CN1635118A - Synthesis of carcinoembryonic antigen peptide epitope gene coded sequence concatemer and epitope vaccine thereof - Google Patents
Synthesis of carcinoembryonic antigen peptide epitope gene coded sequence concatemer and epitope vaccine thereof Download PDFInfo
- Publication number
- CN1635118A CN1635118A CN 200310115995 CN200310115995A CN1635118A CN 1635118 A CN1635118 A CN 1635118A CN 200310115995 CN200310115995 CN 200310115995 CN 200310115995 A CN200310115995 A CN 200310115995A CN 1635118 A CN1635118 A CN 1635118A
- Authority
- CN
- China
- Prior art keywords
- carcinoembryonic antigen
- gene coded
- coded sequence
- gene
- human carcinoembryonic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
A human carcinoembryonic antigen peptide epitope gene coded sequence concatemer and its production method belongs to the biological technology field. The invention employs self primer-template PCR method to synthesize concatemers of the human carcinoembryonic antigen CAP1 peptide epitope gene coded sequences, and construct the carcinoembryonic antigen epitope gene vaccines based on the concatemers. The PCR primer contains gene coded sequences of CAP1 and connection peptides, partial complementary bases on 3' end, partial inversely complementary bases on 5' end. When the polymerase chain reaction takes place, the primer can use itself as the template to amplify the concatemers of CAP gene coded sequences in the same direction by multi-step reactions. And the concatemer fragments of the human carcinoembryonic antigen CAP1 peptide epitope gene coded sequences with different copy numbers can be obtained by polyacrylamide gel electrophoresis. By adding enzyme cutting sites onto the two ends of the concatemer fragment, and inserting gene eukaryon expression carrier pVAX1, the carcinoembryonic antigen epitope vaccine can be prepared for the immune gene therapy of malignant tumor.
Description
Technical field:
The invention belongs to biological technical field.The preparation method who particularly relates to a kind of series aiding connection body and carcinomebryonic antigen epitope gene vaccine of human carcinoembryonic antigen CAP1 peptide epitopes gene coded sequence.
Background technology:
(Carcinoembryonic antigen CEA) is a kind of important tumor associated antigen and the tumor markers of generally acknowledging in the world to carcinomebryonic antigen.The M ﹠ M of CEA positive tumor is higher, the serious threat mankind's life and health.Though operation, radiation and chemotherapy are the main method of treatment malignant tumour, owing to can't solve recurrence and branch problem, or have serious toxic side effect, effect can not be satisfactory.Therefore, if can develop the method that tumour takes place and effectively treats prophylaxis of tumours, will have extremely important practical value.In recent years, along with molecular biology and development of technologies and perfect, tumor biotherapy has become the new model for the treatment of malignant tumor, comes into one's own day by day.Tumor biotherapy comprises immunotherapy of tumors and therapy of tumor two aspects, and the former is the basis of tumor biotherapy, and the latter is the developing direction of tumor biotherapy.Combining the tumor gene vaccine (cancer genetic vaccine) of above-mentioned two aspects treatment content, is the oncotherapy new technology that the nineties grows up, and also is one of focus of working as pre-neoplastic molecular immunology and oncomolecularbiology area research.
CEA can be brought out the general anti tumor immune response by body internal specific CTL identification as tumor associated antigen, therefore is used to the immunotherapy of its positive tumor.In recent years along with the establishment of T cell recognition tumour antigen immunocompetence epi-position notion, be that the immunotherapy of core has obtained great development with the tumour antigen peptide vaccine of T cell recognition.But the deficiency of peptide vaccine is: synthetic small peptide because molecular weight is little, easily by proteolysis enzyme liberating and transformation period short (having only several minutes), can not continue to stimulate the immunity system of body in human body, its application has been subjected to certain restriction.
For obtaining a certain gene fragment of multiple copied number, it was synthetic respectively desire synthetic goal gene will to be divided into several segments usually, coupled together with chemical splicing method then in the past, and cost is higher, and the concatermer copy number that obtains is limited; Though and use isocaudarner technology can obtain the gene fragment of any copy number, copy of every increase will carry out a gene clone, complicated operation, time-consuming.
Technology contents:
The objective of the invention is to set up with the epitope is based gene immunization protocol (epitope-based gene immunization, EBGI), strengthen the antigenicity of carcinoembryonic antigen vaccine, and reduce the interference of irrelevant sequence, make the effect of genetic immunization more single-minded and accurate.
Dna fragmentation of the present invention is formed by human carcinoembryonic antigen CAP1 peptide epitopes and connection peptides gene coded sequence series aiding connection.
Production method of the present invention, the encoding sequence that contains CAP1 and connection peptides in two used PCR primers, at 3 ' end 11 base complementrities are arranged, 5 ' end has 15 base reverse complementals, can be with primer from the human carcinoembryonic antigen CAP1 peptide epitopes gene coded sequence concatermer that goes out different copy numbers as template amplification when carrying out PCR.
The segmental synthetic employing self primer of the concatermer of the inventive method-template PCR method.
Foreign gene of the present invention is the series aiding connection body of human carcinoembryonic antigen peptide epitopes and connection peptides gene coded sequence.
The used carrier for expression of eukaryon of the present invention is pVAX1.
The present invention is based on analysis to CEA gene open reading frame and CEA protein structure, dna encoding sequence with CEA immunodominance peptide epitopes CAP1 is a goal gene, adopt self primer-template PCR method, with primer from as template, by the series aiding connection body of PCR amplification multiple copied CAP1 gene coded sequence.After above-mentioned concatermer two ends add restriction enzyme site, insert the epitope gene vaccine that carrier for expression of eukaryon constitutes, will have better target, and can continue, activated T cell effectively, the releasing body is to the immunological tolerance of tumour.Simultaneously, this concatermer fragment is shorter, is easy to become combined vaccine with other immunostimulant gene recombination, improves the antitumous effect of CEA gene vaccine.Be cloned into the carrier for expression of eukaryon pVAX1 that can be used for gene therapy through drugs approved by FDA, can become carcinomebryonic antigen epitope gene vaccine, be used for the immunogene treatment of malignant tumour.Use self primer-template PCR method and can overcome existing deficiency, synthesize and obtain the target gene fragment of different copy numbers as required.CEA epitope gene vaccine is once after the immunity, plasmid can long-term existence in the inoculation tissue, the simulating nature course of infection is expressed CEA PROTEIN C AP1 immunodominance peptide epitopes, continues stimulating immune system, induces to produce the immunity of persistent anti-CEA positive tumor.That this method also possesses skills is easy, quality is easy to control and evaluation, with low cost, etc. advantage, and will be along with therapy of tumor and immunotherapy development of technology, development and perfection gradually.
Embodiment:
One, CAP1 peptide epitopes gene coded sequence series aiding connection body is synthetic
1, the PCR design of primers of concatermer and synthetic
The encoding sequence that contains CAP1 and connection peptides in the designed one couple of PCR primers has 11 base complementrities at 3 ' end, and 5 ' end has 15 base reverse complementals.Can be when carrying out PCR with primer from the human carcinoembryonic antigen CAP1 peptide epitopes gene coded sequence concatermer that goes out different copy numbers as template amplification.
Primer is synthetic with dna synthesizer.
Primer 1:5 ' GGAGCAGGAGCAGCGTACCTTTCGGGAGCGTTGG 3 '
Primer 2: 5 ' CGCTGCTCCTGCTCCCTCCAACTCCAACGCTCCC 3 '
2, pcr amplification
Adding Auele Specific Primer 1 and 2 in reaction system is total to 4l (each 20pmol), dNTP8l, Tag enzyme 2.5U, 10 * Tag enzyme reaction buffer solution 10l, adds distilled water to 100l.The PCR reaction conditions is: 94 ℃ of 1min, 30 ℃ of 1min, 72 ℃ of 1min, 10 circulations, and 94 ℃ of 1min, 50 ℃ of 1min, 72 ℃ of 1min, 30 circulations then, last 72 ℃ are fully extended 10min.
3, the polyacrylamide gel electrophoresis of PCR product separates
(1) cleaning panes is fixed on the electrophoresis apparatus.
(2) preparation 8% separation gel (20ml) electrophoresis
30% acrylamide 5.3ml
5×TBE 4ml
10% ammonium persulphate 0.14ml
Distilled water 10.6ml
After adding the TEMED10l mixing, inject the glue bed rapidly, add distilled water again and cover.After treating polymerization fully, the sucking-off distilled water.The PCR product is mixed with sample loading buffer, inject the well electrophoresis, the hole adds the contrast of standard molecule amount, voltage 2-8V/cm in addition.
(3) dyeing; Gel is immersed with dyeing in the 0.5g/l ethidium bromide dye liquor of 1 * TBE preparation 30-45 minute.
(4) this clotting glue is downcut in the position of definite target gene fragment under ultraviolet lamp, transfers in the Eppendorf tube.
(5) elution buffer of 2 times of volumes of adding in centrifuge tube
The preparation of elution buffer:
0.5mol/L ammonium acetate
The 10mol/L magnesium acetate
1mmol/L?EDTA(pH8.0)
0.1％SDS
(6) 37 ℃ incubation 4-12 hour.
(7) the centrifugal 2min of 12000rpm, supernatant liquor is transferred in another centrifuge tube.
(8) add the ice precooling dehydrated alcohol of 2 times of volumes ,-20C placed 30 minutes, the centrifugal 10min of 12000rpm, precipitation target gene fragment.
Two, make up eukaryon expression plasmid pVAX1-CEA
1, clone's synthesizing with gene fragment
(1) PCR primer
5 ' end of primer adds BamHI restriction enzyme site and initiator codon, and 3 ' end adds the complementary sequence of EcoRI restriction enzyme site and terminator codon
Primer 1:5 ' GAGGATCCACCATGGAGCAGGAGCAGCG 3 '
Primer 2: 5 ' CCGGATTCCTAAATCGCTGCTCCTGCTCC 3 '
(2) pcr amplification and product reclaim:
Adding primer 1 and 2 in reaction system is total to 4l (each 20pmol), dNTP8l, Tag (Ex) polysaccharase 2.5U, 10 * Tag enzyme reaction buffer solution 10l, adds distilled water to 100l.The cyclic amplification program is: pre-95 ℃ of 5min of sex change, then 95 ℃ of 1min of sex change, 58 ℃ of 1min of renaturation, extend 72 ℃ of 1min, 72 ℃ of 10min are fully extended in totally 30 circulations.Agarose gel electrophoresis reclaims with the DNA purification kit after identifying the PCR product.
2, make up eukaryon expression plasmid pVAX1-CEA
(1) double digestion reaction:
The CEA gene fragment and the linear carrier pVAX1 that prepare the toughness end with EcoRI and the reaction of BamHI double digestion respectively.
DNA 15l(2g/l)
10×buffer 10l
EcoRI/BamHI 5l(10U/l)
Distilled water adds to 100l
Put 37 ℃ of water-bath 1.5-2 hours.
Behind the agarose gel electrophoresis, reclaim enzyme with the DNA purification kit and cut product.
(2) connection of dna fragmentation:
Be connected with the CEA gene fragment and the linear carrier pVAX1 of common sticky end
Dna fragmentation 0.1g
Linear pVAX1 plasmid 0.4g
10×buffer 2l
T4DNA ligase enzyme 1l
Distilled water adds to 20l
25 ℃, connect 1-2 hour.
Three, the production of recombinant plasmid pVAX1-CEA
1, preparation competence intestinal bacteria (Calcium Chloride Method):
(1) scrape with the aseptic inoculation ring and get frozen intestinal bacteria bacterial classification in liquid nitrogen, streak inoculation is cultivated 12-16h for 37 ℃ in the LB agar plate.
(2) picking list bacterium colony is inoculated in the 5ml LB liquid nutrient medium, 37 ℃, 200rpm/min jolting cultivation 12h.
(3) get 1% nutrient solution, be inoculated in the 50ml LB liquid nutrient medium, 37 ℃, 250rpm/min jolting cultivation 2-3h are to OD
600=0.4-0.6.
(4) take out after ice bath 10min immediately.
Below all need aseptic technique.
(5) nutrient solution is transferred in the ice-cold 50ml centrifuge tube 4 ℃, the centrifugal 10min of 4000rpm.
(6) abandon clean supernatant liquor, ice-cold 0.1mol CaCl
2The resuspended thalline of 10ml, ice-water bath 30min.
(7) 4 ℃, the centrifugal 10min of 4000rpm abandon clean supernatant liquor.
(8) ice-cold 0.1mol CaCl
2The resuspended thalline of 2ml is placed 12-24h for 4 ℃, the competence bacterium.Can be packed as 200l/ part, add 30% glycerine ,-70 ℃ of preservations are standby.
2, bacterium transforms
(1) gets the 50ng plasmid and add and to contain in the aseptic glass test tube of 0.2ml competence bacterium, mixing gently, ice-water bath 30min.
(2) 42 ℃ of heat-shocked 90s.
(3) add 0.8l LB liquid nutrient medium, 37 ℃, the gentle jolting 45mi of 120rpm/min.
(4) 200l bacterium liquid is applied in the agar culture dish that contains penbritin 50g/ml with glass elbow shop bacterium device, 37 ℃ keep flat absorption 20min after, be inverted and cultivate 10-14h.
3, the Rapid identification of recombinant plasmid
(1) will transform bacterium colony and transfer to successively in the agar culture dish that contains Amp, after the numbering, 37 ℃ of incubated overnight.
(2) an amount of bacterium colony of picking adds the 25l solution A, mixing.
(3) add the 25l solution B, mixing, behind 70 ℃ of insulation 5min, 4 ℃, the centrifugal 10min of 12000rpm.
(4) get supernatant, row agarose gel electrophoresis (comparing with empty plasmid simultaneously) determines whether to be recombinant plasmid according to the molecular weight size.
4, a large amount of extractions (alkaline lysis) of plasmid:
(1) 1% transformed bacteria is inoculated in the 100ml LB substratum (containing Amp50g/ml), 37 ℃, 250rpm/min jolting cultivation 12-16h are to OD
600=0.6-0.8.
(2) take out after ice bath 10min immediately, transfer in the ice-cold 50ml centrifuge tube 4 ℃, the centrifugal 10min of 4000rpm.
(3) abandon clean supernatant liquor, add solution I (40mmol/L glucose, 2540mmol/L Tris-CI pH8.0, the 10mmol/L EDTA pH8.0) 4ml of ice precooling, the concuss mixing.
(4) add freshly prepared solution II (0.2mol/L NaCI, 1%SDS) 8ml, slowly put upside down mixing, place 5-10min.
(5) add ice-cold solution III (5mol/L potassium acetate 3.6ml, 3mol/L glacial acetic acid 0.69ml, distilled water 1.71ml) 6ml, put upside down mixing, ice-water bath 10min.4 ℃, the centrifugal 10min of 8000rpm.
(6) get supernatant liquor, add 0.6 volume primary isoamyl alcohol, mixing ,-20 ℃ of precipitation 20min.4 ℃, the centrifugal 10min of 12000rpm.
(7) abandon clean supernatant liquor, wash precipitation, dry, be dissolved in 1.2mlTE (pH8.0) solution with 70% ethanol.
(8) add Rnase A30l, 37 ℃ of water-bath 30min.
(9) add the equal-volume balance phenol, mix.The centrifugal 10min of 5000rpm.
(10) carefully draw the upper strata water, balance phenol extracting and chloroform-primary isoamyl alcohol (24: 1) extracting.
(11) the centrifugal 10min of 5000rpm carefully draws the upper strata water.
(12) add 1/10 volume NaAc (pH5.3), the dehydrated alcohol of 2.5 times of volumes, mixing ,-20 ℃ of precipitation 20min.
(13) the centrifugal 10min of 12000rpm abandons clean supernatant, and 70% washes 2 times.
(14) precipitation is dried, and is dissolved in 200l TE (pH8.0) solution.
(15) get 10l and measure OD by 1: 100 dilution back
260, calculate plasmid DNA concentration.-20 ℃ of preservations are standby.
Claims (5)
1, a kind of human carcinoembryonic antigen peptide epitopes gene coded sequence concatermer, it is characterized in that: this dna fragmentation is formed by human carcinoembryonic antigen CAP1 peptide epitopes and connection peptides gene coded sequence series aiding connection.
2, a kind of human carcinoembryonic antigen peptide epitopes gene coded sequence concatermer production method, it is characterized in that: the encoding sequence that contains CAP1 and connection peptides in two used PCR primers, at 3 ' end 11 base complementrities are arranged, 5 ' end has 15 base reverse complementals, can be with primer from the human carcinoembryonic antigen CAP1 peptide epitopes gene coded sequence concatermer that goes out different copy numbers as template amplification when carrying out PCR.
3, human carcinoembryonic antigen peptide epitopes gene coded sequence concatermer according to claim 2 production method, it is characterized in that: the segmental synthetic employing self primer of concatermer-template PCR method.
4, human carcinoembryonic antigen peptide epitopes gene coded sequence concatermer according to claim 2 production method, it is characterized in that: foreign gene is the series aiding connection body of human carcinoembryonic antigen peptide epitopes and connection peptides gene coded sequence.
5, human carcinoembryonic antigen peptide epitopes gene coded sequence concatermer according to claim 2 production method, it is characterized in that: used carrier for expression of eukaryon is pVAX1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310115995 CN1635118A (en) | 2003-12-29 | 2003-12-29 | Synthesis of carcinoembryonic antigen peptide epitope gene coded sequence concatemer and epitope vaccine thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310115995 CN1635118A (en) | 2003-12-29 | 2003-12-29 | Synthesis of carcinoembryonic antigen peptide epitope gene coded sequence concatemer and epitope vaccine thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1635118A true CN1635118A (en) | 2005-07-06 |
Family
ID=34843518
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200310115995 Pending CN1635118A (en) | 2003-12-29 | 2003-12-29 | Synthesis of carcinoembryonic antigen peptide epitope gene coded sequence concatemer and epitope vaccine thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1635118A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102458458A (en) * | 2009-04-17 | 2012-05-16 | 全球免疫股份有限公司 | Combination immunotherapy compositions against cancer and methods |
-
2003
- 2003-12-29 CN CN 200310115995 patent/CN1635118A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102458458A (en) * | 2009-04-17 | 2012-05-16 | 全球免疫股份有限公司 | Combination immunotherapy compositions against cancer and methods |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2322213T3 (en) | NAP PROTEIN OF HELICOBACTER PYLORI. | |
| CN101905018A (en) | Recombinant fusion protein vaccine and attenuated live vector vaccine for treating and preventing helicobacter pylori (Hp) infection | |
| CN100579578C (en) | Pyloric spiral bacillus antigen recombinant vaccine | |
| CN102021173B (en) | Preparation method for soluble truncated human tumor necrosis factor-related apoptosis inducing ligand (TRAIL) active protein | |
| CN103012577B (en) | Recombinant porcine interleukin 4, and encoding gene and expression method thereof | |
| CN1635118A (en) | Synthesis of carcinoembryonic antigen peptide epitope gene coded sequence concatemer and epitope vaccine thereof | |
| CN1872346A (en) | Vaccine for diabetes in type I, and constructing method | |
| CN103012578B (en) | Recombinant porcine interleukin 2, and encoding gene and expression method thereof | |
| CN1287858C (en) | Foot-and-mouth disease gene engineering polypeptide vaccine and its preparing method | |
| CN1803846A (en) | Hybrid protein of p53 protein epitope(SQAMDDLMLS) and filobactivirus gene 8 protein and application thereof | |
| CN1534097A (en) | Chinese prawn heat shock protein 70 gene and its clone method | |
| CN101177684B (en) | Sheep brucella M5 strain ribosome protein L7/L12 gene, encoding protein and uses thereof | |
| CN105176897A (en) | Recombinant engineering strain expressing GnRH/M2 fusion polypeptide and construction and application thereof | |
| CN101525378B (en) | Listonella anguillarum subunit vaccine antigenic protein and application thereof | |
| CN1563388A (en) | Constructing genetic engineering Vaccine of adhesin of confluent Helicobacter pylor and preparation method | |
| CN1100881C (en) | Nucleic acid vaccine for cysticercosis co-contracted by human and pig | |
| CN101153284A (en) | Gene of sheep type brucella M5 mycopremna ribosomal protein L7, its encoding protein and application | |
| CN1778914A (en) | Expression of soluble TRAIL protein | |
| CN1187372C (en) | Synthetic chimeric peptide of human chorionic gonadotrophin genetic engineering and its preparation method | |
| CN1129454C (en) | DNA vaccine for foot-and -mouth disease | |
| CN101045923A (en) | Process of producing interleukin analog | |
| CN1116411C (en) | Process for preparing human Angiostatin transgenic alga | |
| CN1313489C (en) | GP thymosin alpha 1 and preparation method | |
| CN1532281A (en) | RFecombination of carcino-emhyyonic antigen gene fragment and gene vaccine | |
| CN1432578A (en) | Recombinant protein A gene and prepn and application of its expression product |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |