CN1597954A

CN1597954A - Rockfish insulin like growth factor I receptor gene and its application

Info

Publication number: CN1597954A
Application number: CN 200410051603
Authority: CN
Inventors: 李文笙; 邝月媚; 林浩然
Original assignee: Sun Yat Sen University
Current assignee: Sun Yat Sen University
Priority date: 2004-09-24
Filing date: 2004-09-24
Publication date: 2005-03-23

Abstract

The invention discloses a rockfish insulin-like growth factor I receptor gene, which is a gene fragment with rockfish insulin-like growth factor I receptor gene cDNA sequence, obtained by using rockfish hypothalamic total RNA as a template and by RT-PCR and Gene RACER methods. The invention can obtain stable-source and low-cost recombinant protein of rockfish insulin-like growth factor I receptor, having an important application to preparing fry growth promoter or additive.

Description

Cabrilla insulin-like growth factor I receptor gene and application thereof

Technical field

The invention belongs to gene engineering technology field, relate in particular to a kind of gene.

Background technology

RhIGF-1 (IGFs) is the multi-functional growth factor of a class, has biological effect widely, plays an important role in embryo and ontogenetic process.IGFs is by the IGF acceptor performance biological action of two types of cell surfaces.The IGFs acceptor has two kinds, is called IGF-I acceptor (IGF-IR or title I type IGF acceptor) and IGF-II acceptor (IGF-IIR or title II type IGF acceptor).The effect overwhelming majority of IGFs pair cell realizes by combining with IGF-IR.IGF-IR is a tetramer glycoprotein, strides film β subunit by 2 α subunits that are positioned at outside and 2 and forms.The structure of IGF-IR is extremely similar to insulin receptor.The halfcystine enrichment region of α subunit is the specific recognition site of its part, and the β chain of tenuigenin part contains a tyrosine kinase activity district.A α subunit and a β subunit are coupled together by disulfide linkage and form one and half acceptors, and two and half acceptors constitute a complete acceptor by the disulfide linkage on the α subunit.IGF-I combines meeting and causes the tyrosine that is positioned on the acceptor on the intracellular β subunit and the phosphorylation of serine residue with IGF-IR, and then causes the series of biological effect.IGFs plays an important role on the growth and breeding of fish, and is insufficient to the research of IGFs only, should further understand the interaction of IGFs and its acceptor, and this molecular mechanisms of action for understanding IGF is significant.And in the prior art, the research of IGFs acceptor is mainly concentrated in the Mammals, for the research of the IGFs acceptors of fish seldom.

Cabrilla is the ocean coral fishes, belongs to Sushi section (Serranidae), and Epinephelus (Epinephelus) has kind more than 30.Cabrilla is a kind of famous and precious seawater fish, has high economic worth.The seed rearing of cabrilla is the key of breeding production sustainable development, but does not also have a kind of additive of bait that can effectively promote its seed growth at present in cabrilla is propagated artificially.

Summary of the invention

The objective of the invention is to seed rearing problem at present cabrilla, a kind of recombinant garouper insulin-like growth factor I receptor gene is provided, utilize this gene can produce recombinant garouper insulin-like growth factor embryonic stage I receptor protein, this receptor albumen can effectively promote the growth of cabrilla seed, in preparation fry growth promoter or additive important use is arranged.

The cDNA of this research epinephelus coioides IGFs acceptor clones and sequential analysis, to improve the regulation and control theory of IGFs and its receptor acting, for the IGFs system is used for fish farming, promotes fish growth and breeding to provide fundamental basis.

Amino acid sequence analysis shows that cabrilla insulin-like growth factor I receptor preproprotein amino acid total order classifies 1413aa as, and mature peptide is 1384aa.Use the Clustalx algorithm, the IGF-R sequence of Epinephelus coioide IGF-IR preproprotein amino acid complete sequence and other species is carried out homology relatively, find that the conservative property that promptly is rich in leucine district and Tyrosylprotein kinase district in two main functional zone is very high, the variability of carboxyl terminal is bigger, and cabrilla IGF-IR sequence of the present invention belongs to the b type.

Cabrilla insulin-like growth factor I receptor gene of the present invention is that the cDNA that obtains with the total RNA reverse transcription of cabrilla hypothalamus is a template, obtains through PCR and the amplification of Gene RACER method.

The IGF-IR mature peptide gene order that the present invention is used to express cabrilla IGF-IR recombinant protein is to be template with cabrilla insulin-like growth factor I receptor Gene Double chain DNA, obtain through the PCR method amplification, it derives from the pairing gene fragment of α subunit of cabrilla insulin-like growth factor I receptor gene.

The present invention has also made up the carrier of the IGF-IR mature peptide gene order of above-mentioned expression cabrilla IGF-IR recombinant protein; The escherichia coli cloning carrier and the expression vector that particularly contain this gene.These construction of carrier are according to a conventional method, will by PCR method synthetic Epinephelus coioide insulin-like growth factor I receptor gene through enzyme cut with separation and purification after, be linked between the corresponding restriction enzyme site of existing respective carrier, promptly be built into the required cabrilla insulin-like growth factor I receptor expression carrier that contains.

The recombinant expression vector that the above-mentioned coli expression carrier that contains cabrilla insulin-like growth factor I receptor gene preferably is built into by synthetic cabrilla insulin-like growth factor I receptor gene of the present invention and coli expression carrier pET15b, called after pET15b-IGF-IR.

The present invention has also made up the intestinal bacteria recombinant strain that can efficiently express cabrilla insulin-like growth factor I receptor gene respectively with the above-mentioned corresponding expression vectors that contains cabrilla insulin-like growth factor I receptor gene.

Of the present inventionly above-mentionedly can express the bacterial strain that cabrilla insulin-like growth factor I receptor intestinal bacteria recombinant bacterial strain preferably obtains by containing cabrilla insulin-like growth factor I receptor expression carrier pET15b-IGF-IR transformed into escherichia coli BL21, called after pET15b-IGF-IR-BL21.

The present invention also provides the method for utilizing above-mentioned intestinal bacteria recombinant strain to produce the cabrilla insulin-like growth factor I receptor.First just bacterial classification inoculation is in containing the LB liquid nutrient medium of penbritin, 37 ℃, 200 rev/mins of overnight incubation, be inoculated in next day in the same medium, and induce through IPTG, 37 ℃, 200 rev/mins of cultivations, collect thalline after 10 hours, obtain recombinant garouper insulin-like growth factor I receptor product through separation and purification.

Beneficial effect of the present invention: cabrilla has great economic worth, adopt conventional genetic engineering technique, utilize cabrilla insulin-like growth factor I receptor gene of the present invention, can produce recombinant garouper IGF-I receptor protein, be used to prepare fry seed growth promoter or additive, promote the quick growth of fry, had great economic benefit.

Description of drawings

Fig. 1 is to be the gel electrophoresis analysis figure of the insulin-like growth factor I receptor gene intermediate segment pcr amplification product of template with the cDNA that the total RNA reverse transcription of cabrilla hypothalamus obtains;

Fig. 2 is that recombinant plasmid PCR and enzyme are cut evaluation gel electrophoresis analysis figure;

Fig. 3 is cabrilla insulin-like growth factor I receptor gene 5 ' end fragment synthetic PCR gel electrophoresis analysis figure for the first time;

Fig. 4 is cabrilla insulin-like growth factor I receptor gene 5 ' end fragment synthetic PCR gel electrophoresis analysis figure for the second time;

Fig. 5 is that cabrilla insulin-like growth factor I receptor gene 5 ' end fragment recombinant plasmid PCR identifies;

Fig. 6 is cabrilla insulin-like growth factor I receptor gene IGF-IR Tyrosylprotein kinase district first round PCR gel electrophoresis analysis figure;

Fig. 7 is that PCR gel electrophoresis analysis figure is taken turns in cabrilla insulin-like growth factor I receptor gene IGF-IR Tyrosylprotein kinase district second;

Fig. 8 is that cabrilla insulin-like growth factor I receptor gene IGF-IR Tyrosylprotein kinase district fragment recombinant plasmid PCR identifies;

Fig. 9 is cabrilla insulin-like growth factor I receptor gene 3 ' end fragment synthetic first round PCR gel electrophoresis analysis figure;

Figure 10 is that cabrilla insulin-like growth factor I receptor gene 3 ' end fragment synthetic second is taken turns PCR gel electrophoresis analysis figure;

Figure 11 is that cabrilla insulin-like growth factor I receptor gene IGF-IR3 ' end fragment recombinant plasmid PCR identifies;

Figure 12 is that the SDS-PAGE gel electrophoresis and the Western blot of recombinant garouper insulin-like growth factor I receptor gene expression product identifies collection of illustrative plates;

Figure 13 is the structure synoptic diagram of intestinal bacteria recombinant expression vector pET15b-IGF-IR.

Wherein, among Fig. 1: M:100bp+1.5kb DNA Ladder; 1: two primer extension products; 2: the sense primer amplified production; 3: antisense justice primer extension product; 4: negative control;

Among Fig. 2: M:100bp+1.5kb DNA Ladder; 1,2,3 amplified productions that are respectively different plasmids;

Among Fig. 3: M:100bp+1.5kb DNA Ladder; 1: amplified production; 2: negative control;

Among Fig. 4: M:1kb DNA Ladder; 1: two primer extension products; 2: the sense primer amplified production; 3: antisense justice primer extension product; 4: negative control;

Among Fig. 5: M:1kb DNA Ladder; 1,2,3 amplified productions that are respectively different plasmids;

Among Fig. 6: M:1kb DNA Ladder; 1: amplified production; 2: negative control;

Among Fig. 7: M:100bp+1.5kb DNA Ladder; 1: amplified production; 2. negative control;

Among Fig. 8: M:100bp+1.5kb DNA Ladder; 1,2,3 amplified productions that are respectively different plasmids;

Among Fig. 9: M:100bp DNA Ladder; 1: amplified production; 2: negative control;

Among Figure 10: M:100bp DNA Ladder; 1: amplified production; 2: negative control;

Among Figure 11: M:100bp DNA Ladder; 1,2,3 amplified productions that are respectively different plasmids;

Among Figure 12: M: molecular weight standard; 1:IPTG induces Pet-15b-IGF-IR to express; The proteic Western blot of 3:Pet-15b-IGF-IR; 2,4 negative contrasts.

Embodiment

Embodiment 1: the IGF-IR gene order of 12 kinds of species that the synthetic basis of cabrilla insulin-like growth factor I receptor gene intermediate segment has been logined in GeneBank, with Dnassist software they are carried out similarity relatively, be used for the degenerated primer of nested pcr amplification at the synthetic cover of conservative region design.Sense primer Primer1703:

5’T(G/T)AA(A/G)CC(C/T)TGGAC(A/C/T)CA(A/G)TA(C/T)GC3’(22bp)；

Antisense primer Primer2935:

5’CACTGAA(A/G)TA(C/T)TC(A/C/G/T)GG(A/G)TT(A/C/G)AC3’(22bp)；

Antisense primer Primer3100:

5’TC(A/G)TT(A/C/G/T)AC(A/C/T)GTCTT(A/G/T)ATGGC3’(20bp)。Reaction conditions is: 95 ℃ of pre-sex change 5 minutes; Bottom is 38 circulations, is divided into two stages: (1) 95 ℃ of sex change 30 seconds, from 50 ℃ to 1 ℃ of 37 ℃ of per two cycle down, annealed 30 seconds, totally 28 circulations, 72 ℃ were extended 1 minute; (2) 95 ℃ of sex change 30 seconds, 37 ℃ of annealing 30 seconds, totally 8 circulations, 72 ℃ were extended 1 minute; Last 72 ℃ were extended 7 minutes.First round PCR Primer1703 and Primer3100 as a result amplifies the band of a treaty 1.4kb, nested PCRPrimer1703 and Primer2935 amplify the band of a treaty 1.25kb, size is consistent with the cabrilla IGF-IR cDNA intermediate segment of expection, as Fig. 1.

The PCR of 1.25kb is reclaimed fragment is connected on pGEM-Teasy (Promega company) carrier, transform blue hickie screening recon behind the DH5 α, random choose 10 recon enlarged culturing, PCR identifies that the back finds 8 positive colonies.The electrophoresis evaluation figure of pcr amplification product sees Fig. 2.Further cut the evaluation plasmid after extracting positive plasmid, select PCR evaluation and enzyme to cut and identify that being the male plasmid checks order with the EcoRI enzyme.Login Http:// www.ncbi.nlm.nih.gov/ website, utilize BLAST software that the sequence of known other species IGF-IR in acquired sequence and the Genebank is carried out the homology comparative analysis, the result shows that the sequence of gained is the IGF-IR cDNA intermediate segment of cabrilla.

Embodiment 2: the synthetic operation of cabrilla insulin-like growth factor I receptor gene 5 ' end fragment is undertaken by GeneRacer Kit Protocol.Requirement according to test kit, according to the IGF-IR cDNA intermediate segment sequences Design that checked order two specificity downstream primers: antisense primer Primer 5R336:5 ' CCTCTTCCTGGTCTCCCACACCTATG3 ' (26bp), nested antisense primer Primer 5R104n:

5’GGTGCGGATGTAGACCACTTTGC3’(23bp)。

Two specificity downstream primers of universal primer and this according to GeneRacer Kit test kit are nested PCR, and end-result obtains the band that a molecular weight is about 2.4kb.For the first time the PCR reaction conditions is: 95 ℃ of pre-sex change 5 minutes; Bottom is 40 circulations, is divided into two stages: (1) 95 ℃ of sex change 30 seconds, from 62 ℃ to 0.5 ℃ of 47 ℃ of each cycle down, annealed 30 seconds, totally 32 circulations, 72 ℃ were extended 1 minute; (2) 95 ℃ of sex change 30 seconds, 46 ℃ of annealing 30 seconds, totally 8 circulations, 72 ℃ were extended 1 minute; Last 72 ℃ were extended 7 minutes.For the second time PCR with the first time PCR product be template, reaction conditions is: 95 ℃ of pre-sex change 5 minutes; Bottom is 35 circulations: 95 ℃ of sex change 30 seconds, and 60 ℃ of annealing 30 seconds, 72 ℃ were extended 1 minute 30 seconds; Last 72 ℃ were extended 7 minutes.The electrophoresis of secondary PCR amplified production is identified figure as shown in Figure 3 and Figure 4.

The PCR of 2.4kb reclaimed selected 12 recons after fragment connects, transforms, PCR has 6 positive colonies after identifying, as Fig. 5, further cuts the evaluation plasmid with the EcoRI enzyme, selects PCR to identify and enzyme is cut evaluation and is the male plasmid and checks order.Utilize BLAST software that the sequence of known other species IGF-IR in acquired 2.4kb sequence and the Genebank is carried out the homology comparative analysis, the result shows that the sequence of gained is the 5 ' fragment of cabrilla IGF-IR cDNA.

Embodiment 3: cabrilla insulin-like growth factor I receptor gene Tyrosylprotein kinase district is segmental synthetic

Sequence according to the high conservative zone-tyrosine kinase activity district of the IGF-IR β subunit of the intermediate segment that has obtained and other species of having reported, design two specificity sense primers and a degeneracy antisense primer, obtain cabrilla IGF-IR tyrosine kinase activity district fragment.Sense primer Primer 3R707:5 ' GCCGTTCACAGTTTACCGCATCG3 ' (23bp), sense primer Primer 3R1109n:

5 ' CGTCCTCTACGCTATGATCTTCG3 ' (23bp), antisense primer Primer3RYR1:5 ' GGCTTGTTSTCMKCRCTGTAG3 ' (21bp), for the first time the PCR reaction conditions is: 95 ℃ of pre-sex change, 5min, bottom is 30 circulations, 94 ℃ of sex change, 30sec; 50 ℃ of-65 ℃ of annealing, 30sec; 72 ℃ of extensions, 1min30sec, last 72 ℃ of extensions, 10min.PCR dilutes 50 times as template with the product of 52 ℃ of annealing amplifications of the PCR first time for the second time, and reaction conditions is: 95 ℃ of pre-sex change, and 5min, bottom is 30 circulations, 94 ℃ of sex change, 30sec; 48 ℃ of-68 ℃ of annealing, 30sec; 72 ℃ of extensions, 1min, last 72 ℃ of extensions, 10min.The electrophoresis of secondary PCR amplified production is identified figure as shown in Figure 6 and Figure 7.

The PCR of 1.1kb reclaimed selected 9 recons after fragment connects, transforms, PCR has 8 positive colonies (Fig. 8) after identifying, further cuts the evaluation plasmid with the EcoRI enzyme, selects PCR to identify and enzyme is cut evaluation and is the male plasmid and checks order.Utilize BLAST software that the sequence of known IGF-IR in acquired 1.06kb sequence and the Genebank is carried out the homology comparative analysis, the result shows that the sequence of gained is a cabrilla IGF-IR cDNA tyrosine kinase activity district fragment.

Embodiment 4: cabrilla insulin-like growth factor I receptor gene 3 ' end fragment synthetic according to tyrosine kinase activity district fragment sequence that obtains and the IGF-IR 3 ' non-coding area sequence of several fish, design have been synthesized two the 3 ' Auele Specific Primers and the Auele Specific Primer of paired 3 ' non-coding region with it.Sense primer Primer 3R3700:5 ' GTGTTGGCAGTACAATCCTAAG3 ' (22bp), sense primer Primer3R3500n:5 ' AGGGTTTGCTTCCTGTCCGATG3 ' (22bp), antisense primer Primer 3R6000:5 ' CCCACTGTGACATCAGGTTC3 ' is (20bp).The PCR reaction conditions is for the first time: 95 ℃ of pre-sex change, and 5min, bottom is 35 circulations, 94 ℃ of sex change, 30sec; 48 ℃ of-68 ℃ of annealing, 30sec; 72 ℃ of extensions, 1min, last 72 ℃ of extensions, 10min.PCR dilutes 50 times as template with the product of 60 ℃ of annealing amplifications of the PCR first time for the second time, and reaction conditions is: 95 ℃ of pre-sex change, and 5min, bottom is 30 circulations, 94 ℃ of sex change, 30sec; 48 ℃ of-68 ℃ of annealing, 30sec; 72 ℃ of extensions, 1min, last 72 ℃ of extensions, 10min.The electrophoresis of secondary PCR amplified production identifies that figure is as Fig. 9 and shown in Figure 10.

The PCR of 560bp reclaimed selected 9 recons after fragment connects, transforms, PCR has 9 positive colonies after identifying, as Figure 11, positive rate is 100%, further cut the evaluation plasmid, select PCR evaluation and enzyme to cut and identify that being the male plasmid checks order with the EcoRI enzyme.Utilize BLAST software that the sequence of known IGF-IR in acquired 560bp sequence and the Genebank is carried out the homology comparative analysis, the result shows that the sequence of gained is the 3 ' fragment of cabrilla IGF-IRcDNA.

Embodiment 5: the correct IGF-IR intermediate segment that the splicing of cabrilla insulin-like growth factor I receptor full length gene sequence obtains order-checking, 5 ' end fragment, tyrosine kinase activity district fragment, 3 ' end fragment splice and obtain cabrilla IGF-IR cDNA full length sequence, the non-coding region that comprises 5 ' end 595bp, complete α subunit, β subunit Tyrosylprotein kinase conserved regions, 3 ' non-coding region 71bp, total length 4908bp.Open reading frame 4242bp, initiator codon is from the 596bp beginning, to the terminator codon end at 4837bp place.Infer the aminoacid sequence that the respective egg white matter with DNAsist software, length is 1413aa, comprise the signal peptide of 29aa and the mature peptide of 1384aa, be divided into the N-end region, be rich in the halfcystine district, the protein cleavage site, stride several functional zone such as after birth district, Tyrosylprotein kinase district (TK) and C-terminal district.The aminoacid sequence of IGF-I acceptor gene total length and supposition is seen sequence table.

Embodiment 6: cabrilla insulin-like growth factor I receptor gene synthetic

According to the plasmid sequence that comprises complete α subunit part that when cloning IGF-IR 5 ' terminal sequence, obtains, in conjunction with the multiple clone site of Pet-15b carrier, the Auele Specific Primer of the synthetic a pair of amplification of design α subunit fragments.Sense primer Primer Sen13:5 ' ACGCTCGAGCGACCCAGCATTGACATC3 ' (27bp), antisense primer Primer Anti1702:5 ' ATGGATCCGTGGCACCCGGCAAATG3 ' (25bp), the plasmid (1: 100) that comprises complete α subunit part that obtains during with clone's IGF-IR5 ' terminal sequence be a template, IGF-IR-α subunit fragments increases.The PCR reaction conditions is: 95 ℃ of pre-sex change 4 minutes; Bottom is 30 circulations: 94 ℃ of sex change 30 seconds, and 60 ℃ of annealing 30 seconds, 72 ℃ were extended 1.5 minutes; Last 72 ℃ were extended 7 minutes.The bright band that occurs about 1.6kb behind the pcr amplification, consistent with the expection size, connect to advance and get that PCR identifies behind the pGEMT-easy carrier (Promega company) and enzyme is cut and identified that being male clones the extraction plasmid, this plasmid is pGEMT-IGF-IR.

Embodiment 7: the structure that contains the coli expression carrier pET15b-IGF-IR of cabrilla insulin-like growth factor I receptor gene

With BamHI and XhoI difference Pet-15b (Novagen company) and two kinds of carriers of pGEMT-IGF-IR (embodiment 6 gained) are carried out double digestion, the 5.7kb and the 1.6kb that obtain are respectively expected that big or small fragment reclaims purifying, T4 ligase (Takara company) is transformed into DH5 α after connecting, screening positive clone extracts plasmid, serve the order-checking of Hai Boya biotech firm, sequencing result proof IGF-IR gene successfully changes among the expression vector Pet-15b, recombinant vectors pET15b-IGF-IR successfully makes up, and plasmid construction figure sees Figure 13.

Embodiment 8: the structure that can efficiently express the intestinal bacteria recombinant strain pET15b-IGF-IR-BL21 of cabrilla insulin-like growth factor I receptor gene

CaCl ₂Method is pET15b-IGF-IR Transformed E .coli BL21, screens transformant containing on the LB flat board of penbritin, detects and the restriction analysis acquisition contains the sub-pET15b-IGF-IR-BL21 of recombinant conversion of pET15b-IGF-IR through plasmid.

Embodiment 9: utilize bacillus coli gene engineering bacteria pET15b-IGF-IR-BL21 to produce recombinant garouper insulin-like growth factor embryonic stage I acceptor

The single colony inoculation of picking bacillus coli gene engineering bacteria pET15b-IGF-IR-BL21 is in containing the LB liquid nutrient medium of 100ug/ml penbritin, 37 ℃, 200 rev/mins of overnight incubation, be inoculated in the same medium of proper volume by 1: 50 inoculum size next day, and 37 ℃ are cultured to A ₆₀₀Be 0.5～0.6, add IPTG (final concentration is 1.0mmol/l), receive bacterium after 10 hours in 37 ℃ of inducing culture.Synthetic cabrilla insulin-like growth factor I receptor has obtained to efficiently express in bacillus coli gene engineering bacteria pET15b-IGF-IR-BL21.

The cell that takes a morsel adds 2 * electrophoresis sample-loading buffer, boils after 5 minutes and runs the SDS-PAGE gel electrophoresis by standard method.The results are shown in Figure 12, a new protein band appears in demonstration on the position of inductive pET15b-IGF-IR-BL21 at about 61kD, this band does not appear in inductive pET15b-IGF-IR-BL21, proves cabrilla insulin-like growth factor I receptor embryonic stage abduction delivering in pET15b-IGF-IR-BL21.

Adopting immunoblotting (Western blot) method to carry out immunocompetence recombinant garouper insulin-like growth factor I receptor embryonic stage identifies.Use the antibody of the sequence His-tag of Pet-15b own anti-as one, sheep anti-mouse igg-HRP is anti-as two.The results are shown in Figure 12, show that recombinant protein has special immunocompetence.

Untitled.ST25

SEQUENCE?LISTING

＜110〉Zhongshan University

＜120〉cabrilla insulin-like growth factor I receptor gene and application thereof

<130>

<160>2

<170>PatentIn?version?3.2

<210>1

<211>4908

<212>DNA

＜213〉Epinephelus coioide (Epinephelus coioides)

<220>

<221>CDS

<222>(596)..(4834)

<220>

<221>sig_peptide

<222>(596)..(682)

<400>1

cgactggagc?acgaggacac?tgacatggac?tgaaggagta?gaagatttta?tccaggatat 60

ttcgaaacaa?acgtcgtgtc?tttcacgcag?gggagctgcg?tattgattta?atatgttact 120

gaatcgcctg?gacagcctct?ttccatcaca?tttttgaggg?ggtttgaccc?gtgttctgcc 180

tccagagggt?cctccagcag?cgggacgttg?aacgtttttc?ctccagatat?ggagtgtgaa 240

gatgcggatt?acagaggaat?ccccgccgct?agtttaaccg?cattggtttc?atcacacaca 300

ccaatgcggc?gttgtttttg?tcaggaatag?acccgaacta?tgaattcaca?ttttcacgcc 360

agagggataa?atcggtgatt?tttttggagc?acgactggac?tcccattagg?aaacgtgaga 420

aagctacccc?agctagcccg?tttgtagtag?ctattagctc?cattagccgg?ctaactgcta 480

aaaggtgctg?gctggagatt?aaaaaagctt?tttaataatt?ctgagcaggt?tttgtccacg 540

tttcccccct?caacatattt?atttacagga?tttgggagga?tttactcatc?cagga?atg 598

Met

1

agg?tct?cgt?acg?gaa?agg?agc?cgc?ttg?acc?ttg?ttt?tgg?ggt?ctg?atg 646

Arg?Ser?Arg?Thr?Glu?Arg?Ser?Arg?Leu?Thr?Leu?Phe?Trp?Gly?Leu?Met

5 10 15

ctg?ggt?ctg?tcg?tcc?tgc?ctc?cgg?ccc?gcc?acc?gca?gag?atc?tgt?ggc 694

Leu?Gly?Leu?Ser?Ser?Cys?Leu?Arg?Pro?Ala?Thr?Ala?Glu?Ile?Cys?Gly

20 25 30

ccc?agc?att?gac?atc?ggg?aat?gac?atc?agt?gaa?ttc?agg?cgt?cta?gag 742

Pro?Ser?Ile?Asp?Ile?Gly?Asn?Asp?Ile?Ser?Glu?Phe?Arg?Arg?Leu?Glu

35 40 45

aac?tgc?aca?gtg?gtg?gag?ggc?tac?cta?cag?atc?ctc?ctt?atc?ggt?gac 790

Asn?Cys?Thr?Val?Val?Glu?Gly?Tyr?Leu?Gln?Ile?Leu?Leu?Ile?Gly?Asp

50 55 60 65

aaa?aac?aac?aac?aac?gtc?aac?cag?gaa?gtc?ctc?cgc?tcc?ctc?agt?ttc 838

Lys?Asn?Asn?Asn?Asn?Val?Asn?Gln?Glu?Val?Leu?Arg?Ser?Leu?Ser?Phe

70 75 80

cca?aag?ctg?acc?atg?atc?aca?gac?tac?ccg?ctg?cta?ttc?cgg?gtg?tct 886

Pro?Lys?Leu?Thr?Met?Ile?Thr?Asp?Tyr?Pro?Leu?Leu?Phe?Arg?Val?Ser

85 90 95

ggc?ctg?gac?agt?ctg?agc?aca?ctc?ttt?ccc?aac?ctc?acc?gtc?ata?cga 934

Gly?Leu?Asp?Ser?Leu?Ser?Thr?Leu?Phe?Pro?Asn?Leu?Thr?Val?Ile?Arg

Untitled.ST25

100 105 110

gga?cgg?aac?ctc?ttc?tac?aac?tat?gcc?ctc?gtg?atc?ttt?gag?atg?acc 982

Gly?Arg?Asn?Leu?Phe?Tyr?Asn?Tyr?Ala?Leu?Val?Ile?Phe?Glu?Met?Thr

115 120 125

agc?ttg?aag?gac?att?ggc?ctg?tac?aac?ttg?agg?aac?att?acc?tgt?ggc 1030

Ser?Leu?Lys?Asp?Ile?Gly?Leu?Tyr?Asn?Leu?Arg?Asn?Ile?Thr?Cys?Gly

130 135 140 145

gcc?atc?cgc?att?gag?aag?aac?ccc?gag?ctc?tgc?tac?ctg?gac?tcc?ata 1078

Ala?Ile?Arg?Ile?Glu?Lys?Asn?Pro?Glu?Leu?Cys?Tyr?Leu?Asp?Ser?Ile

150 155 160

gac?tgg?tcc?ctc?atc?ctg?gac?gca?gag?ttc?aac?aac?tac?att?gcc?gga 1126

Asp?Trp?Ser?Leu?Ile?Leu?Asp?Ala?Glu?Phe?Asn?Asn?Tyr?Ile?Ala?Gly

165 170 175

aac?aag?cag?tcc?aag?gag?tgc?agc?gat?gtt?tgt?cca?ggc?atc?atg?gag 1174

Asn?Lys?Gln?Ser?Lys?Glu?Cys?Ser?Asp?Val?Cys?Pro?Gly?Ile?Met?Glu

180 185 190

aac?aac?cct?cag?tgc?aga?aag?acc?atg?ttc?aac?aac?aac?tat?aac?tac 1222

Asn?Asn?Pro?Gln?Cys?Arg?Lys?Thr?Met?Phe?Asn?Asn?Asn?Tyr?Asn?Tyr

195 200 205

cgc?tgc?tgg?aat?tcc?aat?cac?tgc?cag?aaa?gag?tgc?ccg?gag?aag?tgt 1270

Arg?Cys?Trp?Asn?Ser?Asn?His?Cys?Gln?Lys?Glu?Cys?Pro?Glu?Lys?Cys

210 215 220 225

gtg?cgg?cga?gca?tgc?aca?gcg?gac?ggc?gag?tgc?tgc?cac?cct?cag?tgt 1318

Val?Arg?Arg?Ala?Cys?Thr?Ala?Asp?Gly?Glu?Cys?Cys?His?Pro?Gln?Cys

230 235 240

ctg?ggc?agc?tgc?aca?gtc?cct?ggt?agt?gac?aca?gca?tgt?gca?gca?tgt 1366

Leu?Gly?Ser?Cys?Thr?Val?Pro?Gly?Ser?Asp?Thr?Ala?Cys?Ala?Ala?Cys

245 250 255

gtg?cat?tac?tac?cac?caa?gga?cgc?tgc?gtg?gcc?gac?tgc?cct?ccc?ggc 1414

Val?His?Tyr?Tyr?His?Gln?Gly?Arg?Cys?Val?Ala?Asp?Cys?Pro?Pro?Gly

260 265 270

acc?tac?aag?ttc?gag?ggc?tgg?cag?tgc?atc?agc?gcc?gag?ctt?tgc?tcc 1462

Thr?Tyr?Lys?Phe?Glu?Gly?Trp?Gln?Cys?Ile?Ser?Ala?Glu?Leu?Cys?Ser

275 280 285

aaa?gtc?cac?ctc?ccc?gac?ttc?aac?agc?ttc?atc?atc?cac?ggc?ggc?gag 1510

Lys?Val?His?Leu?Pro?Asp?Phe?Asn?Ser?Phe?Ile?Ile?His?Gly?Gly?Glu

290 295 300 305

tgc?atg?tct?gaa?tgt?cca?cat?ggg?tac?atg?cag?acc?gca?ccc?aac?agt 1558

Cys?Met?Ser?Glu?Cys?Pro?His?Gly?Tyr?Met?Gln?Thr?Ala?Pro?Asn?Ser

310 315 320

atg?ttc?tgt?aca?gcc?tgt?gat?ggc?ctg?tgt?gat?aaa?gta?tgt?gag?gag 1606

Met?Phe?Cys?Thr?Ala?Cys?Asp?Gly?Leu?Cys?Asp?Lys?Val?Cys?Glu?Glu

325 330 335

aag?gtc?atc?gac?tcc?atg?gat?gct?gct?cag?tct?ctc?aaa?ggc?tgc?act 1654

Lys?Val?Ile?Asp?Ser?Met?Asp?Ala?Ala?Gln?Ser?Leu?Lys?Gly?Cys?Thr

340 345 350

gtt?atc?aaa?gga?aac?ctg?cat?atc?aat?atc?cgc?aga?ggc?cac?aac?atc 1702

Val?Ile?Lys?Gly?Asn?Leu?His?Ile?Asn?Ile?Arg?Arg?Gly?His?Asn?Ile

355 360 365

gtg?gca?gag?ctg?gag?agt?ttc?aca?ggt?ttg?atc?cag?agg?gtg?acc?ggt 1750

Val?Ala?Glu?Leu?Glu?Ser?Phe?Thr?Gly?Leu?Ile?Gln?Arg?Val?Thr?Gly

370 375 380 385

aac?gtg?tgg?atc?agg?cat?tcc?cac?act?ctg?agc?tcc?ctg?gcc?ttc?ctc 1798

Asn?Val?Trp?Ile?Arg?His?Ser?His?Thr?Leu?Ser?Ser?Leu?Ala?Phe?Leu

390 395 400

cgc?agc?ctc?aga?tac?atc?gac?gga?gaa?gag?ctt?ctg?gat?gac?atg?tat 1846

Untitled.ST25

Arg?Ser?Leu?Arg?Tyr?Ile?Asp?Gly?Glu?Glu?Leu?Leu?Asp?Asp?Met?Tyr

405 410 415

gcc?ttc?ttg?gca?gtt?gac?aac?cag?cag?ctc?cag?tat?ctt?tgg?gac?tgg 1894

Ala?Phe?Leu?Ala?Val?Asp?Asn?Gln?Gln?Leu?Gln?Tyr?Leu?Trp?Asp?Trp

420 425 430

aag?cag?cac?aac?ctc?acc?atc?aag?gca?gga?aag?ctg?ttc?ttc?aga?gcc 1942

Lys?Gln?His?Asn?Leu?Thr?Ile?Lys?Ala?Gly?Lys?Leu?Phe?Phe?Arg?Ala

435 440 445

aac?cca?aaa?ctg?tgc?atg?tcc?gag?atc?cgt?aag?atg?tgg?gag?aag?aca 1990

Asn?Pro?Lys?Leu?Cys?Met?Ser?Glu?Ile?Arg?Lys?Met?Trp?Glu?Lys?Thr

450 455 460 465

ggc?atc?cag?ggc?cac?ttt?gat?gag?agt?gat?ttc?cga?aac?aac?ggc?gac 2038

Gly?Ile?Gln?Gly?His?Phe?Asp?Glu?Ser?Asp?Phe?Arg?Asn?Asn?Gly?Asp

470 475 480

aga?gcc?agc?tgt?gaa?agt?aca?atc?ctg?aag?ttt?aag?tcc?aac?agc?acc 2086

Arg?Ala?Ser?Cys?Glu?Ser?Thr?Ile?Leu?Lys?Phe?Lys?Ser?Asn?Ser?Thr

485 490 495

agc?agt?aca?agg?atc?aaa?ctg?acc?tgg?cag?cgc?tac?tgg?ccc?cct?gac 2134

Ser?Ser?Thr?Arg?Ile?Lys?Leu?Thr?Trp?Gln?Arg?Tyr?Trp?Pro?Pro?Asp

500 505 510

tac?aga?gac?ctc?atc?agc?ttt?att?gtc?tac?tac?aag?gag?gcg?cca?tac 2182

Tyr?Arg?Asp?Leu?Ile?Ser?Phe?Ile?Val?Tyr?Tyr?Lys?Glu?Ala?Pro?Tyr

515 520 525

cag?aac?ata?aca?gag?ttc?gag?ggg?cag?gac?ggc?tgt?ggc?tac?aac?agc 2230

Gln?Asn?Ile?Thr?Glu?Phe?Glu?Gly?Gln?Asp?Gly?Cys?Gly?Tyr?Asn?Ser

530 535 540 545

tgg?aat?atg?gtg?gat?gtg?gag?ctg?agg?ccg?gac?aaa?gag?aca?gac?ccc 2278

Trp?Asn?Met?Val?Asp?Val?Glu?Leu?Arg?Pro?Asp?Lys?Glu?Thr?Asp?Pro

550 555 560

gga?gtt?ctg?ctg?tcc?ggc?ctg?aag?ccc?tgg?acg?cac?tac?gct?ata?ttc 2326

Gly?Val?Leu?Leu?Ser?Gly?Leu?Lys?Pro?Trp?Thr?His?Tyr?Ala?Ile?Phe

565 570 575

gtt?aag?gcc?atc?aca?ctc?atg?gtg?gag?ggc?aaa?cat?ttg?ccg?ggt?gcc 2374

Val?Lys?Ala?Ile?Thr?Leu?Met?Val?Glu?Gly?Lys?His?Leu?Pro?Gly?Ala

580 585 590

aag?agc?aaa?gtg?gtc?tac?atc?cgc?acc?agc?cct?tcc?gcg?ccc?tcc?atg 2422

Lys?Ser?Lys?Val?Val?Tyr?Ile?Arg?Thr?Ser?Pro?Ser?Ala?Pro?Ser?Met

595 600 605

cct?cag?gat?gtg?cga?gcg?tac?tct?aac?tca?tcc?aca?cag?ttg?gtg?gtg 2470

Pro?Gln?Asp?Val?Arg?Ala?Tyr?Ser?Asn?Ser?Ser?Thr?Gln?Leu?Val?Val

610 615 620 625

cgt?tgg?tcg?ccc?cct?gtc?tca?cca?aat?gga?aac?caa?act?tac?tac?ctg 2518

Arg?Trp?Ser?Pro?Pro?Val?Ser?Pro?Asn?Gly?Asn?Gln?Thr?Tyr?Tyr?Leu

630 635 640

gtt?aga?tgg?cag?caa?caa?gca?gaa?gat?cga?gag?ctg?tat?cag?cac?aat 2566

Val?Arg?Trp?Gln?Gln?Gln?Ala?Glu?Asp?Arg?Glu?Leu?Tyr?Gln?His?Asn

645 650 655

tac?tgc?tct?aaa?gag?ctg?aag?atc?ccc?ata?agg?att?gcg?gcc?ata?ggt 2614

Tyr?Cys?Ser?Lys?Glu?Leu?Lys?Ile?Pro?Ile?Arg?Ile?Ala?Ala?Ile?Gly

660 665 670

gtg?gga?gac?cag?gaa?gag?gac?acc?aag?ccc?act?aag?cca?gat?ccc?gac 2662

Val?Gly?Asp?Gln?Glu?Glu?Asp?Thr?Lys?Pro?Thr?Lys?Pro?Asp?Pro?Asp

675 680 685

gga?cca?gac?aaa?ggc?ccc?tgt?tgc?ccc?tgc?ccc?aaa?tca?gtc?gag?gtt 2710

Gly?Pro?Asp?Lys?Gly?Pro?Cys?Cys?Pro?Cys?Pro?Lys?Ser?Val?Glu?Val

690 695 700 705

Untitled.ST25

ctg?gaa?gct?gaa?gct?gct?gat?gcc?tcc?tac?aga?aaa?gtc?ttt?gaa?aac 2758

Leu?Glu?Ala?Glu?Ala?Ala?Asp?Ala?Ser?Tyr?Arg?Lys?Val?Phe?Glu?Asn

710 715 720

ttc?ctg?cac?aac?tcc?att?ttt?aca?cca?agg?cca?cca?gat?cgt?cgc?cgt 2806

Phe?Leu?His?Asn?Ser?Ile?Phe?Thr?Pro?Arg?Pro?Pro?Asp?Arg?Arg?Arg

725 730 735

aga?gat?ctc?ttt?ggc?ata?gcc?aat?gcc?act?cac?ccc?cgc?cgg?aac?cgg 2854

Arg?Asp?Leu?Phe?Gly?Ile?Ala?Asn?Ala?Thr?His?Pro?Arg?Arg?Asn?Arg

740 745 750

ctg?cac?acc?aac?agc?acc?agc?agc?agc?acc?atc?cct?tct?ctc?cta?gcc 2902

Leu?His?Thr?Asn?Ser?Thr?Ser?Ser?Ser?Thr?Ile?Pro?Ser?Leu?Leu?Ala

755 760 765

gct?ggt?aac?agc?agc?acc?tca?gac?gtg?gag?cca?gct?gac?aga?gag?ttt 2950

Ala?Gly?Asn?Ser?Ser?Thr?Ser?Asp?Val?Glu?Pro?Ala?Asp?Arg?Glu?Phe

770 775 780 785

gag?ttc?ata?gag?caa?gcg?gtg?aca?gag?cga?gag?ctg?cag?atc?ttt?ggc 2998

Glu?Phe?Ile?Glu?Gln?Ala?Val?Thr?Glu?Arg?Glu?Leu?Gln?Ile?phe?Gly

790 795 800

ctg?cag?ccg?ttc?aca?gtt?tac?cgc?atc?gac?att?cat?gcc?tgc?aat?cgg 3046

Leu?Gln?Pro?Phe?Thr?Val?Tyr?Arg?Ile?Asp?Ile?His?Ala?Cys?Asn?Arg

805 810 815

cag?gtc?caa?cgc?tgc?agc?gct?gca?gag?ttt?gtc?ttc?tcc?aga?acc?aag 3094

Gln?Val?Gln?Arg?Cys?Ser?Ala?Ala?Glu?Phe?Val?Phe?Ser?Arg?Thr?Lys

820 825 830

cct?gca?gaa?aag?gca?gac?gac?ata?cct?ggc?cca?gtg?acc?tgg?gag?ggc 3142

Pro?Ala?Glu?Lys?Ala?Asp?Asp?Ile?Pro?Gly?Pro?Val?Thr?Trp?Glu?Gly

835 840 845

cat?gag?gac?tgg?gtg?ttt?ctg?cgc?tgg?cca?gag?cct?cct?cac?ccc?aac 3190

His?Glu?Asp?Trp?Val?Phe?Leu?Arg?Trp?Pro?Glu?Pro?Pro?His?Pro?Asn

850 855 860 865

gga?ctc?atc?ctc?atg?tat?gag?atc?aag?ttt?aaa?ctg?gct?gct?gag?acc 3238

Gly?Leu?Ile?Leu?Met?Tyr?Glu?Ile?Lys?Phe?Lys?Leu?Ala?Ala?Glu?Thr

870 875 880

gag?aag?cac?gaa?tgt?gtc?tct?ggt?cag?atg?tat?cac?aca?cag?cgt?ggt 3286

Glu?Lys?His?Glu?Cys?Val?Ser?Gly?Gln?Met?Tyr?His?Thr?Gln?Arg?Gly

885 890 895

gtt?cgg?ctg?tcc?aac?ctc?agt?cca?gga?aac?tac?tca?gtc?aga?gtg?aga 3334

Val?Arg?Leu?Ser?Asn?Leu?Ser?Pro?Gly?Asn?Tyr?Ser?Val?Arg?Val?Arg

900 905 910

gcc?acg?tca?ctg?gct?ggc?aac?ggc?tcc?tgg?aca?cac?gct?ctg?gat?ctc 3382

Ala?Thr?Ser?Leu?Ala?Gly?Asn?Gly?Ser?Trp?Thr?His?Ala?Leu?Asp?Leu

915 920 925

tac?gtg?gcc?gaa?cga?tat?gaa?aac?gtc?ctc?tac?gct?atg?atc?ttc?gtt 3430

Tyr?Val?Ala?Glu?Arg?Tyr?Glu?Asn?Val?Leu?Tyr?Ala?Met?Ile?Phe?Val

930 935 940 945

ccc?atc?gtc?atc?atc?ctc?gtc?atc?tgt?ctt?tta?gtc?tca?atg?ctg?gtg 3478

Pro?Ile?Val?Ile?Ile?Leu?Val?Ile?Cys?Leu?Leu?Val?Ser?Met?Leu?Val

950 955 960

gtc?ctc?agc?agg?aaa?aga?aac?agt?gac?cgg?ctc?gga?aat?gga?gtc?ctg 3526

Val?Leu?Ser?Arg?Lys?Arg?Asn?Ser?Asp?Arg?Leu?Gly?Asn?Gly?Val?Leu

965 970 975

tac?gcc?tca?gtt?aac?cca?gag?tac?ttc?agc?gct?gca?gaa?atg?tac?gtg 3574

Tyr?Ala?Ser?Val?Asn?Pro?Glu?Tyr?Phe?Ser?Ala?Ala?Glu?Met?Tyr?Val

980 985 990

cct?gat?gag?tgg?gag?gtg?gca?cgg?gag?aag?atc?acc?ctg?agt?cgt?gag 3622

Pro?Asp?Glu?Trp?Glu?Val?Ala?Arg?Glu?Lys?Ile?Thr?Leu?Ser?Arg?Glu

995 1000 1005

Untitled.ST25

ctt?ggc?cag?ggg?tcc?ttt?ggc?atg?gtg?tac?gag?ggc?ttg?gca?aag 3667

Leu?Gly?Gln?Gly?Ser?Phe?Gly?Met?Val?Tyr?Glu?Gly?Leu?Ala?Lys

1010 1015 1020

ggt?gtg?gtc?aaa?gac?gaa?cca?gag?acg?cgt?gtg?gcc?att?aag?act 3712

Gly?Val?Val?Lys?Asp?Glu?Pro?Glu?Thr?Arg?Val?Ala?Ile?Lys?Thr

1025 1030 1035

gtc?aac?gag?tcg?gcc?agc?atg?agg?gag?agg?ata?gag?ttt?ctc?aat 3757

Val?Asn?Glu?Ser?Ala?Ser?Met?Arg?Glu?Arg?Ile?Glu?Phe?Leu?Asn

1040 1045 1050

gaa?gcc?tca?gtc?atg?aag?gag?ttc?aac?tgt?cac?cat?gtg?gtt?cgt 3802

Glu?Ala?Ser?Val?Met?Lys?Glu?Phe?Asn?Cys?His?His?Val?Val?Arg

1055 1060 1065

ctc?ctg?gga?gtg?gtt?tct?cag?gga?caa?cca?acc?ctg?gtc?atc?atg 3847

Leu?Leu?Gly?Val?Val?Ser?Gln?Gly?Gln?Pro?Thr?Leu?Val?Ile?Met

1070 1075 1080

gag?ctg?atg?acg?aga?gga?gac?ctg?aag?agc?tac?ctg?cgc?tcc?ctc 3892

Glu?Leu?Met?Thr?Arg?Gly?Asp?Leu?Lys?Ser?Tyr?Leu?Arg?Ser?Leu

1085 1090 1095

cga?cct?aaa?gag?caa?cag?tgg?tcg?agc?ctg?tct?ctc?cct?cct?cta 3937

Arg?Pro?Lys?Glu?Gln?Gln?Trp?Ser?Ser?Leu?Ser?Leu?Pro?Pro?Leu

1100 1105 1110

aag?aag?atg?ctt?cag?atg?gcc?ggg?cag?atc?gct?gac?ggc?atg?gct 3982

Lys?Lys?Met?Leu?Gln?Met?Ala?Gly?Gln?Ile?Ala?Asp?Gly?Met?Ala

1115 1120 1125

tac?ctc?aac?gcc?aac?aag?ttt?gtc?cac?aga?gac?ctg?gca?gcc?agg 4027

Tyr?Leu?Asn?Ala?Asn?Lys?Phe?Val?His?Arg?Asp?Leu?Ala?Ala?Arg

1130 1135 1140

aac?tgc?atg?gtg?gcc?gag?gac?ttc?acc?gtt?aag?ata?gga?gac?ttt 4072

Asn?Cys?Met?Val?Ala?Glu?Asp?Phe?Thr?Val?Lys?Ile?Gly?Asp?Phe

1145 1150 1155

ggc?atg?acc?aga?gac?atc?tat?gag?aca?gat?tac?tac?cgc?aaa?ggt 4117

Gly?Met?Thr?Arg?Asp?Ile?Tyr?Glu?Thr?Asp?Tyr?Tyr?Arg?Lys?Gly

1160 1165 1170

ggt?aag?ggt?ttg?ctt?cct?gtc?cga?tgg?atg?tcg?ccc?gag?tct?ctg 4162

Gly?Lys?Gly?Leu?Leu?Pro?Val?Arg?Trp?Met?Ser?Pro?Glu?Ser?Leu

1175 1180 1185

aag?gat?gga?gtc?ttc?acc?acc?acc?tct?gat?gtc?tgg?tca?ttt?gga 4207

Lys?Asp?Gly?Val?Phe?Thr?Thr?Thr?Ser?Asp?Val?Trp?Ser?Phe?Gly

1190 1195 1200

gtt?gta?ctg?tgg?gaa?att?gcc?act?ctg?gca?gaa?cag?ccc?tac?caa 4252

Val?Val?Leu?Trp?Glu?Ile?Ala?Thr?Leu?Ala?Glu?Gln?Pro?Tyr?Gln

1205 1210 1215

ggt?ctg?tcc?aat?gag?cag?gtg?ctc?cgc?ttt?gtc?atg?gag?gga?ggg 4297

Gly?Leu?Ser?Asn?Glu?Gln?Val?Leu?Arg?Phe?Val?Met?Glu?Gly?Gly

1220 1225 1230

ctg?ctg?gag?aaa?cca?cag?aat?tgt?cct?gac?atg?ctg?ttc?gag?ctg 4342

Leu?Leu?Glu?Lys?Pro?Gln?Asn?Cys?Pro?Asp?Met?Leu?Phe?Glu?Leu

1235 1240 1245

atg?cga?atg?tgt?tgg?cag?tac?aat?cct?aag?atg?cgt?cca?tcc?ttc 4387

Met?Arg?Met?Cys?Trp?Gln?Tyr?Asn?Pro?Lys?Met?Arg?Pro?Ser?Phe

1250 1255 1260

gtg?gag?atc?atc?agc?agc?tta?aag?gat?gag?ctg?gaa?cca?gct?ttc 4432

Val?Glu?Ile?Ile?Ser?Ser?Leu?Lys?Asp?Glu?Leu?Glu?Pro?Ala?Phe

1265 1270 1275

aga?gag?gtt?agt?ttc?ttc?tac?agt?gcg?gac?aac?aag?ccg?cct?gat 4477

Arg?Glu?Val?Ser?Phe?Phe?Tyr?Ser?Ala?Asp?Asn?Lys?Pro?Pro?Asp

Untitled.ST25

1280 1285 1290

gct?ccg?cag?ctc?cac?ctg?gac?aag?atg?gac?aac?atg?gat?gat?gtt 4522

Ala?Pro?Gln?Leu?His?Leu?Asp?Lys?Met?Asp?Asn?Met?Asp?Asp?Val

1295 1300 1305

cct?ctg?gag?ccc?ccc?tct?tcc?acg?cag?cca?cag?caa?acc?cca?gtc 4567

Pro?Leu?Glu?Pro?Pro?Ser?Ser?Thr?Gln?Pro?Gln?Gln?Thr?Pro?Val

1310 1315 1320

ccc?caa?cag?acc?cca?ccc?tcc?ccg?aac?tca?gag?gct?cca?ccc?gtc 4612

Pro?Gln?Gln?Thr?Pro?Pro?Ser?Pro?Asn?Ser?Glu?Ala?Pro?Pro?Val

1325 1330 1335

ccc?tcg?tta?gcc?ccc?agc?tcc?ccc?tcc?tct?ccc?tgt?acg?tcg?acc 4657

Pro?Ser?Leu?Ala?Pro?Ser?Ser?Pro?Ser?Ser?Pro?Cys?Thr?Ser?Thr

1340 1345 1350

gct?gcc?atg?gac?aag?cag?ccc?tct?ggc?cag?cag?gca?gcc?aat?ggg 4702

Ala?Ala?Met?Asp?Lys?Gln?Pro?Ser?Gly?Gln?Gln?Ala?Ala?Asn?Gly

1355 1360 1365

ctg?tcg?ggg?gcg?ggt?cta?gca?gca?ggg?tca?ggg?gcg?gtg?cgg?ccg 4747

Leu?Ser?Gly?Ala?Gly?Leu?Ala?Ala?Gly?Ser?Gly?Ala?Val?Arg?Pro

1370 1375 1380

tct?ctg?gac?gaa?ctg?ccg?ccg?tac?gca?cac?atg?aac?gga?gga?cgc 4792

Ser?Leu?Asp?Glu?Leu?Pro?Pro?Tyr?Ala?His?Met?Asn?Gly?Gly?Arg

1385 1390 1395

aaa?aat?gaa?cgc?gcc?atg?ccc?ctc?cca?cag?tcc?tct?gcc?tgc 4834

Lys?Asn?Glu?Arg?Ala?Met?Pro?Leu?Pro?Gln?Ser?Ser?Ala?Cys

1400 1405 1410

tgatgggaca?gagacaccca?ccggactgca?aaccctgcca?cctacatctc?tacagaacct?4894

gatgtcacag?tggg 4908

<210>2

<211>1413

<212>PRT

＜213〉Epinephelus coioide (Epinephelus coioides)

<400>2

Met?Arg?Ser?Arg?Thr?Glu?Arg?Ser?Arg?Leu?Thr?Leu?Phe?Trp?Gly?Leu

1 5 10 15

Met?Leu?Gly?Leu?Ser?Ser?Cys?Leu?Arg?Pro?Ala?Thr?Ala?Glu?Ile?Cys

20 25 30

Gly?Pro?Ser?Ile?Asp?Ile?Gly?Asn?Asp?Ile?Ser?Glu?Phe?Arg?Arg?Leu

35 40 45

Glu?Asn?Cys?Thr?Val?Val?Glu?Gly?Tyr?Leu?Gln?Ile?Leu?Leu?Ile?Gly

50 55 60

Asp?Lys?Asn?Asn?Asn?Asn?Val?Asn?Gln?Glu?Val?Leu?Arg?Ser?Leu?Ser

65 70 75 80

Phe?Pro?Lys?Leu?Thr?Met?Ile?Thr?Asp?Tyr?Pro?Leu?Leu?Phe?Arg?Val

85 90 95

Ser?Gly?Leu?Asp?Ser?Leu?Ser?Thr?Leu?Phe?Pro?Asn?Leu?Thr?Val?Ile

100 105 110

Arg?Gly?Arg?Asn?Leu?Phe?Tyr?Asn?Tyr?Ala?Leu?Val?Ile?Phe?Glu?Met

Untitled.ST25

115 120 125

Thr?Ser?Leu?Lys?Asp?Ile?Gly?Leu?Tyr?Asn?Leu?Arg?Asn?Ile?Thr?Cys

130 135 140

Gly?Ala?Ile?Arg?Ile?Glu?Lys?Asn?Pro?Glu?Leu?Cys?Tyr?Leu?Asp?Ser

145 150 155 160

Ile?Asp?Trp?Ser?Leu?Ile?Leu?Asp?Ala?G1u?Phe?Asn?Asn?Tyr?Ile?Ala

165 170 175

Gly?Asn?Lys?Gln?Ser?Lys?Glu?Cys?Ser?Asp?Val?Cys?Pro?Gly?Ile?Met

180 185 190

Glu?Asn?Asn?Pro?Gln?Cys?Arg?Lys?Thr?Met?Phe?Asn?Asn?Asn?Tyr?Asn

195 200 205

Tyr?Arg?Cys?Trp?Asn?Ser?Asn?His?Cys?Gln?Lys?Glu?Cys?Pro?Glu?Lys

210 215 220

Cys?Val?Arg?Arg?Ala?Cys?Thr?Ala?Asp?Gly?Glu?Cys?Cys?His?Pro?Gln

225 230 235 240

Cys?Leu?Gly?Ser?Cys?Thr?Val?Pro?Gly?Ser?Asp?Thr?Ala?Cys?Ala?Ala

245 250 255

Cys?Val?His?Tyr?Tyr?His?Gln?Gly?Arg?Cys?Val?Ala?Asp?Cys?Pro?Pro

260 265 270

Gly?Thr?Tyr?Lys?Phe?Glu?Gly?Trp?Gln?Cys?Ile?Ser?Ala?Glu?Leu?Cys

275 280 285

Ser?Lys?Val?His?Leu?Pro?Asp?Phe?Asn?Ser?Phe?Ile?Ile?His?Gly?Gly

290 295 300

Glu?Cys?Met?Ser?Glu?Cys?Pro?His?Gly?Tyr?Met?Gln?Thr?Ala?Pro?Asn

305 310 315 320

Ser?Met?Phe?Cys?Thr?Ala?Cys?Asp?Gly?Leu?Cys?Asp?Lys?Val?Cys?Glu

325 330 335

Glu?Lys?Val?Ile?Asp?Ser?Met?Asp?Ala?Ala?Gln?Ser?Leu?Lys?Gly?Cys

340 345 350

Thr?Val?Ile?Lys?Gly?Asn?Leu?His?Ile?Asn?Ile?Arg?Arg?Gly?His?Asn

355 360 365

Ile?Val?Ala?Glu?Leu?Glu?Ser?Phe?Thr?Gly?Leu?Ile?Gln?Arg?Val?Thr

370 375 380

Gly?Asn?Val?Trp?Ile?Arg?His?Ser?His?Thr?Leu?Ser?Ser?Leu?Ala?Phe

385 390 395 400

Leu?Arg?Ser?Leu?Arg?Tyr?Ile?Asp?Gly?Glu?Glu?Leu?Leu?Asp?Asp?Met

405 410 415

Untitled.ST25

Tyr?Ala?Phe?Leu?Ala?Val?Asp?Asn?Gln?Gln?Leu?Gln?Tyr?Leu?Trp?Asp

420 425 430

Trp?Lys?Gln?His?Asn?Leu?Thr?Ile?Lys?Ala?Gly?Lys?Leu?Phe?Phe?Arg

435 440 445

Ala?Asn?Pro?Lys?Leu?Cys?Met?Ser?Glu?Ile?Arg?Lys?Met?Trp?Glu?Lys

450 455 460

Thr?Gly?Ile?Gln?Gly?His?Phe?Asp?Glu?Ser?Asp?Phe?Arg?Asn?Asn?Gly

465 470 475 480

Asp?Arg?Ala?Ser?Cys?Glu?Ser?Thr?Ile?Leu?Lys?Phe?Lys?Ser?Asn?Ser

485 490 495

Thr?Ser?Ser?Thr?Arg?Ile?Lys?Leu?Thr?Trp?Gln?Arg?Tyr?Trp?Pro?Pro

500 505 510

Asp?Tyr?Arg?Asp?Leu?Ile?Ser?Phe?Ile?Val?Tyr?Tyr?Lys?Glu?Ala?Pro

515 520 525

Tyr?Gln?Asn?Ile?Thr?Glu?Phe?Glu?Gly?Gln?Asp?Gly?Cys?Gly?Tyr?Asn

530 535 540

Ser?Trp?Asn?Met?Val?Asp?Val?Glu?Leu?Arg?Pro?Asp?Lys?Glu?Thr?Asp

545 550 555 560

Pro?Gly?Val?Leu?Leu?Ser?Gly?Leu?Lys?Pro?Trp?Thr?His?Tyr?Ala?Ile

565 570 575

Phe?Val?Lys?Ala?Ile?Thr?Leu?Met?Val?Glu?Gly?Lys?His?Leu?Pro?Gly

580 585 590

Ala?Lys?Ser?Lys?Val?Val?Tyr?Ile?Arg?Thr?Ser?Pro?Ser?Ala?Pro?Ser

595 600 605

Met?Pro?Gln?Asp?Val?Arg?Ala?Tyr?Ser?Asn?Ser?Ser?Thr?Gln?Leu?Val

610 615 620

Val?Arg?Trp?Ser?Pro?Pro?Val?Ser?Pro?Asn?Gly?Asn?Gln?Thr?Tyr?Tyr

625 630 635 640

Leu?Val?Arg?Trp?Gln?Gln?Gln?Ala?Glu?Asp?Arg?Glu?Leu?Tyr?Gln?His

645 650 655

Asn?Tyr?Cys?Ser?Lys?Glu?Leu?Lys?Ile?Pro?Ile?Arg?Ile?Ala?Ala?Ile

660 665 670

Gly?Val?Gly?Asp?Gln?Glu?Glu?Asp?Thr?Lys?Pro?Thr?Lys?Pro?Asp?Pro

675 680 685

Asp?Gly?Pro?Asp?Lys?Gly?Pro?Cys?Cys?Pro?Cys?Pro?Lys?Ser?Val?Glu

690 695 700

Val?Leu?Glu?Ala?Glu?Ala?Ala?Asp?Ala?Ser?Tyr?Arg?Lys?Val?Phe?Glu

705 710 715 720

Unti?tled.ST25

Asn?Phe?Leu?His?Asn?Ser?Ile?Phe?Thr?Pro?Arg?Pro?Pro?Asp?Arg?Arg

725 730 735

Arg?Arg?Asp?Leu?Phe?Gly?Ile?Ala?Asn?Ala?Thr?His?pro?Arg?Arg?Asn

740 745 750

Arg?Leu?His?Thr?Asn?Ser?Thr?Ser?Ser?Ser?Thr?Ile?Pro?Ser?Leu?Leu

755 760 765

Ala?Ala?Gly?Asn?Ser?Ser?Thr?Ser?Asp?Val?Glu?Pro?Ala?Asp?Arg?Glu

770 775 780

Phe?Glu?Phe?Ile?Glu?Gln?Ala?Val?Thr?Glu?Arg?Glu?Leu?Gln?Ile?Phe

785 790 795 800

Gly?Leu?Gln?Pro?Phe?Thr?Val?Tyr?Arg?Ile?Asp?Ile?His?Ala?Cys?Asn

805 810 815

Arg?Gln?Val?Gln?Arg?Cys?Ser?Ala?Ala?Glu?Phe?Val?Phe?Ser?Arg?Thr

820 825 830

Lys?Pro?Ala?Glu?Lys?Ala?Asp?Asp?Ile?Pro?Gly?Pro?Val?Thr?Trp?Glu

835 840 845

Gly?His?Glu?Asp?Trp?Val?Phe?Leu?Arg?Trp?Pro?Glu?Pro?Pro?His?Pro

850 855 860

Asn?Gly?Leu?Ile?Leu?Met?Tyr?Glu?Ile?Lys?Phe?Lys?Leu?Ala?Ala?Glu

865 870 875 880

Thr?Glu?Lys?His?Glu?Cys?Val?Ser?Gly?Gln?Met?Tyr?His?Thr?Gln?Arg

885 890 895

Gly?Val?Arg?Leu?Ser?Asn?Leu?Ser?Pro?Gly?Asn?Tyr?Ser?Val?Arg?Val

900 905 910

Arg?Ala?Thr?Ser?Leu?Ala?Gly?Asn?Gly?Ser?Trp?Thr?His?Ala?Leu?Asp

915 920 925

Leu?Tyr?Val?Ala?Glu?Arg?Tyr?Glu?Asn?Val?Leu?Tyr?Ala?Met?Ile?Phe

930 935 940

Val?Pro?Ile?Val?Ile?Ile?Leu?Val?Ile?Cys?Leu?Leu?Val?Ser?Met?Leu

945 950 955 960

Val?Val?Leu?Ser?Arg?Lys?Arg?Asn?Ser?Asp?Arg?Leu?Gly?Asn?Gly?Val

965 970 975

Leu?Tyr?Ala?Ser?Val?Asn?Pro?Glu?Tyr?Phe?Ser?Ala?Ala?Glu?Met?Tyr

980 985 990

Val?Pro?Asp?Glu?Trp?Glu?Val?Ala?Arg?Glu?Lys?ILe?Thr?Leu?Ser?Arg

995 1000 1005

Glu?Leu?Gly?Gln?Gly?Ser?Phe?Gly?Met?Val?Tyr?Glu?Gly?Leu?Ala

1010 1015 1020

Untitled.ST25

Lys?Gly?Val?Val?Lys?Asp?Glu?Pro?Glu?Thr?Arg?Val?Ala?Ile?Lys

1025 1030 1035

Thr?Val?Asn?Glu?Ser?Ala?Ser?Met?Arg?Glu?Arg?Ile?Glu?Phe?Leu

1040 1045 1050

Asn?Glu?Ala?Ser?Val?Met?Lys?Glu?Phe?Asn?Cys?His?His?Val?Val

1055 1060 1065

Arg?Leu?Leu?Gly?Val?Val?Ser?Gln?Gly?Gln?Pro?Thr?Leu?Val?Ile

1070 1075 1080

Met?Glu?Leu?Met?Thr?Arg?Gly?Asp?Leu?Lys?Ser?Tyr?Leu?Arg?Ser

1085 1090 1095

Leu?Arg?Pro?Lys?Glu?Gln?Gln?Trp?Ser?Ser?Leu?Ser?Leu?Pro?Pro

1100 1105 1110

Leu?Lys?Lys?Met?Leu?Gln?Met?Ala?Gly?Gln?Ile?Ala?Asp?Gly?Met

1115 1120 1125

Ala?Tyr?Leu?Asn?Ala?Asn?Lys?Phe?Val?His?Arg?Asp?Leu?Ala?Ala

1130 1135 1140

Arg?Asn?Cys?Met?Val?Ala?Glu?Asp?Phe?Thr?Val?Lys?Ile?Gly?Asp

1145 1150 1155

Phe?Gly?Met?Thr?Arg?Asp?Ile?Tyr?Glu?Thr?Asp?Tyr?Tyr?Arg?Lys

1160 1165 1170

Gly?Gly?Lys?Gly?Leu?Leu?Pro?Val?Arg?Trp?Met?Ser?Pro?Glu?Ser

1175 1180 1185

Leu?Lys?Asp?Gly?Val?Phe?Thr?Thr?Thr?Ser?Asp?Val?Trp?Ser?Phe

1190 1195 1200

Gly?Val?Val?Leu?Trp?Glu?Ile?Ala?Thr?Leu?Ala?Glu?Gln?Pro?Tyr

1205 1210 1215

Gln?Gly?Leu?Ser?Asn?Glu?Gln?Val?Leu?Arg?Phe?Val?Met?Glu?Gly

1220 1225 1230

Gly?Leu?Leu?Glu?Lys?Pro?Gln?Asn?Cys?Pro?Asp?Met?Leu?Phe?Glu

1235 1240 1245

Leu?Met?Arg?Met?Cys?Trp?Gln?Tyr?Asn?Pro?Lys?Met?Arg?Pro?Ser

1250 1255 1260

Phe?Val?Glu?Ile?Ile?Ser?Ser?Leu?Lys?Asp?Glu?Leu?Glu?Pro?Ala

1265 1270 1275

Phe?Arg?Glu?Val?Ser?Phe?Phe?Tyr?Ser?Ala?Asp?Asn?Lys?Pro?Pro

1280 1285 1290

Asp?Ala?Pro?Gln?Leu?His?Leu?Asp?Lys?Met?Asp?Asn?Met?Asp?Asp

Untitled.ST25

1295 1300 1305

Val?Pro?Leu?Glu?Pro?Pro?Ser?Ser?Thr?Gln?Pro?Gln?Gln?Thr?Pro

1310 1315 1320

Val?Pro?Gln?Gln?Thr?Pro?Pro?Ser?Pro?Asn?Ser?Glu?Ala?Pro?Pro

1325 1330 1335

Val?Pro?Ser?Leu?Ala?Pro?Ser?Ser?Pro?Ser?Ser?Pro?Cys?Thr?Ser

1340 1345 1350

Thr?Ala?Ala?Met?Asp?Lys?Gln?Pro?Ser?Gly?Gln?Gln?Ala?Ala?Asn

1355 1360 1365

Gly?Leu?Ser?Gly?Ala?Gly?Leu?Ala?Ala?Gly?Ser?Gly?Ala?Val?Arg

1370 1375 1380

Pro?Ser?Leu?Asp?Glu?Leu?Pro?Pro?Tyr?Ala?His?Met?Asn?Gly?Gly

1385 1390 1395

Arg?Lys?Asn?Glu?Arg?Ala?Met?Pro?Leu?Pro?Gln?Ser?Ser?Ala?Cys

1400 1405 1410

Claims

1. cabrilla insulin-like growth factor I receptor gene, its nucleotide sequence is shown in SEQ ID NO:1.

2. cabrilla insulin-like growth factor I receptor gene as claimed in claim 1, the coded aminoacid sequence of its nucleotide sequence is shown in SEQ ID NO:2.

3. the application of the cabrilla IGF-1 gene of claim 1 in preparation fry growth promoter or additive.

4. the application of cabrilla IGF-1 gene as claimed in claim 3 in preparation cabrilla fry growth promoter or additive.