CN1618951A - Brachyplast bundle spore mold - Google Patents
Brachyplast bundle spore mold Download PDFInfo
- Publication number
- CN1618951A CN1618951A CN 200310116787 CN200310116787A CN1618951A CN 1618951 A CN1618951 A CN 1618951A CN 200310116787 CN200310116787 CN 200310116787 CN 200310116787 A CN200310116787 A CN 200310116787A CN 1618951 A CN1618951 A CN 1618951A
- Authority
- CN
- China
- Prior art keywords
- days
- brachyplast
- bundle
- cultivated
- mould
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
A calarisporium sp.Ym35852 (CCTCC No.M203064) is disclosed, which can be used as initial bacterial strain to ferment the endofunguses in rauwolfia plant for obtaining ceramide compound used to prepare the medicines for treating cancer or dermatopathy.
Description
Technical field
The present invention relates to microbial technology field, particularly relate to a kind of its fermented product and have microorganism medicinal, nourishing function.
Background technology
Ceramide (Ceramide) compounds; the compound medicinal, nourishing function that is that a class has; wherein part of compounds can preserve moisture and suppress the melanochrome generation, prevent pachylosis, is used for cosmetic or dermatology aspect skin, hair, nail and eyelashes are handled or treated and protect.This compounds obtains not appear in the newspapers as yet with microbial fermentation mode.
Summary of the invention
The purpose of this invention is to provide a kind of its fermented product and have microorganism-brachyplast bundle spore mould medicinal, nourishing function.
Mould Ym 35852 Calcarisporiumsp.Ym 35852 of brachyplast bundle spore mould called after brachyplast bundle spore of the present invention now are deposited in specified depositary institution of State Intellectual Property Office, and deposit number is CCTCC NO:M203064.
The mould fungus strain of brachyplast bundle spore of the present invention separates acquisition from apocynaceae plant Rauvolfia yunnanensis Rauwolfiayunnanaensis Tsiang plant living body.Now be deposited in the preservation of depositary institution of Patent Office of State Intellectual Property Office, depositary institution's title: Chinese typical culture collection center, preservation date are on August 6th, 2003, and deposit number is M203064.
The microscopic morphology feature of YM35852 bacterial strain of the present invention:
1, hyphae colorless has barrier film asexual generation.Conidiophore is coarse, colourless or pigment arranged.Bigger stalk is taken turns dendritic branch, and nascent branch becomes elongated sporogenous cell usually; Conidium (sympodulospore) is colourless smooth, monospore, Long Circle, on single the warty tooth at living sporophore branch estranged top, form evacuate bunch.5.0~6.25 * 2.5~3.75 microns.
2, sexual generation is not found.
The solid culture feature of brachyplast bundle spore mould of the present invention:
1, the PDA substratum was cultivated 4 days for 28 ℃, and colony diameter 47mm spread in 7 days.The bacterium colony circle, beige, central authorities are with yellow slightly, and suede is cotton-shaped, and there is powdery in the later stage, and densification is thicker, and neat in edge has protuberance.Back side chocolate.
2, malt extract medium was cultivated 4 days for 28 ℃, colony diameter 38mm, and 7 days 49mm spread in 11 days.The bacterium colony circle, canescence is with a small amount of black particle, the suede powdery, the edge is irregular, and is flat tightr.Back side black.
3, examine the Bake substratum and cultivated 4 days for 28 ℃, colony diameter 38mm, 7 days 54mm spread in 11 days.The bacterium colony subcircular, the edge is irregular, beige, suede is cotton-shaped, closely.Back side brown.
Brachyplast bundle spore mould YM35852 strain liquid fermentation culture of the present invention:
1,5~7 days substratum PDA shake-flask culture time.28 ℃ ± 2 ℃ of culture temperature.
2, fermentation culture feature: cultivated the 1st day, bacterial classification has odd white hypha point; Cultivated the 2nd day, and covered with white hypha; Cultivated the 3rd day, the fermented liquid mycelium is intensive, and it is filbert that mycelium is; Cultivated the 4th day, and covered with pitch black brown mycelium, the fermented liquid thickness was cultivated the 5th~7 day, and the intensive one-tenth of fermented liquid mycelium is block, the chocolate mycelium.
3, the fermentation of YM35852 strain liquid was carried out chemical extraction, column chromatographic isolation and purification to fermented liquid after 5~7 days, obtained 1 anti-skin pathogenic bacterium and people's myeloplast activity of tumor cells compound.The present structure of gained compound is still indeterminate.
Brachyplast bundle spore mould YM35852 strain liquid fermenting extraction process of the present invention is: bacterial classification → test tube slant → seed culture → fermentation culture → fermented product extraction → column chromatography → mixing cpd → purifying → monomeric compound.
In the above-mentioned steps, fermentation raw material is potato glucose substratum (PDA).This technology is suitable for imperfect fungi Moniliaceae filamentous fungus quasi-microorganism.
In the above-mentioned YM35852 liquid-state fermentation technology, the fermentation condition parameter is as follows:
(1) fermentation mode: liquid state fermentation.
(2) strain inclined plane: the test tube slant spawn culture adopts potato glucose solid medium (solid PDA).
(3) seed culture: seed culture is potato glucose liquid nutrient medium (liquid PDA).
Potato glucose substratum (PDA) preparation: get fresh potato 200 grams, peeling is cut into small pieces, and adds 1 liter in water and boils 30 minutes, filters and abandons potato, and filter adds water and complement to 1 liter night, adds glucose 20 grams, the PH nature.
Add agar 15 grams in the above-mentioned potato glucose substratum, be solid PDA substratum.
(4) fermentation culture: the substratum of fermentation is potato glucose liquid nutrient medium (liquid PDA), the PH nature.
(5) incubation time: test tube slant strain activation and culture 5 days, seed shaking table incubation time 72~96 hours, fermented incubation time 5~7 days.
(6) culture temperature: 28 ℃ ± 1 ℃ of test tube slant spawn culture temperature, 28 ℃ ± 2 ℃ of seed shaking table culture temperature, fermentation culture temperature are 28 ℃ ± 2 ℃.
(7) fermented product extracts: fermentation finishes, and collects fermented liquid and thalline respectively.Chemical extraction method is routinely extracted 3 merging respectively with industrial hexyl hexanoate and is drained, and gets paste and slightly carries compound.
(8) separating compound: adopt silica gel (Silica G) column chromatography method separation and purification to obtain ceramide (Ceramide) compound.
The present invention is the endogenetic fungus in the employing Radix Rauvolfiae plant materials obtains the ceramide compound as fermentation a starting strain.It is to be raw material with potato glucose substratum (PDA), by the liquid state fermentation mode, adopts the combinatorial chemistry means, the strain excellent YM35852 brachyplast bundle mould genus of spore (Calcarisporium sp.) of separation and Extraction ceramide (Ceramide) effective constituent.This bacterial strain is an important microbe of seeking human antitumor and dermatosis medicinal ingredients Biological resources.With the ceramide of this bacterial strain fermentation liquor separation and Extraction is the replenishing water and preserving moisture composition of the high-efficient and lasting that comes out newly developed, different fully with the now general composition principle of preserving moisture, it can be close with the keratoderma structure, can very fast infiltration skin, with the moisture combination in the stratum corneum, form reticulated structure, form one deck water-retaining film at skin surface, supply water for cell paste part and nutrient in moisture-locking, be particularly suitable for dryness, maturation or by the skin of sun damage.The external application cream series products that can contain ceramide by use reaches purpose that prevents anaphylaxis dermatosis and the effect that suppresses the melanochrome foxiness.Can induce liver tumor Bel7402 apoptosis: adopt mtt assay, fluorescent dye, flow cytometry, agarose gel electrophoresis, Western blot. method, the result shows: the ceramide that is extracted is 14.28 μ mol-L to the cytostatic IC50 value of Bel7402
-1Nucleus concentrates, and fluorescence obviously strengthens; DNA presents typical case's " ladder type " to be changed; The p53 protein expression is on a declining curve; The Bcl-2 protein expression obviously reduces; The Bax protein expression does not have obvious change.
Description of drawings
Fig. 1 is YM35852 radicula byssoidea and conidiophore (200X).
Fig. 2 is a YM35852 fungus conidium form (400X).
Embodiment
The embodiment of the invention:
Get numbering YM35852 bacterial classification, under aseptic condition (sterilisable chamber or Bechtop),, transfer and (in 18 * 180mm), put interior 28 ℃ ± 1 ℃ activation culture of incubator 5 days in sterilized solid PDA substratum test tube with a little bacterial classification of inoculating needle picking.
Take out 5 days bacterial classification of activation, under aseptic condition, insert the good bacterial classification of activation in sterilized seed liquid PDA substratum, cultivated 72~96 hours, be the YM35852 seed at 28 ℃ ± 2 ℃ following shaking tables with the same manner.
500 milliliters of glass triangle bottles are adopted in fermentation, 100 milliliters of the liquid PDA substratum that prepare of packing into, and 15 pounds of sterilizations were taken out to be cooled to 30 ℃ after 30 minutes.Under aseptic condition, get the YM35852 seed, be inoculated in 500 milliliters of glass triangle bottles that 100 milliliters of liquid PDA substratum are housed, the seed inoculum size is 5~10% (v/w), puts 28 ℃ ± 2 ℃ aerated culture 5~7 days.During fermentation, note the proving room temperature variation, check to have or not the microbiological contamination phenomenon.
Fermentation finishes, and collects fermented liquid and thalline respectively.With industrial hexyl hexanoate extractive fermentation liquid 3 times, merging is drained; Thalline is with industrial hexyl hexanoate soaked overnight 3 times, and merging is drained.Get paste and slightly carry compound.
Separating compound: slightly carry compound and adopt silica gel (Silica G) column chromatography, use trichloromethane respectively: methyl alcohol and sherwood oil: hexyl hexanoate=95: 5 wash-outs, separation and purification obtains ceramide (Ceramide) compound.This compound is pressed 0.2mg/ml dosage, and people's bone marrow leukemia cells growth inhibition ratio is reached 73.33%.
The 18SRNA partial sequence of bacterial strain of the present invention is analyzed as follows (700bp):
TGTTACGAACACCGCAACAGCTTTCGCTGGCGGACGGACTATATCTTAGGCCTGCGTGCGCAAGCCCA
CCCCTATCTAGTCTCTGAACCTTCCCCCTATAACGAGGGGGCTTGGCTGCGAGTGGCCCAACCCTCCA
GCAGTGTTACCGTACCCGGAGCAGTTACGCCCGGCCGCCGCGCCTATTTCTAGGGCGGTTTGGTCGCT
GGAGGTTTAAGGGTTTTCCCGCACTTTAGGGATGTCGCCGCTCCGTCTAGGGGAGCGACTAGCGGTCT
TAGGTACACCACCTTCCTGTAGACACAGGCCGCTTTCGGGGGCAGAGACGCTGCGGAATCTTGTTTAC
CCCTGGTGGTGCCCTTCCGTCAATTTCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCA
AAGACTTTGATTTCTCGTAAGGTGCCGAACGAGTCAAAAAATAACATCGTCCGATCCCTAGTCGGCAT
AGTTTATGGTTAAGACTACGACGGTATCTGCAGGTACCCCGCGGCTTTTCAGCGGCGGCTCGACTATA
TTTTAAGGGCGCTACAGCGGAGCGCTCCCACCGACATTTAGTCTGTGAACTGCATCCTGGCGCCCCGA
GGCGCCGTACGGACTTGGCTGCGGATTGTCCAATCCCTCACACTATTACGACTCGCCGCTATTTCTAG
CCGCGAGGTGTGGTGAGGGC。
Claims (3)
1, a kind of brachyplast bundle spore mould is characterized in that the mould Ym 35852Calcarisporium of called after brachyplast bundle spore sp.Ym 35852, now is deposited in specified depositary institution of State Intellectual Property Office, and deposit number is CCTCC NO:M203064.
2, according to the described brachyplast bundle of claim 1 spore mould, it is characterized in that the 18SRNA partial sequence of described bacterial strain is analyzed as follows:
TGTTACGAACACCGCAACAGCTTTCGCTGGCGGACGGACTATATCTTAGGCCTGCGTGC
GCAAGCCCACCCCTATCTAGTCTCTGAACCTTCCCCCTATAACGAGGGGGCTTGGCTGC
GAGTGGCCCAACCCTCCAGCAGTGTTACCGTACCCGGAGCAGTTACGCCCGGCCGCCGC
GCCTATTTCTAGGGCGGTTTGGTCGCTGGAGGTTTAAGGGTTTTCCCGCACTTTAGGGA
TGTCGCCGCTCCGTCTAGGGGAGCGACTAGCGGTCTTAGGTACACCACCTTCCTGTAGA
CACAGGCCGCTTTCGGGGGCAGAGACGCTGCGGAATCTTGTTTACCCCTGGTGGTGCCC
TTCCGTCAATTTCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAGAC
TTTGATTTCTCGTAAGGTGCCGAACGAGTCAAAAAATAACATCGTCCGATCCCTAGTCG
GCATAGTTTATGGTTAAGACTACGACGGTATCTGCAGGTACCCCGCGGCTTTTCAGCGG
CGGCTCGACTATATTTTAAGGGCGCTACAGCGGAGCGCTCCCACCGACATTTAGTCTGT
GAACTGCATCCTGGCGCCCCGAGGCGCCGTACGGACTTGGCTGCGGATTGTCCAATCCC
TCACACTATTACGACTCGCCGCTATTTCTAGCCGCGAGGTGTGGTGAGGGC。
3, according to the described brachyplast bundle of claim 1 spore mould, it is characterized in that the solid culture of described bacterial strain is characterized as:
One, the PDA substratum was cultivated 4 days for 28 ℃, and colony diameter 47mm spread in 7 days, the bacterium colony circle, and beige, central authorities are with yellow slightly, and suede is cotton-shaped, and there is powdery in the later stage, and densification is thicker, and neat in edge has protuberance, back side chocolate;
Two, malt extract medium was cultivated 4 days for 28 ℃, colony diameter 38mm, and 7 days 49mm spread in 11 days, the bacterium colony circle, canescence is with a small amount of black particle, the suede powdery, the edge is irregular, and is flat tightr, back side black;
Three, examine the Bake substratum and cultivated 4 days for 28 ℃, colony diameter 38mm, 7 days 54mm spread in 11 days, the bacterium colony subcircular, the edge is irregular, beige, suede is cotton-shaped, closely, back side brown.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 200310116787 CN1244683C (en) | 2003-11-21 | 2003-11-21 | Brachyplast bundle spore mold |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 200310116787 CN1244683C (en) | 2003-11-21 | 2003-11-21 | Brachyplast bundle spore mold |
Publications (2)
Publication Number | Publication Date |
---|---|
CN1618951A true CN1618951A (en) | 2005-05-25 |
CN1244683C CN1244683C (en) | 2006-03-08 |
Family
ID=34760771
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 200310116787 Expired - Fee Related CN1244683C (en) | 2003-11-21 | 2003-11-21 | Brachyplast bundle spore mold |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1244683C (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101626773A (en) * | 2006-11-02 | 2010-01-13 | 奥力有限公司 | Agent for promoting healing of living body |
-
2003
- 2003-11-21 CN CN 200310116787 patent/CN1244683C/en not_active Expired - Fee Related
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101626773A (en) * | 2006-11-02 | 2010-01-13 | 奥力有限公司 | Agent for promoting healing of living body |
CN101626773B (en) * | 2006-11-02 | 2013-04-17 | 奥力有限公司 | Agent for promoting healing of living body |
Also Published As
Publication number | Publication date |
---|---|
CN1244683C (en) | 2006-03-08 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Rai et al. | Antimicrobial activity of four wild edible mushrooms from Darjeeling hills, West Bengal, India | |
CN114410481B (en) | Trichoderma asperellum and application thereof | |
CN110982868B (en) | Co-culture method for improving triterpene content of ganoderma lucidum and application thereof | |
CN113801808B (en) | Streptomyces albocongensis and application thereof | |
CN106497852B (en) | Burkholderia strain ES-89 for preventing and treating plant fungal diseases as well as culture method and application thereof | |
CN111996129A (en) | New strain of cicada fungus and its use in anti-tumor and bacteriostasis | |
CN104073440A (en) | Paecilomyces fumosoroseus and application thereof | |
CN105062898B (en) | A kind of peacilomyce hepiahi bacterium strain that coremium is produced on silkworm chrysalis and its cultural method | |
CN1478886A (en) | Chinese beimao spore liquid culture fermentationi technology | |
CN112358971A (en) | A fungus DYM25 with antibacterial, antioxidant and anticancer effects, and its application | |
CN1244683C (en) | Brachyplast bundle spore mold | |
CN100412186C (en) | Tinder fungus and process for deep liquid fermentation preparation of tinder fungus | |
CN111440731B (en) | Chinese wolfberry endophytic fusarium strain and application thereof | |
CN101177666A (en) | Novel bacterial producing paclitaxel and method for breeding and preparing paclitaxel | |
CN104830695B (en) | Endophyte with induction Hairy Root Cultures of Salvia miltiorrhiza phenolic acid summation and application thereof | |
CN1244682C (en) | Fusarium | |
CN1168820C (en) | Fleabane endogenous fungus | |
CN102943103B (en) | Penicillium fungus M1 and application thereof to increase of saponins yield in fermentation process of ginseng or Americginseng | |
CN109628345A (en) | A kind of prevention and treatment succulent brown rot composite bacteria agent and its preparation method and application | |
CN1256424C (en) | 'Yuanjiang' black spore fungus | |
CN108707555A (en) | Monascus strain and its application of the high yield rich in Monacolin K | |
CN114946895B (en) | Application of amomum tsao-ko essential oil | |
CN112159766B (en) | Aphyllophora fuscopsis new strain, fermentation method thereof and application thereof in bacteriostasis | |
CN1209462C (en) | Metabolist product of cyathus against mycobacterium tuberculosis and preparation thereof | |
CN109971655B (en) | Astragalus membranaceus endophytic Chaetomium sp HQ-1 and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
C19 | Lapse of patent right due to non-payment of the annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |