CN1648254A - Goose parvo-virus VP1 and VP3 gene non-overlapping sequence pronucleus expression protein and its preparing method - Google Patents
Goose parvo-virus VP1 and VP3 gene non-overlapping sequence pronucleus expression protein and its preparing method Download PDFInfo
- Publication number
- CN1648254A CN1648254A CN 200410043810 CN200410043810A CN1648254A CN 1648254 A CN1648254 A CN 1648254A CN 200410043810 CN200410043810 CN 200410043810 CN 200410043810 A CN200410043810 A CN 200410043810A CN 1648254 A CN1648254 A CN 1648254A
- Authority
- CN
- China
- Prior art keywords
- gene
- overlapping sequence
- inclusion body
- pbs
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The present invention provides goose parvovirus VP1 and VP3 gene non-overlapping sequence prokaryotic expression protein and its preparation process. The preparation process includes: 1) designing and amplifying specific primer for goose parvovirus VP1 and VP3 gene nucleotide non-overlapping sequence; 2) PCR amplification to obtain VP1 and VP3 gene non-overlapping sequence segments; 3) cloning, sequencing and identifying VP1 and VP3 gene non-overlapping sequence; 4) directional subcloning VP1 and VP3 gene non-overlapping sequence to pGEX-6p-1 prokaryotic expression vector; 5) inducing expression of VP1 and VP3 gene non-overlapping sequence in colibacillus; and 6) affinity chromatographic purification of VP1 and VP3 gene non-overlapping sequence expressing protein. The present invention may be used as the detection antigen for the identification of goose parvovirus antibody and goose parvovirus VP3 gene subunit antibody.
Description
(1) technical field
What the present invention relates to is a kind of making method of recombinant product, specifically a kind of VP1 that differentiates goose parvovirus antibody and goose parvovirus VP3 gene subunit antibody and VP3 gene non-overlapping sequence prokaryotic expression proteantigen and preparation method thereof.
(2) background technology
(Goose parvovirus GPV) is the cause of disease of Goose Parvovirus (being commonly called as gosling plague or Derzsy ' s disease) to goose parvovirus.This disease is to support goose already to endanger one of maximum transmissible disease, and the mortality ratio of infected goose is at 90-100%.Since 1956 found this disease, all there was generation each foster goose countries and regions in the whole world, causes enormous economic loss.Anti-system for this disease; main at present application GPV whole virus vaccine prevents; totivirus deactivation vaccine and weak malicious seedling have higher protection ratio; but there are loose poison, latent infection really after using complete malicious vaccine; especially can't differentiate natural infection antibody and complete malicious vaccine immunity antibody; cause the area of gosling plague immunity when epidemic situation takes place, can't effectively monitor, can't take effectively anti-system measure.And the unique channel that solves this difficult problem is researched and developed the VP3 recombinant vaccine exactly, and VP1-VP3 antigen is the prerequisite that the VP3 recombinant vaccine can practical application for the foundation of discrimination method on basis.Therefore research and application goose parvovirus VP1-VP3 gene fragment prokaryotic expression product have important use value.
(3) summary of the invention
The invention provides a kind of goose parvovirus VP1 and VP3 gene non-overlapping sequence prokaryotic expression albumen and preparation method thereof.Its purpose be to provide a kind of nothing of differentiating goose parvovirus antibody and goose parvovirus VP3 gene subunit antibody loose poison danger, good stability, highly sensitive, can realize suitability for industrialized production, prokaryotic expression detection antigen that cost is low and preparation method thereof.
The object of the present invention is achieved like this:
It is a kind of goose parvovirus capsid protein Nucleotide VP1 and VP3 gene non-overlapping sequence prokaryotic expression product for goose parvovirus VP1 and VP3 gene non-overlapping sequence prokaryotic expression albumen, the VP1-VP3 gene fragment contains 594 bases, 198 amino-acid residues of encoding, when expressing with prokaryotic expression carrier pGEX-6p-1, Triptide leading peptide on VP1-VP3 gene fragment and the fusion expression vector obtains amalgamation and expression, and the molecular weight size of fusion rotein is about 47KU.
The nucleotide sequence of its non-overlapping sequence and the aminoacid sequence that pushes over thereof are:
ATGCGGAATCTGAAAGCTGGAGCCCCTCAGCCAAAACCAAACCAGCAGTCTCAGTCTGTG
1 M R N L K A G A P Q P K P N Q Q S Q S V
61 TCTCCAGACAGAGAACCCGAACGAAGAGATAATAATCGGGGCTTTGTACTTCCTGGCTAT
21 S P D R E P E R R D N N R G F V L P G Y
121 AAGTATCTTGGGCCTGGTAACGGCCTTGATAAAGGCCCACCTGTCAATAACGCGGACACC
41 K Y L G P G N G L D K G P P V N N A D T
181 GTCGCGCTTGAACACGACAAGGCCTACGACCAGCAGCTTAAAGCGGGAGACAATCCATAT
61 V A L E H D K A Y D Q Q L K A G D N P Y
241 ATAAAATTCAATCACGCTGACCAGGACTTTATAGATAGTCTCCAAGACGACCAGTCATTC
81 I K F N H A D Q D F I D S L Q D D Q S F
301 GGAGGTAATCTTGGAAAGGCTGTATTTCAGGCCAAAAAACGTATCTTAGAGCCATTTGGC
101 G G N L G K A V F Q A K K R I L E P F G
361 CTAGTAGAAGATCCTATCAACACGGCACCTGCAAAAAAAAATACAGGGAAGCTTACTGAC
121 L V E D P I N T A P A K K N T G K L T D
421 CATTACCCGGTAGTTAAGAAGCCTAAACTTACCGAGGAAGTCAGTGCGGGAGGTGGTAGC
141 H Y P V V K K P K L T E E V S A G G G S
481 AGTGCCGTAGAAGACGGAGGAGCCACCGCGGAGGGCACCGAACCTGTGCGGCCG
161 S A V E D G G A T A E G T E P V R P
Product of the present invention is preparation like this:
(1), the Auele Specific Primer of design amplification GPV PV1-VP3 gene;
(2), obtain the VP1-VP3 gene fragment by pcr amplification;
(3), to the evaluation of cloning, check order of VP1-VP3 gene;
(4), with the directed subclone of VP1-VP3 gene to the pGEX-6p-1 prokaryotic expression carrier;
(5), the VP1-VP3 gene is at colibacillary abduction delivering;
With recombinant expression plasmid pGEX-6p-(VP1-VP3) transformed into escherichia coli BL21 (DE3) plysS, express;
(6), the proteic affinity chromatography purification of VP1-VP3 genetic expression, mainly comprise:
1. the preparation of sample to be purified
Bacterium is expressed in centrifugal collection: the centrifuging and taking precipitation, and use the PBS of 1mol/L, pH7.4 to wash 3 times, will precipitate with resuspended of PBS solution;
The cracking thalline obtains supernatant soluble proteins and inclusion body precipitation: adding N,O-Diacetylmuramidase to weightmeasurement ratio final concentration is 1%, ice bath 30min, carry out supersound process then, the centrifuging and taking supernatant and add 1% TritionX-100 and DTT to final concentration be in-20 ℃ of preservations behind the 1mmol/L, in order to purifying, precipitation is inclusion body;
The cracking of inclusion body and the recovery of soluble proteins: inclusion body washs 2 times with the inclusion body washings of the pH8.0 that 30% sucrose, 100mol/LNaCl, 50mmol/L Tris, 1%TritionX-100 form, adding is resuspended by the inclusion body lysate of the pH8.0 that 1.5%N-sarcosyl, 25mmol/L trolamine, 1mmol/LEDTA form, handle 2h for 4 ℃, supersound process again, remove infusible precipitate, get supernatant and be the solubility inclusion body protein, the solubility supernatant is handled as stated above;
2. renaturation before the purifying of expressing protein
The adding final concentration is 2% Trition X-100 in the supernatant, the renaturation buffer that adds the pH8.5 that forms by 0.8mmol/L oxidized form Triptide GSSH, 2mmol/L reduced glutathione GSH, 2mmol/LEDTA, 20mmol/L Tris of 9 times of volumes, with 0.01mol/L PBS, pH7.4 dialysis 48h, take out the inclusion body protein liquid of renaturation, concentrate through poly-ethanol-8000, behind the Trition X-100 of adding 2%, preserve fully in purifying in-20 ℃;
The proteic affinity chromatography purification of VP1-VP3 gene prokaryotic comprises:
1. with 20ml PBS flushing pillar, preserve liquid with flush away;
2. carry out the balanced gel layer with 6ml PBS+1% Trition X-100;
3. toward the interior application of sample of post, add the 2ml sample at every turn, in 27 ℃ of incubators, feel behind the application of sample and make 30min, just discard effluent liquid then, the rate requirement of release 1/30 seconds;
4. wash pillar 4 times with 10ml PBS damping fluid,, guarantee the purity of product with abundant flush away coli somatic foreign protein;
5. with 10ml elutriant flushing binding substances, measure collection elutriant in clean Eppendorf pipe by 1-2ml;
6. the regeneration of purification column and preservation: wash 2 times with 5 times of high level salt solution liquid, wash 2 times with 5 times of 20% ethanol, in 4 ℃ of preservations to the glue-line volume by 3mol/L PBS+3mol/LNaCl solution composition to the glue-line volume.
VP1 provided by the invention and VP3 gene non-overlapping sequence prokaryotic expression antigen, be to utilize genetic engineering technique, on the basis that goose parvovirus (GPV) capsid protein gene VP1 and VP3 non-overlapping sequence are cloned, it is connected the gene engineering product that transformed into escherichia coli BL21 expression system is induced, expressed with prokaryotic expression carrier pGEX-6p-1 (being a kind of fusion expression vector of the GST of having leading peptide).This proteic expression-form is the VP3/GST fusion rotein, and the molecular weight of the fusion rotein of expression is 47KU, is that amalgamation and expression one is to consider to be convenient to purifying with product design, the 2nd, can increase the immunogenicity of expressing protein.This gene coded protein is a non-glycosylated protein, and therefore, the product after prokaryotic expression system is expressed all shows to have the immune response activity similar to native protein after Western blot, Dot-ELISA identify.
The advantage one of amalgamation and expression is to be convenient to affinity chromatography purification, the 2nd, and immunogenicity is improved behind the increase molecular weight of albumen.This fusion rotein is when expressing, most of inclusion body formal representation with non-solubility, we have adopted comparatively gentle inclusion body fragmentation pattern for inclusion body before purifying, therefore after the inclusion body protein cracking again after renaturation is handled, think that according to Dot-ELISA and Western blot qualification result some albumen has kept the characteristic of native protein substantially, its linear antigen and spatial dependence antigenic structure still keep.Still kept good homogeneous colloidal state through 24 months through the cracked inclusion body protein, do not have and separate out and deposited phenomenon, show in stable condition.
Use this prokaryotic expression detection antigen and differentiate that the advantage one of goose parvovirus antibody and goose parvovirus VP3 subunit antibody is because this product is a viral sub-units expression of gene product, be not totivirus, therefore carry out the diffusing poison danger of exhausted nothing in the testing process at this antigen of application; The 2nd, detection reaction highly sensitive, no cross reaction phenomenon; The 3rd, because the VP3 gene is the main protective gene of goose parvovirus; after the application of VP3 gene development recombinant vaccine, only avoid the VP1 and the VP3 gene non-overlapping sequence of VP3 gene fragment in the capsid protein sequence and can differentiate GPV totivirus antibody and VP3 gene subunit antibody.The foundation of this discrimination method is the prerequisite that the VP3 recombinant vaccine can practical application.
The product that adopts method of the present invention to produce can be used for:
Differentiate the indirect-ELISA of goose parvovirus antibody and goose parvovirus VP3 gene subunit antibody and the detection antigen of Dot-ELISA method.
Product advantage applies of the present invention exists:
1. because this detection antigen is VP1-VP3 gene fragment prokaryotic expression protein, be not totivirus, therefore use and do not have the poison of loosing danger when this antigen detects extremely.
2. as ELISA Detection of antigen goose parvovirus antibody, its detection sensitivity height, high specificity, no cross reaction.
3. production technique advanced person, stable performance, production cost is low, and product is paid value added height, is fit to batch production production, and market application foreground is wide.
(4), specific embodiments
The antigenic preparation production process of goose parvovirus VP1 and VP3 gene non-overlapping sequence prokaryotic expression is:
1. design the Auele Specific Primer of amplification GPV VP1-VP3 gene;
2. obtain the VP1-VP3 gene fragment by pcr amplification;
3. to the evaluation of cloning, check order of VP1-VP3 gene;
With the directed subclone of VP1-VP3 gene to the pGEX-6p-1 prokaryotic expression carrier;
5.VP1-VP3 gene is at colibacillary abduction delivering:
With recombinant expression plasmid pGEX-6p-(VP1-VP3) transformed into escherichia coli BL21 (DE3) plysS, carry out abduction delivering then.
6.VP1-VP3 the proteic affinity chromatography purification of genetic expression
(1) preparation of sample to be purified
Bacterium is expressed in centrifugal collection: the centrifuging and taking precipitation, (1mol/L, pH7.4) washing is 3 times, resuspended of PBS solution of bacterial precipitation with PBS.
The cracking thalline obtains supernatant soluble proteins and inclusion body precipitation: adding N,O-Diacetylmuramidase to final concentration is 1% (1mg/ml), and ice bath 30min carries out supersound process then, is tending towards transparent, does not have obvious grumeleuse degree of being when blowing with the liquid-transfering gun suction with suspension.Centrifuging and taking supernatant (being soluble proteins) and add 1% TritionX-100 and the DTT of 1mmol/L to final concentration be in-20 ℃ of preservations, in order to purifying behind the 1mmol/L.Precipitation is inclusion body.
The cracking of inclusion body and the recovery of soluble proteins: inclusion body is partly used inclusion body washings (30% sucrose, 100mol/L NaCl, 50mmol/L Tris, pH8.0,1%TritionX-100) with 12000r/m, 4 ℃ of centrifuge washings 2 times, resuspended precipitation, add 16ml inclusion body lysate (1.5% (m/v) N-sarcosyl, the 25mmol/L trolamine, 1mmol/L EDTA, pH8.0) resuspended, handle 2h for 4 ℃, supersound process 20S again, with 12000r/m, 4 ℃ of centrifugal 20min, remove infusible precipitate, get supernatant and be the solubility inclusion body protein.The solubility supernatant is handled as stated above.
(3) renaturation before the purifying of expressing protein
In the solubilization of inclusion bodies supernatant, add final concentration immediately and be 2% Trition X-100, renaturation buffer (the 0.8mmol/L oxidized form Triptide GSSH that adds 9 times of volumes, 2mmol/L reduced glutathione GSH, 2mmol/L EDTA, 20mmol/L Tris, pH8.5), with 0.01mol/LPBS (pH7.4) dialysis 48h, every 12h changes a dialyzate.Take out the inclusion body protein liquid of renaturation, concentrate, behind the Trition X-100 of adding 2%, be equipped with in purifying in-20 ℃ of preservations through poly-ethanol-8000.
(4) the affinity chromatography purification flow process of expressing protein
1. with 20ml PBS flushing pillar, preserve liquid with flush away;
2. carry out the balanced gel layer with 6ml PBS+1%Trition X-100;
3. toward the interior application of sample of post, can go up sample 2ml with sample in little filter (the 0.22 μ m aperture) filtration during application of sample at every turn, and slowly discard effluent liquid after 30min is made in sense under 27 ℃ of conditions, the speed that discharges effluent liquid is 1/15 seconds.
4. wash pillar 2 times with 10ml PBS damping fluid;
5. with 10ml elutriant flushing binding substances, measure collection elutriant in clean Eppendorf pipe by 1-2ml;
6. the regeneration of purification column and preservation: can regeneration with high salt regenerated liquid (1mol/L PBS+3molo/L NaCl) detergent gel 2 times.For prolonged preservation, wash 2 times to the PBS of glue-line volume liquid with 5 times, wash 2 times with 5 times of 20% ethanol, in 4 ℃ of preservations to the glue-line volume.
(5) expressing protein Determination on content
Adopt the uItraviolet absorption methods quantitative protein.After the suitable dilution of sample to be checked, measure the OD value of this protein soln simultaneously at λ 260nm and λ 280nm place, use diluent as blank simultaneously, calculate protein content by following formula:
(1.46 * A280,0.74 * A260) * extension rate=(mg)/the ml protein content
The mass concentration of VP1-VP3/GST purifying protein is 〉=1.5mg/ml.
Claims (3)
1, a kind of goose parvovirus VP1 and VP3 gene non-overlapping sequence prokaryotic expression albumen, it is characterized in that: it is a kind of goose parvovirus capsid protein Nucleotide VP1 and VP3 gene non-overlapping sequence prokaryotic expression product, the VP1-VP3 gene fragment contains 594 bases, 198 amino-acid residues of encoding, when expressing with prokaryotic expression carrier pGEX-6p-1, Triptide leading peptide on VP1-VP3 gene fragment and the fusion expression vector obtains amalgamation and expression, and the molecular weight size of fusion rotein is about 47KU.
2, goose parvovirus VP1 according to claim 1 and VP3 gene non-overlapping sequence prokaryotic expression albumen is characterized in that:
The nucleotide sequence of non-overlapping sequence and the aminoacid sequence that pushes over thereof are:
ATGCGGAATCTGAAAGCTGGAGCCCCTCAGCCAAAACCAAACCAGCAGTCTCAGTCTGTG
1 M R N L K A G A P Q P K P N Q Q S Q S V
61 TCTCCAGACAGAGAACCCGAACGAAGAGATAATAATCGGGGCTTTGTACTTCCTGGCTAT
21 S P D R E P E R R D N N R G F V L P G Y
121 AAGTATCTTGGGCCTGGTAACGGCCTTGATAAAGGCCCACCTGTCAATAACGCGGACACC
41 K Y L G P G N G L D K G P P V N N A D T
181 GTCGCGCTTGAACACGACAAGGCCTACGACCAGCAGCTTAAAGCGGGAGACAATCCATAT
61 V A L E H D K A Y D Q Q L K A G D N P Y
241 ATAAAATTCAATCACGCTGACCAGGACTTTATAGATAGTCTCCAAGACGACCAGTCATTC
81 I K F N H A D Q D F I D S L Q D D Q S F
301 GGAGGTAATCTTGGAAAGGCTGTATTTCAGGCCAAAAAACGTATCTTAGAGCCATTTGGC
101 G G N L G K A V F Q A K K R I L E P F G
361 CTAGTAGAAGATCCTATCAACACGGCACCTGCAAAAAAAAATACAGGGAAGCTTACTGAC
121 L V E D P I N T A P A K K N T G K L T D
421 CATTACCCGGTAGTTAAGAAGCCTAAACTTACCGAGGAAGTCAGTGCGGGAGGTGGTAGC
141 H Y P V V K K P K L T E E V S A G G G S
481 AGTGCCGTAGAAGACGGAGGAGCCACCGCGGAGGGCACCGAACCTGTGCGGCCG
161 S A V E D G G A T A E G T E P V R P
3, the preparation method of goose parvovirus VP1 and VP3 gene non-overlapping sequence prokaryotic expression proteantigen is characterized in that:
(1), the Auele Specific Primer of design amplification GPV PV1-VP3 gene;
(2), obtain the VP1-VP3 gene fragment by pcr amplification;
(3), to the evaluation of cloning, check order of VP1-VP3 gene;
(4), with the directed subclone of VP1-VP3 gene to the pGEX-6p-1 prokaryotic expression carrier;
(5), the VP1-VP3 gene is at colibacillary abduction delivering;
With recombinant expression plasmid pGEX-6p-(VP1-VP3) transformed into escherichia coli BL21 (DE3) plysS, express;
(6), the proteic affinity chromatography purification of VP1-VP3 genetic expression, mainly comprise:
1. the preparation of sample to be purified
Bacterium is expressed in centrifugal collection: the centrifuging and taking precipitation, and use the PBS of 1mol/L, pH7.4 to wash 3 times, will precipitate with resuspended of PBS solution;
The cracking thalline obtains supernatant soluble proteins and inclusion body precipitation: adding N,O-Diacetylmuramidase to weightmeasurement ratio final concentration is 1%, ice bath 30min, carry out supersound process then, the centrifuging and taking supernatant and add 1% TritionX-100 and DTT to final concentration be in-20 ℃ of preservations behind the 1mmol/L, in order to purifying, precipitation is inclusion body;
The cracking of inclusion body and the recovery of soluble proteins: inclusion body washs 2 times with the inclusion body washings of the pH8.0 that 30% sucrose, 100mol/LNaCl, 50mmol/L Tris, 1%TritionX-100 form, adding is resuspended by the inclusion body lysate of 1.5%N-sarcosyl, 2 5mmol/L trolamines, 1mmol/L EDTA, the pH8.0 that forms, handle 2h for 4 ℃, supersound process again, remove infusible precipitate, get supernatant and be the solubility inclusion body protein, the solubility supernatant is handled as stated above;
2. renaturation before the purifying of expressing protein
The adding final concentration is 2% Trition X-100 in the supernatant, the renaturation buffer that adds the pH8.5 that forms by 0.8mmol/L oxidized form Triptide GSSH, 2mmol/L reduced glutathione GSH, 2mmol/LEDTA, 20mmol/L Tris of 9 times of volumes, with 0.01mol/L PBS, pH7.4 dialysis 48h, take out the inclusion body protein liquid of renaturation, concentrate through poly-ethanol-8000, behind the Trition X-100 of adding 2%, preserve fully in purifying in-20 ℃;
The proteic affinity chromatography purification of VP1-VP3 gene prokaryotic comprises:
1. with 20ml PBS flushing pillar, preserve liquid with flush away;
2. carry out the balanced gel layer with 6ml PBS+1%Trition X-100;
3. toward the interior application of sample of post, add the 2ml sample at every turn, in 27 ℃ of incubators, feel behind the application of sample and make 30min, just discard effluent liquid then, the rate requirement of release 1/30 seconds;
4. wash pillar 4 times with 10ml PBS damping fluid,, guarantee the purity of product with abundant flush away coli somatic foreign protein;
5. with 10ml elutriant flushing binding substances, measure collection elutriant in clean Eppendorf pipe by 1-2ml;
6. the regeneration of purification column and preservation: wash 2 times with 5 times of high level salt solutions, wash 2 times with 5 times of 20% ethanol, in 4 ℃ of preservations to the glue-line volume by 3mol/L PBS+3mol/LNaCl solution composition to the glue-line volume.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200410043810 CN1648254A (en) | 2004-08-18 | 2004-08-18 | Goose parvo-virus VP1 and VP3 gene non-overlapping sequence pronucleus expression protein and its preparing method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200410043810 CN1648254A (en) | 2004-08-18 | 2004-08-18 | Goose parvo-virus VP1 and VP3 gene non-overlapping sequence pronucleus expression protein and its preparing method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1648254A true CN1648254A (en) | 2005-08-03 |
Family
ID=34868634
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200410043810 Pending CN1648254A (en) | 2004-08-18 | 2004-08-18 | Goose parvo-virus VP1 and VP3 gene non-overlapping sequence pronucleus expression protein and its preparing method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1648254A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102373179A (en) * | 2011-08-02 | 2012-03-14 | 胡传伟 | (Blue Parvovirus)-TA isolated strain, standard sample of virus VP1, VP2 and NS1 genes complete sequences and preparation method thereof |
| CN103122336A (en) * | 2012-12-14 | 2013-05-29 | 哈药集团生物疫苗有限公司 | Goose parvovirus H-strain and application thereof in preventing and treating gosling plague |
| CN110092841A (en) * | 2019-05-15 | 2019-08-06 | 中国科学院过程工程研究所 | A kind of recombinant virus sample particle and its preparation method and application based on inclusion bodies expression |
| CN110174516A (en) * | 2019-06-05 | 2019-08-27 | 扬州优邦生物药品有限公司 | Goose parvovirus VP3 proteantigen ELISA detection kit and detection method and application |
-
2004
- 2004-08-18 CN CN 200410043810 patent/CN1648254A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102373179A (en) * | 2011-08-02 | 2012-03-14 | 胡传伟 | (Blue Parvovirus)-TA isolated strain, standard sample of virus VP1, VP2 and NS1 genes complete sequences and preparation method thereof |
| CN103122336A (en) * | 2012-12-14 | 2013-05-29 | 哈药集团生物疫苗有限公司 | Goose parvovirus H-strain and application thereof in preventing and treating gosling plague |
| CN103122336B (en) * | 2012-12-14 | 2015-02-04 | 哈药集团生物疫苗有限公司 | Goose parvovirus H-strain and application thereof in preventing and treating gosling plague |
| CN110092841A (en) * | 2019-05-15 | 2019-08-06 | 中国科学院过程工程研究所 | A kind of recombinant virus sample particle and its preparation method and application based on inclusion bodies expression |
| CN110092841B (en) * | 2019-05-15 | 2021-06-08 | 中国科学院过程工程研究所 | Recombinant virus-like particle expressed based on inclusion body form and preparation method and application thereof |
| CN110174516A (en) * | 2019-06-05 | 2019-08-27 | 扬州优邦生物药品有限公司 | Goose parvovirus VP3 proteantigen ELISA detection kit and detection method and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113150084B (en) | Nanocrystallized coronavirus antigen and application thereof | |
| CN109232720B (en) | Foot-and-mouth disease O type virus sIgA antibody ELISA detection kit and application thereof | |
| Guo et al. | Self-assembly of virus-like particles of rabbit hemorrhagic disease virus capsid protein expressed in Escherichia coli and their immunogenicity in rabbits | |
| CN106139139A (en) | swine fever E2 subunit vaccine and application thereof | |
| Nan et al. | Trigger factor assisted self-assembly of canine parvovirus VP2 protein into virus-like particles in Escherichia coli with high immunogenicity | |
| WO2012134416A2 (en) | Peptide ligands | |
| CN1317563C (en) | Recombined pronucleus expression detection antigen for detecting goose parvovirus anti-body and preparing method | |
| CN1648254A (en) | Goose parvo-virus VP1 and VP3 gene non-overlapping sequence pronucleus expression protein and its preparing method | |
| CN102643348B (en) | Recombinant chimeric protein carrying rotavirus antigen epitope and preparation thereof | |
| CN110845584B (en) | Swine fever virus envelope protein oligomeric protein body and preparation method and application thereof | |
| CN106754981B (en) | Method for preparing gosling plague virus-like particles by using escherichia coli system | |
| Yusibov et al. | Purification, characterization, assembly and crystallization of assembled alfalfa mosaic virus coat protein expressed in Escherichia coli | |
| CN102643335B (en) | Recombinant rotavirus VP6 carrier protein and preparation thereof | |
| CN113061167B (en) | Rabbit hemorrhagic disease virus recombinant antigen and application thereof | |
| CN116041448A (en) | Novel coronavirus immunogenic substance, preparation method and application thereof | |
| Lee et al. | Enhanced immunomagnetic separation for the detection of norovirus using the polyclonal antibody produced with human norovirus GII. 4-like particles | |
| CN102643349A (en) | Recombinant chimeric protein carrying hepatitis B virus epitope and preparation thereof | |
| EP2366708A1 (en) | Canine astrovirus AstV strain Bari/08 identified in dogs with gastro-enteritis | |
| CN108715607B (en) | Recombinant cholera toxin B subunit protein, PEDV inactivated vaccine, preparation and application | |
| CN1563383A (en) | Plamid vector, VP7 expresses antigen of blue tongue virus VP7 gene recombined expression, and preparation method | |
| CN1811431A (en) | Recombined prokaryotic expression detection antigen for detecting local trichina nematode antibody and producing method thereof | |
| CN111690043A (en) | NTD polypeptide based on SARS-CoV-2 nucleoprotein, coding gene, recombinant vector, expression method and application | |
| CN1241938C (en) | Purification technique in preparing genetic engineering vaccine of heat shock protein A of recombined Helicobacter pylori | |
| RU2817256C1 (en) | A/egypt/euro-sa/2022 strain of aphtae epizooticae foot-and-mouth disease virus for manufacture of biopreparations for diagnosis and specific prevention of foot-and-mouth disease genotype a/euro-sa | |
| CN114588881B (en) | Immunoadsorbent and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |