CN1622996A - Synthetic herbicide resistance gene - Google Patents

Abstract

The invention provides a DNA molecule, a DNA construct, a transgenic plant and a transgenic plant part comprising a synthetic DNA sequence. The synthetic DNA sequence encodes an enzyme that degrades 2,4-dichlorophenoxyacetic acid (2,4-D) to dichlorophenol. The synthetic DNA sequence comprises a natural microbial sequence that encodes the enzyme in which at least a plurality of the codons of the natural microbial sequence have been replaced by codons more preferred by a plant. The invention also provides a method of controlling weeds in a field containing transgenic plants according to the invention by applying an auxin herbicide, such as 2,4-D, to the field. The invention further provides methods of selecting plants and plant cells that have been transformed with a DNA construct according to the invention using an auxin herbicide.

Description

The synthetic herbicide resistance gene

Invention field

The present invention relates to the synthetic herbicide resistance gene, the purposes that it prepares Herbicid resistant transgenic plant and is used as selected marker.

Background of invention

2,4 dichlorophenoxyacetic acid (2,4-D) be the weedicide that is used to control broadleaf weeds.2,4-D is by oxygen enrichment Alcaligenes and other microbiological deterioration.Coding oxygen enrichment Alcaligenes is to 2, and first enzyme in the degradation pathway of 4-D is tfdA.This genes encoding catalysis 2,4-D changes 2 into, the dioxygenase enzyme of 4-two chlorophenols (DCP).Than 2,4-D is much smaller, and has reported the transgene tobacco crop, vegetable lamb and the deciduous tree that contain the tfdA gene to 2 to the toxicity of plant for DCP, and the tolerance of 4-D increases.Streber etc., Bio/Technology, 7,811-816 (1989); Lyon etc., Plant Molec.Biol., 13,533-540 (1989); Bayley etc., Theor.Appl.Genet., 83,645-649 (1992); Llewellyn and Last, inHerbicide-Resistant Crops, the 10th chapter, 159-174 page or leaf (Duke, chief editor CRCPress (1996)); Last and Llewellyn, Weed Science, 47,401-404 (1999); United States Patent (USP) 6,153,401,6,100,446 and 5,608,147; With PCT application WO 98/38294 and WO 95/18862.Yet the transgenic plant that do not obtain as yet may run under agriculture situation resist 2, the level of 4-D.See Last and Llewellyn, WeedScience, 47,401-404 (1999).These authors point out the codon optimized of tfdA gene " may strengthen the tolerance level.”Id.at?404。The tfdA gene is also as identifying the selective marker that transforms plant and vegetable cell.United States Patent (USP) 5,608,147; PCT applies for WO 95/18862.

Summary of the invention

The invention provides the dna molecular that comprises the synthetic dna sequence dna.This synthetic dna sequence encoding is degraded to 2,4 dichlorophenoxyacetic acid the enzyme of two chlorophenols.The synthetic dna sequence dna comprises the natural microbial sequence of this enzyme of encoding, and wherein most at least codons of natural microbial sequence are replaced by the preferred codon of plant.

The present invention also provides the DNA construct that comprises the synthetic dna sequence dna of just having described.In this construct, the synthetic dna sequence dna gene expression in plants control sequence that is operably connected.

The present invention further provides the part of transgenic plant or plant.The part of these transgenic plant or plant comprises the synthetic dna sequence dna that can be operatively connected with the gene expression in plants control sequence.

The present invention also provides the method for weed of controlling in the field that contains with good grounds transgenic plant of the present invention.This method comprises to the field uses the growth hormone weedicide of effectively controlling the amount of weeds in the field.Owing to comprising and expressing the synthetic dna sequence dna, transgenic plant tolerate the growth hormone weedicide.Really, for the first time, prepared tolerance growth hormone weedicide level and be higher than the transgenic plant of controlling the normal level of using of weeds in the agricultural substantially.

The present invention further provides the method for selecting to transform plant and vegetable cell.The method of selection transformed plant cells comprises provides the vegetable cell group.At least some vegetable cell is transformed by DNA construct of the present invention in the colony.Then, gained vegetable cell group selects to make transformed plant cells hyperplasia and unconverted vegetable cell not to grow in the substratum of the growth hormone weedicide of outgrowth concentration containing.

The method that select to transform plant comprise provide suspect comprise according to the present invention transgenic plant flora.Then, the growth hormone weedicide is applied to flora, the amount of selected weedicide makes the growth that transforms plant-growth and unconverted plant be suppressed.

The accompanying drawing summary

The figure of Fig. 1: pProPC1SV-SAD.

The figure of Fig. 2: pPZP211-PNPT-311g7.

The figure of Fig. 3: pPZP211-PNPT-512g7.

The figure of Fig. 4: pPZP211-PNPT-311-SAD.

The figure of Fig. 5: pPZP211-PNPT-512-SAD.

In these figure, SAD=is the degraded 2 of dicotyledons reorganization, the synthetic gene of 4-D; The CDS=encoding sequence; The AMV-leader=from 5 ' untranslated leader of alfalfa mosaic virus 35S transcript; PC1SV-promotor=peanut chlorotic streak viral promotors; The T-DNA left side of T-Left=Agrobacterium tumefaciens nopaline Ti-plasmids pTiT37; 3 ' polyadenylation (polyA) termination signal sequence of 35SpolyA=cauliflower mosaic virus (CaMV) 35S transcript; NPTII=neomycin phosphotransferase II; 3 ' polyA termination signal of the gene 7 in the T left side of g7PolyA=Agrobacterium tumefaciens octopine plasmid; The MCS=multiple clone site; The T-DNA right side of T-Right=Agrobacterium tumefaciens Ti-plasmids pTiT37.

The detailed description of the preferred embodiment of the invention

The invention provides the synthetic dna sequence dna." synthetic " used herein is meant that there is the dna sequence dna of sequence in non-natural.

Synthetic dna sequence encoding of the present invention with 2,4 dichlorophenoxyacetic acid (2,4-D) be degraded to the enzyme of two chlorophenols (DCP).This synthetic dna sequence dna comprises the natural microbial sequence of this enzyme of encoding, and wherein most at least codons of natural microbial sequence are replaced by the preferred codon of plant.

" natural microbial sequence " is that coding can be with 2, and 4-D is degraded to the encoding sequence of naturally occurring microbial gene of the enzyme of DCP.Therefore, " natural microbial sequence " can be to separate from the cDNA of microorganism or the encoding sequence of genomic clone, can be the dna molecular with chemosynthesis of the encoding sequence identical with this clone, maybe can be the combination of this sequence.

During verified several bacteriums belong to 2, the plurality of enzymes approach of 4-D degraded.See as Plant Molec.Biol. such as Lyon, 13,533-540 (1989) and the reference of quoting here.Oxygen enrichment Alcaligenes strain (strains of Alcaligenes eutrophus) is to study the most widely in these bacteriums.First enzyme in the A.eutrophus degradation pathway is with 2, and 4-D changes DCP into.This enzyme, so-called monooxygenase, still now known is dioxygenase enzyme (seeing Fukumori etc., J.Bacteriol., 175,2083-2086 (1993)), by the tfdA genes encoding.Therefore, the natural microbial sequence can be the cDNA of coding tfdA dioxygenase enzyme or the encoding sequence of genomic clone.Theor.Appl.Genet. such as Bayley, 83,645-649 (1992), Plant Molec.Biol. such as Lyon, 13,533-540 (1989), J.Bacteriology such as Streber, 169,2950-2955 (1987), Perkins and Lurquin, J.Bacteriology, 170,5669-5672 (1988) and United States Patent (USP) 6,100,446 and 6, this clone and centrifugation thereof have been described in 153,401.Also see Molecular Cloning:A Laboratory Manual such as Maniatis, ColdSpring Harbor, NY (1982), Sambrook etc., Molecular Cloning:ALaboratory Manual, Cold Spring Harbor, NY (1989).

Known a lot of bacterium can degrade 2,4-D, comprise acinetobacter calcoaceticus, Achromobacter, Alcaligenes, Arthrobacter, coryneform bacteria, flavobacterium, pseudomonas and actinomyces strain (as Nocardia bacteria subspecies and green product look streptomycete) (are seen as Llewellyn and Last inHerbicide Resistant Crops, the 10th chapter (Stephen O.Duke ed., CRCPress Inc. (1996)), Bayley etc., Theor.Appl.Genet., 83,645-649 (1992), Lyon etc., Plant Molec.Biol., 13,533-540 (1989), and Streber etc., J.Bacteriology, 169,2950-2955 (1987), Loos, in Degradation Of Herbicides, pages 1-49 (Kearney andKaufman, the chief editor., Marcel Dekker, Inc., New York 1969), with the reference of quoting in these reference), separate degraded 2 with available method well known in the art (as using 2 with the enrichment culture technology, 4-D separates from soil), the other bacterial isolates of 4-D (is seen as Loos, in Degradation Of Herbicides, 1-49 page or leaf (Kearney and Kaufman, chief editor, Marcel Dekker, Inc., New York 1969).Can obtain coding with 2 from these other bacteriums to clone similar mode with tfdA, 4-D changes the other cDNA and the genomic clone of the enzyme of DCP into.See as Bayley etc., Theor.Appl.Genet., 83,645-649 (1992); Lyon etc., Plant Molec.Biol., 13,533-540 (1989); J.Bacteriology such as Streber, 169,2950-2955 (1987), Perkins and Lurquin, J.Bacteriology, 170,5669-5672 (1988); United States Patent (USP) 6,100,446 and 6,153,401.Also see MolecularCloning:A Laboratory Manual such as Maniatis, Cold Spring Harbor, NY (1982), Sambrook etc., Molecular Cloning:A Laboratory Manual, ColdSpring Harbor, NY (1989).In addition, or alternatively, isolating clone, their part, or from their sequence can be used as probe and identifies and separate other clone.See as Perkins and Lurquin J.Bacteriology, 170,5669-5672 (1988); Bayley etc., Theor.Appl.Genet., 83,645-649 (1992); United States Patent (USP) 6,100,446 and 6,153,401.Also see MolecularCloning:A Laboratory Manual such as Maniatis, Cold Spring Harbor, NY (1982), Sambrook etc., Molecular Cloning:A Laboratory Manual, ColdSpring Harbor, NY (1989).The natural microbial sequence can be the encoding sequence of one of these cDNA or genomic clone.

Also known yeast and fungi can degrade 2, and 4-D (sees as Llewellyn and Last inHerbicide-Resistant Crops, the 10th chapter (Stephen O.Duke ed., CRCPress Inc. (1996)); Han and New, Soil Biol.Biochem., 26,1689-1695 (1994); Donnelly etc., Applied And EnvironmentalMicrobiology, 59,2642-2647 (1993); Loos, in Degradation OfHerbicides, 1-49 page or leaf (Kearney and Kaufman, chief editor Marcel Dekker, Inc., New York 1969) and the reference of quoting in these reference), with can obtain to degrade 2 with well known method, the other yeast of 4-D and fungal bacterial strain (as using 2 with the enrichment culture technology, 4-D separates from soil) (are seen as Loos, in Degradation OfHerbicides, 1-49 page or leaf (Kearney and Kaufman, chief editor, Marcel Dekker, Inc., New York 1969); Han and New, Soil Biol.Biochem., 26,1689-1695 (1994)).Can obtain coding with 2 from yeast and fungi with method well known in the art, 4-D changes the other cDNA of enzyme of DCP and genomic clone (obtaining the reference quoted clone's the discussion from bacterium above seeing) into and the natural microbial sequence can be the encoding sequence of one of these cDNA or genomic clone.

In addition, as noted above, the natural microbial sequence can be chemosynthesis wholly or in part.In order to do like this, with well known method to cDNA or genomic clone order-checking as acquisition as described in former sections.See as Molecular Cloning:A LaboratoryManual such as Maniatis Cold Spring Harbor, NY (1982), Sambrook etc., MolecularCloning:A Laboratory Manual, Cold Spring Harbor, NY (1989).Can use the synthetic wholly or in part synthetic dna sequence dna that comprises the encoding sequence of this cDNA or genomic clone of well known method.See as Molecular Cloning:A Laboratory Manual such as Maniatis Cold Spring Harbor, NY (1982), Sambrook etc., Molecular Cloning:A Laboratory Manual, Cold Spring Harbor, NY (1989).For example, can use phosphoramidite (phosphoamidite) chemical method synthetic DNA sequence in automatic dna synthesizer.And, to be that the public is obtainable (see Streber etc., J.Bacteriology, 169 to the tfdA gene order of oxygen enrichment Alcaligenes JMP134,2950-2955 (1987), United States Patent (USP) 6,100,446 and 6,153,401, and GenBank (registration number M16730)), and comprise the also chemosynthesis wholly or in part of synthetic dna sequence dna of the encoding sequence of oxygen enrichment Alcaligenes tfdA gene.

Preferred natural microbial sequence is the natural bacteria sequence." natural bacteria sequence " is that coding can be with 2, and 4-D is degraded to the naturally occurring bacterial gene of the enzyme of DCP.Therefore, " natural bacteria sequence " can be to separate from the cDNA of bacterium or the encoding sequence of genomic clone, can be the dna molecular with chemosynthesis of the encoding sequence identical with this clone, maybe can be the combination of this sequence.Most preferred natural bacteria sequence is to separate from the cDNA of oxygen enrichment Alcaligenes strain or the encoding sequence of genomic clone, has the dna molecular of the chemosynthesis of the encoding sequence identical with this clone, or the combination of this sequence.

As noted above, most at least codons of natural microbial sequence are replaced by the preferred codon of plant (being also referred to as " plant optimization codon " here)." plant is codon more preferably " or " plant optimization codon " is the codon of plant code specific amino acids than the more frequent use of that amino acid whose microorganism codon of coding.Preferably, the plant optimization codon is the plant code amino acid codon of frequent use.The vegetable codon usage can be the general codon usage of plant, a class plant (as dicotyledons), the plant of specific type (as cotton or soybean) etc.The codon usage of plant or preferably can derive out by means known in the art.See Expression, 225-85 page or leaf (Reznikoff ﹠amp as Maximizing Gene; Gold, chief editor, 1986), Perlak etc., Proc.Natl.Acad.Sci.USA, 88,3324-3328 (1991), PCT WO 97/31115, PCT WO 97/11086, EP 646643, EP 553494 and United States Patent (USP) 5,689,052,5,567,862,5,567,600,5,552,299 and 5,017,692.For example, the employed codon of proteic all different aminoacids of the selected expression of plants of plant code is tabulated, those albumen that preferred heights is expressed.This can carry out by hand or use is the software (seeing that PCT applies for WO97/11086) of this purpose design.

Compare with using the natural microbial sequence, the preferred codon of plant that use will be expressed the synthetic dna sequence dna will improve expression.The report of delivering shows that codon usage is in mRNA stability with transcribe and influence gene on the level of efficiency and express in plant.See as Perlak etc., Proc.Natl.Acad.Sci.USA, 88,3324-3328 (1991); Adang etc., PlantMolec.Biol., 21:1131-1145 (1993); Sutton etc., Transgenic Res., 1:228-236 (1992).The codon of not every natural microbial sequence all need be changed into the codon of plant optimization for the expression that is improved.Yet the least preferred codon of preferred plant is at least changed into the codon of plant optimization." the least preferred codon of plant " is that plant is used in question (in question) minimum codon coding specific amino acids in the natural microbial sequence.Be preferably greater than approximately 50%, most preferably about at least 80% microorganism codon is changed into the codon of plant optimization.

Can the codon of plant optimization be imported the natural microbial sequence with method well known in the art.For example, can use site-directed mutagenesis.See Perlak etc., Proc.Natl.Acad.Sci.USA, 88,3324-3328 (1991).Also see Maniatis etc., Molecular Cloning:A Laboratory Manual, Cold Spring Harbor, NY (1982), Sambrook etc., Molecular Cloning:A Laboratory Manual, Cold Spring Harbor, NY (1989).Yet, preferably using chemical synthesis coding degraded 2, the global DNA sequence of the enzyme of 4-D imports the natural microbial sequence with the codon of plant optimization.Especially, when a large amount of microorganism codons are replaced by the codon of plant optimization, very preferably chemosynthesis.In addition, chemosynthesis has lot of advantages.For example, use chemosynthesis to allow dna molecular or its encoded protein sequence are carried out other change, as, optimization expression (as is removed and is disturbed the mRNA secondary structure of transcribing or translating, remove unwanted potential polyadenylation sequence and change A+T and G+C content), insert unique restriction site at convenient point, deletion proteolytic enzyme cutting site etc.

The plant optimization codon replaces the synthetic dna sequence dna of the most at least microorganism codons aminoacid sequence identical with the natural microbial sequence of will encoding, if unique difference that these displacements are sequences of synthetic dna sequence dna to be compared with the natural microbial sequence.Yet the synthetic dna sequence dna can comprise the other change of comparing with the natural microbial sequence.For example, the synthetic dna sequence dna can be encoded 2, and 4-D is degraded to the enzyme of DCP, but because one or more displacements in the natural microbial sequence, insertion or disappearance, its enzyme with (not sudden change) natural microbial sequence encoding is compared, and has the aminoacid sequence of change.The method of carrying out this displacement, insertion and disappearance is well known in the art and top the description.

Well knownly determine 2, whether 4-D has been degraded to the test of DCP.See as Streber etc., J.Bacteriol., 169,2950-2955 (1987); Perkins etc., J.Bacteriol., 170,5669-5672 (1988); Streber etc., Bio/Technology, 7,811-816 (1989); Lyon etc., Plant Molec.Biol., 13,533-540 (1989); Bayley etc., Theor.Appl.Genet., 83,645-649 (1992); Fukumori etc., J.Bacteriol., 175,2083 (1993); Lyon etc., Transgenic Res, 2,162-169 (1993); Llewellyn and Last, inHerbicide-Resistant Crops, the 10th chapter, 159-174 page or leaf (Duke, ed.., CRC Press (1996)); Last and Llewellyn, Weed Science, 47,401-404 (1999).And to 2, the tolerance of 4-D and other growth hormone weedicide can be used to prove this transformation.As follows and the reference of quoting just now.

The present invention also provides the DNA construct that comprises the synthetic DNA sequence that can be operatively connected the gene expression in plants control sequence.Here Ding Yi " DNA construct " is (non-natural exists) dna molecular that effectively DNA is imported the structure of host cell, and this term comprises mosaic gene, expression cassette and carrier.

" can be operatively connected " used herein is meant dna sequence dna so that the connection of the mode that coded albumen is expressed (comprising the order of sequence, the location of sequence and the relative spacing of various sequences).Well known and encoding sequence can be operatively connected the method for expression control sequenc.See as Maniatis etc., Molecular Cloning:A Laboratory Manual, ColdSpring Harbor, NY (1982), Sambrook etc., Molecular Cloning:ALaboratory Manual, Cold Spring Harbor, NY (1989).

" expression control sequenc " is to control the dna sequence dna that relates in transcribing or translating by any way.Well known suitable expression control sequenc and preparation and use their method.

This expression control sequenc should comprise promotor.This promotor can be any dna sequence dna that shows transcriptional activity in the part of selected vegetable cell, plant or plant.This promotor can be induction type or composing type (constitutive).It can be naturally occurring, can be made up of the part of various naturally occurring promotors, or can partially or completely be synthetic.The research of promoter structure provides the guidance of design promotor, as Harley and Reynolds, and Nucleic Acids Res., 15, the guidance of 2343-61 (1987).And, can optimize the position of promotor with respect to transcription initiation.See as Roberts etc., Proc.NatlAcad.Sci.USA, 76,760-4 (1979).The a lot of suitable promotor of using in the well known plant.

For example, the suitable constitutive promoter that uses in the plant comprises: the promotor of plant-derived virus, as (PC1SV) promotor (United States Patent (USP) 5 of peanut chlorotic streak cauliflower mosaic virus (peanut chloroticstreak caulimovirus), 850,019), 35S promoter (the Odell etc. of cauliflower mosaic virus (CaMV), Nature 313:810-812 (1985)), the promotor of chlorella virus methyl transferase gene (United States Patent (USP) 5,563,328), and the total length transcripting promoter (United States Patent (USP) 5 of figwort mosaic virus (FMV), 378,619); Promotor (McElroy etc. as rice actin, Plant Cell 2:163-171 (1990)), ubiquitin (Christensen etc., Plant Mol.Biol.12:619-632 (1989) and Christensen etc., Plant Mol.Biol.18:675-689 (1992)), pEMU (Last etc., Theor.Appl.Genet.81:581-588 (1991)), MAS (Velten etc., EMBO is (1984) J.3:2723-2730), corn H3 histone (Lepetit etc., Mol.Gen.Genet.231:276-285 (1992) and Atanassova etc., Plant Journal 2 (3): 291-300 (1992)), and Brassica napus ALS3 (PCT applies for WO 97/41228); Promotor (seeing United States Patent (USP) 4,771,002,5,102,796,5,182,200,5,428,147) with various edaphic bacilluss (Agrobacterium) gene.

The suitable inducible promoter that uses in the plant comprises: from the promotor that copper is produced the ACE1 system reply PNAS 90:4567-4571 (1993) such as () Mett; The benzenesulfonamide herbicide safener produces the promotor (Hershey etc. of the corn In2 gene of replying, Mol.Gen.Genetics 227:229-237 (1991) and Gatz etc., Mol.Gen.Genetics243:32-38 (1994)), with Tet inhibitor promotor (Gatz etc., Mol.Gen.Genet.227:229-237 (1991) from Tn10.The particularly preferred inducible promoter that uses in the plant is a kind ofly plant is not normally produced the inductor of replying to produce the promotor of replying.Such exemplary inducible promoter is the inducible promoter from the steroid hormone gene, its transcriptional activity is by glucocorticoid inducible (Schena etc., Proc.Natl.Acad.Sci.USA 88:10421 (1991)) or the nearest application of chimeric transcription activator XVE, be used for by the inducible plant expression system (Zuo etc. of estradiol activatory based on estrogen receptor, The Plant Journal, 24:265-273 (2000)).Other inducible promoter that uses in the plant has been described among EP332104, PCT WO93/21334 and the PCT WO 97/06269.

At last, can use by the part of other promotor and partially or completely synthetic start molecular promotor.See as Ni etc., Plant J., 7:661-676 (1995) and PCTWO 95/14098 have described this promotor of using in the plant.

This promotor can comprise, or be comprised one or more enhancer elements by modification.Preferably, promotor will comprise most enhancer elements.Compare with the promotor that does not comprise them, the promotor that contains enhancer element provides higher levels of and transcribes.The suitable enhancer element that uses in the plant comprises PC1SV enhancer element (United States Patent (USP) 5,850,019), CaMV 35S enhancer element (United States Patent (USP) 5,106,739 and 5,164,316) and FMV enhancer element (Maiti etc., Transgenic Res., 6,143-156 (1997)).Also see PCT WO96/23898 and Enhancers And Eukaryotic Expression (Cold SpringHarbor Press, Cold Spring Harbor, NY, 1983).

For effective expression, preferably this encoding sequence also can be operatively connected with 3 ' non-translated sequence.3 ' non-translated sequence will comprise transcription termination sequence and polyadenylation sequence.3 ' non-translational region can be obtained by the flanking region from edaphic bacillus, plant virus, plant or other eukaryotic gene.3 suitable ' the non-translated sequence that uses in the plant comprises those of cauliflower mosaic virus 35S gene, Kidney bean albumen seed storage protein gene, the pea ribulose diphosphate salt carboxylic acid E9 of little subunit gene, soybean 7S storage protein gene, octopine synthase gene and nopaline synthase gene.

Also use 5 ' non-translated sequence.5 ' non-translated sequence is a part that extends to the mRNA of translation initiation codon from 5 ' capsite.This zone of mRNA is that translation initiation is essential and work in the adjusting of genetic expression in the plant.5 suitable ' the non-translational region that uses in the plant comprises those of alfalfa mosaic virus, cucumber mosaic virus envelope protein gene and Tomato mosaic virus.

As noted above, DNA construct can be a carrier.This carrier can contain its dubbing system that duplicates at host cell of one or more permissions.The self-replacation carrier comprises plasmid, clay and virus vector.Alternatively, this carrier can be to allow to be integrated into coding degraded 2, the integrative vector of the host cell chromosome of the synthetic DNA sequence of the enzyme of 4-D.This carrier expectation also has the unique restriction site that inserts dna sequence dna.If carrier does not have unique restriction site, it can be modified and import or remove restriction site and make it be more suitable for further operation so.

DNA construct of the present invention can be used for transforming the vegetable cell (as follows) of any kind.Genetic marker should be used to select plant transformed cell (" selective marker ").The product that selective marker typically allows to bear selection (promptly suppressing not contain the cell growth of this selective marker) or screen this selective marker coding reclaims transformant.

But the selectable marker gene that Plant Transformation is the most generally used is neomycin phosphotransferase II (nptII) gene, separates from Tn5, controls following time when it places the expression of plants control signal, gives the resistance to kantlex.Fraley etc., Proc.Natl.Acad.Sci.USA, 80:4803 (1983).But another selectable marker gene that generally uses is the drug-fast hygromycin phosphotransferase gene of giving antibiotic hygromycin.Vanden Elzen etc., PlantMol.Biol., 5:299 (1985).

But give other selectable marker gene to antibiotic drug-fast bacterium origin comprise gentamycin acetyl transferase, streptomycin phosphotransferase transferring enzyme, aminoglycosides-3 '-adeninyl transferring enzyme and bleomycin resistance decision thing.Hayford etc., Plant Physio.86:1216 (1988), Jones etc., Mol.Gen.Genet.210:86 (1987), Svab etc., Plant Mol.Biol.14:197 (1990), Hille etc., Plant Mol.Biol.7:171 (1986).But other selectable marker gene is given the resistance to weedicide, as glyphosate, and glufosinate or bromoxynil.Comai etc., Nature 317:741-744 (1985), Stalker etc., Science 242:419-423 (1988), Hincbee etc., Bio/Technology 6:915-922 (1988), Stalker etc., J.Biol.Chem.263:6310-6314 (1988) and Gordon-Kamm etc., Plant Cell 2:603-618 (1990).

But other selectable marker gene of Plant Transformation is not the bacterium origin.These genes comprise, for example, and little mouse dihydrofolate reductase, plant 5-enolpyruvylshikimate-3-phosphate synthase and plant acetyl lactic acid synthetic enzyme.Eichholtz etc., Somatic CellMol.Genet.13:67 (1987), Shah etc., Science 233:478 (1986), Charest etc., Plant Cell Rep.8:643 (1990), EP 154,204.

The generally use gene of the transformant that screening is inferred comprises GRD beta-glucuronidase (GUS), beta-galactosidase enzymes, luciferase and chloramphenicol acetyltransferase.Jefferson, R.A., Plant Mol.Biol.Rep.5:387 (1987)., Teeri etc., EMBOJ.8:343 (1989), Koncz etc., Proc.Natl.Acad.Sci.USA 84:131 (1987), De Block etc., EMBO is (1984) J.3:1681, green fluorescent protein (GFP) (Chalfie etc., Science 263:802 (1994), Haseloff etc., TIG 11:328-329 (1995) and PCT application WO 97/41228).Another method of identifying rare relatively transformation event has been used the gene of the dominance composing type conditioning agent of the painted approach of coding Zea corn anthocyanin.Ludwig etc., Science 247:449 (1990).

According to another aspect of the present invention, can be to the tolerance of growth hormone weedicide as the selective marker of plant and vegetable cell." growth hormone weedicide " used herein is meant phenoxy group growth hormone (phenoxy herbicides), and it comprises 2,4-D, 4-chlorophenoxyacetic acid, 4 ,-chloro-2-methylenedioxy phenoxy guanidine-acetic acid, 2,4,5-trichlorophenoxyacetic acid, 2,4-dichlorophenoxy butyric acid, 4-(2-methyl-4-chlorophenoxy) butyric acid, 2-(4-chlorophenoxy) propionic acid, 2-(2,4 dichloro benzene oxygen base) propionic acid, 2-(2,4, the 5-Trichlorophenoxy) propionic acid and these sour salt (comprising amine salt) and ester.The growth hormone weedicide is commercial to be obtained.See Crop ProtectionReference (Chemical ﹠amp; Pharmaceutical Press, Inc., New York, NY, 11th ed., 1995).Preferred growth hormone weedicide is 2,4-D and salt thereof (comprising amine salt) and ester." tolerance " refers to when being positioned over the substratum that contains the growth hormone weedicide level that prevents no transformed cells growth, transformed plant cells can grow (survival, hyperplasia and be regenerated as plant)." tolerance " also refers to behind the growth hormone weedicide of using the amount that suppresses unconverted plant-growth, and transforming plant can grow.

The method of well known selection transformed plant cells.In brief, the DNA construct of the involved synthetic dna sequence dna of the present invention of some vegetable cell conversion at least among the vegetable cell group (as explant or embryo's suspension culture).Gained vegetable cell group is positioned over to contain and selects to make transformed plant cells to grow, and in the substratum of the growth hormone weedicide of the concentration that unconverted vegetable cell is not grown.The suitable concn of growth hormone weedicide can be determined according to experience known in the art.At least 2, under the situation of 4-D, this amount can further need become accidental bud and the thin accidental amount that forms bud of permission conversion plant of forming of the unconverted vegetable cell of inhibition, because this obviously is the situation of naturally occurring bacterium tfdA gene.See United States Patent (USP) 5,608,147 and PCT application WO 95/18862.Usually, 2, should the amount from about 0.001mg/l to about 5mg/l substratum there be preferably approximately 0.01mg/l to 0.2mg/l substratum in 4-D with scope.

Selection also known in the art transforms the method for plant.In brief, the growth hormone weedicide is applied to comprise and the invention provides degraded 2, the flora of the transgenic plant of the DNA construct of 4-D one or more comprising.Select the feasible conversion of the amount plant-growth of growth hormone weedicide, and the growth of unconverted plant is suppressed.The level that suppresses should be enough to feasible conversion and unconverted plant can be easy to distinguish come (promptly suppressing have significance,statistical).This amount can experience as known in the art be determined.Also see Crop Protection Reference (Chemical﹠amp; Pharmaceutical Press, Inc., New York, NY, the 11st edition, 1995).

Can be used for preparation to 2 based on the selection to the growth hormone herbicide tolerant, the plant of 4-D and other growth hormone herbicide tolerant may not need to use another kind of selective marker in this case.Lacking selective marker separately is that advantage is arranged, since it reduces to minimum with expressed exogenous gene quantity.

Also can be used to prepare the transgenic plant of expressing other gene of interest based on selection to the growth hormone herbicide tolerant.Known a lot of this gene and comprise the proteic gene of the commercial value of encoding and give the gene (see the WO97/41228 as PCT, its whole disclosures are incorporated into here as a reference) of the agronomy character of improvement to plant.

DNA construct of the present invention can be used for transforming various vegetable cells.If use selective marker separately, coding degraded 2, the synthetic DNA sequence of the enzyme of 4-D and selective marker can be on identical or different DNA construct.Preferably, they are arranged on the unique DNA construct as transcription unit, make all encoding sequences express together.And, when the tolerance to the growth hormone weedicide is used as selective marker, interested one or more genes and coding degraded 2, the synthetic DNA sequence of the enzyme of 4-D can be on identical or different DNA construct.This construct prepares in identical as mentioned above mode.

Proper host cell comprises the vegetable cell (as follows) of any kind.Preferably, this vegetable cell is the cell of the normal growth hormone weedicide of not degrading.Yet the present invention also can be used for increasing the Degradation Level of growth hormone weedicide the plant of this weedicide of normal degraded.

Therefore, a part and the vegetable cell of " transgenosis " of the present invention plant, plant comprise the growth hormone weedicide of normally not degrading, but made their can the degrade plant of these weedicides, a part and the vegetable cell of plant and this conversion plant, the part of plant and offsprings of vegetable cell according to the present invention by conversion.The part of " transgenosis " of the present invention plant, plant and vegetable cell also comprise normal degraded growth hormone weedicide, but made their can degrade a part and the vegetable cell of more these weedicides or their plant of more effective degraded, plant and this conversion plant, the part of plant and offsprings of vegetable cell according to the present invention by conversion.

" plant " is construed as and is meant that can to carry out the differentiation of photosynthetic unicellular organism or many cells biological, comprises algae, angiosperm (unifacial leaf and dicotyledonous), gymnosperm, bryophyte, pteridophyte and plan pteridophyte." part of plant " is the part of many cells differentiation plant, comprises seed, pollen, plumule, flower, fruit, bud, leaf, root, stem, explant etc." vegetable cell " is construed as structure and the physiology unit that is meant metaphyte.Therefore, term " vegetable cell " is meant the part of plant or plant or derives from any cell of plant.Some examples of the cell that the present invention includes comprise the noble cells of the part of living plant, the noble cells in the cultivation, the undifferentiated cell in the cultivation and the cell of indifferent tissue such as callus or tumour.

The method of well known transformed plant cells.For example, developed a lot of methods of Plant Transformation, comprised biological and physics conversion scheme.See, for example, Miki etc., " Proceduresfor Introducing Foreign DNA into Plants " in Methods in PlantMolecular Biology and Biotechnology, Glick, B.R.and Thompson, J.E. edit. (CRC Press, Inc., Boca Raton, 1993) the 67-88 page or leaf.In addition, can obtain the carrier and the extracorporeal culturing method of vegetable cell or metaplasia and aftergrowth.See, for example, Gruber etc., " Vectors for Plant Transformation " inMethods in Plant Molecular Biology and Biotechnology, Glick, B.R.and Thompson, J.E. edit (CRC Press, Inc., Boca Raton, 1993) the 89-119 page or leaf.

The mechanism of extensive utilization that expression vector is imported plant is based on the natural conversion system of edaphic bacillus.Agrobacterium tumefaciens and root of hair (rhizogenes) edaphic bacillus be the genetic transformation plant cell to the morbific soil bacteria of plant.The Ti of Agrobacterium tumefaciens and rhizobiaceae and Ri plasmid carry respectively is responsible for the gene that plant genetic transforms.See for example Kado, C.I., Crit.Rev.Plant.Sci.10:1 (1991).The soil bacillus carrier system and method that a lot of reference provide agrobacterium-mediated gene to transmit.For example see Horsch etc., Science 227:1229 (1985), Hoekema etc., Nature 303:179 (1983), de Framond etc., Bio/Technology 1:262 (1983), Jordan etc., PlantCell Reports 7:281-284 (1988), Leple etc., Plant Cell Reports11:137-141 (1992), Stomp etc., Plant Phys io.92:1226-1232 (1990), Knauf etc., Plasmid 8:45-54 (1982)), Gruber etc., aforementioned, Miki etc., aforementioned, Moloney etc., Plant CellReports 8:238 (1989), PCT applies for WO 84/02913, WO 84/02919 and WO 84/02920, and EP 116,718 and United States Patent (USP) 4,940,838,5,464,763, with 5,929,300.

Usually the methods for plant transformation that is suitable for is the conversion of particulate mediation, and wherein DNA is carried on particulate (microprojectiles) surface.The biolistic device that accelerates to the speed that is enough to penetrate plant cell wall and film with particulate imports plant tissue with expression vector.Sanford etc., Part.Sci.Technol.5:27 (1987), Sanford, J.C., TrendsBiotech.6:299 (1988), Sanford, J.C., Physio.Plant 79:206 (1990), Klein etc., Biotechnology 10:268 (1992), Klein etc., Nature327:70-73 (1987).

Another method that DNA physics passes to plant is the supersound process of target cell.Zhang etc., Bio/Technology 9:996 (1991).Alternatively, the fusion of liposome or spheroplast has been used for expression vector is imported plant.Des hayes etc., EMBO J., 4:2731 (1985), Christou etc., Proc Natl.Acad.Sci.USA 84:3962 (1987).Also reported use CaCl ₂The precipitator method, polyvinyl alcohol or poly--L-ornithine absorb protoplastis with dna direct.Hain etc., Mol.Gen.Genet.199:161 (1985) and Draper etc., Plant Cell Physiol.23:451 (1982).The electroporation of protoplastis and intact cell and tissue has also been described.Donn etc., In Abstracts ofVIIth International Congresson Plant Cell and Tissue CultureIAPTC, A2-38,53 pages (1990); D ' Halluin etc., Plant Cell 4:1495-1505 (1992), Spencer etc., Plant Mol.Biol.24:51-61 (1994) and Fromm etc., Proc.Natl.Acad.Sci.USA 82:5824 (1985).Other technology comprises microinjection (microinjection) (Crossway, Mol.Gen.Genetics, 202:179-185 (1985)), polyethylene glycol transforms (Krens etc., Nature 296:72-74 (1982)), but carries out the fusion (Fraley etc. of protoplastis with the solution of other entity-minicell, cell, lysosome or other surface lipids, Proc.Natl.Acad.Sci.USA 79:1859-1863 (1982)), with United States Patent (USP) 5,231, the technology of illustrating in 019).

After the selection, transformed plant cells is reproduced in the transgenic plant.The plant regeneration technology is well known in the art and comprises Handbook of Plant Cell Culture, 1-3 volume, Evans etc., chief editor .Macmillan Publishing Co., New York, N.Y. (respectively 1983,1984,1984); Predieri and Malavasi, Plant Cell, Tissue, and Organ Culture 17:133-142 (1989); James, D.J. etc., J.Plant Physio.132:148-154 (1988); Fasolo, F. etc., PlantCell, Tissue, and Or gan Culture 16:75-87 (1989); Valobra and James, Plant Cell, Tissue, and Organ Culture21:51-54 (1990); Srivastava, P.S., etc., Plant Science 42:209-214 (1985); Rowland and Ogden, Hort.Science 27:1127-1129 (1992); Park and Son, Plant Cell, Tissue, and Organ Culture 15:95-105 (1988); Noh and Minocha, Plant Cell Reports 5:464-467 (1986); Brand and Lineberger, Plant Science 57:173-179 (1988); Bozhkov, P.V. etc., Plant Cell Reports 11:386-389 (1992); Kvaalen and yonArnold, Plant Cell, Tissue, and Organ Culture 27:49-57 (1991); Tremblay and Tremblay, Plant Cell Tissue, and Organ Culture 27:95-103 (1991); Gupta and Pullman, United States Patent (USP) 5,036,007; Michler and Bauer, Plant Science 77:111-118 (1991); Wetzstein, H.Y. etc., Plant Science 64:193-201 (1989); McGranahan, G.H. etc., Bio/Technology 6:800-804 (1988); Gingas, V.M., Hort.Science 26:1217-1218 (1991); Chalupa, V., Plant Cell Reports9:398-401 (1990); Gingas and Lineberger, Plant Cell, Tissue, and OrganCulture 17:191-203 (1989); Bureno, M.A. etc., Phys.Plant.85:30-34 (1992); And Roberts, D.R., etc., those of illustrating among the Can.J.Bot.68:1086-1090 (1990).

The transgenic plant that can prepare any kind according to the present invention.This kind of plant comprises for example from belonging to Fragaria, lotus flower, clover (medicago), Onobrychis, trifolium, trigonella, cowpea, oranges and tangerines, flax, Ceranium, cassava, Radix Dauci Sativae, Arabidopsis, Brassica, radish, mustard belongs to, belladonna (atropa), capsicum, thorn apple, henbane, Lycopersicon, tobacco, eggplant, Petunia, purple foxglove, Majorana, witloof, Sunflower Receptacle, Lactuca, Bromus, asparagus, Common Snapdragon, Hererocallis, Nemesia, Flos Pelargonii, Panicum, Pennisetum, Herba Ranunculi Japonici, Sencia, salpiglossis, cucumber, Browalia, glycine, Lolium, corn, wheat, Chinese sorghum (Malus), high mallow, celery, the kind of thorn apple and wooden dicotyledonous forest species.Especially, can transform the broad leaved plant (comprising bean or pea, soybean, cotton, pea, potato, Sunflower Receptacle, tomato, tobacco, fruit tree, ornamental plant and tree) of at present known grown plain weedicide infringement, make them become these herbicide tolerant.Can transform other plant (going into corn, Chinese sorghum, dell, sugarcane, asparagus and grass) of thinking at present to the growth hormone herbicide tolerant and increase their tolerances these weedicides.

Still in another embodiment, the invention provides method for weed in the field of control transgenic plant growth.This method comprises to the growth hormone weedicide of field application significant quantity controls weeds.The method of known applications growth hormone weedicide and they are the amount of control all kinds weeds effectively.See Crop Protection Reference (Chemical ﹠amp; Pharmaceutical Press, Inc., New York, NY, the 11st edition, 1995).For the first time, as result of the present invention, prepared being higher than the transgenic plant of the normal growth hormone weedicide level tolerance of using of agricultural control weeds substantially.

Embodiment

Embodiment 1: coding 2, the generation of the synthetic plant majorizing sequence of 4-D dioxygenase enzyme

Separation is from 2 of the oxygen enrichment Alcaligenes, and 4-D dioxygenase enzyme (is also referred to as monooxygenase usually; On seeing) dna sequence dna of gene derives from GenBank sequence library (registration number M16730).By this dna sequence dna, determined the aminoacid sequence [SEQ ID NO:1] of single open reading frame (ORF) encoded protein.The codon usage table that reflects dicotyledonous ORFs is to be selected to obtain by the random cdna combined sequence of cotton, arabidopsis and the tomato of GenBank database extraction.The codon usage table of reflection unifacial leaf ORFs is to be selected at random to obtain by the cDNA sequence of the corn that also extracts from the GenBank database.Table 1 and table 2 are arranged below.Use the specific codon usage table of these plants, with bacterium 2, the one-level aminoacid sequence that 4-D dioxygenase enzyme obtains is converted to the dicotyledonous and preferred dna encoding sequence of monocotyledons codon [being respectively SEQ ID NOS:2 and 3] of reflection.

Dicotyledonous and the monocotyledons of synthetic optimizes 2,4-D dioxygenase enzyme ORFs[SEQ ID NOS:2 and 3], be then used in that design can effectively express in transgenic plant 2,4-D dioxygenase enzyme gene.For dicotyledonous and unifacial leaf version, these synthetic genes be called SAD (for dicotyledonous reorganization synthetic gene) and SAM (synthetic gene of adapting for unifacial leaf).In order to produce interpretable transcript, in case gene has made up and has been inserted in the Plant Genome, representative is from alfalfa mosaic virus (AMV; Gallie etc., Nucleic Acids Res., 15:8693-8711 (1987)) the 5 ' untranslated leader of 5 ' untranslated leader of 35S transcript just incorporate the design of synthetic gene into.In addition, the flag sequence of coding Cys Ala Gly adds the 3 ' end in the composite coding district of each version synthetic gene to.At last, for easy clone, the sequence of design comprises that the HindIII-specificity is given prominence to and comprises that at 3 ' end Sal I-specificity is outstanding at 5 ' end.The complete design sequence of the composite part of SAD and SAM gene is SEQ ID NO:4 and 5.

For making up the part of designed synthetic SAD and SAM gene, each sequence is divided into the eclipsed oligonucleotide, and 12 oligonucleotide of each bar obtain 24 oligonucleotide of each dna sequence dna altogether in two chains.Following table 3A, 3B, 4A and 4B have provided the complete list of the oligonucleotide of a part that is used to make up synthetic SAD and SAM gene.Use standard phosphoramidite chemical method is used the dna integration technology, Inc., Coralville, Iowa synthetic oligonucleotide.(www.epicentre.com) goes up disclosed use Ampliligase in the World Wide Web based on Sutton etc. 1995 in use ^TMThermostable ligase (Epicentre TechnologiesInc., Madison, WI) step of described scheme assembling synthetic dna molecular.(Invitrogen Life Technologies, Carlsbad is CA) as the mixture of the upper and lower chain oligonucleotide of each synthetic DNA construct phosphorylated oligonucleotide at first to use the T4 polynucleotide kinase.Every kind of mixture contains every kind of oligonucleotide of 10pmol, 70mM Tris/HCl pH 7.6,10mM MgCl ₂, 5mM dithiothreitol (DTT) (DTT), 0.1mM ATP and 10 T4 of unit polynucleotide kinases, cumulative volume 25 μ l.Mixture is 37 ℃ of following incubations 30 minutes, and 70 ℃ of sex change incubations are 10 minutes subsequently, finish phosphorylation.In order to anneal and to be connected oligonucleotide, every kind of reaction mixture in the thermodynamic cycle instrument 70 ℃ handled 10 minutes and be cooled to subsequently 65 ℃ of times more than 10 minutes again.In every kind of mixture, add 65 μ l water in proper order, the 10XAmpliligase damping fluid of 10 μ l (Epicentre Technologies) and 2 μ l Ampliligase (5 units/μ l), the time-temperature more than three hours is reduced to 40 ℃.T

This time stage, in order to improve cloning efficiency, from they separately (Waltham MA) uses Amplitaq Gold in the model PTC-100 thermodynamic cycle instrument at MJ ResearchInc. ^TMArchaeal dna polymerase is at the Perkin Elmer Life Sciences of manufacturers (Boston, the dna sequence dna of complete synthetic SAD of recovery and SAM in the annealing/ligation of the polymerase chain reaction of carrying out under the condition that MA) provides (PCR).The PCR primer that is used to reclaim each sequence is AGATCCTTTTTATTTTTAATTTTCTTTC[SEQ ID NO:6], represent the 28mer of AMV leader sequence 5 ' end and be used for SAD and SAM recovery PCR reaction, with CTCCAGCACACTAAACAACAGCGTC[SEQ ID NO:7], SAD sequence 3 ' terminal specific 25mer, with CTCCAGCACACTACACCACC[SEQ ID NO:8], SAM sequence 3 ' terminal specific 20mer.As Ausubel etc., Current Protocols InMolecular Biology (Green/Wiley Interscience, New York, 1989) described gel-purified corresponding to 918bp suitably size the PCR fragment and be cloned among the pUCR19 between two XcmI restriction sites, pUCR19 is the pUC19 carrier of the modification that designs for quick clone PCR fragment, use XcmI digestion (O ' Mahony and Oliver, PlantMolecular Biology, 39:809-821 (1999)) the T overhang that produces and produce plasmid pUCRsynSAD and pUCRsynSAM.In case the clone enters these carriers, the inset that just checks order confirms the sequence integrity of the part of designed synthetic SAD and SAM gene.(PE Applied Biosystems, Foster City CA) implement dna sequencing according to the instruction of manufacturers to use dRhodamine to stop the cycle sequencing test kit.Use the reaction of PerkinElmer/ABI Prism 310 automatic sequence analyser analytical sequences.

Table 1: dicotyledonous codon usage

Amino acid	Codon	Use %	Amino acid	Codon	Use %
						L-Ala	GCU	45.10	Methionin	AAG	??55.14
	GCA	25.41		AAA	??44.86
							GCC	17.62	Methionine(Met)	AUG	??100.00
	GCG	11.87	Phenylalanine	UUC	??51.60
						Arginine	AGA	32.71		UUU	??48.40
	AGG	23.18	Proline(Pro)	CCU	??37.73
							CGU	18.53		CCA	??34.72
	CGA	10.55		CCG	??14.94
							CGG	7.70		CCC	??12.61
	CGC	7.33	Serine	UCU	??27.64
						L-asparagine	AAC	51.76		UCA	??19.32
	AAU	48.24		AGU	??15.84
						Aspartic acid	GAU	65.56		AGC	??13.98
	GAC	34.44		UCC	??13.50
						Halfcystine	UGU	56.16		UCG	??9.72
	UGC	43.84	Threonine	ACU	??36.71
						L-glutamic acid	GAG	51.01		ACA	??28.49
	GAA	48.99		ACC	??21.89
						Glutamine	CAA	54.26		ACG	??12.91
	CAG	45.74	Tryptophane	UGG	??100.00

Glycine	?GGA	?36.34	Tyrosine	UAC	52.04
							?GGU	?35.49		UAU	47.96
	?GGC	?14.14	Xie Ansuan	GUU	40.71
							?GGG	?14.03		GUG	26.01

Amino acid	Codon	Use %	Amino acid	Codon	Use %
						Histidine	CAU	57.39		GUC	20.56
	CAC	42.61		GUA	12.71
						Isoleucine	AUU	43.44	Stop	UAA	41.50
	AUC	36.28		UGA	40.73
							AUA	20.28		UAG	17.77
Leucine	UUG	24.73
							CUC	19.86
	CUU	19.86
							UUA	12.99
	CAG	11.69
							CUA	10.87

Table 2: unifacial leaf codon usage

Amino acid	Codon	Use %	Amino acid	Codon	Use %
						L-Ala	GCC	36.21	Methionin	AAG	79.42
	GCG	24.24		AAA	20.58
							GCU	23.10	Methionine(Met)	AUG	100.00
	GCA	16.45
						Arginine	AGG	27.35		UUU	29.32
	CGC	27.09	Proline(Pro)	CCA	27.77
							CGG	15.18		CCG	27.06
	AGA	12.94		CCC	23.97
							CGU	11.41		CCU	21.20
	CGA	6.03	Serine	AGC	24.00
						L-asparagine	AAC	68.33		UCC	23.41
	AAU	31.67		UCU	15.47
						Aspartic acid	GAC	62.72		UCG	13.97
	GAU	37.28		UCA	13.59

Amino acid	Codon	Use %	Amino acid	Codon	Use %
						Halfcystine	UGC	73.56		AGU	9.57
	UGU	26.44	Threonine	ACC	40.33
						L-glutamic acid	GAG	73.29		ACU	21.27
	GAA	26.71		ACG	20.39
						Glutamine	CAG	58.31		ACA	18.00
	CAA	41.69	Tryptophane	UGG	100.00
						Glycine	GGC	41.40	Tyrosine	UAC	72.14
	GGG	20.28		UAU	27.86
							GGU	20.25	Xie Ansuan	GUG	37.35
	GGA	18.07		GUC	32.71
						Histidine	CAC	63.83		GUU	22.11
	CAU	36.17		GUA	7.83
						Isoleucine	AUC	57.82	Stop	UGA	44.57
	AUU	28.52		UAG	28.24
							AUA	136.5		UAA	27.18
Leucine	CUC	27.01
							CUU	27.01
	CUG	23.80
							UUG	11.90
	CUA	6.23
							UUA	4.05

Table 3A

Dicotyledonous oligonucleotide: positive-sense strand

AGCTAGATCCTTTTTATTTTTAATTTTCTTTCAAATACTTCCAG?????????????[SEQ?ID?NO：13]

ATCCATGTCTGTTGTTGCTAACCCTTTGCATCCTTTGTTCGCTGCTGGAG

TTGAGGATATTGATCTCAGAGAAGCATTGG???????????????????????????[SEQ?ID?NO：14]

GTTCTACTGAGGTGAGAGAAATTGAGAGACTCATGGACGAAAAGTCAGTT

CTCGTTTTCAGAGGTCAACCACTCTCACAG???????????????????????????[SEQ?ID?NO：15]

GATCAACAGATTGCTTTTGCTAGGAATTTTGGACCTTTGGAGGGTGGATT

CATCAAAGTGAACCAGAGACCATCTAGGTT???????????????????????????[SEQ?ID?NO：16]

CAAATATGCTGAACTCGCTGATATCTCTAATGTTTCATTGGATGGTAAGG

TGGCACAAAGAGACGCTAGAGAAGTTGTGG???????????????????????????[SEQ?ID?NO：17]

GAAATTTTGCAAATCAATTGTGGCATTCTGATTCTTCATTCCAACAGCCA

GCAGCTAGATATTCTATGTTGTCAGCTGTT???????????????????????????[SEQ?ID?NO：18]

GTTGTGCCTCCTTCTGGAGGTGATACAGAATTTTGTGATATGAGGGCAGC

TTACGATGCTCTCCCAAGGGATTTGCAGTC???????????????????????????[SEQ?ID?NO：19]

TGAACTCGAGGGATTGAGAGCTGAACATTACGCTTTGAACTCAAGATTTC

TCTTGGGAGATACTGATTACTCAGAGGCAC???????????????????????????[SEQ?ID?NO：20]

AGAGAAACGCTATGCCTCCTGTTAACTGGCCTCTCGTTAGGACTCATGCT

GGTTCTGGTAGAAAGTTCTTGTTTATTGGA???????????????????????????[SEQ?ID?NO：21]

GCACATGCTTCACATGTTGAGGGTCTCCCTGTTGCTGAGGGAAGAATGTT

GCTCGCTGAATTGCTCGAACATGCTACTCA???????????????????????????[SEQ?ID?NO：22]

AAGAGAGTTTGTTTATAGACACAGATGGAATGTTGGTGACTTGGTTATGT

GGGATAATAGATGTGTGTTGCATAGAGGTA???????????????????????????[SEQ?ID?NO：23]

GGAGATATGATATTTCTGCTAGAAGGGAACTCAGAAGGGCTACTACTTTG

GATGACGCTGTTGTTTAGTGTGCTGGAG?????????????????????????????[SEQ?ID?NO：24]

Table 3B

Dicotyledonous oligonucleotide: unjust chain

GAACAAAGGATGCAAAGGGTTAGCAACAACAGACATGGATCTGGAAGTAT

TTGAAAGAAAATTAAAAATAAAAAGGATCT??????????????????????????[SEQ?ID?NO：25]

TCGTCCATGAGTCTCTCAATTTCTCTCACCTCAGTAGAACCCAATGCTTC

TCTGAGATCAATATCCTCAACTCCAGCAGC??????????????????????????[SEQ?ID?NO：26]

CCAAAGGTCCAAAATTCCTAGCAAAAGCAATCTGTTGATCCTGTGAGAGT

GGTTGACCTCTGAAAACGAGAACTGACTTT??????????????????????????[SEQ?ID?NO：27]

CAATGAAACATTAGAGATATCAGCGAGTTCAGCATATTTGAACCTAGATG

GTCTCTGGTTCACTTTGATGAATCCACCCT??????????????????????????[SEQ?ID?NO：28]

AATGAAGAATCAGAATGCCACAATTGATTTGCAAAATTTCCCACAACTTC

TCTAGCGTCTCTTTGTGCCACCTTACCATC??????????????????????????[SEQ?ID?NO：29]

TATCACAAAATTCTGTATCACCTCCAGAAGGAGGCACAACAACAGCTGAC

AACATAGAATATCTAGCTGCTGGCTGTTGG??????????????????????????[SEQ?ID?NO：30]

GTTCAAAGCGTAATGTTCAGCTCTCAATCCCTCGAGTTCAGACTGCAAAT

CCCTTGGGAGAGCATCGTAAGCTGCCCTCA??????????????????????????[SEQ?ID?NO：31]

CTAACGAGAGGCCAGTTAACAGGAGGCATAGCGTTTCTCTGTGCCTCTGA

GTAATCAGTATCTCCCAAGAGAAATCTTGA??????????????????????????[SEQ?ID?NO：32]

CCTCAGCAACAGGGAGACCCTCAACATGTGAAGCATGTGCTCCAATAAAC

AAGAACTTTCTACCAGAACCAGCATGAGTC??????????????????????????[SEQ?ID?NO：33]

GTCACCAACATTCCATCTGTGTCTATAAACAAACTCTCTTTGAGTAGCAT

GTTCGAGCAATTCAGCGAGCAACATTCTTC??????????????????????????[SEQ?ID?NO：34]

GCCCTTCTGAGTTCCCTTCTAGCAGAAATATCATATCTCCTACCTCTATG

CAACACACATCTATTATCCCACATAACCAA??????????????????????????[SEQ?ID?NO：35]

TCGACTCCAGCACACTAAACAACAGCGTCATCCAAAGTAGTA??????????????[SEQ?ID?NO：36]

Table 4A

Unifacial leaf oligonucleotide: positive-sense strand

AGCTAGATCCTTTTTATTTTTAATTTTCTTTCAAATACTTCCAG????????????[SEQ?ID?NO：37]

ATCCATGTCCGTGGTGGCCAACCCACTCCACCCGCTCTTCGCGGCCGGCG

TGGAGGATATCGACCTCAGGGAGGCGCTGG??????????????????????????[SEQ?ID?NO：38]

GCAGCACCGAAGTGCGCGAAATCGAGAGGCTCATGGACGAGAAGAGCGTC

CTCGTCTTCCGCGGCCAACCACTCTCACAG??????????????????????????[SEQ?ID?NO：39]

GATCAACAGATTGCTTTTGCTAGGAATTTTGGACCTTTGGAGGGTGGATT

CATCAAGGTGAACCAGCGCCCGTCCAGGTT??????????????????????????[SEQ?ID?NO：40]

CAAGTACGCTGAACTGGCCGACATCAGCAACGTGTCCCTCGATGGGAAGG

TGGCCCAGAGGGACGCTAGGGAAGTTGTGG??????????????????????????[SEQ?ID?NO：41]

GCAACTTCGCCAACCAACTGTGGCACTCCGATAGCTCTTTCCAACAGCCA

GCAGCCAGGTACTCCATGCTGAGCGCCGTC??????????????????????????[SEQ?ID?NO：42]

GTCGTGCCACCATCCGGCGGTGACACCGAGTTCTGCGATATGCGCGCCGC

GTACGACGCCCTCCCGAGGGATCTGCAGAG??????????????????????????[SEQ??ID?NO：43]

CGAGCTGGAGGGCCTCCGCGCGGAGCACTACGCCCTCAACAGCAGGTTCC

TCCTGGGGGACACTGACTACTCCGAGGCCC??????????????????????????[SEQ?ID?NO：44]

AGAGGAACGCGATGCCACCAGTGAACTGGCCCCTCGTCCGCACCCACGCT

GGCAGCGGCCGCAAGTTCCTGTTCATCGGG??????????????????????????[SEQ?ID?NO：45]

GCCCATGCCTCCCATGTGGAGGGTCTCCCTGTCGCGGAGGGCCGCATGCT

CCTGGCCGAGCTCCTGGAGCACGCCACCCA??????????????????????????[SEQ?ID?NO：46]

ACGCGAGTTCGTCTACCGCCACAGGTGGAATGTCGGCGACCTCGTCATGT

GGGATAACCGCTGCGTGCTGCACCGCGGCA??????????????????????????[SEQ?ID?NO：47]

GGCGCTACGATATCAGCGCGCGCAGGGAACTCAGGCGCGCCACCACCCTC

GACGACGCGGTGGTGTAGTGTGCTGGAG????????????????????????????[SEQ?ID?NO：48]

Table 4B

Unifacial leaf oligonucleotide: unjust chain

GAAGAGCGGGTGGAGTGGGTTGGCCACCACGGACATGGATCTGGAAGTAT

TTGAAAGAAAATTAAAAATAAAAAGGATCT???????????????????????????[SEQ?ID?NO：49]

TCGTCCATGAGCCTCTCGATTTCGCGCACTTCGGTGCTGCCCAGCGCCTC

CCTGAGGTCGATATCCTCCACGCCGGCCGC???????????????????????????[SEQ?ID?NO：50]

CCAAAGGTCCAAAATTCCTAGCAAAAGCAATCTGTTGATCCTGTGAGAGT

GGTTGGCCGCGGAAGACGAGGACGCTCTTC???????????????????????????[SEQ?ID?NO：51]

GAGGGACACGTTGCTGATGTCGGCCAGTTCAGCGTACTTGAACCTGGACG

GGCGCTGGTTCACCTTGATGAATCCACCCT???????????????????????????[SEQ?ID?NO：52]

AAAGAGCTATCGGAGTGCCACAGTTGGTTGGCGAAGTTGCCCACAACTTC

CCTAGCGTCCCTCTGGGCCACCTTCCCATC???????????????????????????[SEQ?ID?NO：53]

TATCGCAGAACTCGGTGTCACCGCCGGATGGTGGCACGACGACGGCGCTC

AGCATGGAGTACCTGGCTGCTGGCTGTTGG???????????????????????????[SEQ?ID?NO：54]

GTTGAGGGCGTAGTGCTCCGCGCGGAGGCCCTCCAGCTCGCTCTGCAGAT

CCCTCGGGAGGGCGTCGTACGCGGCGCGCA???????????????????????????[SEQ?ID?NO：55]

CGGACGAGGGGCCAGTTCACTGGTGGCATCGCGTTCCTCTGGGCCTCGGA

GTAGTCAGTGTCCCCCAGGAGGAACCTGCT???????????????????????????[SEQ?ID?NO：56]

CCTCCGCGACAGGGAGACCCTCCACATGGGAGGCATGGGCCCCGATGAAC

AGGAACTTGCGGCCGCTGCCAGCGTGGGTG???????????????????????????[SEQ?ID?NO：57]

GTCGCCGACATTCCACCTGTGGCGGTAGACGAACTCGCGTTGGGTGGCGT

GCTCCAGGAGCTCGGCCAGGAGCATGCGGC???????????????????????????[SEQ?ID?NO：58]

GCGCGCCTGAGTTCCCTGCGCGCGCTGATATCGTAGCGCCTGCCGCGGTG

CAGCACGCAGCGGTTATCCCACATGACGAG???????????????????????????[SEQ?ID?NO：59]

TCGACTCCAGCACACTACACCACCGCGTCGTCGAGGGTGGTG???????????????[SEQ?ID?NO：60]

Embodiment 2: plant can be expressed the structure of SAD gene

Generation for complete sum plant-competent SAD gene, fill overhang with XbaI digestion and with dna polymerase i (the big fragment of Klenow), subsequently with KpnI digestion, at first discharge the part that 5 ' end of composition sequence is removed the synthetic SAD gene that comprises among the pUCRsynSAD.This connects into plasmid pProPClSV, from pKLP36 (Maiti and Shepherd, Biochem.Biophys.Res.Com., 244:440-444 (1998) is described) contain the pUC19 plasmid that strengthens peanut chlorotic streak virus (PC1SV) promotor, at first cut with NcoI, the overhang that handle to fill produces with dna polymerase i (the big fragment of Klenow) and cutting with KpnI subsequently.The plasmid pProPC1SV-SAD of this generation has a synthetic SAD gene part in it, comprise that the leading 3 ' zone with coding Cys Ala Gly mark of 5 ' AMV directly is connected (Fig. 1) with 3 of PC1SV promotor ' end.The source that this plasmid makes up as PC1SV-SAD before the importing edaphic bacillus carries out Plant Transformation, is inserted two component carriers and is carried out gene constructed at last.

Select two two component carrier-pPZP211-PNPT-311g7 (Fig. 2) and pPZP211-PNPT-512g7 (Fig. 3) to carry out gene constructed at last.These two carriers are based on Hajdukiewicz etc., Plant Molec.Biol., the pPZP family of the described carrier of 25:989-994 (1994), it is the pPZP211 derivative, wherein neomycin phosphotransferase II (NPTII) gene of neomycin resistance is placed adjacent with multiple clone site (MCS, Fig. 2 and 3) by PC1SV promoters driven and g7 polyA terminator sequence.Unique difference is the position of MCS with respect to g7 polyA terminator sequence between these two carriers.G7 polyA terminator sequence be from 3 ' polyA termination signal of the gene 7 of the octopine T-Left of octopine Agrobacterium tumefaciens Ti-plasmids with separate as EcoRI-SalI fragment (Velten and Schell from pAP2034, Nucleic Acids, 13:6981-6998 (1985)).

Remove the PC1SV-SAD sequence as the HindIII-SmaI fragment and insert pPZP211-PNPT-311g7 and pPZP211-PNPT-512g7 from pProPC1SV-SAD, they are from first handling filling overhang sequence and digest with HindIII subsequently with BamHI digestion and with dna polymerase i (the big fragment of Klenow).These reactions produce two carriers, pPZP211-PNPT-311-SAD (Fig. 4) and pPZP211-PNPT-512-SAD (Fig. 5), and at one of both direction of PC1SV-NPTII-35SpolyA construct, they contain complete plant can express the SAD gene.Carry out this design that the SAD gene inserts Plant Genome, because uncertain to the influence of effective transmission of conversion and expressed proterties about in identical plasmid, having two PC1SV promoter sequences.The SAD gene is put into carrier make the PC1SV promotor insert, can avoid the possibility of aftermath as directly repeating with counter-rotating.

Behind the structure, as mentioned above the SAD gene in each carrier is checked order to guarantee validity.This demonstration of checking order, in the structure of pProPC1SV-SAD, the outer ATG codon of framework is imported into 5 ' untranslated leader.The existence of this ATG codon will change the convertibility of transcript, and therefore it also recover normal AMV leader sequence by PCR mutagenesis deletion from the SAD gene is synthetic.After the reparation, for validity is checked this sequence.The original SAD genetic marker that contains the outer ATG of framework is SAD1 (because some transformation experiment uses this construct to begin).The SAD gene of this reparation is called SAD2 and is to be used for unique version that the SAD construct is incorporated into the gene of cotton gene.

Embodiment 3:SAD2 imports cotton

By as Walker-Peach and Velten, in Plant Molecular BiologyManual, B1 joint: 1-19 (Gelvin, Shilperoort and Verma, the chief editor, Kluwer Academic Publishers, Dordrecht, The Netherlands, 1994)) described direct conversion contains two the two component carrier-pPZP211-PNPT-311-SAD2 and the pPZP211-PNPT-512-SAD2 of SAD2 gene, import EHA 105 strains (Hood etc., Transgenic Research, 2:208-218 (1993)) of Agrobacterium tumefaciens separately.This construct is subsequently by the cotyledon explant of edaphic bacillus transfection importing from cotton mutation Coker312 (Coker Seed Inc.).This is by separating aseptic cotyledon tissue (from the seedling that grows in the surface sterilization seed culture), produces explant (using aseptic cork drill) and explant immersed to contain suitable construct, finishes in cultivate 48 hours of the EHA 105 of 28 ℃ of growths.Then this explant is transferred to (MS substratum+0.2mg/L 2,4-D and 0.1mg/L kinetin) on the 2MST substratum, removes excessive EHA 105 subsequently.The cotyledon that infects is organized in and transfers to T1+KCL substratum (MS substratum+0.1mg/L2,4-D and 0.1mg/L kinetin+50mg/L Kanamycin Sulfate and 250mg/L cefotaxime) before, and 28 ℃ of incubations are 2 days on the 2MST substratum.In case form healthy callus, just it be positioned over fresh T1+KCL and (contain 0.05mg/L 2,4-D) carry out second and take turns selection.After six weeks, from the callus of survival, produce the somatocyte plumule, as Trolinder and Goodin, Plant Cell Reports, the ripe transgene cotton plant of the described preparation of 6:231-234 (1987).

Common property is given birth to the cotton seedling (pPZP211-PNPT-311-SAD has produced 44 strains in transforming, and pPZP211-PNPT-512-SAD2 has produced 67 strains in transforming) of the anti-kantlex of 111 strains.With the existence of SAD composite coding sequence and NPTII encoding sequence in each plant of pcr analysis to guarantee to insert the integrity of DNA.Implement PCR as mentioned above.The primer that is used for this analysis is, for the SAD coding region is GGAGTTGAGGATATTGATCTCAGAGAAGCATTG[SEQ ID NO:9] and GCGATCTGCTGATCCTGACTC (SEQ ID NO:10], be CGTCAAGAAGGCGATAGAAGG[SEQ ID NO:11 for the NPTII coding region] and GCTATGACTGGGCACAACAGAC[SEQID NO:12].Handle in the 44 strain pPZP211-PNPT-311-SAD seedling of survival at kantlex, handle in the 67 strain pPZP211-PNPT-512-SAD seedling of survival at kantlex, PCR detects 14 strain feminine genders.

Remain 95 strains and be grown in the basin in greenhouse, spray 2 with 1lb/ acre acid Equivalent then up to square at least phase (about 18 " height), and 4-D amine (United Agri Products, Greeley, CO).This is to use 2, the twice of the normal field speed of 4-D.In 95 strain plants, the 22 strains survival of this processing back, seldom or do not have a tangible weedicide infringement.11 strains contain the pPZP211-PNPT-311-SAD2 construct in these plants, and 11 strains contain the pPZP211-PNPT-512-SAD2 construct.Every kind of plant grows to the ripening stage in the greenhouse.

In 22 strain transgenic plant, only 7 strains have produced seed.The residue plant is obviously barren.Infer that this infertility is the effect of the very common reproducer of cotton.In the fertile plant of seven strains, 3 strains contain the pPZP211-PNPT-311-SAD2 construct, and 4 strains contain the pPZP211-PNPT-311-SAD2 construct.

For the synthetic SAD gene that confirms to insert can heredity and in order to obtain the indication that gene inserts quantity, the seed that can breed SAD transgenic cotton flowering plant from seven strains implant used Peters specialty water-soluble fertilizer (5-11-26 HYDRO-SOL, replenishing nitrocalcite and sal epsom provides complete nutrition to praise; Hummert, St.Louis, MO) saturated hydroponicrock wool slabs (Hummert, St.Louis, MO).Hydroponic rock wool slabs is placed on the platform in greenhouse, uses acyclic water culture watering system to make nutrition keep optimum level.Plant grew 24 days down at greenhouse experiment (28 ℃+5 ℃ temperature).At this point, take out plant and spray prominent hat, spray 2 with the normal field speed of 1/2 lb/ acre acid Equivalent, 4-D maintaining in the prominent hat 24 hours, allows 2, and the greenhouse is then put back in the 4-D volatilization.10-14 days after-visions are estimated the effect of processing, and following table 5 has been described the result.

Table 5

Transgenic lines	Plant quantity	Harmless	Some symptom	Grievous injury	Ratio " Res "/Sens
						311-22-1-4	??43	??16	??16	??11	?3∶1
311-22-1-5	??47	??6	??18	??23	?1∶1
						311-22-1-8	??56	??14	??28	??14	?3∶1
512-21-1-5	??56	??8	??34	??14	?3∶1
						512-21-4-3	??30	??7	??20	??3	?9∶1
512-21-4-5	??41	??5	??24	??12	?2∶1
						512-24-4-4	??63	??7	??21	??35	?1∶1
2,4-D res contrast	??55	??7	??33	??15	?3∶1
						2,4-D sens contrast	??45	??0	??20	??25	?1∶1

2,4-D res contrasts=contains the transgenosis 2 of the natural tfdA of existence gene construct, 4-D resistant cotton (Bayley etc., Theoretical Applied Genetics, 83:645-649 (1992))
	2,4-D sens contrast=with with those identical modes that contain the SAD construct by somatic embryo regenerated Coker 312 (not genetically modified)
Withered and the minority leaf drying of some symptom=some leaf
	The significantly withered and dry easily infringement of grievous injury=all leaves

Ratio " Res "/Sens with in the experimentation to 2, the plant quantity of some resistance of 4-D processes and displays is divided by showing that grievous injury or dead combinations of plant quantity calculates.Do not show some sign of opposing from Coker 312 negative controls of tissue regeneration, so these ratios can not be thought definite appraisal of SAD gene Mendelian inheritance.Yet all negative control plants demonstrate 2 really, the infringement of 4-D inductive, however each all transgenic lines that contain the SAD gene do not show infringement at all.

With 2,4-D handled 24 days each strain that does not show 7 strains that damage, and wherein five strains are selected in the back of germinateing, and get each new formation leaf sample, and one of each plant is implemented the PCR detection as mentioned above.PCR detects each plant SAD construct positive.These plant further growths 14 days spray 2,4-D amine once more with the normal field speed of 1/2 lb/ acre acid Equivalent then.After this processing, all 35 strain plants do not show infringement, yet all negative controls do not survive this sprinkling incident.35 strain plant-growths are to the ripening stage, and the collection seed.

The content of each reference mentioned above comprises that publication, patent and disclosed application incorporate into here as a reference.

Sequence table

<110>Oliver，Mel

＜120〉synthetic Herbicid resistant group

<130>3553-30prov

<160>60

<170>PatentIn?version?3.0

<210>1

<211>287

<212>PRT

＜213〉oxygen enrichment Alcaligenes

<400>1

Met?Ser?Val?Val?Ala?Asn?Pro?Leu?His?Pro?Leu?Phe?Ala?Ala?Gly?Val

1???????????????5???????????????????10??????????????????15

Glu?Asp?Ile?Asp?Leu?Arg?Glu?Ala?Leu?Gly?Ser?Thr?Glu?Val?Arg?Glu

20??????????????????25??????????????????30

Ile?Glu?Arg?Leu?Met?Asp?Glu?Lys?Ser?Val?Leu?Val?Phe?Arg?Gly?Gln

35??????????????????40??????????????????45

Pro?Leu?Ser?Gln?Asp?Gln?Gln?Ile?Ala?Phe?Ala?Arg?Asn?Phe?Gly?Pro

50??????????????????55??????????????????60

Leu?Glu?Gly?Gly?Phe?Ile?Lys?Val?Asn?Gln?Arg?Pro?Ser?Arg?Phe?Lys

65??????????????????70??????????????????75??????????????????80

Tyr?Ala?Glu?Leu?Ala?Asp?Ile?Ser?Asn?Val?Ser?Leu?Asp?Gly?Lys?Val

85??????????????????90??????????????????95

Ala?Gln?Arg?Asp?Ala?Arg?Glu?Val?Val?Gly?Asn?Phe?Ala?Asn?Gln?Leu

100?????????????????105?????????????????110

Trp?His?Ser?Asp?Ser?Ser?Phe?Gln?Gln?Pro?Ala?Ala?Arg?Tyr?Ser?Met

115?????????????????120?????????????????125

Leu?Ser?Ala?Val?Val?Val?Pro?Pro?Ser?Gly?Gly?Asp?Thr?Glu?Phe?Cys

130?????????????????135?????????????????140

Asp?Met?Arg?Ala?Ala?Tyr?Asp?Ala?Leu?Pro?Arg?Asp?Leu?Gln?Ser?Glu

145?????????????????150?????????????????155?????????????????160

Leu?Glu?Gly?Leu?Arg?Ala?Glu?His?Tyr?Ala?Leu?Asn?Ser?Arg?Phe?Leu

165?????????????????170?????????????????175

Leu?Gly?Asp?Thr?Asp?Tyr?Ser?Glu?Ala?Gln?Arg?Asn?Ala?Met?Pro?Pro

180?????????????????185?????????????????190

Val?Asn?Trp?Pro?Leu?Val?Arg?Thr?His?Ala?Gly?Ser?Gly?Arg?Lys?Phe

195?????????????????200?????????????????205

Leu?Phe?Ile?Gly?Ala?His?Ala?Ser?His?Val?Glu?Gly?Leu?Pro?Val?Ala

210?????????????????215?????????????????220

Glu?Gly?Arg?Met?Leu?Leu?Ala?Glu?Leu?Leu?Glu?His?Ala?Thr?Gln?Arg

225?????????????????230?????????????????235?????????????????240

Glu?Phe?Val?Tyr?Arg?His?Arg?Trp?Asn?Val?Gly?Asp?Leu?Val?Met?Trp

245?????????????????250?????????????????255

Asp?Asn?Arg?Cys?Val?Leu?His?Arg?Gly?Arg?Arg?Tyr?Asp?Ile?Ser?Ala

260?????????????????265?????????????????270

Arg?Arg?Glu?Leu?Arg?Arg?Ala?Thr?Thr?Leu?Asp?Asp?Ala?Val?Val

275?????????????????280?????????????????285

<210>2

<211>864

<212>DNA

＜213〉artificial sequence

<220>

＜221〉exon

<222>(1)..(864)

<220>

＜221〉misc_ feature

<222>(1)..(864)

＜223〉degraded 2, the dicotyledonous ORF of 4-D

<400>2

atg?tct?gtt?gtt?gct?aac?cct?ttg?cat?cct?ttg?ttc?gct?gct?gga?gtt???????48

Met?Ser?Val?Val?Ala?Asn?Pro?Leu?His?Pro?Leu?Phe?Ala?Ala?Gly?Val

1???????????????5???????????????????10??????????????????15

gag?gat?att?gat?ctc?aga?gaa?gca?ttg?ggt?tct?act?gag?gtg?aga?gaa???????96

Glu?Asp?Ile?Asp?Leu?Arg?Glu?Ala?Leu?Gly?Ser?Thr?Glu?Val?Arg?Glu

20??????????????????25??????????????????30

att?gag?aga?ctc?atg?gac?gaa?aag?tca?gtt?ctc?gtt?ttc?aga?ggt?caa??????144

Ile?Glu?Arg?Leu?Met?Asp?Glu?Lys?Ser?Val?Leu?Val?Phe?Arg?Gly?Gln

35??????????????????40??????????????????45

cca?ctc?tca?cag?gat?caa?cag?att?gct?ttt?gct?agg?aat?ttt?gga?cct??????192

Pro?Leu?Ser?Gln?Asp?Gln?Gln?Ile?Ala?Phe?Ala?Arg?Asn?Phe?Gly?Pro

50??????????????????55??????????????????60

ttg?gag?ggt?gga?ttc?atc?aaa?gtg?aac?cag?aga?cca?tct?agg?ttc?aaa??????240

Leu?Glu?Gly?Gly?Phe?Ile?Lys?Val?Asn?Gln?Arg?Pro?Ser?Arg?Phe?Lys

65??????????????????70??????????????????75??????????????????80

tat?gct?gaa?ctc?gct?gat?atc?tct?aat?gtt?tca?ttg?gat?ggt?aag?gtg??????288

Tyr?Ala?Glu?Leu?Ala?Asp?Ile?Ser?Asn?Val?Ser?Leu?Asp?Gly?Lys?Val

85??????????????????90??????????????????95

gca?caa?aga?gac?gct?aga?gaa?gtt?gtg?gga?aat?ttt?gca?aat?caa?ttg??????336

Ala?Gln?Arg?Asp?Ala?Arg?Glu?Val?Val?Gly?Asn?Phe?Ala?Asn?Gln?Leu

100?????????????????105?????????????????110

tgg?cat?tct?gat?tct?tca?ttc?caa?cag?cca?gca?gct?aga?tat?tct?atg??????384

Trp?His?Ser?Asp?Ser?Ser?Phe?Gln?Gln?Pro?Ala?Ala?Arg?Tyr?Ser?Met

115?????????????????120?????????????????125

ttg?tca?gct?gtt?gtt?gtg?cct?cct?tct?gga?ggt?gat?aca?gaa?ttt?tgt??????432

Leu?Ser?Ala?Val?Val?Val?Pro?Pro?Ser?Gly?Gly?Asp?Thr?Glu?Phe?Cys

130?????????????????135?????????????????140

gat?atg?agg?gca?gct?tac?gat?gct?ctc?cca?agg?gat?ttg?cag?tct?gaa??????480

Asp?Met?Arg?Ala?Ala?Tyr?Asp?Ala?Leu?Pro?Arg?Asp?Leu?Gln?Ser?Glu

145?????????????????150?????????????????155?????????????????160

ctc?gag?gga?ttg?aga?gct?gaa?cat?tac?gct?ttg?aac?tca?aga?ttt?ctc???????528

Leu?Glu?Gly?Leu?Arg?Ala?Glu?His?Tyr?Ala?Leu?Asn?Ser?Arg?Phe?Leu

165?????????????????170?????????????????175

ttg?gga?gat?act?gat?tac?tca?gag?gca?cag?aga?aac?gct?atg?cct?cct???????576

Leu?Gly?Asp?Thr?Asp?Tyr?Ser?Glu?Ala?Gln?Arg?Asn?Ala?Met?Pro?Pro

180?????????????????185?????????????????190

gtt?aac?tgg?cct?ctc?gtt?agg?act?cat?gct?ggt?tct?ggt?aga?aag?ttc???????624

Val?Asn?Trp?Pro?Leu?Val?Arg?Thr?His?Ala?Gly?Ser?Gly?Arg?Lys?Phe

195?????????????????200?????????????????205

ttg?ttt?att?gga?gca?cat?gct?tca?cat?gtt?gag?ggt?ctc?cct?gtt?gct???????672

Leu?Phe?Ile?Gly?Ala?His?Ala?Ser?His?Val?Glu?Gly?Leu?Pro?Val?Ala

210?????????????????215?????????????????220

gag?gga?aga?atg?ttg?ctc?gct?gaa?ttg?ctc?gaa?cat?gct?act?caa?aga???????720

Glu?Gly?Arg?Met?Leu?Leu?Ala?Glu?Leu?Leu?Glu?His?Ala?Thr?Gln?Arg

225?????????????????230?????????????????235?????????????????240

gag?ttt?gtt?tat?aga?cac?aga?tgg?aat?gtt?ggt?gac?ttg?gtt?atg?tgg???????768

Glu?Phe?Val?Tyr?Arg?His?Arg?Trp?Asn?Val?Gly?Asp?Leu?Val?Met?Trp

245?????????????????250?????????????????255

gat?aat?aga?tgt?gtg?ttg?cat?aga?ggt?agg?aga?tat?gat?att?tct?gct???????816

Asp?Asn?Arg?Cys?Val?Leu?His?Arg?Gly?Arg?Arg?Tyr?Asp?Ile?Ser?Ala

260?????????????????265?????????????????270

aga?agg?gaa?ctc?aga?agg?gct?act?act?ttg?gat?gac?gct?gtt?gtt?tag???????864

Arg?Arg?Glu?Leu?Arg?Arg?Ala?Thr?Thr?Leu?Asp?Asp?Ala?Val?Val

275?????????????????280?????????????????285

<210>3

<211>864

<212>DNA

＜213〉artificial sequence

<220>

＜22l〉exon

<222>(1)..(864)

<220>

＜22l〉the misc_ feature

<222>(1)..(864)

＜223〉degraded 2, the unifacial leaf ORF of 4-D

<400>3

atg?tcc?gtg?gtg?gcc?aac?cca?ctc?cac?ccg?ctc?ttc?gcg?gcc?ggc?gtg???????48

Met?Ser?Val?Val?Ala?Asn?Pro?Leu?His?Pro?Leu?Phe?Ala?Ala?Gly?Val

1???????????????5???????????????????10??????????????????15

gag?gat?atc?gac?ctc?agg?gag?gcg?ctg?ggc?agc?acc?gaa?gtg?cgc?gaa???????96

Glu?Asp?Ile?Asp?Leu?Arg?Glu?Ala?Leu?Gly?Ser?Thr?Glu?Val?Arg?Glu

20??????????????????25??????????????????30

atc?gag?agg?ctc?atg?gac?gag?aag?agc?gtc?ctc?gtc?ttc?cgc?ggc?caa??????144

Ile?Glu?Arg?Leu?Met?Asp?Glu?Lys?Ser?Val?Leu?Val?Phe?Arg?Gly?Gln

35??????????????????40??????????????????45

cca?ctc?tca?cag?gat?caa?cag?att?gct?ttt?gct?agg?aat?ttt?gga?cct??????192

Pro?Leu?Ser?Gln?Asp?Gln?Gln?Ile?Ala?Phe?Ala?Arg?Asn?Phe?Gly?Pro

50??????????????????55??????????????????60

ttg?gag?ggt?gga?ttc?atc?aag?gtg?aac?cag?cgc?ccg?tcc?agg?ttc?aag??????240

Leu?Glu?Gly?Gly?Phe?Ile?Lys?Val?Asn?Gln?Arg?Pro?Ser?Arg?Phe?Lys

65??????????????????70??????????????????75??????????????????80

tac?gct?gaa?ctg?gcc?gac?atc?agc?aac?gtg?tcc?ctc?gat?ggg?aag?gtg??????288

Tyr?Ala?Glu?Leu?Ala?Asp?Ile?Ser?Asn?Val?Ser?Leu?Asp?Gly?Lys?Val

85??????????????????90??????????????????95

gcc?cag?agg?gac?gct?agg?gaa?gtt?gtg?ggc?aac?ttc?gcc?aac?caa?ctg??????336

Ala?Gln?Arg?Asp?Ala?Arg?Glu?Val?Val?Gly?Asn?Phe?Ala?Asn?Gln?Leu

100?????????????????105?????????????????????110

tgg?cac?tcc?gat?agc?tct?ttc?caa?cag?cca?gca?gcc?agg?tac?tcc?atg??????384

Trp?His?Ser?Asp?Ser?Ser?Phe?Gln?Gln?Pro?Ala?Ala?Arg?Tyr?Ser?Met

115?????????????????120?????????????????????125

ctg?agc?gcc?gtc?gtc?gtg?cca?cca?tcc?ggc?ggt?gac?acc?gag?ttc?tgc??????432

Leu?Ser?Ala?Val?Val?Val?Pro?Pro?Ser?Gly?Gly?Asp?Thr?Glu?Phe?Cys

130?????????????????135?????????????????140

gat?atg?cgc?gcc?gcg?tac?gac?gcc?ctc?ccg?agg?gat?ctg?cag?agc?gag??????480

Asp?Met?Arg?Ala?Ala?Tyr?Asp?Ala?Leu?Pro?Arg?Asp?Leu?Gln?Ser?Glu

145?????????????????150?????????????????155?????????????????160

ctg?gag?ggc?ctc?cgc?gcg?gag?cac?tac?gcc?ctc?aac?agc?agg?ttc?ctc??????528

Leu?Glu?Gly?Leu?Arg?Ala?Glu?His?Tyr?Ala?Leu?Asn?Ser?Arg?Phe?Leu

165?????????????????170?????????????????175

ctg?ggg?gac?act?gac?tac?tcc?gag?gcc?cag?agg?aac?gcg?atg?cca?cca??????576

Leu?Gly?Asp?Thr?Asp?Tyr?Ser?Glu?Ala?Gln?Arg?Asn?Ala?Met?Pro?Pro

180?????????????????185?????????????????190

gtg?aac?tgg?ccc?ctc?gtc?cgc?acc?cac?gct?ggc?agc?ggc?cgc?aag?ttc??????624

Val?Asn?Trp?Pro?Leu?Val?Arg?Thr?His?Ala?Gly?Ser?Gly?Arg?Lys?Phe

195?????????????????200?????????????????205

ctg?ttc?atc?ggg?gcc?cat?gcc?tcc?cat?gtg?gag?ggt?ctc?cct?gtc?gcg??????672

Leu?Phe?Ile?Gly?Ala?His?Ala?Ser?His?Val?Glu?Gly?Leu?Pro?Val?Ala

210?????????????????215?????????????????220

gag?ggc?cgc?atg?ctc?ctg?gcc?gag?ctc?ctg?gag?cac?gcc?acc?caa?cgc??????720

Glu?Gly?Arg?Met?Leu?Leu?Ala?Glu?Leu?Leu?Glu?His?Ala?Thr?Gln?Arg

225?????????????????230??????????????????235????????????????240

gag?ttc?gtc?tac?cgc?cac?agg?tgg?aat?gtc?ggc?gac?ctc?gtc?atg?tgg??????768

Glu?Phe?Val?Tyr?Arg?His?Arg?Trp?Asn?Val?Gly?Asp?Leu?Val?Met?Trp

245?????????????????250?????????????????255

gat?aac?cgc?tgc?gtg?ctg?cac?cgc?ggc?agg?cgc?tac?gat?atc?agc?gcg??????816

Asp?Asn?Arg?Cys?Val?Leu?His?Arg?Gly?Arg?Arg?Tyr?Asp?Ile?Ser?Ala

260?????????????????265?????????????????270

cgc?agg?gaa?ctc?agg?cgc?gcc?acc?acc?ctc?gac?gac?gcg?gtg?gtg?tag??????864

Arg?Arg?Glu?Leu?Arg?Arg?Ala?Thr?Thr?Leu?Asp?Asp?Ala?Val?Val

275?????????????????280?????????????????285

<210>4

<211>918

<212>DNA

＜213〉artificial sequence

<220>

＜221〉exon

<222>(45)..(908)

<220>

＜221〉misc_ feature

<222>(1)..(918)

＜223〉degraded 2, the dicotyledonous gene of 4-D

<400>4

agatcctttt?tatttttaat?tttctttcaa?atacttccag?atcc?atg?tct?gtt?gtt??????56

Met?Ser?Val?Val

1

gct?aac?cct?ttg?cat?cct?ttg?ttc?gct?gct?gga?gtt?gag?gat?att?gat??????104

Ala?Asn?Pro?Leu?His?Pro?Leu?Phe?Ala?Ala?Gly?Val?Glu?Asp?Ile?Asp

5???????????????????10??????????????????15??????????????????20

ctc?aga?gaa?gca?ttg?ggt?tct?act?gag?gtg?aga?gaa?att?gag?aga?ctc??????152

Leu?Arg?Glu?Ala?Leu?Gly?Ser?Thr?Glu?Val?Arg?Glu?Ile?Glu?Arg?Leu

25??????????????????30??????????????????35

atg?gac?gaa?aag?tca?gtt?ctc?gtt?ttc?aga?ggt?caa?cca?ctc?tca?cag??????200

Met?Asp?Glu?Lys?Ser?Val?Leu?Val?Phe?Arg?Gly?Gln?Pro?Leu?Ser?Gln

40??????????????????45??????????????????50

gat?caa?cag?att?gct?ttt?gct?agg?aat?ttt?gga?cct?ttg?gag?ggt?gga??????248

Asp?Gln?Gln?Ile?Ala?Phe?Ala?Arg?Asn?Phe?Gly?Pro?Leu?Glu?Gly?Gly

55??????????????????60??????????????????65

ttc?atc?aaa?gtg?aac?cag?aga?cca?tct?agg?ttc?aaa?tat?gct?gaa?ctc??????296

Phe?Ile?Lys?Val?Asn?Gln?Arg?Pro?Ser?Arg?Phe?Lys?Tyr?Ala?Glu?Leu

70??????????????????75??????????????????80

gct?gat?atc?tct?aat?gtt?tca?ttg?gat?ggt?aag?gtg?gca?caa?aga?gac??????344

Ala?Asp?Ile?Ser?Asn?Val?Ser?Leu?Asp?Gly?Lys?Val?Ala?Gln?Arg?Asp

85??????????????????90??????????????????95??????????????????100

gct?aga?gaa?gtt?gtg?gga?aat?ttt?gca?aat?caa?ttg?tgg?cat?tct?gat??????392

Ala?Arg?Glu?Val?Val?Gly?Asn?Phe?Ala?Asn?Gln?Leu?Trp?His?Ser?Asp

105?????????????????110?????????????????115

tct?tca?ttc?caa?cag?cca?gca?gct?aga?tat?tct?atg?ttg?tca?gct?gtt??????440

Ser?Ser?Phe?Gln?Gln?Pro?Ala?Ala?Arg?Tyr?Ser?Met?Leu?Ser?Ala?Val

120?????????????????125?????????????????130

gtt?gtg?cct?cct?tct?gga?ggt?gat?aca?gaa?ttt?tgt?gat?atg?agg?gca??????488

Val?Val?Pro?Pro?Ser?Gly?Gly?Asp?Thr?Glu?Phe?Cys?Asp?Met?Arg?Ala

135?????????????????140?????????????????145

gct?tac?gat?gct?ctc?cca?agg?gat?ttg?cag?tct?gaa?ctc?gag?gga?ttg??????536

Ala?Tyr?Asp?Ala?Leu?Pro?Arg?Asp?Leu?Gln?Ser?Glu?Leu?Glu?Gly?Leu

150?????????????????155?????????????????160

aga?gct?gaa?cat?tac?gct?ttg?aac?tca?aga?ttt?ctc?ttg?gga?gat?act??????584

Arg?Ala?Glu?His?Tyr?Ala?Leu?Asn?Ser?Arg?Phe?Leu?Leu?Gly?Asp?Thr

165?????????????????170?????????????????175?????????????????180

gat?tac?tca?gag?gca?cag?aga?aac?gct?atg?cct?cct?gtt?aac?tgg?cct??????632

Asp?Tyr?Ser?Glu?Ala?Gln?Arg?Asn?Ala?Met?Pro?Pro?Val?Asn?Trp?Pro

185?????????????????190?????????????????195

ctc?gtt?agg?act?cat?gct?ggt?tct?ggt?aga?aag?ttc?ttg?ttt?att?gga??????680

Leu?Val?Arg?Thr?His?Ala?Gly?Ser?Gly?Arg?Lys?Phe?Leu?Phe?Ile?Gly

200?????????????????205?????????????????210

gca?cat?gct?tca?cat?gtt?gag?ggt?ctc?cct?gtt?gct?gag?gga?aga?atg??????728

Ala?His?Ala?Ser?His?Val?Glu?Gly?Leu?Pro?Val?Ala?Glu?Gly?Arg?Met

215?????????????????220?????????????????225

ttg?ctc?gct?gaa?ttg?ctc?gaa?cat?gct?act?caa?aga?gag?ttt?gtt?tat??????776

Leu?Leu?Ala?Glu?Leu?Leu?Glu?His?Ala?Thr?Gln?Arg?Glu?Phe?Val?Tyr

230?????????????????235?????????????????240

aga?cac?aga?tgg?aat?gtt?ggt?gac?ttg?gtt?atg?tgg?gat?aat?aga?tgt??????824

Arg?His?Arg?Trp?Asn?Val?Gly?Asp?Leu?Val?Met?Trp?Asp?Asn?Arg?Cys

245?????????????????250?????????????????255?????????????????260

gtg?ttg?cat?aga?ggt?agg?aga?tat?gat?att?tct?gct?aga?agg?gaa?ctc??????872

Val?Leu?His?Arg?Gly?Arg?Arg?Tyr?Asp?Ile?Ser?Ala?Arg?Arg?Glu?Leu

265?????????????????270?????????????????275

aga?agg?gct?act?act?ttg?gat?gac?gct?gtt?gtt?tag?tgtgctggag???????????918

Arg?Arg?Ala?Thr?Thr?Leu?Asp?Asp?Ala?Val?Val

280?????????????????285

<210>5

<211>918

<212>DNA

＜213〉artificial sequence

<220>

＜221〉exon

<222>(45)..(905)

<220>

＜221〉misc_ feature

<222>(1)..(918)

＜223〉degraded 2, the unifacial leaf gene of 4-D

<400>5

agatcctttt?tatttttaat?tttctttcaa?atacttccagatcc?atg?tcc?gtg?gtg???????56

Met?Ser?Val?Val

1

gcc?aac?cca?ctc?cac?ccg?ctc?ttc?gcg?gcc?ggc?gtg?gag?gat?atc?gac??????104

Ala?Asn?Pro?Leu?His?Pro?Leu?Phe?Ala?Ala?Gly?Val?Glu?Asp?Ile?Asp

5???????????????????10??????????????????15??????????????????20

ctc?agg?gag?gcg?ctg?ggc?agc?acc?gaa?gtg?cgc?gaa?atc?gag?agg?ctc??????152

Leu?Arg?Glu?Ala?Leu?Gly?Ser?Thr?Glu?Val?Arg?Glu?Ile?Glu?Arg?Leu

25??????????????????30??????????????????35

atg?gac?gag?aag?agc?gtc?ctc?gtc?ttc?cgc?ggc?caa?cca?ctc?tca?cag??????200

Met?Asp?Glu?Lys?Ser?Val?Leu?Val?Phe?Arg?Gly?Gln?Pro?Leu?Ser?Gln

40??????????????????45??????????????????50

gat?caa?cag?att?gct?ttt?gct?agg?aat?ttt?gga?cct?ttg?gag?ggt?gga??????248

Asp?Gln?Gln?Ile?Ala?Phe?Ala?Arg?Asn?Phe?Gly?Pro?Leu?Glu?Gly?Gly

55??????????????????60??????????????????65

ttc?atc?aag?gtg?aac?cag?cgc?ccg?tcc?agg?ttc?aag?tac?gct?gaa?ctg??????296

Phe?Ile?Lys?Val?Asn?Gln?Arg?Pro?Ser?Arg?Phe?Lys?Tyr?Ala?Glu?Leu

70??????????????????75??????????????????80

gcc?gac?atc?agc?aac?gtg?tcc?ctc?gat?ggg?aag?gtg?gcc?cag?agg?gac??????344

Ala?Asp?Ile?Ser?Asn?Val?Ser?Leu?Asp?Gly?Lys?Val?Ala?Gln?Arg?Asp

85??????????????????90??????????????????95??????????????????100

gct?agg?gaa?gtt?gtg?ggc?aac?ttc?gcc?aac?caa?ctg?tgg?cac?tcc?gat??????392

Ala?Arg?Glu?Val?Val?Gly?Asn?Phe?Ala?Asn?Gln?Leu?Trp?His?Ser?Asp

105?????????????????110?????????????????115

agc?tct?ttc?caa?cag?cca?gca?gcc?agg?tac?tcc?atg?ctg?agc?gcc?gtc??????440

Ser?Ser?Phe?Gln?Gln?Pro?Ala?Ala?Arg?Tyr?Ser?Met?Leu?Ser?Ala?Val

120?????????????????125?????????????????130

gtc?gtg?cca?cca?tcc?ggc?ggt?gac?acc?gag?ttc?tgc?gat?atg?cgc?gcc??????488

Val?Val?Pro?Pro?Ser?Gly?Gly?Asp?Thr?Glu?Phe?Cys?Asp?Met?Arg?Ala

135?????????????????140?????????????????145

gcg?tac?gac?gcc?ctc?ccg?agg?gat?ctg?cag?agc?gag?ctg?gag?ggc?ctc??????536

Ala?Tyr?Asp?Ala?Leu?Pro?Arg?Asp?Leu?Gln?Ser?Glu?Leu?Glu?Gly?Leu

150?????????????????155?????????????????160

cgc?gcg?gag?cac?tac?gcc?ctc?aac?agc?agg?ttc?ctc?ctg?ggg?gac?act??????584

Arg?Ala?Glu?His?Tyr?Ala?Leu?Asn?Ser?Arg?Phe?Leu?Leu?Gly?Asp?Thr

165?????????????????170?????????????????175?????????????????180

gac?tac?tcc?gag?gcc?cag?agg?aac?gcg?atg?cca?cca?gtg?aac?tgg?ccc??????632

Asp?Tyr?Ser?Glu?Ala?Gln?Arg?Asn?Ala?Met?Pro?Pro?Val?Asn?Trp?Pro

185?????????????????190?????????????????195

ctc?gtc?cgc?acc?cac?gct?ggc?agc?ggc?cgc?aag?ttc?ctg?ttc?atc?ggg??????680

Leu?Val?Arg?Thr?His?Ala?Gly?Ser?Gly?Arg?Lys?Phe?Leu?Phe?Ile?Gly

200?????????????????205?????????????????210

gcc?cat?gcc?tcc?cat?gtg?gag?ggt?ctc?cct?gtc?gcg?gag?ggc?cgc?atg??????728

Ala?His?Ala?Ser?His?Val?Glu?Gly?Leu?Pro?Val?Ala?Glu?Gly?Arg?Met

215?????????????????220?????????????????225

ctc?ctg?gcc?gag?ctc?ctg?gag?cac?gcc?acc?caa?cgc?gag?ttc?gtc?tac??????776

Leu?Leu?Ala?Glu?Leu?Leu?Glu?His?Ala?Thr?Gln?Arg?Glu?Phe?Val?Tyr

230?????????????????235?????????????????240

cgc?cac?agg?tgg?aat?gtc?ggc?gac?ctc?gtc?atg?tgg?gat?aac?cgc?tgc??????824

Arg?His?Arg?Trp?Asn?Val?Gly?Asp?Leu?Val?Met?Trp?Asp?Asn?Arg?Cys

245?????????????????250?????????????????255?????????????????260

gtg?ctg?cac?cgc?ggc?agg?cgc?tac?gat?atc?agc?gcg?cgc?agg?gaa?ctc??????872

Val?Leu?His?Arg?Gly?Arg?Arg?Tyr?Asp?Ile?Ser?Ala?Arg?Arg?Glu?Leu

265?????????????????270?????????????????275

agg?cgc?gcc?acc?acc?ctc?gac?gac?gcg?gtg?gtg?tagtgtgctg?gag???????????918

Arg?Arg?Ala?Thr?Thr?Leu?Asp?Asp?Ala?Val?Val

280?????????????????285

<210>6

<211>28

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(28)

＜223〉primer

<400>6

agatcctttt?tatttttaat?tttctttc???????????????????????????????????????28

<210>7

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(25)

＜223〉primer

<400>7

ctccagcaca?ctaaacaaca?gcgtc??????????????????????????????????????????25

<210>8

<211>20

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

<222>(1)..(20)

＜223〉primer

<400>8

ctccagcaca?ctacaccacc????????????????????????????????????????????????20

<210>9

<211>33

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(33)

＜223〉primer

<400>9

ggagttgagg?atattgatct?cagagaagca?ttg?????????????????????????????????33

<210>10

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(21)

＜223〉primer

<400>10

gcgatctgct?gatcctgact?c??????????????????????????????????????????????21

<210>11

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(21)

＜223〉primer

<400>11

cgtcaagaag?gcgatagaag?g??????????????????????????????????????????????21

<210>12

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(22)

＜223〉primer

<400>12

gctatgactg?ggcacaacag?ac?????????????????????????????????????????????22

<210>13

<211>44

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(44)

＜223〉gene fragment

<400>13

agctagatcc?tttttatttt?taattttctt??tcaaatactt?ccag????????????????????44

<210>14

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>14

atccatgtct?gttgttgcta?accctttgca?tcctttgttc?gctgctggag?ttgaggatat????60

tgatctcaga?gaagcattgg????????????????????????????????????????????????80

<210>15

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>15

gttctactga?ggtgagagaa?attgagagac?tcatggacga?aaagtcagtt?ctcgttttca????60

gaggtcaacc?actctcacag????????????????????????????????????????????????80

<210>16

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>16

gatcaacaga?ttgcttttgc?taggaatttt?ggacctttgg?agggtggatt?catcaaagtg????60

aaccagagac?catctaggtt????????????????????????????????????????????????80

<210>17

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>17

caaatatgct?gaactcgctg?atatctctaa?tgtttcattg?gatggtaagg?tggcacaaag????60

agacgctaga?gaagttgtgg????????????????????????????????????????????????80

<210>18

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>18

gaaattttgc?aaatcaattg?tggcattctg?attcttcatt?ccaacagcca?gcagctagat????60

attctatgtt?gtcagctgtt????????????????????????????????????????????????80

<210>19

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>19

gttgtgcctc?cttctggagg?tgatacagaa?ttttgtgata?tgagggcagc?ttacgatgct????60

ctcccaaggg?atttgcagtc????????????????????????????????????????????????80

<210>20

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>20

tgaactcgag?ggattgagag?ctgaacatta?cgctttgaac?tcaagatttc?tcttgggaga????60

tactgattac?tcagaggcac????????????????????????????????????????????????80

<210>21

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>21

agagaaacgc?tatgcctcct?gttaactggc?ctctcgttag?gactcatgct?ggttctggta????60

gaaagttctt?gtttattgga????????????????????????????????????????????????80

<210>22

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>22

gcacatgctt?cacatgttga?gggtctccct?gttgctgagg?gaagaatgtt?gctcgctgaa????60

ttgctcgaac?atgctactca????????????????????????????????????????????????80

<210>23

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221) misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>23

aagagagttt?gtttatagac?acagatggaa?tgttggtgac?ttggttatgt?gggataatag????60

atgtgtgttg?catagaggta????????????????????????????????????????????????80

<210>24

<211>78

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(78)

＜223〉gene fragment

<400>24

ggagatatga?tatttctgct?agaagggaac?tcagaagggc?tactactttg?gatgacgctg????60

ttgtttagtg?tgctggag??????????????????????????????????????????????????78

<210>25

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>25

gaacaaagga?tgcaaagggt?tagcaacaac?agacatggat?ctggaagtat?ttgaaagaaa????60

attaaaaata?aaaaggatct????????????????????????????????????????????????80

<210>26

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>26

tcgtccatga?gtctctcaat?ttctctcacc?tcagtagaac?ccaatgcttc?tctgagatca????60

atatcctcaa?ctccagcagc????????????????????????????????????????????????80

<210>27

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>27

ccaaaggtcc?aaaattccta?gcaaaagcaatctgttgatc?ctgtgagagt?ggttgacctc?????60

tgaaaacgag?aactgacttt????????????????????????????????????????????????80

<210>28

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>28

caatgaaaca?ttagagatat?cagcgagttc?agcatatttg?aacctagatg?gtctctggtt????60

cactttgatg?aatccaccct????????????????????????????????????????????????80

<210>29

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>29

aatgaagaat?cagaatgcca?caattgattt?gcaaaatttc?ccacaacttc?tctagcgtct????60

ctttgtgcca?ccttaccatc????????????????????????????????????????????????80

<210>30

<211>80

<212>DNA

＜213) artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>30

tatcacaaaa?ttctgtatca?cctccagaag?gaggcacaac?aacagctgac?aacatagaat????60

atctagctgc?tggctgttgg????????????????????????????????????????????????80

<210>31

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>31

gttcaaagcg?taatgttcag?ctctcaatcc?ctcgagttca?gactgcaaat?cccttgggag????60

agcatcgtaa?gctgccctca????????????????????????????????????????????????80

<210>32

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>32

ctaacgagag?gccagttaac?aggaggcata?gcgtttctct?gtgcctctga?gtaatcagta????60

tctcccaaga?gaaatcttga????????????????????????????????????????????????80

<210>33

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>33

cctcagcaac?agggagaccc?tcaacatgtg?aagcatgtgc?tccaataaac?aagaactttc????60

taccagaacc?agcatgagtc????????????????????????????????????????????????80

<210>34

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>34

gtcaccaaca?ttccatctgt?gtctataaac?aaactctctt?tgagtagcat?gttcgagcaa????60

ttcagcgagc?aacattcttc????????????????????????????????????????????????80

<210>35

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>35

gcccttctga?gttcccttct?agcagaaata?tcatatctcc?tacctctatg?caacacacat????60

ctattatccc?acataaccaa????????????????????????????????????????????????80

<210>36

<211>42

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(42)

＜223〉gene fragment

<400>36

tcgactccag?cacactaaac?aacagcgtca?tccaaagtag?ta???????????????????????42

<210>37

<211>44

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(44)

＜223〉gene fragment

<400>37

agctagatcc?tttttatttt?taattttctt?tcaaatactt?ccag

44

<210>38

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>38

atccatgtcc?gtggtggcca?acccactcca?cccgctcttc?gcggccggcg?tggaggatat????60

cgacctcagg?gaggcgctgg????????????????????????????????????????????????80

<210>39

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>39

gcagcaccga?agtgcgcgaa?atcgagaggc?tcatggacga?gaagagcgtc?ctcgtcttcc????60

gcggccaacc?actctcacag????????????????????????????????????????????????80

<210>40

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>40

gatcaacaga?ttgcttttgc?taggaatttt?ggacctttgg?agggtggatt?catcaaggtg????60

aaccagcgcc?cgtccaggtt????????????????????????????????????????????????80

<210>41

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>41

caagtacgct?gaactggccg?acatcagcaa?cgtgtccctc?gatgggaagg?tggcccagag????60

ggacgctagg?gaagttgtgg????????????????????????????????????????????????80

<210>42

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>42

gcaacttcgc?caaccaactgtggcactccg?atagctcttt?ccaacagcca?gcagccaggt?????60

actccatgct?gagcgccgtc????????????????????????????????????????????????80

<210>43

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>43

gtcgtgccac?catccggcgg?tgacaccgag?ttctgcgata?tgcgcgccgc?gtacgacgcc????60

ctcccgaggg?atctgcagag????????????????????????????????????????????????80

<210>44

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>44

cgagctggag?ggcctccgcg?cggagcacta?cgccctcaac?agcaggttcc?tcctggggga????60

cactgactac?tccgaggccc????????????????????????????????????????????????80

<210>45

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>45

agaggaacgc?gatgccacca?gtgaactggc?ccctcgtccg?cacccacgctggcagcggcc?????60

gcaagttcct?gttcatcggg????????????????????????????????????????????????80

<210>46

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>46

gcccatgcct?cccatgtgga?gggtctccct?gtcgcggagg?gccgcatgct?cctggccgag????60

ctcctggagc?acgccaccca????????????????????????????????????????????????80

<210>47

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>47

acgcgagttc?gtctaccgcc?acaggtggaa?tgtcggcgac?ctcgtcatgt?gggataaccg????60

ctgcgtgctg?caccgcggca????????????????????????????????????????????????80

<210>48

<211>78

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(78)

＜223〉gene fragment

<400>48

ggcgctacga?tatcagcgcg?cgcagggaac?tcaggcgcgc?caccaccctc?gacgacgcgg????60

tggtgtagtg?tgctggag??????????????????????????????????????????????????78

<210>49

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>49

gaagagcggg?tggagtgggt?tggccaccac?ggacatggat?ctggaagtat?ttgaaagaaa????60

attaaaaata?aaaaggatct????????????????????????????????????????????????80

<210>50

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>50

tcgtccatga?gcctctcgat?ttcgcgcact?tcggtgctgc?ccagcgcctc?cctgaggtcg????60

atatcctcca?cgccggccgc????????????????????????????????????????????????80

<210>51

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>51

ccaaaggtcc?aaaattccta?gcaaaagcaa?tctgttgatcctgtgagagt?ggttggccgc?????60

ggaagacgag?gacgctcttc????????????????????????????????????????????????80

<210>52

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>52

gagggacacg?ttgctgatgt?cggccagttc?agcgtacttg?aacctggacg?ggcgctggtt????60

caccttgatg?aatccaccct????????????????????????????????????????????????80

<210>53

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>53

aaagagctat?cggagtgcca?cagttggttg?gcgaagttgc?ccacaacttc?cctagcgtcc????60

ctctgggcca?ccttcccatc????????????????????????????????????????????????80

<210>54

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>54

tatcgcagaa?ctcggtgtca?ccgccggatg?gtggcacgac?gacggcgctc?agcatggagt????60

acctggctgc?tggctgttgg????????????????????????????????????????????????80

<210>55

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>55

gttgagggcg?tagtgctccg?cgcggaggcc?ctccagctcg?ctctgcagat?ccctcgggag????60

ggcgtcgtac?gcggcgcgca????????????????????????????????????????????????80

<210>56

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>56

cggacgaggg?gccagttcac?tggtggcatc?gcgttcctct?gggcctcgga?gtagtcagtg????60

tcccccagga?ggaacctgct????????????????????????????????????????????????80

<210>57

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>57

cctccgcgac?agggagaccc?tccacatggg?aggcatgggc?cccgatgaac?aggaacttgc????60

ggccgctgcc?agcgtgggtg????????????????????????????????????????????????80

<210>58

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>58

gtcgccgaca?ttccacctgt?ggcggtagac?gaactcgcgt?tgggtggccgt?gctccaggag???60

ctcggccagg?agcatgcggc????????????????????????????????????????????????80

<210>59

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(80)

＜223〉gene fragment

<400>59

gcgcgcctga?gttccctgcg?cgcgctgata?tcgtagcgcc?tgccgcggtg?cagcacgcag????60

cggttatccc?acatgacgag????????????????????????????????????????????????80

<210>60

<211>42

<212>DNA

＜213〉artificial sequence

<220>

＜221〉misc_ feature

<222>(1)..(42)

＜223〉gene fragment

<400>60

tcgactccag?cacactacac?caccgcgtcg?tcgagggtgg?tg???????????????????????42

Claims (50)

1. dna molecular that comprises the synthetic dna sequence dna, this synthetic dna sequence encoding is with 2, the 4-dichlorphenoxyacetic acid is degraded to the enzyme of two chlorophenols, and this synthetic dna sequence dna comprises the natural microbial sequence of this enzyme of encoding, and wherein most at least codons of natural microbial sequence are replaced by the preferred codon of plant.

2. the dna molecular of claim 1, wherein least preferred all codons of plant are replaced by the preferred codon of plant in the natural microbial sequence.

3. the dna molecular of claim 1, wherein the codon of natural microbial sequence at least 50% is replaced by the preferred codon of plant.

4. the dna molecular of claim 3, wherein the codon of natural microbial sequence at least 80% is replaced by the preferred codon of plant.

5. each dna molecular of claim 1-4, wherein the natural microbial sequence is the natural bacteria sequence.

6. each dna molecular of claim 1-4, wherein the codon of natural microbial sequence is replaced by the preferred codon of dicotyledons.

7. the dna molecular of claim 6 that comprises the nucleotide sequence of SEQ ID NO:2.

8. each dna molecular of claim 1-4, wherein the codon of natural microbial sequence is replaced by the preferred codon of monocotyledons.

9. the dna molecular of claim 8 that comprises the nucleotide sequence of SEQ ID NO:3.

10. DNA construct that comprises the synthetic dna sequence dna, this synthetic dna sequence dna can be operatively connected the gene expression in plants control sequence, the synthetic dna sequence encoding is with 2, the 4-dichlorphenoxyacetic acid is degraded to the enzyme of two chlorophenols, and this synthetic dna sequence dna comprises the natural microbial sequence of this enzyme of encoding, and wherein most at least codons of natural microbial sequence are replaced by the preferred codon of plant.

11. the DNA construct of claim 10, wherein least preferred all codons of plant are replaced by the preferred codon of plant in the natural microbial sequence.

12. the DNA construct of claim 10, wherein the codon of natural microbial sequence at least 50% is replaced by the preferred codon of plant.

13. the DNA construct of claim 12, wherein the codon of natural microbial sequence at least 80% is replaced by the preferred codon of plant.

14. each DNA construct of claim 10-13, wherein the natural microbial sequence is the natural bacteria sequence.

15. each DNA construct of claim 10-13, wherein the codon of natural microbial sequence is replaced by the preferred codon of dicotyledons.

16. comprise the DNA construct of claim 15 of the nucleotide sequence of SEQ ID NO:2.

17. comprise the DNA construct of claim 15 of the nucleotide sequence of SEQ ID NO:4.

18. each DNA construct of claim 10-13, wherein the codon of natural microbial sequence is replaced by the preferred codon of monocotyledons.

19. comprise the DNA construct of claim 18 of the nucleotide sequence of SEQ ID NO:3.

20. comprise the DNA construct of claim 18 of the nucleotide sequence of SEQ ID NO:5.

21. the DNA construct of claim 10, it is a carrier.

22. the DNA construct of claim 10, it is a plasmid.

23. the DNA construct of claim 10, it is pProPC1SV-SAD.

24. the DNA construct of claim 10, it is pPZP211-PNPT-311-SAD.

25. the DNA construct of claim 10, it is pPZP211-PNPT-512-SAD.

26. the DNA construct of claim 10, wherein expression control sequenc comprises peanut chlorotic streak viral promotors.

27. part that comprises the transgenic plant or the plant of synthetic dna sequence dna, this synthetic dna sequence dna can be operatively connected the gene expression in plants control sequence, the synthetic dna sequence encoding is with 2, the 4-dichlorphenoxyacetic acid is degraded to the enzyme of two chlorophenols, and this synthetic dna sequence dna comprises the natural microbial sequence of this enzyme of encoding, and wherein most at least codons of natural microbial sequence are replaced by the preferred codon of plant.

28. the plant of claim 27 or the part of plant, wherein expression control sequenc comprises peanut chlorotic streak viral promotors.

29. the plant of claim 27 or the part of plant, wherein least preferred all codons of plant are replaced by the preferred codon of plant in the natural microbial sequence.

30. the plant of claim 27 or the part of plant, wherein the codon of natural microbial sequence at least 50% is replaced by the preferred codon of plant.

31. the plant of claim 30 or the part of plant, wherein the codon of natural microbial sequence at least 80% is replaced by the preferred codon of plant.

32. the plant of claim 27-31 or the part of plant, wherein the natural microbial sequence is the natural bacteria sequence.

33. the plant of claim 27 or the part of plant, it is that the part of dicotyledons or plant and the codon of natural microbial sequence are replaced by the preferred codon of dicotyledons.

34. the plant of claim 33 or the part of plant, wherein one or more cells comprise the nucleotide sequence of SEQ ID NO:2.

35. the plant of claim 33 or the part of plant, wherein one or more cells comprise the nucleotide sequence of SEQ ID NO:4.

36. the plant of claim 27 or the part of plant, it is that the part of monocotyledons or plant and the codon of natural microbial sequence are replaced by the preferred codon of monocotyledons.

37. the plant of claim 36 or the part of plant, wherein one or more cells comprise the nucleotide sequence of SEQ ID NO:3.

38. the plant of claim 36 or the part of plant, wherein one or more cells comprise the nucleotide sequence of SEQ ID NO:5.

39. the plant of claim 27 or the part of plant, it is the part of vegetable lamb or plant.

40. the part of the plant of claim 27, it is a seed.

41. the part of the plant of claim 27, it is a fruit.

42. a control contains the method for weed in the fields of transgenic plant, this method comprises to the field uses the growth hormone weedicide of effectively controlling the amount of the weeds in the field, owing to comprise the synthetic dna sequence dna, these transgenic plant are to the growth hormone herbicide tolerant, this synthetic dna sequence dna can be operatively connected the gene expression in plants control sequence, the synthetic dna sequence encoding is with 2, the 4-dichlorphenoxyacetic acid is degraded to the enzyme of two chlorophenols, and this synthetic dna sequence dna comprises the natural microbial sequence of this enzyme of encoding, and wherein most at least codons of natural microbial sequence are replaced by the preferred codon of plant.

43. the method for claim 42, wherein the growth hormone weedicide be 2,4 dichlorophenoxyacetic acid (2,4-D) or 2,4-D amine.

44. the method for claim 42, wherein plant is a monocotyledons.

45. the method for claim 42, wherein plant is a dicotyledons.

46. the method for claim 42, wherein plant is a vegetable lamb.

47. a method of selecting transformed plant cells comprises: the vegetable cell group is provided; DNA construct with claim 10 transforms at least some vegetable cells among this group; With by selecting to make transformed plant cells hyperplasia and unconverted plant not to cultivate gained vegetable cell group in the substratum of the growth hormone weedicide of outgrowth concentration to select transformed plant cells containing.

48. the method for claim 47, wherein the growth hormone weedicide be 2,4 dichlorophenoxyacetic acid (2,4-D) or 2,4-D amine.

49. a method of selecting to transform plant comprises: flora is provided, and it can comprise that one or more comprise the plant of the DNA construct of claim 10; With select to transform plant by use a lot of growth hormone weedicides to flora, the growth that the amount of selected weedicide make to transform plant-growth and unconverted plant is suppressed.

50. the method for claim 49, wherein the growth hormone weedicide be 2,4 dichlorophenoxyacetic acid (2,4-D) or 2,4-D amine.