcoR I simultaneously, and 1% agarose electrophoresis separation and purification is at T ₄CTnI after under the effect of dna ligase enzyme being cut is connected with pPIC9, and the product after the connection is transformed among the intestinal bacteria Top10F ', and screening and enzyme are cut evaluation, and enzyme is cut and sent the order-checking of AudioCodes company, order-checking correct plasmid called after pPIC9+I after correct.Concrete steps are as follows:

(1) the competent preparation of Top10F ' (Calcium Chloride Method):

A. inoculate E.coli Top10F ' in the test tube that the LB liquid nutrient medium is housed, with aseptic platinum filament in 37 ℃ of overnight incubation;

B. get in the LB liquid nutrient medium that 100ul bacterium liquid is inoculated in about 10ml, be cultured to logarithmic phase in 37 ℃;

C. bacterium liquid is transferred to one aseptic, ice precooling the 50ml centrifuge tube in, ice put 5-10 minute.4 ℃ of 4000rpm are centrifugal 10 ';

D. pour out nutrient solution, residual nutrient solution was flow to end in 1 minute the pipe inversion;

E. ice the 0.1M CaCl of precooling with 10ml ₂Resuspended precipitation is positioned on ice, 4 ℃ of 4000 rev/mins of centrifugal 5-10 ';

F. pour out supernatant, residual nutrient solution was flow to end in 1 minute the pipe inversion;

G. ice the 0.1M CaCl of precooling with 2ml ₂Resuspended precipitation;

H.200ul/ prop up in the EP pipe that is sub-packed in 1.5ml precooling on ice, it is standby to put 4 ℃ of preservations.

(2) conversion of connection product:

A. the ligation product is added in the competence bacterium that a branch installs, rotate mixing gently, about 30 in transforming on ice ';

B.42 ℃ 90 " heat-shockeds;

C. rapidly test tube is transferred in the ice bath, make cell cooling 1 '-2 ';

D. (SOC prepares as follows: add Tryptones 12g, yeast extract 24g, NaCl 0.5g in 950ml water to add 800ul SOC substratum in the pipe.After the dissolving, add 250mM KCl 10ml and add water to 1L then, high pressure steam sterilization 20 minutes is reduced to about 60 ℃, adds the 2M MgCl of 5ml through sterilization ₂Solution and 20ml are through the 1M of degerming glucose solution.), 37 ℃ shake bacterium cultivate 60 ', make bacteria resuscitation;

E. get 100ul bacterium liquid, (LA prepares as follows: add Tryptones 10g in the 90ml water to coat LA, yeast extract 5g, NaCl 10g, agar powder 15g, after the dissolving, add entry to 100ml, high pressure steam sterilization 20 minutes is reduced to about 60 ℃, add 100mg/ml penbritin 100ul, bed board behind the mixing) in the culture dish;

F. be inverted culture dish, in 37 ℃ of overnight incubation.

(3) evaluation of bacterium colony (plasmid extraction)

A. the bacterium colony of picking white is inoculated in the glass test tube that 3ml LB is housed, and shakes bacterium and spends the night;

B. get 1ml bacterium liquid in the EP of 1.5ml pipe;

C. centrifugal, supernatant discarded;

D. centrifugal again, draw residual liquid;

E. add 200ul solution I (50mmol/L glucose, 25mmol/L Tris-Cl pH8.0,10mmol/L EDTApH8.0) and overhang precipitation;

F. add 200ul solution II (0.2M NaOH, 1%SDS) and put upside down mixing gently;

G. add 200ul solution III (5mol/L potassium acetate 60ml, glacial acetic acid 11.5ml, water 28.5ml) and put upside down mixing gently;

H.15,000rpm is centrifugal 10 ', supernatant is transferred in the 1.5ml EP pipe that is added with 0.6 times of volume Virahol, placed 10 minutes for 4 ℃ behind the mixing;

I.15,000rpm is centrifugal 10 ', supernatant discarded, the ethanol that adds 1ml 75% cleans tube wall;

J. centrifugal, supernatant discarded is in 55 ℃ of dryings;

K. contain the TE dissolving of RNase with 20ul;

L. with SnabI and EcoRI plasmid is carried out enzyme and cut evaluation.

Use the same method and cTnC PCR product is cut the back with AVrII and NotI enzyme insert and to contain in the pPIC9+I plasmid of cTnI.The pPIC9+I+C plasmid that has inserted cTnI and cTnC links to each other with Linker with behind EcoRI and the AVrII double digestion, obtain containing the plasmid vector pPIC9-IC of cTnI-Linker-cTnC gene, sequencing result shows that the fusion rotein encoding gene cTnI-C of human cardiac troponin I and TnC has SEQ ID № in the sequence table: 1 dna sequence dna; SEQ ID № in its code sequence tabulation: 2 aminoacid sequence.

Two, the expression of cTnI-C and purifying

1, construction of prokaryotic expression vector (choosing pET15b plasmid construction expression vector)

With the pPIC9-IC plasmid is template, and amplification cTnI-C gene carries out 1% agarose gel electrophoresis to the amplified production that obtains, and the result shows about the enzyme-added about 1200bp of length that cuts after site and the protection base as shown in Figure 5.Among Fig. 5, M is a dna molecular amount standard; 1 is the cTnI-CPCR product.According to a conventional method it is cloned between the multiple clone site Nde I and BamH I of pET15b (its physical map as shown in Figure 4), obtains prokaryotic expression carrier pET15-IC, enzyme is cut and is identified the order-checking of correct back.Wherein, cTnI-C amplimer (upstream and downstream is introduced Nde I and BamH I restriction enzyme site respectively) is: upstream 5 ' ATTACGTAATGGCCGATGGTAGCAGC 3 '; Downstream 5 ' TGGATCCCTACTCCACACCCTTCATG 3 '.

2, the abduction delivering of fusion rotein

The conversion of E.coli BL21 (DE3) pLysS and the abduction delivering of fusion rotein:

The pET15-IC plasmid is transformed the competence for preparing according to conventional Calcium Chloride Method expresses among bacterium E.coliBL21 (DE3) pLysS, bacterium liquid after the recovery is coated on the LB flat board that contains microbiotic (penbritin 100ug/ml and paraxin 17ug/ml) 37 ℃ of overnight incubation.The picking colony transferred species is cultivated in containing identical antibiotic LB liquid nutrient medium, and bacterial growth is about at 0.6 o'clock to OD600, and the adding final concentration is 0.5mmolL ^-1IPTG, under 25 ℃ of conditions, induce Expression of Fusion Protein.Induce and collect the bacterial precipitation carrying out ultrasonic bacteria breaking after 5 hours, centrifugal collection supernatant, on Access micropartical chemistry luminescence immunoassay instrument, detect cTnI content with the AccuTnI test kit, behind the broken bacterium of result after 40000 times of the supernatant dilutions measured result be 3.73ng/ml, (calculation formula: (supernatant liquor volume ml number behind 3.73 * extension rate * 1000ml)/broken bacterium) fusion protein expression can reach 11mg/L in shaking bottle as calculated.Simultaneously supernatant is carried out SDS-PAGE and Western-blot evaluation ((Santa Cruz company) is first antibody with the anti-people cTnI of rabbit polyclonal antibody, is that second antibody adopts indirect detection method to carry out the immunology detection of Western marking film with goat anti-rabbit igg/HRP (Sigma company)).The SDS-PAGE qualification result has the expression of target protein as shown in Figure 6 near 46kD, consistent with expection.Among Fig. 6, M is the low molecular weight protein (LMWP) standard, swimming lane 1-7 is the cracking supernatant liquor (band of arrow indication is a target protein) that IPTG induces the host bacterium that comprises recombinant plasmid pET15-IC after 1-7 hour, swimming lane 8 is not for comprising the lysis supernatant liquor of the host bacterium of plasmid pET-15b through the IPTG inductive, swimming lane 9 is for comprising the lysis supernatant liquor of the host bacterium of plasmid pET-15b through the IPTG inductive.The Western-blot qualification result shows in the cracking supernatant liquor of host bacteria to detect this fusion rotein, and is shown as single band as shown in Figure 7, no degradation fragment, and the illustration purpose protein stability is better.

3, warm proteic purifying

Utilize the Acta-FPLC protein purification system to carry out proteic purifying

Utilize pET15b as the carrier expressed fusion protein its N end have His-tag can with Ni ²⁺Therefore the specificity combination uses Ni ²⁺-Sepharose post carries out affinitive layer purification to fusion rotein, carry out the SDS-PAGE electrophoretic analysis behind the purifying, the result shows to obtain the pure cTnI-C fusion rotein of PAGE that the content of cTnI is 17.1ng/ml in 1000 times of rear fusion proteins of elutriant dilution after testing as shown in Figure 8.Among Fig. 8, M is the low molecular weight protein (LMWP) standard, and 1 wears component for stream, and 2 is elution fraction, i.e. target protein place part.Wherein, binding buffer liquid is 50mmol/L pH8.0 sodium phosphate buffer; Elution buffer is the 50mmol/L pH6.8 sodium phosphate buffer that contains imidazoles, carries out gradient elution; Elution requirement is 5 column volumes of 50mmol/L imidazoles, 5 column volumes of 100mmol/L imidazoles, 10 column volumes of 300mmol/L imidazoles, 5 column volumes of 500mmol/L imidazoles.

The immunologic competence of embodiment 2, fusion rotein cTnI-C is measured

Adopt Access micropartical chemistry luminescence immunoassay instrument and AccuTnI detection kit to measure by the immunologic competence that double antibody sandwich method carries out cTnI among the cTnI-C.Wherein, two strain antibodies all are the mouse-anti people cTnI monoclonal antibody of preparation according to a conventional method, and a strain bag is by on paramagnetic particle, a strain alkali phosphatase enzyme mark.CTnI in the fusion rotein that the result obtains can be shown that the cTnI among the cTnI-C has better immunogenicity by cTnI monoclonal antibody identification in the reagent.

Sequence table

<160>2

<210>1

<211>1236

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>1

atgggcagca?gccatcatca?tcatcatcac?agcagcggcc?tggtgccgcg?cggcagccat 60

atggccgatg?gtagcagcga?tgcggctagg?gaacctcgcc?ctgcaccagc?cccaatcaga 120

cgccgctcct?ccaactaccg?cgcttatgcc?acggagccgc?acgccaagaa?aaaatctaag 180

atctccgcct?cgagaaaatt?gcagctgaag?actctgctgc?tgcagattgc?aaagcaagag 240

ctggagcgag?aggcggagga?gcggcgcgga?gagaaggggc?gcgctctgag?cacccgctgc 300

cagccgctgg?agttggccgg?gctgggcttc?gcggagctgc?aggacttgtg?ccgacagctc 360

cacgcccgtg?tggacaaggt?ggatgaagag?agatacgaca?tagaggcaaa?agtcaccaag 420

aacatcacgg?agattgcaga?tctgactcag?aagatctttg?accttcgagg?caagtttaag 480

cggcccaccc?tgcggagagt?gaggatctct?gcagatgcca?tgatgcaggc?gctgctgggg 540

gcccgggcta?aggagtccct?ggacctgcgg?gcccacctca?agcaggtgaa?gaaggaggac 600

accgagaagg?aaaaccggga?ggtgggagac?tggcgcaaga?acatcgatgc?actgagtgga 660

atggagggcc?gcaagaaaaa?gtttgagagc?gaattcagtg?gtggtggtgg?ttctggtggg 720

gggggttctg?gtggcggtgg?ttctcctagg?atggatgaca?tctacaaggc?tgcggtagag 780

cagctgacag?aagagcagaa?aaatgagttc?aaggcagcct?tcgacatctt?cgtgctgggc 840

gctgaggatg?gctgcatcag?caccaaggag?ctgggcaagg?tgatgaggat?gctgggccag 900

aaccccaccc?ctgaggagct?gcaggagatg?atcgatgagg?tggacgagga?cggcagcggc 960

acggtggact?ttgatgagtt?cctggtcatg?atggttcggt?gcatgaagga?cgacagcaaa 1020

gggaaatctg?aggaggagct?gtctgacctc?ttccgcatgt?ttgacaaaaa?tgctgatggc 1080

tacatcgacc?tggatgagct?gaagataatg?ctgcaggcta?caggcgagac?catcacggag 1140

gacgacatcg?aggagctcat?gaaggacgga?gacaagaaca?acgacggccg?catcgactat 1200

gatgagttcc?tggagttcat?gaagggtgtg?gagtag 1236

<210>2

<211>411

<212>PRT

＜213〉artificial sequence

<220>

<223>

<400>2

Met?Gly?Ser?Ser?His?His?His?His?His?His?Ser?Ser?Gly?Leu?Val?Pro

1 5 10 15

Arg?Gly?Ser?His?Met?Ala?Asp?Gly?Ser?Ser?Asp?Ala?Ala?Arg?Glu?Pro

20 25 30

Arg?Pro?Ala?Pro?Ala?Pro?Ile?Arg?Arg?Arg?Ser?Ser?Asn?Tyr?Arg?Ala

35 40 45

Tyr?Ala?Thr?Glu?Pro?His?Ala?Lys?Lys?Lys?Ser?Lys?Ile?Ser?Ala?Ser

50 55 60

Arg?Lys?Leu?Gln?Leu?Lys?Thr?Leu?Leu?Leu?Gln?Ile?Ala?Lys?Gln?Glu

65 70 75 80

Leu?Glu?Arg?Glu?Ala?Glu?Glu?Arg?Arg?Gly?Glu?Lys?Gly?Arg?Ala?Leu

85 90 95

Ser?Thr?Arg?Cys?Gln?Pro?Leu?Glu?Leu?Ala?Gly?Leu?Gly?Phe?Ala?Glu

100 105 110

Leu?Gln?Asp?Leu?Cys?Arg?Gln?Leu?His?Ala?Arg?Val?Asp?Lys?Val?Asp

115 120 125

Glu?Glu?Arg?Tyr?Asp?Ile?Glu?Ala?Lys?Val?Thr?Lys?Asn?Ile?Thr?Glu

130 135 140

Ile?Ala?Asp?Leu?Thr?Gln?Lys?Ile?Phe?Asp?Leu?Arg?Gly?Lys?Phe?Lys

145 150 155 160

Arg?Pro?Thr?Leu?Arg?Arg?Val?Arg?Ile?Ser?Ala?Asp?Ala?Met?Met?Gln

165 170 175

Ala?Leu?Leu?Gly?Ala?Arg?Ala?Lys?Glu?Ser?Leu?Asp?Leu?Arg?Ala?His

180 185 190

Leu?Lys?Gln?Val?Lys?Lys?Glu?Asp?Thr?Glu?Lys?Glu?Asn?Arg?Glu?Val

195 200 205

Gly?Asp?Trp?Arg?Lys?Asn?Ile?Asp?Ala?Leu?Ser?Gly?Met?Glu?Gly?Arg

210 215 220

Lys?Lys?Lys?Phe?Glu?Ser?Glu?Phe?Ser?Gly?Gly?Gly?Gly?Ser?Gly?Gly

225 230 235 240

Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Pro?Arg?Met?Asp?Asp?Ile?Tyr?Lys

245 250 255

Ala?Ala?Val?Glu?Gln?Leu?Thr?Glu?Glu?Gln?Lys?Asn?Glu?Phe?Lys?Ala

260 265 270

Ala?Phe?Asp?Ile?Phe?Val?Leu?Gly?Ala?Glu?Asp?Gly?Cys?Ile?Ser?Thr

275 280 285

Lys?Glu?Leu?Gly?Lys?Val?Met?Arg?Met?Leu?Gly?Gln?Asn?Pro?Thr?Pro

290 295 300

Glu?Glu?Leu?Gln?Glu?Met?Ile?Asp?Glu?Val?Asp?Glu?Asp?Gly?Ser?Gly

305 310 315 320

Thr?Val?Asp?Phe?Asp?Glu?Phe?Leu?Val?Met?Met?Val?Arg?Cys?Met?Lys

325 330 335

Asp?Asp?Ser?Lys?Gly?Lys?Ser?Glu?Glu?Glu?Leu?Ser?Asp?Leu?Phe?Arg

340 345 350

Met?Phe?Asp?Lys?Asn?Ala?Asp?Gly?Tyr?Ile?Asp?Leu?Asp?Glu?Leu?Lys

355 360 365

Ile?Met?Leu?Gln?Ala?Thr?Gly?Glu?Thr?Ile?Thr?Glu?Asp?Asp?Ile?Glu

370 375 380

Glu?Leu?Met?Lys?Asp?Gly?Asp?Lys?Asn?Asn?Asp?Gly?Arg?Ile?Asp?Tyr

385 390 395 400

Asp?Glu?Phe?Leu?Glu?Phe?Met?Lys?Gly?Val?Glu

405 410

Claims (10)

1, the fusion rotein of a kind of human cardiac troponin I and TnC, be to have SEQ ID № in the sequence table: the protein of 2 amino acid residue sequences, or with SEQ ID №: 2 amino acid residue sequence is through replacement, disappearance or the interpolation of one or several amino-acid residue and have the № with SEQ ID: 2 amino acid residue sequence is identical active by SEQ ID №: 2 deutero-protein.

2, fusion rotein according to claim 1 is characterized in that: the fusion rotein of described human cardiac troponin I and TnC is the SEQ ID № in the sequence table: 2.

3, the fusion rotein encoding gene of a kind of human cardiac troponin I and TnC is one of following nucleotide sequences:

1) SEQ ID № in the sequence table: 1 dna sequence dna;

2) SEQ ID № in the code sequence tabulation: the polynucleotide of 2 protein sequences;

3) with sequence table in SEQ ID №: 1 dna sequence dna that limits has 95% above homology, and the identical function protein DNA sequence of encoding.

4, gene according to claim 3 is characterized in that: described fusion rotein encoding gene is the SEQ ID № in the sequence table: 1.

5, contain the described expression carrier of claim 3.

6, the clone that contains the described gene of claim 3.

7, the arbitrary segmental primer of the amplification described gene of claim 3 is right.

8, the application of the fusion rotein of described human cardiac troponin I of claim 1 and TnC in human cardiac troponin I detects.

9, application according to claim 8 is characterized in that: the fusion rotein of described human cardiac troponin I and TnC is as quality control product in the human cardiac troponin I detection system and/or standard substance.

10, application according to claim 8 is characterized in that: the fusion rotein of described human cardiac troponin I and TnC is used to prepare human cardiac troponin I antibody.

Images