CN1605628A - Human source anti-hepatitis A virus gene engineering antibody from CHO cell - Google Patents
Human source anti-hepatitis A virus gene engineering antibody from CHO cell Download PDFInfo
- Publication number
- CN1605628A CN1605628A CN 200410070620 CN200410070620A CN1605628A CN 1605628 A CN1605628 A CN 1605628A CN 200410070620 CN200410070620 CN 200410070620 CN 200410070620 A CN200410070620 A CN 200410070620A CN 1605628 A CN1605628 A CN 1605628A
- Authority
- CN
- China
- Prior art keywords
- antibody
- hepatitis
- virus
- gene
- hav
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
Human anti-hepatitis virus gene engineering antibody produced by CHO cell comprises: two human anti-hepatitis virus neutrality gene engineering antibody CHO (chinese hamster ovary cell) producing cells, and human anti-hepatitis virus neutrality gene engineering antibody preparation produced by the cells for the prevention and treatment. The production characters in that: full human antibody IgG1 Lambada and IgG1 Kappa, which are stably expressed by gene recombination filtrated from human IgGFc from bacteriophage human antibody database in CHO (chinese hamster ovary cell), are named to ChHAIgG16 and ChHAIgG78, and the molecular weight is probable 150 kd.
Description
One, technical field
The invention belongs to biotechnology and biological pharmacy technical field.
Two, background technology
The present invention includes two strain human source anti-hepatitis As virus neutrality genetic engineering antibody.Respectively by China
Mouse gonad cell (CHO) production clone is produced.Its antibody and preparation thereof can be used for preparing the hepatitis A that causes is infected in diagnosis, prevention and treatment by hepatitis A virus medicine or reagent.
The death number still accounts for the first place due to the transmissible disease in the dead population in the whole world, and viral hepatitis is the transmissible disease of serious harm China people ' s health.In the transmissible disease of statutory report, the acute and chronic hepatitis that various hepatitis viruss cause M ﹠ M in all transmissible diseases of China all accounts for the first place.Hepatitis A (hepatitis A) is the acute infectious disease that is caused by hepatitis A virus (HAV), infect object based on teenager and children, grownup's sickness rate is also in rising trend, it is the highest a kind of of sickness rate in the various viral hepatitis, in the etesian acute viral hepatitis, have 50% to be hepatitis A approximately.China is one of hepatitis A the most serious popular country, though the use of hepatitis A vaccine has reduced the sickness rate of hepatitis A, but the annual eruption and prevalence that still has certain scale in China partial area, and in a single day it is popular outbreak of communicable diseases to take place, and the defence of specific antibody preparation and treatment will be rapider effectively than vaccine.
Up to now, most of virus diseases do not have the specific treatment medicine, the biological products that are used for clinical treatment and some virus disease of prevention are still based on blood product, as the haematogenous gamma-globulin that uses clinically for many years, be used for preventions such as viral hepatitis that hepatitis A or hepatitis B virus cause and measles, not only non-specific foreign protein is many in these blood products, specific antibody content is very low, and maximum problem is the pathogeny pollution problem that blood source goods potential fails to detect, and considers and should abandon from long-term interest.As the new biotechnology medicine that rises of a class, people's source antivirus genetic engineering antibody with it to the human body non-immunogenicity, the class that pollution-free source, advantages such as specificity antivirus curative effect and continuous scale production feasibility become prevention and treatment virus disease gradually has the product innovation of practice prospect.At present in the biological products that drugs approved by FDA is gone on the market or awaited the reply, various forms of monoclonal antibodies and genetic engineering antibody account for certain proportion, in 67 kinds of biological products of approved listing at present, treatment and prevention have 9 kinds with monoclonal antibody and genetic engineering antibody.The antibody that is awaiting the reply has 35 kinds.Wherein in four kinds of humanized genetic engineering antibodies of approved listing and generation tremendous economic and social benefit, a kind of antiviral gene engineered antibody that is is arranged wherein, its commodity are called " Synagis
TM", be humanization anti respiratory syncytial virus (RSV) genetic engineering antibody.
Therefore become a general orientation of domestic and international research with human source gene engineering product Blood substitute goods, and progressively led to success.Still do not have the precedent of any approval in the world with prevention of pure mouse resource monoclonal antibody and treatment virus disease, mouse source antibody human is a heterologous protein with maximum disadvantage, causes easily that in human body inherited immunity repels and make the antibody inefficacy and cause immunological disease.Therefore, specificity antivirus people source neutrality antibody is one of the most promising biological products of virus disease prevention and treatment.Anti-hepatitis A antibody preparation is succeeded in developing, and will be domestic and international initiative, might obtain a kind new medicine certificate.
Three, summary of the invention
The objective of the invention is anti-hepatitis A virus (HAV) Fab antibody gene of acquired neutrality (seeing the patent application that patent publication No. is CN1316437A for details) and the gene recombination of humanized IgG constant region, by the cells of mamma animals expression system, in the cells of mamma animals Chinese hamster ovary celI, produce at hepatitis A virus (HAV) have obviously in and the complete humanized IgG antibody of secretor type of function, for replacing haematogenous gamma-globulin in the market in the future, researching and developing new clinical antiviral prevention and treating provides feasibility study with the specific antibody medicine.
The present invention includes two strain human source anti-hepatitis As virus neutrality genetic engineering antibody and the antibody preparation thereof produced with CHO production clone, be presented below:
1. human source anti-hepatitis A virus gene engineering antibody is characterized in that:
1) for derive from phage human antibody library screening with humanized IgG Fc gene recombination after at the total man source of CHO stably express cell IgG1 λ whole antibody, it is made up of two heavy chains and two λ-κ chimeric light chains, molecular weight is about 150kD, name ChHAIgG16;
2) for derive from phage human antibody library screening with humanized IgG Fc gene recombination after at the total man source of CHO stably express cell IgG1 κ whole antibody, it is made up of two heavy chains and two κ light chains, molecular weight is about 150kD, names ChHAIgG78;
3) human source anti-hepatitis A virus gene engineering antibody ChHAIgG16 or ChHAIgG78, its variable region gene composition characteristic is specific light chain and heavy chain gene, derive from the rich long-pending screening expression of the specificity of human source anti-hepatitis A antiviral antibody gene pool, its corresponding three CDR region sequences are the distinctive brand-new sequence of this antibody, and wherein ChHAIgG16 light chain and heavy chain variable region gene sequence have been to state in the CN1316437A patent application in patent publication No.; ChHAIgG78 variable region of light chain CDR1, CDR2 and CDR3 sequence are difference " RASQSVSSSYLA ", " GASSRAT " and " QQYGSSPLT "; HAV78IgG variable region of heavy chain CDR1, CDR2 and CDR3 sequence be respectively " SHEMN ", " YIGSRGSDTSYADSVKGR " and " ERYRYFEDYYHGLDV ", its gene expression characteristics determined its to the avidity of hepatitis A virus (HAV) with in and defencive function;
4) human source anti-hepatitis A virus gene engineering antibody ChHAIgG16 or ChHAIgG78, its weight chain leader and constant region gene source are in cells of mamma animals human antibody efficient expression vector VH-dhfr1 and VK-dhfr1, and this carrier has been to state in the CN1363682 patent application in patent publication No.;
5) be by the cells of mamma animals expression vector system, the high-affinity neutrality people source complete antibody of specificity combination of producing in CHO engineering cell system and identification hepatitis A virus (HAV) coat protein has and the similar whole antibody molecular characterization of natural antibody molecule; Its in conjunction with the hepatitis A virus (HAV) coat protein and in and the function of virus infection by specificity nucleotide sequence decision among the complementary region CDR1 of decision family, the CDR2 that are present in antibody gene light chain and variable region of heavy chain and the CDR3, its amino acid sequence corresponding has constituted the specific antigens calmodulin binding domain CaM of antibody.
2. the CHO engineering cell system that is used to produce human source anti-hepatitis A virus gene engineering antibody is characterised in that:
1) is the CHO engineering cell system of stability and high efficiency expressing human source anti-hepatitis A virus neutrality genetic engineering antibody ChHAIgG16;
2) be the CHO engineering cell system of stability and high efficiency expressing human source anti-hepatitis A virus neutrality genetic engineering antibody ChHAIgG78;
3) can be exaggerated scale production, the antibody of its production is secretor type antibody, can obtain from culture supernatant;
4) after the serum-free cell cultures, can pass through affinity chromatography process purified antibody protein that obtains from its culture supernatant.
3. human source anti-hepatitis A virus gene engineering antibody preparation HAMax
TM, it is characterized in that: for comprising the single or two kinds of blended used for intravenous injection of a kind of antibody in two kinds of antibody of ChHAIgG16 and ChHAIgG78, intramuscular injection antibody preparation with, oral or external application; It has very high avidity to hepatitis A virus (HAV) antigen, and have external fully in and protect monkey to resist hepatitis A virus (HAV) in hepatitis A virus (HAV) and the body fully and attack.
4.CHO the human source anti-hepatitis A virus gene engineering antibody of cells produce is antibody preparation HAMax extremely
TMPurposes, it is characterized in that:
1) can be used for preventing or treating the preparation of the hepatitis A medicine that causes by hepatitis A virus (HAV);
2) can be used for diagnosing the preparation of the reagent that hepatitis A virus (HAV) infects;
3) can be used for preventing and treat the preparation of the used for intravenous injection, intramuscular injection that infect the hepatitis A that causes by hepatitis A virus (HAV) with the biotechnological formulation of, oral or external application.
Generally speaking, the human source anti-hepatitis A virus neutrality genetically engineered whole antibody of the present invention's statement, it is the expression that on the basis that obtains antibody gene, obtains the full-antibody gene product, this antibody gene can be along with plasmid DNA duplicating and stable duplicating in bacterium, and be recombined among the Chinese hamster ovary celI DNA, form stable expression cell line.Utilize this stable expression cell line, can be in Chinese hamster ovary celI the anti-hepatitis A virus (HAV) whole antibody of scale production continuously, during described antibody has on the identification hepatitis A virus (HAV) nucleocapsid protein and antigen, thereby the function that the blocking-up hepatitis A virus (HAV) infects, utilize in its height and functional performance that hepatitis A virus (HAV) infects and with the similar whole antibody molecular characterization of natural antibody molecule, the preparation antibody preparation is expected clinically to substitute blood product gamma-globulin in the market and is used to prevent and treats by hepatitis A virus (HAV) and infect the hepatitis A that causes.
Four, description of drawings
Fig. 1 be ChHAIgG78 weight chain variable region by the nucleotide sequence deduced amino acid, comprise framework region (FR) and hypervariable region (CDR) of antibody variable region.
2. Fig. 2 is the fluorescence with the 30th generation ChHAIgG16CHO cell expressing humanized IgG antibody of the anti-human IgG K chain (2A) of FITC mark and anti-human IgG Fc (2B) fluorescent antibody staining.
3. Fig. 3 stablizes excretory IgG anti-body contg in go down to posterity middle HAIgG16 and the HAIgG78 two strain CHO engineering cells system expression supernatant for ELISA detects.
4. Fig. 4 is the human source anti-hepatitis A virus IgG antibody of the affinitive layer purification of expressing in the SDS-PAGE electrophoretic analysis Chinese hamster ovary celI.
5. Fig. 5 is the avidity and the international unit elisa assay result relatively of mensuration human source anti-hepatitis A virus gene engineering antibody.
6. Fig. 6 is the external neutralization effectiveness detection of human source anti-hepatitis A virus gene engineering antibody.
7. Fig. 7 is the competitive ELISA analysis of ChHAIgG16 and ChHAIgG78 and HRP mark mouse-anti hepatitis A virus (HAV) neutralizing antibody.
8. Fig. 8 is the dynamic change of immune group and control group rhesus monkey HAV antibody and ALT.
Five, embodiment
Following preferential embodiment elaborates to the present invention, but does not mean that restriction content of the present invention.In these embodiments, be explanation the present invention, the monoclonal antibody gene of employing and cells of mamma animals human antibody efficient expression vector are all from this laboratory invention.Used main bacterial strain is commercial prod XLI-Blu (U.S. Strategene company).Chinese hamster ovary celI is available from U.S. ATCC.Hepatitis A virus (HAV) be this institute hepatitis chamber from the isolating imperial first strain of China patient, existing preserve by the hepatitis chamber, (is the patent application of CN1316437A referring to patent publication No.) can openly be provided to the research institution or the unit of correlative technology field.
Example 1, the sequence signature of the human source anti-hepatitis A virus gene engineering antibody gene that Chinese hamster ovary celI is produced: its variable region gene composition characteristic is specific light chain and heavy chain gene, derive from the rich long-pending screening expression of the specificity of human source anti-hepatitis A antiviral antibody gene pool, its corresponding three CDR region sequences are the distinctive brand-new sequence of this antibody, and wherein ChHAIgG16 light chain and heavy chain variable region gene sequence have been to state in the CN1316437A patent application in patent publication No..ChHAIgG78 variable region of light chain CDR1, CDR2 and CDR3 sequence are difference " RASQSVSSSYLA ", " GASSRAT " and " QQYGSSPLT ".Its complete nucleotide sequence is as follows:
GAGCTCACGCAGTCTCCA?GGCACCCTGTCTTTGTCTCCAGG?GAAAGAGCC
ACC?CTC?TCC?TGC?AGG?GCCAGTCAGAGTGT?AGCAGCAGCTACTTA?GCC
TGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCATC
CAGCAGGGCCACTGGC?ATCCCAGACAGGTTCAGTGGCAGTGGGTCTGGGACA
GACTTCACTCTCACCATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTA
CTGTCAGCAGTATGGT?AGCTCACCGCTCACTTTCGGCGGA?GGGACCAAG?GT
GGAGATCAAACGA?ACTGTG
ChHAIgG78 variable region of heavy chain CDR1, CDR2 and CDR3 sequence are difference " SHEMN ", " YIGSRGSDTSYADSVK " its complete nucleotide sequence is as follows:
CTCGAGTCTGGGGGAGGCTTGATACAGCCCGGAGGGTCCCTGAGACTCTCCTG
TGTAGCCTCTGGATTC?AGGTTCAGTAGTCATGAAATGAACTGGGTC?CGCCAG
GCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATCGGTAGTCGTGGTAGTGA
CACATCCTACGCAGACTCTGTGAAGGGCCGCTTCACC?GTC?TCCAGA?GAC?AAC
GCC?CGG?AAC?ACA?CTG?TAT?CTG?CAA?ATG?AACAACCTGA?GAGCCGAGGA
CACGGCTGTTTATTACT?GTGCGCGAGAGAGG?TAT?CGA?TACTTTGAA?GACTA
CTATCACGGTTT?GACGTCTGGGGCCAAGGG?ACC?ACG?GTC?ACC?GTC?TCC?TCA
Fig. 1 be ChHAIgG78 weight chain variable region by the nucleotide sequence deduced amino acid, comprise framework region (FR) and hypervariable region (CDR) of antibody variable region.
Clone's reorganization of the human source anti-hepatitis A virus gene engineering antibody gene that example 2, Chinese hamster ovary celI are produced: will present anti-hepatitis A virus (HAV) neutralizing antibody Fab gene clone that system obtains by phage surface and go into the human antibody of this laboratory invention and efficiently express in the expression vector.Wherein, ChHAIgG16 and ChHAIgG78 chain variable region gene are cloned into (this carrier has been to state in the CN1363682 patent application in patent publication No.) among the carrier VK-dhfrl respectively with EcoRV and XhoI restriction enzyme site, place under the control of EF-1 α promotor, obtain expression vector 16VL-dhfr and 78VK-dhfr.ChHAIgG16 and ChHAIgG78 heavy chain variable region gene are cloned into (this carrier has been to state in the CN1363682 patent application in patent publication No.) among the carrier VH-dhfr1 respectively with BssHII and BstE II, obtain expression vector 16VH-dhfr and 78VH-dhfr.Vector plasmid DNA is used for transfection CHO cell behind column chromatography purification (QiagenMidi Kit, Qiagen company, the U.S.).
Example 3, the foundation of the Chinese hamster ovary celI system of high efficiency stable expression humanized IgG antibody is extremely expressed: with LipofectinAINE 2000 transfection reagent boxes (GIBCO BRL company, the U.S.) will grow up to individual layer CHO-dhfr-cell (U.S. ATCC article number: CRL-9096) in the expression vector plasmid DNA of purifying and LipofectAMINE Plus cotransfection 24 orifice plates, recession in 24 hours removes IMDM substratum (GIBCO BRL company, the U.S.) be used to keep the substandard products xanthine (H) and the thymus pyrimidine (T) of the growth of CHO-dhfr cell in, and by 1: the rare T25 square vase that imports into of 20-30.Add screening of medicaments methotrexate (MTX, Sigma company, the U.S.) after 24 hours, initial concentration is 10
-7M is enlarged to 10 gradually
-6M, the positive colony of selecting dual expression IgG heavy chain and light chain gene in the pressing process obtains the expression of the complete humanized IgG antibody of reorganization.
Example 4, stable the go down to posterity expression of human source anti-hepatitis A virus full-antibody gene in Chinese hamster ovary celI: according to example 2 methods, at first build up human source anti-hepatitis A virus whole antibody ChHAIgG16 and ChHAIgG78 Chinese hamster ovary celI engineering cell system, will efficiently express the purpose clone of human source anti-hepatitis A virus full-antibody gene with tolerance MTX10
-8M or 2 * 10
-6The generation of M is the first-generation, goes down to posterity containing under the IMDM culture condition of 10% new-born calf serum 1: 4, per generation cell grew approximately 3-4 days, the expression supernatant of collecting per generation cell is in order to detecting.Detect the expression of IgG1 antibody in the different generation preface Chinese hamster ovary celIs with immunofluorescence method.As shown in Figure 2, be fluorescence with the 30th generation ChHAIgG16CHO cell expressing humanized IgG antibody of the anti-human IgG K chain (2A) of FITC mark and anti-human IgG Fc (2B) fluorescent antibody staining.Its cell expressing positive rate is stable still stable on this basis more than 95% when going down to posterity the 30th generation.Detect with the ELISA sandwich assay propagated sensation for the cell expressing supernatant in excretory IgG antibody, with anti-human IgG Fab antibody (Sigma company, the U.S.) bag is by elisa plate, after adding different dilution expressing cho cell supernatant to be detected, the anti-human IgG Fc antibody that adds the HRP mark, the O.D value is detected in the colour developing back, and with compare with the humanized IgG standard substance (SIgG) of concentration known and purifying ChHAIgG16 (RIgG) the ELISA examination criteria curve of concentration known, calculate the IgG content of expressing in the supernatant.As shown in Figure 3, be that ELISA detects excretory IgG anti-body contg in stable go down to posterity middle HAIgG16 and the HAIgG78 two strain CHO engineering cells system expression supernatant, wherein the ChHAIgG16 engineering cell is that expression level is stabilized in 50-60mg/L, is stabilized in 40-50mg/L and the HAIgG78 engineering cell is an expression level.
Example 5, the affinitive layer purification of the human source anti-hepatitis A virus gene engineering antibody that Chinese hamster ovary celI is produced: collect Chinese hamster ovary celI serum-free culture supernatant, 2000G is centrifugal, with low protein adsorption membrane filtration supernatant, to filter the back supernatant and cross the ProteinG affinity chromatographic column, the wash-out neutralization is through the desalting column desalination.Fig. 4 is the human source anti-hepatitis A virus IgG antibody of the affinitive layer purification of expressing in the SDS-PAGE electrophoretic analysis Chinese hamster ovary celI.Wherein Fig. 4 A is anti-hepatitis A virus (HAV) IgG heavy chain of antibody of purifying (50KD) and light chain (25KD) electrophoresis band under the reductive condition, be respectively the protein molecular standard substance from left to right, ChHAIgG16 antibody purification 0.5ug, 1ug and 2ug, humanized IgG standard substance 0.5ug, 1ug and 2ug.Fig. 4 B is the anti-hepatitis A virus (HAV) IgG antibody of the purifying under a non-reduced condition H2L2 tetramer electrophoresis band.Be respectively the protein molecular standard substance from left to right, ChHAIgG16 antibody purification 0.5ug, 1ug and 2ug, humanized IgG standard substance 0.5u, HAIgG78 antibody purification 0.5ug, 1ug and 2ug.
Example 6, the avidity of the human source anti-hepatitis A virus gene engineering antibody of Chinese hamster ovary celI production is measured extremely, and SI units compare: the hepatitis A virus (HAV) bag of using purifying is by elisa plate, the HAIgG16 antibody and the HAIgG78 antibody concentration of purifying in the example 4 are adjusted to 1mg/ml, with 1: 400 initial (every hole 0.25ug), 1: 2 doubling dilution adds the dilution sample of difference in the hand-hole, after the 37C reaction, the anti-human IgG Fc antibody that adds the HRP mark, the O.D value is detected in the colour developing back.Simultaneously with its standard international unit of mensuration of comparing from biological products assay institute 78 international unit/ml SGG.Fig. 5 is avidity and the international unit elisa assay result relatively who measures human source anti-hepatitis A virus gene engineering antibody.16IgG among the figure, 78IgG, 3: 1Mix, SigG and EHF-IgG represent ChHAIgG16 respectively, and ChHAIgG78 antibody, ChHAIgG16 and ChHAIgG78 is with 3: 1 weight mixed antibodies, SGG and irrelevant anti-hantavirus human antibody.Compare with SGG, the anti-hepatitis A virus (HAV) antibody of specificity is higher than nearly 4 times of gamma-globulin, and its affinity costant can reach 1.6 * 10
-11M.1mg recombination human source anti-hepatitis A virus gene engineering antibody is equivalent to 320 international unit.And ChHAIgG16 and ChHAIgG78 mixed antibody do not reach the effect that improves affinity of antibody.
Example 7, in the human source anti-hepatitis A virus gene engineering antibody that Chinese hamster ovary celI is produced and functional examination extremely SI units are relatively: the ChHAIgG16 and the ChHAIgG78 antibody concentration of purifying in the example 4 are adjusted to 1mg/ml, with 1: 25 initial (every hole 4ug), 1: 2 doubling dilution, the hepatitis A virus (HAV) 37C of dilution sample of difference and 100TCID was hatched 2 hours, infect hepatitis A virus (HAV) sensitive cells T4 cell then.ELISA detects hepatitis A virus (HAV) content in each sample hose after 21 days.The sample that detects is that hepatitis A virus (HAV) infects the lysis supernatant after 21 days.Fig. 6 is that detection is renderd a service in the external neutralization of human source anti-hepatitis A virus gene engineering antibody.Neutralization test result shows that this strain antibody not only has very high avidity, and same according to stronger neutralising capacity is arranged.In external and the 100TCID50 hepatitis A virus (HAV) infect and reach 80% and only need about 1ug when above, and in 50% and the time, only need 0.05ug antibody.And ChHAIgG16 and ChHAIgG78 mixed antibody have collaborative enhancement in neutralization test.The anti-hantavirus genetic engineering antibody of similarity condition purifying then can not in and hepatitis A virus (HAV) infect.
The human source anti-hepatitis A virus gene engineering antibody competition of example 8.CHO cells produce suppresses experiment: the hepatitis A virus (HAV) bag of using purifying is by elisa plate.The ChHAIgG16 and the ChHAIgG78 antibody concentration of purifying in the example 4 are adjusted to 1mg/ml, initial with every hole ug, 1: 2 doubling dilution, the dilution sample of difference is added in the hand-hole, after 37 ℃ of reactions, the HRP mark mouse-anti hepatitis A virus (HAV) neutralizing antibody that adds dilution in 1: 1000, the O.D value is detected in the colour developing back.Fig. 7 is the competitive ELISA analysis of ChHAIgG16 and ChHAIgG78 and HRP mark mouse-anti hepatitis A virus (HAV) neutralizing antibody.Wherein, ChHAIgG16 antibody can be fully under the 0.1ug situation and the competition of HRP mark mouse-anti hepatitis A virus (HAV) neutralizing antibody, ChHAIgG78 antibody is HRP mark mouse-anti hepatitis A virus (HAV) neutralizing antibody competition well then, shows that ChHAIgG16 antibody determines family with HAIgG78 antibody at different hepatitis A virus (HAV) antigen.
The human source anti-hepatitis A virus gene engineering antibody of example 9.CHO cells produce is tested in the intravital protectiveness of rhesus monkey: 4 of rhesus monkeies are used in experiment; health and epidemic prevention station provides by Guangxi Zhuang Autonomous Region; 3 female 1 heros heavily are 1.95-4Kg, and experiment is divided into 2 groups at random; every group 2; blood sampling before every monkey experiment detects the total antibody of anti-HAV, and is negative; ALT is normal, and gets rid of by the possibility of other hepatites virus infections.One group of monkey (monkey 204, monkey 205) is before attacking with hepatitis A virus (HAV) street strain, and 3: 1 mixed antibody preparations of first intravenous inoculation human source anti-hepatitis A virus gene engineering antibody ChHAIgG16 and ChHAIgG78,2mg/ are only; One group of monkey (monkey 206, monkey 207) does not inoculate antibody, an injecting normal saline.After 30 hours, attack this two groups of monkeys with hepatitis A virus (HAV) street strain, 10% fecal suspension (wherein containing an antibiotic) 3ml/ monkey, ELISA detects hav antigen P/N value about 3, intravenous injection.Blood sampling detects ALT (serum alanine transaminase) weekly, takes ordinary method to detect the stool of collecting every day.The total antibody of anti-HAV adopts competition law ELISA to detect in the serum, carries out (Wan Tai biotech company, China) by hepatitis A antibody assay kit specification sheets.Hepatitis A virus (HAV) RNA detects and adopts the antibody capture PCR method to carry out in the ight soil, method is as follows: used minus strand primer is the Nucleotide 2389-2414 that is incorporated into VP1,5 '-GGAAATGTCTCAGGTACTTTCTTTG-3 ', positive strand primer is the carboxyl terminal Nucleotide 2167-2193 that is incorporated into VP3,5 '-GTTTTGCTCCTCTTTATCATGCTATG-3 '.Antibody capture virus is carried out in the 0.5ml centrifuge tube.Loop parameter is: 94 ℃ of sex change 30 seconds, and 55 ℃ of annealing renaturation 30 seconds, 72 ℃ were extended 30 seconds, 35 circulations, the primer extension time increases by 5 minutes during last end cycle.The result is the dynamic change of immune group and control group rhesus monkey HAV antibody and ALT as shown in Figure 8.(Fig. 8 A is monkey 204 data to experimental group, Fig. 8 B is monkey 205 data) (Fig. 8 C is monkey 206 data with control group, Fig. 8 D is monkey 207 data) dynamic change of ALT and the total antibody of anti-HAV before and after recombinant antibodies immunity and hepatitis A virus (HAV) street strain attack: after attacking, hepatitis A virus (HAV) street strain observed three months, control group is attacked back about 5-6 week in street strain, ALT obviously raises, continue about 2 week, and control group A LT there is not considerable change, all keeps normal level.The beginning before and after 5-6 week of the total antibody of the anti-HAV of control group obviously presents the positive, and lasts till that always observation finishes, and illustrates that HAV street strain has carried out duplicating and caused infection and morbidity in control group rhesus monkey body.And the experimental group rhesus monkey is after anti-HAV antibody is recombinated in the receiver source, and the anti-HAV antibody of its external source lasting masculin always reached about 6 weeks, and wherein one still can detect the positive when 8 weeks, but 9 week the back antibody become feminine gender, another becomes feminine gender after 7 weeks.But finish (14 week) up to observing, experimental group monkey ALT still is normal.Illustrate that the external source recombinant antibodies can protect rhesus monkey not infected by hepatitis A virus (HAV) effectively in the rhesus monkey body, more do not fall ill.
Claims (4)
1. human source anti-hepatitis A virus gene engineering antibody is characterized in that:
1) for derive from phage human antibody library screening with humanized IgG Fc gene recombination after at the total man source of CHO stably express cell IgG1 λ whole antibody, it is made up of two heavy chains and two λ-κ chimeric light chains, molecular weight is about 150kD, name ChHAIgG16;
2) for derive from phage human antibody library screening with humanized IgG Fc gene recombination after at the total man source of CHO stably express cell IgG1 κ whole antibody, it is made up of two heavy chains and two κ light chains, molecular weight is about 150kD, names ChHAIgG78;
3) human source anti-hepatitis A virus gene engineering antibody ChHAIgG16 or ChHAIgG78, its variable region gene composition characteristic is specific light chain and heavy chain gene, derive from the rich long-pending screening expression of the specificity of human source anti-hepatitis A antiviral antibody gene pool, its corresponding three CDR region sequences are the distinctive brand-new sequence of this antibody, and wherein ChHAIgG16 light chain and heavy chain variable region gene sequence have been to state in the CN1316437A patent application in patent publication No.; ChHAIgG78 variable region of light chain CDR1, CDR2 and CDR3 sequence are difference " RASQSVSSSYLA ", " GASSRAT " and " QQYGSSPLT "; HAV78IgG variable region of heavy chain CDR1, CDR2 and CDR3 sequence are difference " SHEMN ", " YIGSRGSDTSYADSVKGR " and " ERYRYFEDYYHGLDV "; Its gene expression characteristics determined its to the avidity of hepatitis A virus (HAV) and in and defencive function;
4) human source anti-hepatitis A virus gene engineering antibody ChUAIgG16 or ChHAIgG78, its weight chain leader and constant region gene source are in cells of mamma animals human antibody efficient expression vector VH-dhfr1 and VK-dhfr1, and this carrier has been to state in the CN1363682 patent application in patent publication No.;
5) be by the cells of mamma animals expression vector system, the high-affinity neutrality people source complete antibody of specificity combination of producing in CHO engineering cell system and identification hepatitis A virus (HAV) coat protein has and the similar whole antibody molecular characterization of natural antibody molecule; Its in conjunction with the hepatitis A virus (HAV) coat protein and in and the function of virus infection by specificity nucleotide sequence decision among the complementary region CDR1 of decision family, the CDR2 that are present in antibody gene light chain and variable region of heavy chain and the CDR3, its amino acid sequence corresponding has constituted the specific antigens calmodulin binding domain CaM of antibody.
2. according to claim 1, the CHO engineering cell system that is used to produce human source anti-hepatitis A virus gene engineering antibody is characterised in that:
1) is the CHO engineering cell system of stability and high efficiency expressing human source anti-hepatitis A virus neutrality genetic engineering antibody ChHAIgG16;
2) be the CHO engineering cell system of stability and high efficiency expressing human source anti-hepatitis A virus neutrality genetic engineering antibody ChHAIgG78;
3) can be exaggerated scale production, the antibody of its production is secretor type antibody, can obtain from culture supernatant;
4) after the serum-free cell cultures, can pass through affinity chromatography process purified antibody protein that obtains from its culture supernatant.
3. human source anti-hepatitis A virus gene engineering antibody preparation HAMax
TMM, it is characterized in that: for comprising the single or two kinds of blended used for intravenous injection of a kind of antibody in two kinds of antibody of ChHAIgG16 and ChHAIgG78, intramuscular injection antibody preparation with, oral or external application; It has very high avidity to hepatitis A virus (HAV) antigen, and have external fully in and protect monkey to resist hepatitis A virus (HAV) in hepatitis A virus (HAV) and the body fully and attack.
4.CHO the human source anti-hepatitis A virus gene engineering antibody of cells produce is antibody preparation HAMax extremely
TMMPurposes, it is characterized in that:
1) can be used for preventing or treating the preparation of the hepatitis A medicine that causes by hepatitis A virus (HAV);
2) can be used for diagnosing the preparation of the reagent that hepatitis A virus (HAV) infects;
3) can be used for preventing and treat the preparation of the used for intravenous injection, intramuscular injection that infect the hepatitis A that causes by hepatitis A virus (HAV) with the biotechnological formulation of, oral or external application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200410070620 CN1605628A (en) | 2003-09-03 | 2004-07-23 | Human source anti-hepatitis A virus gene engineering antibody from CHO cell |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN03156175.6 | 2003-09-03 | ||
| CN03156175 | 2003-09-03 | ||
| CN 200410070620 CN1605628A (en) | 2003-09-03 | 2004-07-23 | Human source anti-hepatitis A virus gene engineering antibody from CHO cell |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1605628A true CN1605628A (en) | 2005-04-13 |
Family
ID=34796138
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200410070620 Pending CN1605628A (en) | 2003-09-03 | 2004-07-23 | Human source anti-hepatitis A virus gene engineering antibody from CHO cell |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1605628A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104342455A (en) * | 2010-06-22 | 2015-02-11 | 瑞泽恩制药公司 | Mice expressing alight chain with human lambda variable and mouse constant regions |
| US11612151B2 (en) | 2011-12-20 | 2023-03-28 | Regeneron Pharmaceuticals, Inc. | Humanized light chain mice |
-
2004
- 2004-07-23 CN CN 200410070620 patent/CN1605628A/en active Pending
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104342455A (en) * | 2010-06-22 | 2015-02-11 | 瑞泽恩制药公司 | Mice expressing alight chain with human lambda variable and mouse constant regions |
| US11612151B2 (en) | 2011-12-20 | 2023-03-28 | Regeneron Pharmaceuticals, Inc. | Humanized light chain mice |
| US11617357B2 (en) | 2011-12-20 | 2023-04-04 | Regeneron Pharmaceuticals, Inc. | Humanized light chain mice |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110016079B (en) | Neutralizing antibody for resisting respiratory syncytial virus and application thereof | |
| DK1597280T4 (en) | Preparation of monoclonal antibodies by EBV transformation of B cells | |
| CN101550189B (en) | Anthropogenic antivirulin glycosidoprotein neutralizing genetic engineering antibody RD9 and preparation and application thereof | |
| CN106565840B (en) | Antibody against hepatitis B surface antigen and use thereof | |
| CN103619870B (en) | Epi-position of hepatitis B virus surface antigen and application thereof | |
| CN102264393B (en) | Anti-hcv monoclonal antibody as a medicament for the therapeutic treatment and prevention of hcv infections | |
| CN101891805B (en) | Human enterovirus 71 type specific polypeptide and application thereof | |
| CN105001325A (en) | Total-humanized anti-hepatitis B virus neutralizing antibody and preparing method and application thereof | |
| WO2020186687A1 (en) | Human antibody specifically binding four serotypes of dengue viruses | |
| CN1986569A (en) | Humanized respiratory syncytial virus-resisting neutralizing gentically engineered Fab antibody | |
| CN1605628A (en) | Human source anti-hepatitis A virus gene engineering antibody from CHO cell | |
| CN102863527B (en) | Humanized hepatitis b virus resistance surface antigen gene engineering antibodies and preparation method and application thereof | |
| US20230265168A1 (en) | Antibody binding to hepatitis b virus surface antigen and application of antibody | |
| CN110702913B (en) | Monoclonal antibody composition for quantitatively detecting coxiella burnetii I strain | |
| CN113651884A (en) | Humanized anti-SARS-CoV-2 monoclonal antibody and its application | |
| CN114316036A (en) | O-type foot-and-mouth disease virus structural protein VP1 broad-spectrum neutralizing antibody, preparation method and application thereof | |
| AU2005276787A1 (en) | Binding member towards Pneumolysin | |
| CN113583124A (en) | Anti-progastrin release peptide monoclonal antibody and preparation method thereof | |
| CN1163512C (en) | Humanized neutralizing generatically engineering Fab antibody of hepatitis A virus | |
| CN116410309B (en) | Antibodies that specifically bind to poliovirus type III antigens | |
| CN116355083B (en) | Antibodies that specifically bind to poliovirus type I antigens | |
| WO2023102692A1 (en) | Human antibodies and antibody combinations for synergistic neutralization of sars-cov-2, and use thereof | |
| CN113667011B (en) | Method for preparing antigen binding units | |
| CN116355082B (en) | Antibodies that specifically bind to poliovirus type II antigens | |
| WO2023046097A1 (en) | Anti-tigit humanized antibody or antigen-binding fragment thereof and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |