CN1602958A - A and O type gene engineering bivalent polypeptide vaccine of livestock foot-and-mouth disease virus and its preparation process - Google Patents

Abstract

Involves a kind of family member foot-and-mouth disease virus and the pair of valent state multi- peptides vaccine as well as the genetic engineering domain, in particularly a kind of AO genetic engineering double price multi- peptides vaccine and its preparing method.Has cloned AO the foot-and-mouth disease virus VP1antigen decision bunch, after series it with the big fragment which can remarkably enhance its immunity original,inserts the nucleus expresses carrier,Inducts the expressed protein to deactivate then makes double price multi- peptides vaccine which has the foot-and-mouth disease AO immunity original.Its preparing method is adds the cushion fluid in the wet fungus,gentrifugalism, collects the up clear solution;adds the balance Ni+-NTA-Sepharose 6B to the up clear solution,install the gelatin on to the chromatographic analysis column; Elutes with the cushion fluid;collects, analyzes with Sds-page; then maks the Sds-page analysis.Can simultaneously effectively prevent the AO foot-and-mouth disease virus,the safety is reliable.

Description

Livestock foot-and-mouth disease virus of A, the two valency polypeptide vaccines of O type genetic engineering and preparation method thereof

(1) technical field

The present invention relates to a kind of livestock foot-and-mouth disease virus (FMDV) and two valency polypeptide vaccine and field of genetic engineering, especially a kind of A, the two valency polypeptide vaccines of O type genetic engineering and preparation method thereof.

(2) background technology

Foot and mouth disease is to cause a kind of acute, height contact, infectious fever artiodactylous, with propagate rapidly, infectious high and be celebrated, International Office of Epizootics classifies it first of category-A infectious disease as.Traditional vaccine mainly is deactivation and morbid substance attenuation, and promptly pathogen perhaps is lowered its toxicity cultivating, behind the purification, perhaps being inactivated.Though these two kinds of vaccines have better immunogenicity, the safety of producing is relatively poor, need take protective measure to laboratory and the staff who participates in the experiment, and guarantees not polluted by morbid substance: assurance virus is not leaked.In the production of vaccine process, virus might not killed or abundant attenuation fully, can cause containing the high toxicity morbid substance in the vaccine, and then cause the immunized animal morbidity and make disease popular on a large scale.The effect duration of most existing vaccines is all very short, and usually needs freezing preservation, and this has increased the difficulty that vaccine is promoted the use of in the rural area.The recombiant vaccine of making a new generation that develops into of DNA recombinant technique provides new approaches.Though clone foot and mouth disease virus VP1 albumen at present and made foot-and-mouth disease vaccine, a little less than its immunogenicity, still undesirable to the protection effect of animal.Foot and mouth disease belongs to the Picornaviridae Hostis, comprises 7 kinds of serotypes such as A, O, C altogether.China is mainly based on the O type, and A type foot and mouth disease also happens occasionally.The recombinant vaccine of foot and mouth disease is unit price at present.The preparation method of a kind of foot-and-mouth disease vaccine of U.S. Yi Lai company (CN86103718A) proposition in 1986, it is that treatment or the active chemical compound of prevention foot and mouth disease are arranged.This chemical compound contains structural formula X-A-Y-B-Z sequence, wherein A and B are the amino acid residue sequences of forming foot and mouth disease virus VP coat protein serotype sequence, one of them contains 18 to 24 amino acid residues, and comprise the identical sequence of O serotype 141-158 position upper amino acid residue sequence or other serotype, and another contains 14 to 20 amino acid residues, and comprises the amino acid residue sequence on 200 to 213 of the O serotypes or the identical sequence of other serotype.The antigenic antibody vaccine of a kind of foot and mouth disease of Hong Kong University of Science and Thchnology (CN1270839A) proposition in 1999, it belongs to a kind of vaccine for the treatment of Schweineseuche, and this vaccine is that the peptide epitopes that derives from FMDV is transplanted to pig antibody CDR ring and the antigenic antibody vaccine of generation.Can be by the VP1 gene clone FMDV peptide epitopes of PCR by FMDV.Use eclipsed PCR method the FMDV peptide epitopes to be inserted in the CDR zone of pig immune globulin heavy chain and light chain gene, with the antigenized antibody gene clone of gained to mammalian expression vector.To CHO or myeloma cell, select stable transfectant cell line plasmid transfection with the required protein vaccine of a large amount of generations.Shanghai Inst. of Plant Physiology, Chinese Academy of Sciences proposed a kind of novel foot and mouth vaccine and preparation method thereof in 2000, it is a kind of new fusion rotein that contains the little peptide of foot-and-mouth disease virus antigen and coded sequence thereof, and these fusion rotein are in the diagnosis of foot and mouth disease and the purposes in the prevention.Also provide and contained foot-and-mouth disease vaccine of these new fusion proteins and preparation method thereof.Said fusion rotein is that to be inserted with length between the 155-156 amino acids of coat protein for mosaic virus of tobacco be 10-20 amino acid whose foot and mouth disease virus specificity epitope.The length of this foot and mouth disease virus specificity epitope is 11-14 aminoacid.This foot and mouth disease virus specificity epitope is selected from down group: SEQ ID NO:2,3 and 4.Calendar year 2001, Shenzhen Sanfangyuan Information Technology Co., Ltd. proposed a kind of livestock foot-and-mouth disease gene engineering vaccine and manufacture method thereof, the engineering Seedling is to be obtained and the proteic full DNA sequence of codified VP1 by the viral RNA reverse transcription, it is the summation of the stereochemical structure that in the plant-bioreactor that comprises plant rhizome leaf and seed, forms, molecular weight is 30-150KDa, changes over to and expresses in the plant and the transgenic seed kind is gone into the processes such as plant that soil obtains can be used as vaccine by the full gene of VP1 being inserted plasmid vector, recombiant plasmid.

(3) summary of the invention

The object of the present invention is to provide and a kind ofly can effectively prevent A, O type vaccine foot and mouth disease virus, safe and reliable and preparation method thereof simultaneously.

The present invention has cloned the antigenic determinant of A, O type foot and mouth disease virus VP1, with its series connection with can significantly improve after its immunogenic big fragment links to each other, insert prokaryotic expression carrier, make after the albumen of abduction delivering is purified have foot and mouth disease A, immunogenic pair of valency polypeptide vaccine of O type.

The present invention is a kind of two valency polypeptide vaccines that can prevent A, O type foot and mouth disease virus.Be that the antigenic determinant in the VP1 albumen of coding A, O type hoof-and-mouth disease poison strain is partly connected.For strengthening its immunogenicity, in the middle of connecting the preceding paragraph, the end of this gene comprises O, A type foot-and-mouth disease virus antigen bunch big fragment.Its nucleotides sequence is classified as:

1 GGATCCATGGCTGTGCCAAACTTGCGTGGCGATTTGCAGGTGTTGGCTCAGAAAGTGGCT

61 CGTACTTTGCCAGAGCTCCGATCG?CGTCATAAACAGAAAATTGTGGCTCCAGTGAAACAG

121 ACTTTGGAATTCGGCTCTGGCCGTCGTGGCGACGATATGGGCTCTTTGGCTGCTCGTGTGGTG

181 AAACAGTTGCCAGGTACCGTCGACATGGACATTGACCCGTATAAAGAATTTGGAGCTTCT

241 GTGGAGTTACTCTCTTTTTTGCCTTCTGACTTCTTTCCTTCTATTCGAGATCTCCTCGAC

301 ACCGCCTCTGCTCTGTATCGGGAGGCCTTAGAGTCTCCGGAACATTGTTCACCTCACCAT

361 ACAGCACTCAGGCAAGCTATTCTGTGTTGGGGTGAGTTGATGAATCTGGCCACCTGGGTG

421 GGAAGTAATTTGGAAGACCCAGCAGTCGAC GCAGTTCCAAACTTGCGTGGTGATTTGCAG

481? ?GTTTTGGCACAGAAAGTTGCTCGTACCTTGCCAGGCTCTGGCCGTCGTGGCGATATGGGC

541? ?TCTTTGGCTGCTCGTGTGGTGAAACAGTTGCCACTCGAGTCCAGGGAATTAGTAGTCAGC

601 TATGTCAATGTTATGGGCCTAAAAATCAGACAACTACTGTGGTTTCACATTTCCTGTCTT

661 ACTTTTGGAAGAGAAACTGTTCTTGAGTATTTGGTGTCTTTTGGAGTGTGGATTCGCACT

721 CCTCCTGCTTACAGACCACCAAATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTT

781 GTTAGACGACGAGGCAGGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGAAGGTCT

841 CAATCGCCGCGTCGCAGAAGATCTCAATCTCGGGAATCTCAATGTTAGAAGCTT

Wherein 7～72,85～126,451～513 is the proteic O type of VP1 antigenic determinant;

133～192,514～573 is the proteic A type of VP1 antigenic determinant;

205～450,574～894 for helping the carrier protein that the FMDV polypeptide vaccine forms the certain space structure;

Other sequences are junction fragment.

Vaccine of the present invention, its inclusion body Denatured protein is through Ni ⁺-NTA-Sepharose 6B affinity column is directly separation and purification under the condition of non-degeneration, and concrete steps are as follows:

1) wet bacterium with buffer (buffer) A (the 6M guanidine hydrochloride, the 0.1M sodium phosphate, 0.01M Tris/HCl, pH8.0) centrifugal, collect supernatant;

2) will be with the equilibrated Ni of buffer A ⁺-NTA-Sepharose 6B adds in the supernatant, and gel is installed on the chromatographic column;

3) with buffer A and buffer B (8M carbamide, 0.1M sodium phosphate, 0.01M Tris/HCl, pH8.0) eluting;

4) with buffer C (8M carbamide, 0.1M sodium phosphate, 0.01M Tris/HCl, pH6.3) eluting;

5) with buffer D (8M carbamide, the 0.1M sodium phosphate, 0.01M Tris/HCl, pH5.9) eluting, reuse buffer E (8M carbamide, the 0.1M sodium phosphate, 0.01M Tris/HCl, pH4.5) eluting is collected, and analyzes with SDS-PAGE;

6) with buffer F (6M guanidine hydrochloride, 0.2M acetic acid) washing, collect, make SDS-PAGE and analyze.

Expression product is respectively with following four kinds of solution renaturation 12～24h that dialyses successively:

1) 8M carbamide, 5mM EDTA, 1 * PBS;

2) 2M carbamide, 5mM EDTA, 1 * PBS;

3) 0.2M carbamide, 5mM EDTA, 1 * PBS;

4)5mM?EDTA，1×PBS。

(4) description of drawings

Fig. 1 is the SDS-PAGE electrophoretogram of abduction delivering product.

Fig. 2 crosses column purification figure for protein.

Fig. 3 is that the recombiant protein of purification and the Dot-Elisa of inclusion body analyze.

(5) specific embodiment

The present invention is further illustrated below with reference to accompanying drawing.

The product of prokaryotic expression carrier pET-28a behind BamH I and Hind III double digestion passes through T with above fragment behind the purification ₄Dna ligase spends the night in 16 ℃ of connections.Next day, transformed competence colibacillus pET28a expressed bacterium BL21 (DE3) cell.Through enzyme action and PCR identify positive colony pET28a-T8-3S.

This positive colony placed have Kan ^rThe LB culture medium in, 37 ℃ of following overnight incubation are got 300～700uL incubated overnight liquid next day and are inoculated in the 10mL LB culture medium, cultivate 3h, make strain OD for 30～37 ℃ ₆₀₀Reach 0.6～0.9, inhale 1mL in contrast, adding IPTG then, to make its final concentration be 1mmol/L, induce 3～6h for 37 ℃, getting 1mL every one hour from culture fluid is transferred in the centrifuge tube, 12, centrifugal 1～the 5min of 000g, collect thalline, precipitation is resuspended in 1 * SDS sample loading buffer of 100 μ L, 100 ℃ of heating 3～10min, carry out SDS-PAGE and (concentrate glue 8%, separation gel 12%) carry out coomassie brilliant blue staining 4～10h behind the electrophoresis, use methanol: glacial acetic acid: water (45: 45: 10, V/V/V) 45 ℃ of decolouring 1～4h in the solution.Compare with the SDS-PAGE electrophoresis of pET-28a empty carrier abduction delivering sample, discovery induces beginning in back second hour tangible recombination fusion protein band just to occur, and the matching of molecular weight and calculating is for about 34KD, referring to Fig. 1, wherein first road is a not abduction delivering of pET-28a; Second road is pET-28a abduction delivering 4h; The 3rd road is a not abduction delivering of pET28a-T8-3S; The 4th road is pET28a-T8-3S abduction delivering 2h; The 5th road is pET28a-T8-3S abduction delivering 3h; The 6th road is the protein standard sample.

Vaccine of the present invention, its inclusion body Denatured protein is through Ni ⁺-NTA-Sepharose 6B affinity column is directly separation and purification (referring to Fig. 2, wherein abscissa is time T/Min, and vertical coordinate is ultraviolet absorption value a/ (280nm)) under the condition of non-degeneration,

Concrete steps are as follows:

1) the wet bacterium of every gram add 4～5mL buffer A (the 6M guanidine hydrochloride, the 0.1M sodium phosphate, 0.01M Tris/HCl, pH8.0), stirring at room; 10, the centrifugal 10～20min of 000g collects supernatant;

2) with 4～5mL equilibrated Ni of buffer A ⁺-NTA-Sepharose 6B adds in the supernatant, and stirring at room 40～60min installs to gel on the chromatographic column that diameter is 1.6cm;

3) with the buffer A of 10 bed volumes and the buffer B of 5 bed volumes (8M carbamide, the 0.1M sodium phosphate, 0.01MTris/HCl, pH8.0) eluting if necessary, is washed till A 280＜0.01;

4) with buffer C (8M carbamide, the 0.1M sodium phosphate, 0.01M Tris/HCl, pH6.3) eluting is washed till A280＜0.01;

5) (0.01M Tris/HCl pH5.9) washes earlier for 8M carbamide, 0.1M sodium phosphate, and (0.01M Tris/HCl pH4.5) washes reuse 10-20mLbuffer E for 8M carbamide, 0.1M sodium phosphate, and every 3mL collects a pipe, analyzes with SDS-PAGE with 10-20mL buffer D;

6) with 20 mLbuffer F (6M guanidine hydrochloride, 0.2M acetic acid) washing, every 3mL collects a pipe, makes SDS-PAGE and analyzes.

Expression product is respectively with following four kinds of solution renaturation 12～24h that dialyses successively:

1) 8M carbamide, 5mM EDTA, 1 * PBS;

2) 2M carbamide, 5mM EDTA, 1 * PBS;

3) 0.2M carbamide, 5mM EDTA, 1 * PBS;

4)5mM?EDTA，1×PBS。

For further proving conclusively this fusion rotein is at expression in escherichia coli with what form, thalline is resuspended through the buffer of 10mM Tris-Cl (pH7.6) after the expression that we will collect, carry out the ultrasonic disruption thalline in the ice bath (broken 8～40 times, each 30～60s, interval 30～60s), cell pyrolysis liquid is in 4 ℃, 12, the centrifugal 15min of 000g sucts clearly, mix with 1: 1 with sample-loading buffer, precipitation is resuspended in 1 * SDS sample-loading buffer, and 100 ℃ of heating 3min concentrate glue in 8%, carry out the SDS-PAGE electrophoresis in 12% separation gel, this amalgamation and expression albumen of dyed decolouring post analysis is that the form with inclusion body exists.

Whether has the antigenicity of anti-A of FMDV and anti-O in order to detect the fusion recombiant protein, with the anti-A of mice FMDV standard and anti-O antibody as first antibody, with the sheep anti-mouse igg of horseradish peroxidase-labeled is two anti-, recombiant protein and inclusion body to purification carry out the Dot-Elisa detection, the result shows: the recombiant protein of purification and inclusion body all can with anti-A and anti-O antibody generation immunoreation, the albumen that shows inclusion body and purification all has anti-A and the dual antigenicity of anti-O (referring to Fig. 3), wherein first road is the recombiant protein of purification, and second road is an inclusion body; 1: one anti-is mice standard FMDV anti-A type immune serum; 2: one anti-is mice standard FMDV resisting O-type immune serum; 3: one anti-is the mice negative serum.With the fusion recombiant protein behind the purification, inclusion body after the 12%SDS-PAGE electrophoretic separation, electrotransfer goes on the nitrocellulose filter, after the confining liquid sealing, with the anti-A of FMDV standard and anti-O antibody as first antibody, with the IgG of horseradish peroxidase-labeled is two anti-, carrying out WesternBlotting analyzes, can detect a specific band in the fusion recombiant protein sample behind inclusion body and purification, the about 33KD of molecular weight size, match with value of calculation, and do not have respective strap in the pET-28a abduction delivering product sample.This albumen that further illustrates inclusion body and purification all has anti-A and the dual antigenicity of anti-O.

With recombiant protein 50～100 μ g and the Freund's complete adjuvant equal-volume hybrid injection mice of purification, behind the first quarter moon same dose booster immunization once, a week back with same dose again immunity once, all posterior orbit blood samplings, preparation serum detects for Elisa and uses.The every hole of elisa plate bag is by the recombinant protein of 5～10 μ g purification, 4 ℃ are spent the night, cleaning mixture washing 5～10min, with confining liquid sealing 1～2h, by the test serum after the serial gradient dilution immunity, add feminine gender, positive serum in contrast, 37 ℃ of incubation 1h, the goat-anti rabbit two that adds horseradish peroxidase-labeled after the washing is anti-, adds 200 μ L/ hole TMB chromogenic substrates, room temperature lucifuge 30min, add the stop buffer cessation reaction, microplate reader wavelength 450nm place surveys the OD value, uses the blank well zeroising, as OD value 2.1 times, think the positive greater than negative control OD value.Tiring of serum is 1280 after the immunity of survey purifying protein.

Embodiment:

Dna fragmentation with antigenic determinant in chemical method composite coding O and the A type foot and mouth disease virus VP1 albumen, the big fragment that this three fragment series connection back and one section centre is comprised O, A type foot-and-mouth disease virus antigen bunch is connected, with pET-28a prokaryotic expression carrier plasmid, be suspended in respectively in the TE buffer, behind BamHI and HindIII double digestion, run 1% agarose gel electrophoresis, after EB dyeing, reclaim bright band, reclaim test kit with a small amount of glue and reclaim DNA.After both mix, add the T of 1 unit ₄Dna ligase spends the night 16 ℃ of connections, joins e. coli bl21 (DE3) competent cell that 40 μ L now make, 4 ℃ keep 30min, through 37 ℃ of heat shocks, behind the ice bath 2min, add 360 μ L and do not add the LB fluid medium of resistance, 37 ℃ are shaken bacterium 45min, pour into to have Kan ^rThe LB culture medium, cultivate after the picking monoclonal extracts plasmid after a night enzyme action for 37 ℃ and identify, select positive colony.By dna sequencing, this clone's conforms to design.

Positive colony is inoculated in a small amount of Kan ^rIn the culture medium, 37 ℃ of overnight shakings are got 1000 μ L incubated overnight liquid next day and are inoculated in and contain Kan ^r100mL LB culture medium in, 37 ℃ are shaken bacterium 3h, make bacterium liquid OD ₆₀₀Reach about 0.8, adding IPTG, to make its final concentration be 1mmol/L, 37 ℃ of abduction delivering 4h, 12, the centrifugal 1min of 000g collects thalline, buffer with the 10mmol/LTris-Cl (pH7.6) of two volumes is resuspended, uses the ultrasonic disruption thalline in the ice bath, broken 60 times, each 40s, 1min at interval, thalline be in 10, the centrifugal 30min of 000g, promptly obtain the fusion rotein of recombinating, its fusion rotein content accounts for 40%.Every gram thalline add 4～5mL buffer A (the 6M guanidine hydrochloride, the 0.1M sodium phosphate, 0.01M Tris/HCl, pH8.0), stirring at room; 10, the centrifugal 10～20min of 000g collects supernatant: with 4～5mL equilibrated Ni of buffer A ⁺-NTA-Sepharose 6B adds in the supernatant, and stirring at room 40～60min installs to gel on the chromatographic column that diameter is 1.6cm; With the buffer A of 10 bed volumes and the buffer B of 5 bed volumes (8M carbamide, the 0.1M sodium phosphate, 0.01M Tris/HCl, pH8.0) eluting if necessary, is washed till A280＜0.01; With buffer C (8M carbamide, 0.1M sodium phosphate, 0.01M Tris/HCl, pH6.3), be washed till A280＜0.01: with 10 bed volume buffer D (8M carbamide, 0.1M sodium phosphates, 0.01M Tris/HCl, pH5.9) wash 10 bed volume buffer of reuse E (8M carbamide, 0.1M sodium phosphate earlier, 0.01M Tris/HCl, pH4.5) wash, every 3mL collects a pipe, analyzes with SDS-PAGE.With 20mL buffer F (6M guanidine hydrochloride, 0.2M acetic acid) washing, every 3mL collects a pipe, makes SDS-PAGE and analyzes.Expression product is respectively with following four kinds of solution renaturation 12～24h that dialyses successively:

1), 8M carbamide, 5mM EDTA, 1 * PBS;

2), 2M carbamide, 5mM EDTA, 1 * PBS;

3), 0.2M carbamide, 5mM EDTA, 1 * PBS;

4)、5mM?EDTA，1×PBS。

Claims (2)

1, the two valency polypeptide vaccines of livestock foot-and-mouth disease virus of A, O type genetic engineering is characterized in that its nucleotides sequence classifies as:

1 GGATCCATGGCTGTGCCAAACTTGCGTGGCGATTTGCAGGTGTTGGCTCAGAAAGTGGCT

61 CGTACTTTGCCAGAGCTCCGATCGCGTCATAAACAGAAAATTGTGGCTCCAGTGAAACAG

121 ACTTTGGAATTCGGCTCTGGCCGTCGTGGCGATATGGGCTCTTTGGCTGCTCGTGTGGTG

181 AAACAGTTGCCAGGTACCGTCGACATGGACATTGACCCGTATAAAGAATTTGGAGCTTCT

241 GTGGAGTTACTCTCTTTTTTGCCTTCTGACTTCTTTCCTTCTATTCGAGATCTCCTCGAC

301 ACCGCCTCTGCTCTGTATCGGGAGGCCTTAGAGTCTCCGGAACATTGTTCACCTCACCAT

361 ACAGCACTCAGGCAAGCTATTCTGTGTTGGGGTGAGTTGATGAATCTGGCCACCTGGGTG

421 GGAAGTAATTTGGAAGACCCAGCAGTCGAC GCAGTTCCAAACTTGCGTGGTGATTTGCAG

482 GTTTTGGCACAGAAAGTTGCTCGTACCTTGCCAGGCTCTGGCCGTCGTGGCGATATGGGC

542 TCTTTGGCTGCTCGTGTGGTGAAACAGTTGCCACTCGAGTCCAGGGAATTAGTAGTCAGC

601 TATGTCAATGTTATGGGCCTAAAAATCAGACAACTACTGTGGTTTCACATTTCCTGTCTT

661 ACTTTTGGAAGAGAAACTGTTCTTGAGTATTTGGTGTCTTTTGGAGTGTGGATTCGCACT

721 CCTCCTGCTTACAGACCACCAAATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTT

781 GTTAGACGACGAGGCAGGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGAAGGTCT

841 CAATCGCCGCGTCGCAGAAGATCTCAATCTCGGGAATCTCAATGTTAGAAGCTT

Wherein 7～72,85～126,451～513 is the proteic O type of VP1 antigenic determinant;

133～192,514～573 is the proteic A type of VP1 antigenic determinant;

205～450,574～894 for helping the carrier protein that the FMDV polypeptide vaccine forms the certain space structure; Other sequences are junction fragment.

2, the preparation method of livestock foot-and-mouth disease virus of A, the two valency polypeptide vaccines of O type genetic engineering is characterized in that its inclusion body Denatured protein is through Ni ⁺-NTA-Sepharose 6B affinity column is directly separation and purification under the condition of non-degeneration, and concrete steps are as follows:

1) add buffer A wet bacterium, centrifugal, collect supernatant, said buffer A is the 6M guanidine hydrochloride, 0.1M sodium phosphate, 0.01MTris/HCl, pH8.0;

2) will be with the equilibrated Ni of buffer A ⁺-NTA-Sepharose 6B adds in the supernatant, and gel is installed on the chromatographic column;

3) with buffer A and buffer B eluting, said buffer B is a 8M carbamide, 0.1M sodium phosphate, 0.01MTris/HCl, pH8.0;

4) with buffer C eluting, said buffer C is a 8M carbamide, 0.1M sodium phosphate, 0.01M Tris/HCl, pH6.3;

5) with buffer D eluting, reuse buffer E eluting is collected, and analyzes with SDS-PAGE, said buffer D is a 8M carbamide, 0.1M sodium phosphate, 0.01M Tris/HCl, pH5.9, said buffer E is a 8M carbamide, 0.1M sodium phosphate, 0.01MTris/HCl, pH4.5;

6) with buffer F washing, collect, make SDS-PAGE and analyze, said buffer F is the 6M guanidine hydrochloride, 0.2M acetic acid;

Expression product is respectively with following four kinds of solution renaturation 12～24h that dialyses successively:

1) 8M carbamide, 5mM EDTA, 1 * PBS;

2) 2M carbamide, 5mM EDTA, 1 * PBS;

3) 0.2M carbamide, 5mM EDTA, 1 * PBS;

4)5mM?EDTA，1×PBS。

Images