CN1632132A - Probe and its use in associated detection of gene polymorphous site - Google Patents

Probe and its use in associated detection of gene polymorphous site Download PDF

Info

Publication number
CN1632132A
CN1632132A CN 200310122647 CN200310122647A CN1632132A CN 1632132 A CN1632132 A CN 1632132A CN 200310122647 CN200310122647 CN 200310122647 CN 200310122647 A CN200310122647 A CN 200310122647A CN 1632132 A CN1632132 A CN 1632132A
Authority
CN
China
Prior art keywords
probe
pcr
ldr
reaction
site
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 200310122647
Other languages
Chinese (zh)
Inventor
肖振贤
曹慧敏
魏东芝
赵建龙
肖君华
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
East China University of Science and Technology
Shanghai Institute of Microsystem and Information Technology of CAS
Original Assignee
East China University of Science and Technology
Shanghai Institute of Microsystem and Information Technology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by East China University of Science and Technology, Shanghai Institute of Microsystem and Information Technology of CAS filed Critical East China University of Science and Technology
Priority to CN 200310122647 priority Critical patent/CN1632132A/en
Publication of CN1632132A publication Critical patent/CN1632132A/en
Pending legal-status Critical Current

Links

Images

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention discloses a probe and its applications when it is used for relationship detecting gene polymorphism sites. The process adopted in accordance with the present invention is to reconstruct the probe and resolve the problem that the LDR reaction specificity is not high and the probe will affect the PCR reaction by adopting PCR primers with different concentrations and LDR probe. The present invention is capable of improving specificity of LDR reaction, improving precision of polymorphism site detection, reducing the effects of LDR probe on the following PCR reactions, reducing non-specificity amplification products, simplifying the procedure that LDR assorts with PCR to execute gene polymorphism site detection, and omitting the course of residual probe digesting.

Description

A kind of probe and the application in relationship detecting gene polymorphism sites thereof
Technical field
The present invention relates to a kind of probe, relate in particular to the probe and the application thereof of a kind of LDR and PCR relationship detecting gene polymorphism sites.
Technical background
Along with human genome is learned the development of studying, increasing achievement in research will apply in the clinical diagnosis, and this has just required large-scale gene polymorphism sites detection method.
In recent years, ligation is used to detect the attention that gene polymorphism sites more and more causes people, many scholars have done a large amount of research, as: (France Barany et al., Proc.Nat ' l Acad.Sci.USA, 88:189-93 (1991), The Ligase Chain Reaction (LCR) in a PCRWorld, PCR Methods and Applications, 1:5-16 (1991)).
" ligase chain reaction, LCR ", promptly " ligase chain reaction (LCR) " is meant two pairs of probes of design in reaction, makes that ligation can the index amplification template.And " ligase detection reaction, LDR ", promptly " ligase enzyme detection reaction " is only to add a pair of probe in reaction, template is by linear amplification.But there is certain nonspecific reaction in the LDR reaction, have at present and report and to improve the specificity of ligation by the artificial mutational site of introducing in detection probes, as document JianyingLuo et al., Nucleic Acids Research, 1996, Vol.24, the report of No.14 3071-3078, the document is thought will be introduced in the artificial mutation site second site adjacent with detection site, but this method still can not very be eliminated non-specific connection effectively.
In recent years, occurred the related use of LDR technology with round pcr, and the related gene polymorphism sites that is used for of LDR technology, round pcr and biochip technology detects (Norman P.Gerrylet al., J.Mol.Biol. (1999) 292,251-262, U.S.Pat.Pub.No.2003/0032016A1).In these technology, there are some problems,, make LDR and PCR relationship detecting gene polymorphism sites technology have a large amount of false positives such as because there is certain non-specific connection in the LDR reaction; With the LDR reaction product is that template is carried out in the PCR reaction process, because the existence of LDR probe is easy to generate non-specific PCR, U.S.Pat.Pub.No.2003/0032016A1 has used the method by digestive ferment digestion when reducing remaining LDR probe, but its operation is comparatively loaded down with trivial details.
Summary of the invention
The technical issues that need to address of the present invention are to disclose a kind of probe and the application in relationship detecting gene polymorphism sites thereof, to overcome the defective that the LDR specificity is not high and LDR probe influence PCR afterwards reacts that prior art exists.
Technical conceive of the present invention is such: the method that the present invention taked is probe to be transformed and solved the not high and probe of LDR atopic with the PCR primer of different concns and LDR probe influence the problem that PCR reacts.
Technical scheme of the present invention:
The LDR detection probes that this law is bright is made of two class probes: first kind probe comprises two parts, promptly with the complete mating section of template and and PCR primer mating section; The second class probe comprise with template paired part, specific sequence part and and PCR primer mating section, 3 ' end is used for the mutational site and detects, it is characterized in that, introduce artificial mutation in first site adjacent with detection site, promptly unpaired with template, and be used to detect the sudden change difference that the probe in same site is introduced.
The second class probe is according to detecting requirement, and can be two also can be three or four, and the every artificial mutation difference that probe is introduced can reduce the influence of LDR probe to PCR like this.
According to optimized technical scheme of the present invention, in the mutational site of detecting, promptly the sequence of 10-25 base length is respectively designed in the front and back of 3 ' end;
On probe, be provided with and PCR primer mating section, on first kind probe, contain with the PCR upstream primer and match part mutually, on the second class probe, contain with the PCR downstream primer and match part mutually.It is fluorescently-labeled having one in the primer of PCR, as the PCR primer detectable substance mark relative with detection probes, as vitamin H, Cy3, Cy5 etc.
Probe of the present invention can be used for LDR and PCR relationship detecting gene polymorphism sites.
As everyone knows, gene pleiomorphism comprises multiple situations such as unit point transgenation, genetically deficient, insertion and little satellite, the present invention mainly is at the sudden change of gene unit point, and, around the mutational site, there is not the other unit point mutation in about 20 bases.
Application method of the present invention is characterized in that comprising earlier the LDR reaction is carried out in the known mutations site earlier, is that template is carried out the PCR reaction with the LDR product then, reads by PCR product and gene chip hybridization.
Said gene chip is solid surface, as on glass fixed with probe in the complete paired probe sequence of specific sequence.
Specifically comprise the steps:
(1) preparation of LDR product:
Get DNA1 μ l to be detected, first kind detection probes, each 0.04-1 μ M of the second class probe, ligase enzyme 1U-20U, the ligase enzyme damping fluid mixes mutually.The LDR reaction conditions is: 90-98 ℃ 30 seconds, 40-80 ℃ 1-10 minute, circulation 1-40 time;
(2) the related detection of LDR with PCR:
With 1-10 μ l LDR product, PCR primer each 1-100 μ M, pyro polymerase 0.5U-2.0U, the pyro polymerase damping fluid, hybrid reaction, reaction conditions is: 90-98 ℃ 30 seconds, 40-80 ℃ 30 seconds, 72 ℃ 45 seconds, circulation 1-40 time; The used pyro polymerase of this method can be Taq polysaccharase, Tth polysaccharase, Pfu polysaccharase etc.
In the reaction mixture, the concentration of PCR primer is in excess in the LDR concentration and probe concentration greatly, can further reduce of the influence of LDR probe like this to PCR, strengthened its competitive power in the PCR reaction and during the annealing of LDR product, made that promptly the LDR probe and the LDR product annealed that remain in the reaction system promptly can reduce greatly.
(4) result detects:
Get PCR product 1-5 μ l and mix, put, cover with cover glass in the gene chip surface with 1-10 μ l hybridization solution, 30-70 ℃ constant temperature 10-60 minute, with elutriant wash-out 1-30 minute, the result was read in scanning.
Hybridization solution: DIG Easy Hyb. purchases the company in Roche.
Elutriant: 15mM NaCl, 1.5mM trisodium citrate (two water), 0.1%SDS (sodium lauryl sulphate).
After PCR reaction finished, on the gene chip surface, this gene chip surface point had and detection probes specific sequence part paired probe mutually with PCR product point.Polymorphism according to hybridization scanning result interpretation site.
Probe of the present invention not only can be used to optimize LDR and PCR association table loci polymorphism detects, and can also be used for the related multidigit point polymorphism with PCR of LDR and detect, and be used for the test kit of unit point detection and the test kit that the multidigit point polymorphism detects;
Said test kit refers to and comprises above-mentioned probe, and is used for the gene polymorphism sites detection.
Advantage of the present invention and effect:
1. utilization the present invention can improve the specificity of LDR reaction, improves the accuracy that pleomorphism site detects.
2. the present invention has reduced the influence of LDR probe to PCR reaction thereafter, has reduced the non-specific amplification product.
3. the present invention has simplified the related program of carrying out the gene polymorphism sites detection with PCR of LDR, has saved the process that the remaining probe of LDR is digested.
Description of drawings
Fig. 1 is the gene chip that the dna polymorphism that unit point suddenlys change is detected.
Fig. 2 is the signal of unit point detected result.
Fig. 3 is two gene chips that the site is detected simultaneously.
Fig. 4 is result's signal that two sites are detected simultaneously.
Embodiment
Embodiment 1
The design of probe
With hepatitis B virus (HBV) DNA 1896 sites is that example describes, and 1896 sites comprise 1896 wild-types and mutant, and near sequence is:
Wild-type
5’GCTGTGCCTTGGGTGGCTTTGGGGCATGGACATTGACCCG3’
Mutant
5’GCTGTGCCTTGGGTGGCTTTAGGGCATGGACATTGACCCG3’
1. the probe that comprises two parts
The probe title Probe sequence (5 ' → 3 ') Length (nt) Tm(℃)
With the template mating section be AAAGCCACCCAAGGCACAGC 20 71.9
With PCR primer mating section TGGCACCTCGTCTAGATTGA 20 63.3
The total sequence of probe AAAGCCACCCAAGGCACAGCTGGCAC CTCGTCTAGATTGA 40
2. the probe that comprises three parts
(1) detection probes one
The probe title Probe sequence (5 ' → 3 ') Length (nt) Tm(℃)
With the template mating section be GGGTCAATGTCCATGCCAC 19 69.8
The specific sequence part AGTCGCAGCGTGTCC 15 55.6
With PCR primer mating section TAATCCTCCGTAGTGTCGCA 20 63.7
The total sequence of probe TAATCCTCCGTAGTGTCGCAAGTC GCAGCGTGTCCGGGTCAATGTCCA TGCCAC 54
(2) detection probes two
The probe title Probe sequence (5 ' → 3 ') Length (nt) ?Tm(℃)
With the template mating section be GGGTCAATGTCCATGCCTT 19 69.8
The specific sequence part GGTGTCGACGCTGGT 15 55.0
With PCR primer mating section TAATCCTCCGTAGTGTCGCA 20 63.7
The total sequence of probe TAATCCTCCGTAGTGTCGCAAGTCGCA GCGTGTCCGGGTCAATGTCCATGCCTT 54
Annotate: boldface type is a detection site, the mutational site of boldface type for introducing of band underscore.
3.PCR design of primers
Primer sequence (5 ' → 3 ') Length (nt) ??Tm(℃)
??TGGCACCTCGTCTAGATTGA 20 ??63.3
??Cy5-TAATCCTCCGTAGTGTCGCA 20 ??63.7
Embodiment 2
Dna polymorphism to the unit point sudden change detects
With the HBV1896 site is that example detects the unit point dna polymorphism
1.LDR probe design is used embodiment 1 designed probe;
2.PCR design of primers is used embodiment 1 designed primer;
3.LDR reaction, reaction mixture is 20mM Tris-HCl, pH8.3 (25 ℃ of at), 50mMKCl, 10mM MgCl 2, 1mM EDTA, 1mM NAD+, 10mM DTT, 0.1% (v/v) Triton  X-100, each 0.04 μ M of probe, Tth ligase enzyme 15U, 1 μ l, 1896 site template DNAs; The reflection condition be 94 ℃ 30 seconds, 60 ℃ 4 minutes, circulate 20 times;
4.PCR reaction, reaction mixture is 200 μ M dATP, 200 μ M dTTP, 200 μ M dCTP, 200 μ M dGTP, 2mM MgCl 2, 2U Taq archaeal dna polymerase, the upstream and downstream primer of each 1 μ M, wherein primer a 5 ' end is used the Cy5 mark, reaction conditions is: 94 ℃ 30 seconds, 60 ℃ 30 seconds, 72 ℃ 45 seconds, circulate 20 times;
5. PCR product 4 μ l are got in hybridization, add hybridization solution 10 μ l, 98 ℃ of sex change 5 minutes, and ice bath quenches, and mixed solution point on the DNA chip, is added cover glass, 50 ℃ of constant temperature 30 minutes, elutriant wash-out 10 minutes dries up the back and scans, and the results are shown in Figure 1 and Fig. 2.
Embodiment 3
Polymorphism is carried out in two mutational sites simultaneously to be detected
With HBV1896 site and YMDD site is that example detects two site dna polymorphisms simultaneously.
1.1896 the site is designed with embodiment 2:
2.YMDD/YIDD probe design
Sequence is near the YMDD site:
5’TGTCTGGCTTTCAGTTATATG?GATGATGTGGTATTGGGGG?3’
Sequence is near the YIDD site:
5’TGTCTGGCTTTCAGTTATATTGATGATGTGGTATTGGGGG?3’
(1) comprises the probe of two parts
The probe title Probe sequence (5 ' → 3 ') Length (nt) ??Tm(℃)
With the template mating section be ATATAACTGAAAGCCAAACAGTGG 24 ??65.3
With PCR primer mating section TGGCACCTCGTCTAGATTGA 20 ??63.3
The total sequence of probe ATATAACTGAAAGCCAAACAGTGG TGGCACCTCGTCTAGATTGA 44
(2) comprise the probe of three parts
(a) detection probes one
The probe title Probe sequence (5 ' → 3 ') Length (nt) Tm(℃)
With the template mating section be CCCCCAATACCACATCATAC 20 65.5
The specific sequence part GCTGAGGTCGATGCTGAGGTCGCA 24 79.7
With PCR primer mating section CCTCCGTAGTGTCGCA 16 56.4
The total sequence of probe CCTCCGTAGTGTCGCAGCTGAGGTCGATGC TGAGGTCGCACCCCCAATACCACATCATAC 60
(b) detection probes two
The probe title Probe sequence (5 ' → 3 ') Length (nt) Tm(℃)
With the template mating section be CCCCCAATACCACATCATTA 20 65.5
The specific sequence part GCTGCGATCGATGGTCAGGTGCTG 24 79.7
With PCR primer mating section CCTCCGTAGTGTCGCA 16 56.4
The total sequence of probe CCTCCGTAGTGTCGCAGCTGCGATCG ATGGTCAGGTGCTG CCCCCAATACCACATCATTC 60
Annotate: boldface type is a detection site, the mutational site of boldface type for introducing of band underscore.
3.PCR design of primers
Primer sequence (5 ' → 3 ') Length (nt) Tm(℃)
TGGCACCTCGTCTAGATTGA 20 63.3
Cy5-TAATCCTCCGTAGTGTCGCA 20 63.7
4.LDR reaction
Reaction mixture is 20mM Tris-HCl, pH8.3 (25 ℃), 50mM KCl, 10mMMgCl 2, 1mM EDTA, 1mM NAD+, 10mM DTT, 0.1% (v/v) Triton  X-100, each 0.01 μ M of probe, Tth ligase enzyme 15U, 1 μ l, 1896 site template DNAs, 1 μ l YMDD/YIDD site template DNA; The reflection condition be 94 ℃ 30 seconds, 60 ℃ 4 minutes, circulate 20 times;
5.PCR reaction, reaction mixture is 200 μ M dATP, 200 μ M dTTP, 200 μ M dCTP, 200 μ M dGTP, 2mM MgCl 2, 2U Taq archaeal dna polymerase, the upstream and downstream primer of each 1 μ M, wherein primer a 5 ' end is used the Cy5 mark, reaction conditions is: 94 ℃ 30 seconds, 60 ℃ 30 seconds, 72 ℃ 45 seconds, circulate 20 times;
6. PCR product 4 μ l are got in hybridization, add hybridization solution 10 μ l, 98 ℃ of sex change 5 minutes, and ice bath quenches, and mixed solution point on the DNA chip, is added cover glass, 50 ℃ of constant temperature 30 minutes, elutriant wash-out 10 minutes dries up the back and scans, and the results are shown in Figure 3 and Fig. 4.Fig. 3 is a chip point sample synoptic diagram, once is YMDD, YIDD, 1896 wild-types and 1896 mutants from top to bottom, and Fig. 4 is an experimental result.

Claims (12)

1. LDR detection probes, be made of two class probes: first kind probe comprises two parts, promptly with the complete mating section of template and and PCR primer mating section; The second class probe comprise with template paired part, specific sequence part and and PCR primer mating section, 3 ' end is used for the mutational site and detects, it is characterized in that, introduce artificial mutation in first site adjacent with detection site, promptly unpaired with template.
2. probe according to claim 1 is characterized in that, the described second class probe comprises a kind of in two, three or four.
3. probe according to claim 1 is characterized in that, the every artificial mutation difference that probe is introduced.
4. probe according to claim 1 is characterized in that, the first kind and the second class probe and template mating section length are the 10-25 base.
5. probe according to claim 1 is characterized in that, first kind probe and PCR primer mating section are and the pairing of PCR downstream primer that the second class probe and PCR primer mating section are and the pairing of PCR upstream primer.
6. according to the described probe of claim 1～5, it is characterized in that having to have a detectable substance mark in the primer of PCR.
7. according to the application of each described probe of claim 1～6, it is characterized in that, be used for LDR and PCR relationship detecting gene polymorphism sites.
8. the application of probe according to claim 7 is characterized in that, comprise earlier the LDR reaction is carried out in the known mutations site earlier, and be that template is carried out the PCR reaction with the LDR product then, read the result by PCR product and gene chip hybridization.
9. the application of probe according to claim 8 is characterized in that, said gene chip be fixed on the solid surface with probe in the complete paired probe sequence of specific sequence.
10. the application of probe according to claim 7 is characterized in that, the concentration of PCR primer is in excess in the LDR concentration and probe concentration greatly.
11. the application according to each described probe of claim 7～10 is characterized in that, comprises the steps:
(1) preparation of LDR product:
Get DNA1 μ l to be detected, first kind detection probes, each 0.04-1 μ M of the second class probe, ligase enzyme 1U-20U, the ligase enzyme damping fluid mixes mutually.The LDR reaction conditions is: 90-98 ℃ 30 seconds, 40-80 ℃ 1-10 minute, circulation 1-40 time;
(2) the related detection of LDR with PCR:
With 1-10 μ l LDR product, each 1-100pmol of PCR primer, pyro polymerase 0.5U-2.0U, the pyro polymerase mixed solution, hybrid reaction, reaction conditions is: 90-98 ℃ 30 seconds, 40-80 ℃ 30 seconds, 72 ℃ 45 seconds, circulation 1-40 time;
(3) result detects
Get PCR product 1-5 μ l and mix, put, cover with cover glass in the gene chip surface with 1-10 μ l hybridization solution, 30-70 ℃ constant temperature 10-60 minute, with elutriant wash-out 1-30 minute, the result was read in scanning.
12. one kind comprises the test kit that is used for the unit point detection of each described probe of claim 1～13 and the test kit that the multidigit point polymorphism detects.
CN 200310122647 2003-12-22 2003-12-22 Probe and its use in associated detection of gene polymorphous site Pending CN1632132A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 200310122647 CN1632132A (en) 2003-12-22 2003-12-22 Probe and its use in associated detection of gene polymorphous site

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 200310122647 CN1632132A (en) 2003-12-22 2003-12-22 Probe and its use in associated detection of gene polymorphous site

Publications (1)

Publication Number Publication Date
CN1632132A true CN1632132A (en) 2005-06-29

Family

ID=34844557

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 200310122647 Pending CN1632132A (en) 2003-12-22 2003-12-22 Probe and its use in associated detection of gene polymorphous site

Country Status (1)

Country Link
CN (1) CN1632132A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101329250B (en) * 2007-06-20 2011-11-30 上海翼和应用生物技术有限公司 Method for detecting sequence of PCR-LCR gene polymorphism of fluorescence labeling probe
CN107002145A (en) * 2014-10-08 2017-08-01 康奈尔大学 Method for use for leaving combination nuclease, coupled reaction and polymeric enzyme reaction identification and the expression of relative quantification nucleotide sequence, splice variant, transposition, copy number or the change that methylates of prevention

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101329250B (en) * 2007-06-20 2011-11-30 上海翼和应用生物技术有限公司 Method for detecting sequence of PCR-LCR gene polymorphism of fluorescence labeling probe
CN107002145A (en) * 2014-10-08 2017-08-01 康奈尔大学 Method for use for leaving combination nuclease, coupled reaction and polymeric enzyme reaction identification and the expression of relative quantification nucleotide sequence, splice variant, transposition, copy number or the change that methylates of prevention
US11466311B2 (en) 2014-10-08 2022-10-11 Cornell University Method for identification and quantification of nucleic acid expression, splice variant, translocation, copy number, or methylation changes

Similar Documents

Publication Publication Date Title
AU2013267660B2 (en) Methods of detecting single nucleotide polymorphisms at codon 600 of human BRAF
CN109182501B (en) Folate metabolism gene polymorphism detection primer and kit
WO2015178978A2 (en) Strand exchange hairpin primers that give high allelic discrimination
CN110951828A (en) Design method of primer and probe
CN1737164A (en) Method for quickly detecting hepatitis B virus drug-resistant gene variation
JPWO2007083766A1 (en) Method for detecting nucleic acid sequence by intramolecular probe
WO2016165591A1 (en) Mgmt gene promoter methylation detection based on pyrosequencing technology
CN1948508A (en) Multiplexed solid-phase nucleic acid amplification assay
CN110791577A (en) Kit and method for detecting mycobacterium tuberculosis isoniazid drug-resistant mutant gene
Liu et al. Fabrication and application of single nucleotide polymorphisms library on magnetic nanoparticles using adaptor PCR
CN101168773B (en) Nucleic acid sequencing method based on fluorescence quenching
CN101329250B (en) Method for detecting sequence of PCR-LCR gene polymorphism of fluorescence labeling probe
CN1632132A (en) Probe and its use in associated detection of gene polymorphous site
CN101045939A (en) HBV DNA gene subtype detecting method and kit
WO2013105774A1 (en) Method for detecting c-met gene using cuttable probe
CN112852927A (en) Isothermal amplification system and method based on fluorescence self-inhibition probe
CN111154920A (en) Kit for detecting hepatitis B virus and special primer probe set thereof
CN1763519A (en) Dye-containing instant PCR reagent and its use method
CN115747340A (en) Method for detecting human SLCO1B1 genotyping
CN101358231A (en) Application of general fluorescence labeling probe on PCR-LDR gene mononucleotide polymorphism chip
US20140106977A1 (en) Simultaneous detection of multiple mutations
CN1563421A (en) Polymorphism detection chip for gene of enzyme relevant to ethanol metabolism, preparation method of usage
CN106399565A (en) Rs12979860 genotyping dual-color fluorescent PCR rapid detection kit
CN112779322A (en) Gene mutation detection kit based on non-fluorescence labeled probe and high-resolution melting curve, detection method and application thereof
CN1186456C (en) General purpose template nucleic acid detection method and kit

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication