CN1552860A - Camellia expansion specific expression sequence label and its biologic chip - Google Patents

Abstract

This invention relates to specific expressive sequential labels of extendsine of tea tree and their biochips. The labels are of sequences shown in SEQ ID No.1 - SEQ ID No.2, one or combination of more in the said both sequences, complementary or homologous ones of each, those with 8-100 continuous nucleotides as probes or their complementary ones. Two expressive sequential labels of extendsine of tea tree are obtained by DNA determining the established library of cDNA of tea tree by expression sequential label technology after taking out surplus sequences, searching databases through Internet. The invention can be used in evaluation of crop seed sources, early prediction of hybrid vigor, research on plant resistance, determination of plant SNP, inspection of transgenic crop security, and screen of herbicides and agro-chemicals, etc.

Description

One class tea tree swollenin specific expressino sequence label and biochip thereof

Technology 1 field

The present invention relates to biological technical field, relate in particular to a class tea tree swollenin specific expressino sequence label and a biochip thereof.Must experience the expansion and the elongation of cell in cell growth process, and the lax and irreversible stretching, extension of cell walls is a prerequisite, swollenin then plays an important role in this process.It is a multigene family, mainly contains 2 families, and α-swollenin is active higher in dicotyledons.β-swollenin is active higher in monocotyledons, and dicotyledons is then less.

Background technology

But the sequence of transcriptional expression in the organism genome (being gene) only accounts for about 2% of total sequence, and this part sequence is measured, and will directly cause the discovery of new gene, and obtains information the closest with the industrialization relation in the genome.The eighties in 20th century; the appearance of high-throughout automatic sequencing; make from plasmid complementary DNA (cDNA) (Complementary DNA; be called for short cDNA; down together) many cDNA clones of library picked at random and mensuration are from a hundreds of base (the Base Pair at non-carrier two ends; abbreviation bp) thymus nucleic acid (being called for short DNA, down together) sequence becomes possibility down together.These short dna sequence dnas are called " expressed sequence tag " (Expressed Sequence Tags is called for short ESTs).The notion of expressed sequence tag put forward (Science, 252 (5013): 1651-1656) by Adams etc. the earliest in 1991.(1991) (Science such as Venter subsequently, 252 (5013): 1651-1656) founded extensive expressed sequence tagging method, its essential characteristic is exactly from being carrier with the plasmid, in the purpose tissue cDNA library that structure is finished, select many cDNA clones at random, utilize the universal primer that carries on the plasmid that DNA sequence is carried out taking turns in the cDNA two ends and measure, the non-carrier from the hundreds of base of 3 ' end or 5 ' end that is obtained is lacked DNA sequence.Sikela in 1992 and Matsubara (Sikela, et al.Nucleic Acids Research 19,1837-1843; Matsubara, et al.Nature Genetics2 173-179) at obtaining pressing for of a large amount of messenger RNA(mRNA) (mRNA, down together) sequence, proposes the research strategy of large-scale cDNA order-checking.In brief, expressed sequence tag is the short DNA sequence (being generally 300-500bp) from expressing gene fragment 3 ' end or 5 ' end, represents a particular organization or the expressing gene of etap partly to transcribe fragment.Expressed sequence tagging method as tea tree, has the meaning and the value of particularly important for the species that genome research lacks.

According to expressing sequence information design synthetic gene special primer (the Gene specific primer that sequence label provides, GSP) using Oligo (dT) to adding anchor primer (Anchored primer) when mRNA carries out reverse transcription, then in total RNA, adopt terminal rapid amplifying (the Rapid amplification cDNA ends) technology of cDNA, obtain the full length sequence of goal gene.Also can design primer with the information that this sequence label provides, synthesising probing needle screens the cDNA library, and the longest positive colony of picking checks order, in the hope of obtaining goal gene.Xing Guichun etc. (Chinese biological chemistry and molecular biosciences journal, 2001,17 (2) 203-208) extend a new gene M AGE-D1 who has cloned the relevant MAGE gene family of tumour in conjunction with the terminal rapid amplifying technology of cDNA with electronics; Luo Ying etc. (biological chemistry and biophysics progress, 2001,28 (2) 188-191) according to expressed sequence tag sequences Design nest-type PRC primer, have successfully separated the complete sequence of RIG1 gene; Qian J etc. (ActaBiochem Biophys Scnica, 2001,33 (2): 147-152) with an expressed sequence tag sequence relevant with the ubiquitin approach, in conjunction with the RACE-PCR technical point from the UBAP1 full length gene.

Along with the needs and the expressed sequence tag inherent characteristics of biotechnology and life science development, in recent years, people had invented biochip.The essence of biochip (Biochips) be exactly on the little substrate of area in an orderly manner dot matrix arranged a series of addressable biological identification molecule in certain position ground (Lipshutz, RJ et al.Bio Techniques 19 (1995), 442-447 of being fixed in; Fodor, SP et al.Nature 364 (1993), 555-556; Fodor, SP et al.Science 251 (1991), 767-773; Pease, AC et al.Proceedings of National Academy of Science, USA 91 (1994), 5022-5026).Because initial biochip mainly is to be used for determined dna sequence, gene expression profile evaluation (Lockhart, DJ et al.Nature Biotechnology14 (1996), 1675-1680), the detection of gene mutation body and analysis (Feriotto, G et al., Human Mutation 13 (1999), 390-400; Hacia, JG et al.Nature Genetics 21 (suppl 1) (1999), 42-47; Hacia, JG et al.NatureGenetics 22 (1999), 164-167; Nilsson, P et al.Bio Techniques 26 (1999), 308-316), so be called DNA chip or biochip again.At present, this technology has extended to non-nucleic acid fields such as immune response, receptors bind, so biochip has exceeded original scope.Nowadays biochip mainly comprises cDNA microarray, oligonucleotide microarray, moving electric microarray, protein chip and immuno-chip etc., new kind and technology such as organization chip, cell chip, polypeptide chip, mass spectrum chip and electrical chip also occurred.

October nineteen ninety-five P.Brown and his colleague (Bio Techniques, 19 (1995), 442-447) the cDNA microarray technology has been proposed, (Science 270 (1995) for M.Schena, 467-470) and D.Shalon (Genome Research 6 (1996), 639-645) grade has been made the cDNA array first, and this technology has obtained development at full speed subsequently.The utilization biochip technology carries out the chip utilization hybridization technique and the scanning technique that obtain chip processing, valid data extraction, analyzes and report biochip, can obtain corresponding gene expression profile (Gene expression profiling).At present the DNA chip is employed in a lot of fields with relative characteristics such as simple because of having strong property, handiness, susceptibility, as: determined dna sequence, gene pleiomorphism detection (Wang, et al.Science 280 (1998), 1077-1082; Nalushka, et al.Nature Genetics 22 (1999), 239-247), discovery, vaccine and the drug research of new gene, the resistance research (Schenk of plant, PM et al.Proceedingsof National Academy of Science, USA, 97 (2000), 11655-11660), the fluctuation activity etc. of gene in the organic growth, the Harmony research of regulating the gene of cell function, detection different development stage different tissues.The gene expression data of analyzing gene group mass-producing; with finally causing the globality of pair cell differentiation to be observed, relate to the genome molecular linkage map of cell proliferation, necrocytosis, energy metabolism, intercellular and intracellular signal conduction, immunoreactive generation, cell migration etc.The biochip of expressed sequence tag is used for the research and the detection platform of biological function.Biology comprises seed, animal and plant cells and their product of animal, plant and their organ, plant; The research of said biological function comprises the mechanism of generation, animal and plant growth and growth of resistance, animals and plants breeding and new variety of plant of genomic medicine, vaccine, plant and the toxicology of medicine; The detection of biological function comprises the evaluation of the detection of functional assessment, pathogenic agent of security detection, the food composition of transgenic plant and diagnosis, living species, comprises animals and plants and microorganism.That resistance comprises is drought-resistant, disease resistance, pest-resistant evil, anti-low temperature and anti-saline and alkaline characteristic.

Carry out gene expression analysis by biochip to tea tree swollenin expressed sequence tag and formation thereof, help to find and the newcomer of clone gene family, assignment of genes gene mapping clone, as sequence tagged site (Sequence-Tagged Sites is called for short STSs) carry out the chromosomal assignment of genes gene mapping and gene mapping is made, the evaluation in genetic mutation site, analyzing gene in different tissues expression specificity and set up DNA physical map and pair cell and organic holistic approach etc.Just because of expressed sequence tag has so superiority, so expressed sequence tag order-checking has become the focus of many genome research mechanism.

Summary of the invention

Purpose of the present invention provides a class tea tree swollenin specific expressino sequence label and a biochip thereof.

Another object of the present invention provides the analyzing and testing of a kind of tea tree swollenin genetic expression.

Another object of the present invention provides a kind of clone of tea tree swollenin gene.

The sequence of the isolated tea tree swollenin of one class specific expressino sequence label: expressed sequence tag has the sequence shown in SEQ ID No.1～SEQ ID No.2; Shown in one or several combination in 2 sequences; The complementary sequence of every sequence or homologous sequence; 8～100 sequence or its complementary sequences that continuous nucleotide is a probe in every sequence.

Its preparation method is:

1) the total Yeast Nucleic Acid of tea tree (RNA) extracts;

2) messenger RNA(mRNA) (mRNA) isolation and purification;

3) adopt synthetic complementary DNA (cDNA) (cDNA) first chain of polymerase chain reaction (PCR) method and second chain;

4) the cDNA enzyme cut, purifying, and be connected with carrier;

5) producing phage library and plasmid cDNA library transforms;

6) cultivation of recombinant plasmid and extraction;

7) mensuration of expressed sequence tag sequence;

8) reject carrier sequence, redundant sequence, internet database is retrieved, is classified, and obtains SEQ ID No.1～SEQ IDNo.2 expressed sequence tag sequence.

A kind of biochip of being formed by the described expressed sequence tag of claim 1: on carrier, be combined with the sequence shown in SEQ ID No.1～SEQ ID No.2; The nucleic acid molecule of homologous sequence or its complementary sequence; Said nucleic acid molecule is a thymus nucleic acid; Yeast Nucleic Acid and poly oligonucleotide.

Said chip preparation method is:

1) SEQ ID No.1～SEQ ID No.2 expressed sequence tag is carried out pcr amplification again;

2) the PCR product purification is used for chip manufacturing after handling;

3) chip is made by chip point sample instrument point.

Said carrier is solid phase carrier or liquid phase carrier; Solid phase carrier is slide, silicon chip, nylon membrane, nitrocellulose filter, gel.

The analyzing and testing of a kind of tea tree swollenin genetic expression: utilize expressed sequence tag to have the sequence shown in SEQ ID No.1～SEQ IDNo.2; The combination of one or several in the shown sequence; The complementary sequence of every sequence or homologous sequence; The probe that 8～100 continuous nucleotide sequences in every sequence or its complementary sequence detect as gene expression analysis.

The step of the analysing and detecting method of tea tree swollenin genetic expression is:

1) extraction of target gene total tissue RNA or mRNA;

2) formaldehyde gel sex change electrophoretic separation RNA;

3) RNA behind the sex change electrophoresis is transferred to nylon membrane or nitrocellulose filter;

4) utilize the sequence shown in SEQ ID No.1～SEQ ID No.2, homologous sequence, complementary sequence, a 8-100 nucleotides sequence to classify probe as, adopt isotope method to prepare probe;

5) probe and target gene hybridization, radioautograph, by qualitative, quantitative comparison hybridization collection of illustrative plates, the activity of can clear and definite gene whether expressing, expressing is to raise or downward modulation.

A kind of clone of tea tree swollenin gene: utilize expressed sequence tag have the sequence shown in SEQ ID No.1～SEQ ID No.2, shown in sequence in one or several the complementary sequence of combination, every sequence or the gene specific primer that synthesizes pcr amplification for sequence or its complementary sequence of probe of 30～100 continuous nucleotides in the homologous sequence, every sequence, 5 ' or 3 ' primer of amplification microtubule protein gene total length.

The step of the cloning process of tea tree swollenin gene is:

1) the total extraction of RNA and separating of mRNA;

2) synthetic 5 ' or the 3 ' cDNA of PCR method;

3) utilize expressed sequence tag to have the sequence shown in SEQ ID No.1～SEQ ID No.2, homologous sequence, complementary sequence or 30～100 continuous nucleotides and come the synthetic gene special primer, the terminal cDNA of PCR rapid amplifying;

4) Southern hybridization or cloning and sequencing are identified the characteristic of PCR product;

5) after the PCR product is identified by partly or entirely order-checking, be template,, adopt the long range PCR amplification to obtain full length gene with the primer of expressed sequence tag 5 ' or 3 ' design with 5 ' cDNA.

Advantage of the present invention is:

1. make the expressed sequence tag chip with the expressed sequence tag that obtains and have many commercial values and scientific research value: (1) uses the characterization and evaluation that this expressed sequence tag chip can be used for crop germplasm resource.(2) use this biochip and also can be used for the hybrid vigour of farm crop is carried out early prediction, filter out best advantage cross-fertilize seed.(3) use this biochip and also can be used for transgene agricultural product is carried out commodity inspection, to check the security of edible transgenic product.(4) use toxicity and the side effect that this biochip also can be used for searching medicine, carry out toxicologic study, be beneficial to screening new herbicides and novel agrochemical.(5) this biochip can be used for the breeding of plant and the generation of new variety of plant.(6) this biochip also can be used for studying on the whole the expression of whole messenger RNA(mRNA) (mRNA), and this globality research to the organism generegulation has important scientific research and practical advice is worth.(7) use this biochip and can also use intercellular and intracellular signal conduction in the mutant research plant, provide the important theory foundation for finding gene function and physiological metabolism approach in the plant.(8) this biochip can be widely used in agricultural, forestry scientific research and the actual production as a kind of commodity.

2. use these expressed sequence tag and can carry out tea tree swollenin expression of gene analyzing and testing.By analysis to the tea tree gene, through with the comparison of these expressed sequence tag, can judge the power whether tea tree swollenin gene is expressed and expressed, expression is to raise, still downward modulation.

3. use these expressed sequence tag and can carry out the clone of tea tree swollenin gene.Adopt round pcr, synthesize the gene specific primer of tea tree swollenin gene PCR reaction and 5 ' and 3 ' primer of pcr amplification full length gene, be very easy to obtain the full-length gene of tea tree swollenin according to the sequence information that expressed sequence tag provided.

4. can also utilize these expressed sequence tag to draw gene mapping.If an expressed sequence tag only occurs once in genome, it can be as sequence tagged site so.Scheme or transcription map (expression or transcript maps) expressing by the physical map that expressed sequence tag makes up.Utilize expressed sequence tag to carry out gene map and make, can accelerate the making of sequence tagged site and the chromosomal localization of new gene.

5. the expressed sequence tag sequence can be used as gene-specific probe, and the research that tissue-specific gene is expressed has important effect.

6. these new expressed sequence tag have been enriched the expressed sequence tag database, and can maximally utilise disclosed expressed sequence tag database information, the cycle that shortens the new total length complementary DNA (cDNA) of clone greatly also can reduce clone's cost, accelerates the weak tea tree gene clone progress of bioinformation accumulation.

7. expressed sequence tag also can be carried out the genetic evolution relationship analysis of new gene.Expressed sequence tag can relatively can obtain the conserved sequence fragment by different sequences to all vegeto-animal genes as a kind of tag library, thereby obtains the genetic evolution collection of illustrative plates of gene.

Embodiment

Embodiment 1, the structure in cDNA library

One, the extraction of the total RNA of tea tree

Get the tea tree tender leaf 100mg of robust growth spring, add liquid nitrogen freezing rapidly and grind to form fine powdered, after adding 1000 μ LTrizol reagent (available from Gibco BRL) continuation grinding, add 1000 μ L Trizol reagent again again, the mixing branch installs to two in the 1.5mL centrifuge tube that the coke diethyl phthalate is handled, placed on ice 5 minutes, each adds the chloroform of 200 μ L, put upside down mixing, 4 ℃ 12000 rev/mins centrifugal 10 minutes, get 500 μ L supernatant liquors, add isopyknic Virahol, put upside down gently up and down 10 times, room temperature was placed 10 minutes, and 4 ℃ 12000 rev/mins centrifugal 10 minutes, remove supernatant, add 1mL75% ethanol in the precipitation and clean gently, remove ethanol, dry back adds the distilled water dissolution precipitation that 20 μ L handled through the coke diethyl phthalate.Formaldehyde gel sex change electrophoresis detection RNA quality, add sample-loading buffer (1mL :) 16.5 μ L among the RNA 3.5 μ L by 45% methane amide, 545 μ L, 37% formaldehyde, 196 μ L, 10 * 3-(N-Ma Lindai) propanesulfonic acid, 121 μ L, 80% glycerine, 76 μ L and 10% bromjophenol blue, 62 μ L preparation, behind the mixing 95 ℃ of sex change after 2 minutes, put into ice bath rapidly, prevent annealing.During electrophoresis, electrophoresis chamber places on ice, guarantees low temperature, and voltage is no more than 5v/cm.RNA can be placed on the medium-term and long-term preservation of-70 ℃ of refrigerators, and is standby.

Two, the separation of mRNA and purifying

1. the annealing of biotin labeled Oligo (dT) probe and mRNA

Handling the total RNA of adding 0.5mg in the 1.5mL centrifuge tube that does not contain the RNA enzyme through the coke diethyl phthalate, be dissolved in the 500 μ L coke diethyl phthalate treating water, 65 ℃ of water bath heat preservations 10 minutes, Oligo (dT) probe that adds 3 μ L, (1L 20 * SSC contains 20 * SSC of 13 μ L: 175.3g sodium-chlor and 88.2g Trisodium Citrate, pH7.0) mixing gently, room temperature are placed about 10-20 minute to cooling off.

2. the flushing of avidin paramagnetic beads

One pipe avidin paramagnetic beads (available from Promega Corporation) is put into magnetic separation rack after suspending gently, make the avidin paramagnetic beads focus on a side of pipe, carefully remove supernatant, clean the avidin paramagnetic beads three times with 300 μ L, 0.5 * SSC, concentrate magnetic bead with magnetic separation rack at every turn, remove supernatant liquor, the avidin paramagnetic beads of cleaning is dissolved among 0.5 * SSC of 100 μ L standby.

3. the generation of crossbred and rinsing

To annealed biotinylated probe, join in the avidin paramagnetic beads of the 0.5 * SSC that is dissolved in 100 μ L, mixing gently, room temperature was placed 10 minutes, and light mixing was once caught magnetic bead avidin paramagnetic beads with magnetic separation rack every 1-2 minute, the careful supernatant of removing, with 0.1 * SSC washing avidin paramagnetic beads of 300 μ L, magnetic separation rack concentrates the back to remove supernatant liquor, repeats altogether 4 times.

4. wash-out mRNA

The avidin paramagnetic beads of rinsing is suspended in the coke diethyl phthalate water of 100 μ L again, catches magnetic bead with magnetic separation rack, the water of wash-out is drawn in the new pipe, repeated washing avidin paramagnetic beads obtains the mRNA of 250 μ L altogether.

5.mRNA precipitation and dissolving

Add the sodium-acetate (pH5.2) of 0.1 * volume and the isopropanol precipitating mRNA of 1 * volume ,-20 ℃ are spent the night.12000 rev/mins centrifugal 10 minutes, remove supernatant.After 75% the ethanol that adds 1mL suspends, remove supernatant centrifugal a moment, drying is redissolved in the water that the coke diethyl phthalate of 30 μ L is handled.3.5 μ L mRNA adds behind 16.5 μ L sample-loading buffer (joining by 7: the 33) mixings 95 ℃ of sex change 2 minutes, puts into immediately on ice after taking out, and prevents annealing, during formaldehyde gel sex change electrophoresis, electrophoresis chamber places on ice, guarantees low temperature.Voltage is no more than 5v/cm.

Three, the structure in cDNA library

(1) cDNA first chain is synthetic

In the centrifuge tube of 0.5mL, the tea tree mRNA that adds 3 μ L respectively, 1 μ L, 10 μ M 5 ' PCR, the first chain synthetic primers (5 '-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGG CCGGG-3 '), 1 μ L, 10 μ M, 3 ' PCR primer (5 '-ATTCTAGAGGCCGAGGCGGC CGACATG-d (T) ₃₀N _-1N-3 ') (N=A, G, C or T; N _-1=A, G, C).Mixing, centrifugal slightly, 72 ℃ of incubations 2 minutes, cooled on ice 2 minutes, centrifugal component is collected the bottom, add 2 μ L, 5 * the first chains synthetic damping fluid (250mM Tris, pH8.3 in every pipe, the 30mM magnesium chloride, 375mM Repone K), 1 μ L dithiothreitol (DTT) (20mM), 1 μ L dNTP mixture (10mM), 1 μ L ThermoScript II, to cumulative volume be 10 μ L.Through centrifugal mixing of vortex, moment, PTC-220 PCR instrument (MJ Research, Inc.) in 42 ℃ of incubations after 1 hour, take out and be put on ice, stop the synthetic of first chain.Be put in-20 ℃ of refrigerators and can preserve 3 months, standby.

(2) cDNA second chain is synthetic

Earlier the PCR instrument is heated to 95 ℃.In the centrifuge tube of a 0.5mL, add 2 μ L, the first chain cDNA, 80 μ L deionized waters, 10 μ L, 10 * PCR damping fluid, 2 μ L, 50 * dNTP mix, 2 μ L, 10 μ M 5 ' PCR, the second chain synthetic primers (5 '-AAGCAGTGGTATCAACGCA GAGT-3 '), 2 μ L, 3 ' PCR primer (5 '-ATTCT AGAGGCCGAGGCGGCCGACA TG-d (T) ₃₀N _-1N-3 ') (N=A, G, C or T; N _-1=A, G, C), 2 μ L, 50 * polysaccharase mixture to cumulative volume is 100 μ L, vibrates mixing gently, and is centrifugal slightly, and material is collected the bottom, adds 2 mineral oil in case of necessity to cover liquid level.Put in being preheating to 95 ℃ PCR instrument, the PCR response procedures is as follows: 95 ℃ of sex change 20 seconds, then 95 ℃ 5 seconds, 68 ℃ of totally 24 circulations in 6 minutes, after PCR finishes, get 5 μ L with 1.1% sepharose at 0.5 * TBE (45mM Tris-boric acid, 1mM ethylenediamine tetraacetic acid (EDTA), pH8.0) middle electrophoresis.All the other are put in-20 ℃ of refrigerators and can preserve 3 months.

(3) proteopepsis and cDNA purifying

1. get 75 μ L cDNA and be added in the pipe of a 0.5mL, add the Proteinase K (20 μ g/ μ L) of 2 μ L.

2. 45 ℃ of incubations are 20 minutes

3. after taking out, once centrifugal, component is collected the pipe end

4. the deionized water that adds 23 μ L guarantees that cumulative volume is 100 μ L

5. the phenol that adds the abundant mixing of equal-volume: chloroform: primary isoamyl alcohol (25: 24: 1, v/v/v), mixing 1-2 minute back and forth

14000 rev/mins centrifugal 5 minutes

7. there are three layers after centrifugal, get in the pipe of upper strata to a new 0.5mL

8. the chloroform that adds 100 μ L: primary isoamyl alcohol (24: 1, v/v) back and forth mixing 1-2 minute

14000 rev/mins centrifugal 5 minutes

10. get supernatant liquor

11. add 10 μ L sodium-acetate (3M, pH4.8), 1.3 μ L glycogens (20 μ g/ μ L), 260 μ L, 95% ethanol.Rapidly with centrifugal 20 minutes of 14000 rev/mins of room temperatures

12. carefully remove supernatant

13. washing with alcohol precipitation with 100 μ L 80%

14. removed residual ethanol in dry about 10 minutes

15. add the deionized water of 79 μ L, precipitation suspends

(4) Sfi I enzyme is cut and is obtained attachable cDNA

1. in the centrifuge tube of a 0.5mL, add 79 μ L cDNA (through protease K digesting), 10 μ L, 10 * Sfi I damping fluid, 10 μ L Sfi I restriction endonucleases (20 units/μ L), the abundant mixing of 1 μ L, 100 * bovine serum albumin

2. 50 ℃ of water bath heat preservations are 2 hours, are put in after the taking-up in-20 ℃ of refrigerators

3. add 2 μ L, 1% dimethylbenzene green grass or young crops when separating again, fully mixing

(5) building the storehouse separates with cDNA

1. prepare 16 1.5mL centrifuge tubes

2. prepare CHROMA SPIN-400 post (available from Clontech Laboratories, Inc.)

1) CHROMA SPIN-400 is taken out from 4 ℃, at room temperature placed 1 hour, put upside down for several times thoroughly suspensoid;

2) from post, remove bubble,, avoid producing bubble with the pipettor of 1000 μ L suspensoid gently.Take the lid of bottom away, allow under the cylinder spontaneous current.(after 3 minutes, do not flowed, covered top lid, can make cylinder continue to flow down); 3) iron clamp is clamped pillar; 4) storage buffer is by under the pillar spontaneous current, and until the surface that can see glue in the cylinder, the height of glue should be in the 1mL mark.If few, can adjust with the glue in other post; 5) flow velocity is approximately 1/40-60 second, and 1 is about 40 μ L.(if flow velocity is too low, and＜1/100 seconds, perhaps every volume＜25 μ L must suspend again, repeats above-mentioned steps)

3. after storage buffer has flowed, by the careful pillar damping fluid that adds 700 μ L of post preglabellar field, up to the time.

4. after the pillar damping fluid has flowed (about 15-20 minute), carefully the mixture of cDNA that about 100 μ L are cut through Sfi I enzyme and dimethylbenzene green grass or young crops is added to the surface at glue top center position, and rough glue surface can not influence following separation.

5. carry out before next step, allow sample fully enter in the glue (not having residual liquid) on the glue surface.

6. contain the pipe of cDNA with the pillar buffer solution for cleaning of 100 μ L, gently pour the glue surface again into.

7. allow the damping fluid time, when stopping, continuing next step, allow dye coating enter interior several millimeters of glue.

8. the shelf that will be placed with 16 pipes is placed on below the pillar, and first pipe is the outlet under pillar just.

9. the pillar damping fluid that adds 600 μ L begins to collect immediately, every pipe 35 μ L (about 1), and the pipe after the collection is added a cover immediately, after all having collected, covers the lid of pillar.

10. before experimentizing, check the component of each pipe, electrophoresis on the agarose 1.1%/EB glue, every effective 3 μ L make molecular weight marker with 1kb DNA Marker, 150V electrophoresis 10 minutes continuously at point sample hole application of sample.Collect in the pipe of a brightest 3-4 component to a new 1.5mL.

11. with 1/10 volume sodium-acetate (3M; PH4.8), 1.3 μ L glycogens (20mg/mL), 2.5 volumes, 95% ethanol (20 ℃) mixing ,-20 ℃ are spent the night.

12. 14000 rev/mins of room temperatures are centrifugal 20 minutes.

13. carefully remove supernatant.

14. gently centrifugal, remove remaining supernatant, dry about 10 minutes.

15. be dissolved in the deionized water of 7 μ L, gently mixing.The cDNA that these Sfi I enzymes are cut can (available from Clontech Laboratories, Inc.) connect with the λ TripIEx2 carrier of cutting through Sfi I enzyme now.

(6) cDNA is connected with carrier

1. prepare ligation contrast (μ L) sample (μ L) by following component

cDNA?????????????????????????????????0??????????????????1.0

λ TripIEx2 carrier (500ng/ μ L) 1.0 1.0

10 * ligase enzyme damping fluid 0.5 0.5

ATP(10mM)????????????????????????????0.5????????????????0.5

T ₄Dna ligase (400 units/μ L) 0.5 0.5

Deionized water 2.5 1.5

Cumulative volume 5.0 5.0

Wherein 10 * ligase enzyme damping fluid is by 500mM Tris-hydrochloric acid, pH7.8, and the 100mM magnesium chloride, the 100mM dithiothreitol (DTT), the 0.5mg/mL bovine serum albumin is formed.

2. mixing gently avoids producing bubble, and moment, the centrifugal component that makes sank to the bottom, and 16 ℃ of connections are spent the night

3. for each connection, do a packing reaction.

(7) packing reaction

1. connect the packaging protein that adds 25 μ L in the product at each.

2. 30 ℃ of incubations are 90 minutes.

3. take out to be put in 4 ℃ of refrigerators and can preserve for 2 weeks.Can stable preserve 6-7 months at 4 ℃ through the library of amplification, or in 7% dimethyl sulfoxide (DMSO)-70 ℃ preserve at least more than 1 year.

(8) measure titre

1. the preparation of original and working plate

Be the freezing cell of recovering, get the freezing Bacillus coli cells XL1-Blue of 5 μ L and containing the LB flat board of acillin (1LLB: peptone 10g, yeast 5g, sodium-chlor 5g, agarose 15g, pH7.0 autoclaving 20 minutes) go up and draw plate, after 37 ℃ of overnight incubation, as original flat board, place 4 ℃ can preserve for 2 weeks.(1L LB/ sal epsom contains the picking mono-clonal: peptone 10g, yeast 5g, sodium-chlor 5g at another LB/ sal epsom that contains acillin from original flat board, 10mM sal epsom, agar 15g, pH7.0, autoclaving 20 minutes) coated plate on the flat board is after 37 ℃ of overnight incubation, as working plate.

2. the titer determination in library does not increase

Picking separates good mono-clonal and is inoculated into and contains 15mL LB/ sal epsom/maltose substratum (1L contains: peptone 10g from working plate, yeast 5g, sodium-chlor 5g, 10mM sal epsom, agar 15g, 0.2% maltose, pH7.0, autoclaving 20 minutes) the 50mL test tube in, 37 ℃ of overnight incubation of 140 rev/mins of concussions reach 2.0 until the OD value, 5000 rev/mins centrifugal 5 minutes, remove supernatant liquor, with the 7.5mL 10mM sal epsom precipitation that suspends again.To pack product doubly, in the XL-1Blue recipient bacterium of 200 μ L incubated overnight, add the phage of 1 μ L dilution, and allow phage absorb 10-15 minute, add 2mL dissolved LB/ sal epsom top-agar again at 37 ℃ with phage damping fluid dilution 5-20.Put upside down mixing fast and pour into through the LB/ of 37 ℃ of preheatings sal epsom flat board, swing plate makes uniform distribution fast, room temperature cooling allowed the top-agar hardening in 10 minutes, be inverted dull and stereotyped 37 ℃ of cultivations 6-17 hour, statistics bacterial plaque and according to formula: the volume of library titre (pfu/mL)=(plaque number * extension rate)/recipient bacterium, calculate the library titre 6.8 * 10 that do not increase ⁵Pfu/mL, always cloning number is 3.5 * 10 ⁵Individual.

(9) mensuration of library recombination fraction

This library can utilize X-Gal colour developing principle to measure recombination fraction, adds the IPTG of 100mM and the X-Gal of 100mM when measuring titre, and after the incubated overnight, calculating recombination fraction by the quantity of locus coeruleus (not recombinant clone), hickie (recombinant clone) is 98.05%.

(10) cDNA inserts segmental PCR evaluation

Picking 15-20 plaque independently at random from the LB flat board, be added to respectively in the centrifuge tube that contains 200 μ L phage damping fluids, place after 1 hour for 37 ℃, be stored in 4 ℃, utilize λ TripEX2 phage 5 ' PCR primer (5 '-CTCCGAGATCTGGACGAGCT-3 ') and 3 ' PCR primer (5 '-GGGATATCACTCAG CATAAT-3 ') that PCR is carried out in the library that makes up and identify.The PCR reaction volume is 20 μ L, consisting of wherein: contain the diluent 2 μ L of mono-clonal plaque, 25mM magnesium ion 1.4 μ L, 10 μ M Nucleotide, 0.4 μ L, 10 * PCR damping fluid, 2 μ L, 10 μ M 5 ' and 3 ' primer be 0.1 μ L respectively, Taq archaeal dna polymerase 0.1 μ L, deionized water 13.9 μ L.The PCR reaction conditions is: 95 ℃ of pre-sex change 4 minutes, and 95 ℃ of sex change 30 seconds, 55 ℃ of annealing 45 seconds, 72 ℃ were extended 1 minute, 36 circulations, last 72 ℃ were extended 10 minutes.(PTC-225 type, MJ Research carry out on Inc.) to be reflected at the PCR instrument.PCR result shows that inserting fragment is distributed between the 0.5-2.0kb mostly, and the overwhelming majority is about 1.0-1.5kb.

Amplification, the titer determination in (11) cDNA library

The good XL1-Blue mono-clonal of picking separation is inoculated in the 50mL triangular flask of the LB/ sal epsom/maltose substratum that contains 15mL from working plate, and 37 ℃ 140 rev/mins concussion overnight incubation to 0D values reach 2.0.5000 rev/mins centrifugal 5 minutes, remove supernatant liquor, with the 7.5mL 10mM sal epsom precipitation that suspends again.The bacteriolyze thing that in the 7mL test tube, adds 500 μ L inoculums and enough diluted, 37 ℃ of water-bath incubations 15 minutes, (1L contains: peptone 10g, yeast 5g, sodium-chlor 5g to add the soft top-agar of LB/ sal epsom of 4.5mL fusing, 10mM sal epsom, agar 7.2g, pH7.0, autoclaving 20 minutes), short mix is also toppled over bacterium/phage mixture to LB/ sal epsom flat board, and agar evenly is laid on the flat board.Room temperature cooling 10 minutes makes the top-agar hardening, be inverted dull and stereotyped cultivate to grow to until bacterium colony in 6-18 hour in 37 ℃ be in contact with one another.Add 12mL 1 * Lambda dilution buffer liquid (0.1M sodium-chlor, 10mM sal epsom 7H ₂O, 35mMTris-hydrochloric acid, 0.01% gelatin) in each flat board, 4 ℃ are spent the night, and a flat board can become the bacteriolyze thing in an amplification library.Flat board is poured a sterilized wide-necked bottle in 50 rev/mins of concussions of room temperature into after 1 hour.For removing cell debris and the remaining intact cell of cracking, the thorough mixing phage lysate is also poured in 50mL polypropylene sterilization centrifuge tube with cover, add the 10mL chloroform and cover tight lid, behind the vortex 2 minutes, 7000 rev/mins centrifugal 10 minutes, supernatant liquor is transferred in the 50mL centrifuge tube of another sterilization, 4 ℃ of preservations, and be 7.2 * 10 by the titre that preceding method is measured library, amplification back ⁹Pfu/mL.

Library through amplification is distributed into 1mL, but the dimethyl sulfoxide (DMSO) that adds final concentration 7% is avoided repeatedly frozen-thaw process in-70 ℃ of prolonged preservation as far as possible.

The generation of (12) cDNA plasmid library

On the LB solid medium, add 5 μ L DH12S bacterium liquid, coated plate, 37 ℃ are spent the night.Get its mono-clonal in the LB liquid nutrient medium that contains 10mL, 37 ℃ 140 rev/mins are cultured to the OD value is 1.2.Taking out the back, to add magnesium chloride to final concentration be 10mM, and mixing is got the DH12S bacterium liquid mixing of 1 μ L phage cDNA library and 100 μ L, cultivated 15 minutes for 37 ℃, (1L SOC contains: microbial culture tryptone 20g, microbial culture yeast extract 5g to add 700 μ L SOC substratum then, sodium-chlor 0.5g, 2.5mM Repone K, 10mM magnesium chloride, 20mM glucose, pH7.0, autoclaving 20 minutes) 37 ℃ of shaking tables were cultivated 45 minutes, obtained plasmid library, and it is standby that taking-up is put in 4 ℃ of preservations.

Embodiment 2, expressed sequence tag order-checking and acquisition

(1) cultivation of plasmid and extraction

1. with the cDNA plasmid library dilution that obtains, carry out the gradient test, select best weaker concn.

2. go up coated plate at LB solid medium (1L LB contains: peptone 10g, yeast 5g, sodium-chlor 5g, agarose 15g, pH7.0, autoclaving 20 minutes).

3. cultivated about 12-16 hour for 37 ℃, until growing bacterium colony.

With colony inoculation on 96 orifice plates, every hole adds 1mL LB (containing acillin) (1L: peptone 10g, yeast 5g, sodium-chlor 5g, acillin final concentration are 50 μ g/mL) inoculation single bacteria clone.Cultivated about 16-18 hour for 37 ℃.

5. preservation bacterial classification, 3000 rev/mins centrifugal 5 minutes, abandoning supernatant, collecting cell.

6. add 200 μ L solution I (50mM Tris-hydrochloric acid, pH8.0,10mM ethylenediamine tetraacetic acid (EDTA), 0.1mg/mL RNA enzyme, 4 ℃), seal with adhesive tape, the vibration mixing.

7. add 200 μ L solution II (0.2N sodium hydroxide, 1% sodium lauryl sulphate, room temperature), use new tape seal, upset mixes 10 times.This moment, lysate should transparent, thickness, did not contain bacterial debris.

8. add 200 μ L solution III (3M Potassium ethanoate, Glacial acetic acid is regulated pH to 5.5,4 ℃), use new tape seal, upset mixes 10 times.

9. boiling water bath is 5 minutes.

10. ice bath is 10 minutes.

11. 4000 rev/mins centrifugal 20 minutes, supernatant liquor all changes in the following deep-well plates.

12. take off deep-well plates, add 300 μ L aqueous isopropanols, seal with adhesive tape, upset immediately mixes 3 times.Centrifugal 15 minutes (4000 rev/mins), deposit D NA.

13. remove supernatant, add 300 μ L70% ethanol, 4000 rev/mins are centrifugal 5 minutes.

14. water is dissolving DNA again ,-20 ℃ of preservations are standby.

(2) order-checking PCR reaction and sequencing

1. dilute with water 5 ' sequencing primer (5 '-CTCCGAGATCT GGACGAGC T-3 ').Attention: the volume that is added to the DNA of each reaction and primer will depend on their concentration.Adjust the amount of the sterilized water that adds, the final volume of reaction mixture is 20 μ L.

2. on 96 orifice plates, each template that will check order adds following reagent: DYEnamic ET terminator reagent is pre-mixed thing 8 μ L, primer (5 μ M) 1 μ L, and dna profiling 0.2-2 μ g, making cumulative volume is 20 μ L.

3. with mixture light shaking thorough mixing.

4. 96 orifice plates are sealed and are put on the PCR thermal cycler of pre-designed program.

5. carry out the polymerase chain reaction according to following condition, 95 ℃, 20 seconds, 50 ℃, 15 seconds, 60 ℃, 1 minute, totally 32 circulations.

6. after circulation is finished, the solution of simple centrifugal collection pipe bottom.

7. add 1 μ L 7.5M ammonium acetate in each reaction tubes, 27.5 μ L dehydrated alcohols, 5 μ L deionized waters.

4000 rev/mins centrifugal 40 minutes.

9. remove supernatant liquor.

10. add the ethanol of 50 μ L70% in each reaction tubes, and mix.

11. 4000 rev/mins centrifugal 20 minutes.

12. remove supernatant, vacuum-drying or dry air precipitation.Do not want overdrying.

13. will precipitate in the spotting solution that is suspended in 5 μ L again, firmly shake 10-20 second, guarantee to suspend fully simple centrifugal collection sample.

14. sample is put into the dna sequencing instrument, and (model is Megabace ^TM1000, Amershan Pharmacia Biotech Inc.) checks order in.

(3) acquisition of expressed sequence tag

1. the sequencing result is exported.

2. reject the sequence that carrier sequence and redundant sequence obtain expressed sequence tag.

3. with the nonredundancy sequence public expressed sequence tag database is retrieved, it is classified by function.The clone of expressed sequence tag correspondence preserves, standby.

Embodiment 3, the preparation of biochip

One, expressed sequence tag is carried out pcr amplification again

Tea tree cDNA plasmid inserts the fragment PCR amplification, be reflected on the PCR instrument and carry out (PTC-225 type, MJ Research, Inc.), primer is that (forward is 5 '-CCCAGTCACGACGTTGTAAAACG-3 ' to the M13 universal primer, be reversed 5 '-AGCGGATAATTT CACACAGG-3 '), the reaction system of per 100 μ L comprises: 10 * PCR damping fluid, 10 μ L; 25mM magnesium chloride 7 μ L; Each 1 μ L of forward and reverse primer of 100ng/ μ L, 20mM dNTPs 1 μ L, the plasmid template of Taq archaeal dna polymerase of 3 units (available from Promega Corporation) and 15ng.The pcr amplification program is: 94 ℃ of pre-sex change 4 minutes, and each is circulated in 94 ℃ of sex change 30 seconds, 58 ℃ of annealing 1 minute, 72 ℃ were extended 2 minutes; 36-40 circulation altogether, last 72 ℃ were extended 10 minutes.

Two, the PCR product is handled

The sodium-acetate (pH5.2) that adds 100 μ L Virahols and 10 μ L 3M precipitates 8 hours in-20 ℃, 4000 rev/mins 4 ℃ centrifugal 40 minutes, abandon supernatant, precipitation is with 70% washing with alcohol, be dissolved in 20 μ L DNA sex change liquid (0.4M sodium hydroxide, 10mM ethylenediamine tetraacetic acid (EDTA)) after the drying.

Three, chip preparation

Expressed sequence tag after the dissolving of sex change liquid is used for the some system of tea tree swollenin specific expressino sequence label chip, chip is made by chip point sample instrument point, the carrier of chip is a slide, all some points are made as 36 * 24 one-level battle arrays, and each o'clock is parallel twice repeatability with proof test in 4 * 4 the secondary battle array that 8 genes constitute.

Embodiment 4, the analyzing and testing of tea tree swollenin genetic expression

One, the extraction of the total RNA of tea tree and mRNA purifying

Get the tea tree children tender material 100-500mg (how many materials is decided on rna content) of different growth and development stages to be analyzed or Different Organs, adopt embodiment 1, " extraction of RNA " in " structure in cDNA library ", " separation of mRNA and purifying " described flow process, method are extracted total RNA, and separation and purified mRNA are used for following step.

Two, formaldehyde gel sex change electrophoresis

1. prepare 5 * formaldehyde gel electrophoretic buffer: 0.1M 3-(N-Ma Lindai) propanesulfonic acid (pH7.0), 40mM sodium-acetate, 5mM ethylenediamine tetraacetic acid (EDTA) (pH8.0).

2. preparing gel: an amount of agarose is fused to water, is cooled to 60 ℃, add 5 * formaldehyde gel electrophoretic buffer to final concentration and be 1 * and 2.2M.In stink cupboard, record gel, place more than 30 minutes, gel is solidified in room temperature.

3. in the centrifuge tube of a sterilization, mix following liquid, to prepare sample: total RNA or mRNA 4.5 μ L, 5 * formaldehyde gel electrophoretic buffer, 2.0 μ L, formaldehyde 3.5 μ L, methane amide 10 μ L are in 65 ℃ of incubations 15 minutes, and the ice bath cooling concentrated on liquid in pipe in centrifugal 5 seconds and manages at the end.

4. the formaldehyde gel sample loading buffer that adds 2 μ L sterilization and handle (50% glycerine, 1mM ethylenediamine tetraacetic acid (EDTA), pH8.0,0.25% tetrabromophenol sulfonphthalein, the blue or green FF of 0.25% dimethylbenzene) through the coke diethyl phthalate.

Before the application of sample with gel prerunning 5 minutes, voltage is 5V/cm, subsequently sample is added to gel sample hole.With the RNA mixture of known dimensions as molecular weight marker.

6. gel is immersed in 1 * formaldehyde gel sample loading buffer, electrophoresis is carried out in the 3-4V/cm volts lost.

7. after electrophoresis finished, ethidium bromide staining was transferred to RNA on the film after take a picture under ultraviolet lamp (molecular weight marker is other puts a transparent ruler with distance calculating RNA bulk of molecule).

Three, change film

1. gel is moved to a glass and do in the roasting ware, repair the nonuseable part of gel, and (well one end is last) cuts the mark of gel one little angle as following operation in its upper right corner with sharp cutter.

With long and wide all greater than a synthetic glass of gel as platform, put it into and work energetically in the roasting ware, put a filter paper above as paper bridge, pour 20 * SSC into and make liquid level a little less than platform, after the filter paper on the platform drenches, drive all bubbles out of with glass stick.

3. with one sharp paper knife is cut out a nitrocellulose filter or nylon membrane, its length and width should each than the big 2mm of gel, and cut one jiao and make it corresponding with gel.

4. filter membrane is immersed the deionized water surface, till drenched, use 20 * SSC to soak filter membrane at least 5 minutes subsequently.

5. the gel upset is placed on filter paper central authorities moistening on the platform, does not stay any bubble between the two.

6. with around the double-deck preservative film parcel gel.

7. above gel, place moistening filter membrane, and make both corner cuts overlapping.

8. soak 2 filter paper onesize with 2 * SSC solution, and be placed on the filter membrane top, drive all bubbles out of with gel.

9. cut a folded and onesize paper handkerchief of filter paper, be put in the filter paper top, and above paper handkerchief, press a sheet glass, then with the compacting of about 500g weight.Purpose is to set up from liquid pool through the up stream of stream of gel to filter membrane, make RNA under effect capillaceous from stream of gel to and accumulate on the filter membrane.

10. make above-mentioned RNA change film 12-18 hour, central replacing hygenic towelette once.

11. after shifting end, throw off the paper handkerchief and the filter paper of gel top, peel off filter membrane from gel.With 5 * SSC solution soaking filter membrane 5 minutes; In drying at room temperature more than 30 minutes.

12. the air dried filter membrane is placed between two filter paper, in 80 ℃ of baking boxs, did roasting 2-3 hour.

Four, the preparation of probe

Adopt embodiment 3, " expressed sequence tag is carried out pcr amplification again " in " preparation of biochip " described method and flow process, specific expressed sequence tag is carried out pcr amplification, and the PCR product that obtains 15ng/ μ L is made probe, prepares probe with isotope-labelling method.

1. mix PCR product 5 μ L, synthetic Oligonucleolide primers 5 μ L.

2. in 60 ℃ of heating 5 minutes, be cooled to 4 ℃ then.

3. add: 100mM dithiothreitol (DTT) 5 μ L

10 * RP damping fluid (900mM HEPES, pH6.0,100mM magnesium chloride), 5 μ L

The dCTP of each 5mM, dGTP, dTTP mixed solution 5 μ L

[α- ³²P] dATP (specific activity＞3000Ci/mM, 10 μ Ci/ μ L) 25 μ L

Dna polymerase i (Klenow) (12.5 unit) 2.5 μ L

In room temperature reaction 5-6 hour.

4. add: 0.5M ethylenediamine tetraacetic acid (EDTA) (pH8.0) 1.0 μ L, 20% sodium lauryl sulphate, 2.5 μ L.

5. utilize Sephadex G-50 pillar to carry out column chromatography or spin-column chromatography, the expressed sequence tag of mark and uncorporated dNTP branch are opened.

Five, prehybridization, hybridization and radioautograph

1. containing 50% methane amide, 5 * SSPE, 2 * Denhardt reagent, prehybridization 1-2 is individual hour in 0.1% sodium dodecyl sulfate solution.

2. in prehybridization solution, add the probe of the mark of sex change, under optimal temperature, continued incubation 12-24 hour.

3. with 1 * SSC, 0.1% sodium lauryl sulphate was washed film 20 minutes in room temperature, used 0.2 * SSC, 0.1% sodium lauryl sulphate to wash film 3 times subsequently, each 20 minutes.

4. carry out radioautograph with the medical X mating plate, can be in-70 ℃ of exposures 24-72 hour.

Six, the analyzing and testing of genetic expression

Observe the X-ray sheet, carry out tea tree swollenin gene expression analysis and detect, by qualitative, quantitative comparison hybridization collection of illustrative plates, clearly this gene activity of whether expressing, expressing is to raise or downward modulation.

Embodiment 5, the clone of tea tree swollenin gene

One, the total extraction of RNA and separating of mRNA

Adopt embodiment 1, " extraction of RNA " in " structure in cDNA library ", " separation of mRNA and purifying " described flow process, method are extracted total RNA, and separation and purified mRNA are used for following step.

Two, 5 ' or 3 ' cDNA's is synthetic

1. in 0.5mL sterilization centrifuge tube, mix

(1) it is synthetic to carry out 5 ' cDNA: 1-3 μ L RNA sample, 1 μ L, 5 ' primer [5 '-(T) 25V N-3 ' (N=A, C, G, or T; V=A, G, or C)], 1 μ L Oligo (5 '-AAGCAGTGGTATCAACGCAGAGTACGCG GG-3 '), it is synthetic that (2) carry out 3 ' cDNA: 1-3 μ L RNA sample, 1 μ L, 3 ' primer A (5 '-AAGCAGTGGTA TCAACGCAGAG TAC (T) ₃₀VN-3 ', (N=A, C, G, or T; V=A, G or C)

2. adding aqua sterilisa to the cumulative volume of each reaction is 5 μ L

3. biased sample and moment are centrifugal

4. centrifuge tube was 70 ℃ of incubations 2 minutes

5. cooled on ice is 2 minutes

Moment centrifugal collection sample to the pipe end

7. add following ingredients to each centrifuge tube (having contained 5 μ L): 2 μ L 5 * the 1st chain synthesizes damping fluid (250mM Tris-hydrochloric acid (pH8.3), 375mM KCl, 30mM MgCl ₂), 1 μ L dithiothreitol (DTT) (20mM), 1 μ L dNTP mixture (10mM), 1 μ L reversed transcriptive enzyme, cumulative volume are 10 μ L

8. with pipettor hybrid reaction composition gently

Moment centrifugal be gathered into assign to the pipe end

10. there is the PCR instrument of heat lid to be incubated 1.5 hours at 42 ℃

11. dilute the first chain synthesis reaction product: begin to add 20 μ L from the＜total RNA of 200ng, begin to add 100 μ L, begin to add 250 μ L from mRNA from the＞total RNA of 200ng with Tricine-ethylenediamine tetraacetic acid (EDTA) damping fluid

12. heated centrifuge tubes 7 minutes at 72 ℃

13. sample can be preserved 3 months at-20 ℃

Three, contrast PCR reaction

1. mix following reagent by every pipe 50-μ L PCR reaction volume: 34.5 μ L PCR-level water, 5 μ L, 10 * PCR damping fluid, 1 μ LdNTP mixture (10mM), 1 μ L, 50 * polysaccharase mixture, cumulative volume 41.5 μ L

2. vortex mixing and moment are centrifugal

3. according to the form below is prepared the PCR reaction, and order adds each composition in the PCR pipe, gently mixing

Reacted constituent	1 (5 ' contrast) (μ L)	2 (3 ' contrast) (μ L)	3 (5 ' cDNA internal contrast) (μ L)	4 (3 ' cDNA internal contrast) (μ L)
					5 '-the cDNA contrast	????2.5	????-	????2.5	????-
3 '-cDNA contrast	????-	????2.5	????-	????2.5
					5 '-TFR primer (10 μ M)	????1	????-	????1	????1
3 '-TFR primer (10 μ M)	????-	????1	????1	????1
					10 * universal primer mixture *	????5	????5	????-	????-
Water	????-	????-	????4	????4
					The PCR mixture	????41.5	????41.5	????41.5	????41.5
Cumulative volume	????50	????50	????50	????50
					Estimate length	????2.6kb	????2.9kb	????0.3kb	????0.3kb

^*10 * universal primer mixture: long primer (0.4 μ M) 5 '-CTAATACGACTCACTATA GGGCAAGCAGTGGTATCAACGCAGAGT-3 ', short primer (2 μ M), 5 '-CTAA TACGACTCACTATAGGGC-3 '

4. in the PCR pipe, add 2 mineral oil, cover tight lid.If the PCR instrument with the heat lid is arranged can not add mineral oil.

5. adopt following program, carry out heat start PCR, 94 ℃ 30 seconds, 72 ℃ 3 minutes, 5 circulations, 94 ℃ 30 seconds, 70 ℃ 30 seconds, 72 ℃ 3 minutes, 5 circulations, 94 ℃ 30 seconds, 68 ℃ 30 seconds, 72 ℃ 3 minutes, 27 circulations

6. get 5 μ L in 1.2% agarose/ethidium bromide electrophoretic analysis, can work up to controlled trial.

Four, the terminal fast PCR amplification of cDNA

1. mix following reagent by every pipe 50-μ L PCR reaction volume: 34.5 μ L PCR-level water, 5 μ L, 10 * PCR damping fluid, 1 μ LdNTP mixture (10mM), 1 μ L, 50 * polysaccharase mixture, cumulative volume 41.5 μ L

2. the abundant mixing of vortex (avoiding producing bubble), moment is centrifugal

3. carry out 5 '-during pcr amplification, according to the form below is prepared the PCR reaction, and order adds each composition in the PCR pipe, gently mixing: 5 ' cDNA2.5 μ L, 10 * universal primer mixture, 5 μ L, ^§Gene specific primer 1 (10 μ M) 1 μ L, PCR mixture 41.5 μ L, cumulative volume are 50 μ L.

^§Terminal rapid amplifying PCR must be according to a known expressed sequence tag Synthetic 2 gene specific primer, 5 ' PCR needs an antisense primer, 3 ' PCR needs a sense primer, they must satisfy following condition: 23-28bp, 50-70%GC content, Tm 〉=65 ℃ can obtain optimum, if heat start PCR ℃ can be adopted in Tm＞70.

4. carry out 3 '-during PCR, according to the form below is prepared the PCR reaction, and order adds each composition in the PCR pipe, mixing: 3 ' cDNA 2.5 μ L gently, 10 * universal primer mixture, 5 μ L, gene specific primer 2 (10 μ M) 1 μ L, PCR mixture 41.5 μ L, cumulative volume reaches 50 μ L.

5. in the PCR pipe, add 2 mineral oil, cover tight lid.If the PCR instrument with the heat lid is arranged can not add mineral oil.

According at first from total RNA or mRNA, correctly select following program one, carry out heat start PCR.

If program 1:(gene specific primer Tm＞70 ℃), 94 ℃ 30 seconds, 72 ℃ 3 minutes, 5 circulations, 94 ℃ 30 seconds, 70 ℃ 30 seconds, 72 ℃ 3 minutes, 5 circulations, 94 ℃ 30 seconds, 68 ℃ 30 seconds, 72 ℃ 3 minutes, 20 circulations (if using mRNA) or 25 circulations (if using total RNA)

If Tm=60-70 ℃ of program 2:(gene specific primer) 94 ℃ 30 seconds, 68 ℃ 30 seconds, 72 ℃ 3 minutes, 20 circulations (if using mRNA) or 25 circulations (if using total RNA)

Seven, the CHARACTERISTICS IDENTIFICATION of PCR product

(1) Southern hybridization

1. carry out 1.2% agarose/ethidium bromide electrophoresis earlier, take pictures under the ultraviolet lamp.

2. according to embodiment 4, " commentaries on classics film " program of " analyzing and testing of tea tree swollenin genetic expression " is transferred to DNA on the nylon membrane.

3. can adopt end-labelled nido gene specific primer 1 or 2 to be probe.In addition, if the synthetic gene specific primer has 5 ' and 3 ' overlap, gene specific primer 2 can be used as and identify 5 '-probe of PCR, gene specific primer 1 can be used as and identify 3 '-probe of PCR.

4. prehybridization, hybridization, and under medium rigorous degree, wash film, radioautograph.

(1) filter membrane that contains target DNA is floated on a dish 6 * SSC liquid level, soaked 2 minutes in liquid moistening up and down back.(2) filter membrane is packed in the plastics bag, press 0.2mL/cm ²Filter membrane adds prehybridization solution (6 * SSC, 0.05 * Blotto, 50% methane amide), extrudes the air in the bag, in 42 ℃ of water-baths incubation 1-2 hour.(3) 100 ℃ of heating made the probe sex change in 5 minutes, made the probe quenching rapidly in ice-water bath.(4) from water-bath, take out hybridization bag fast, cut off a jiao of bag, in prehybridization solution, add the probe of sex change, remove the air in the bag as far as possible, seal again.(5) hybridization bag is put into 42 ℃ of water-baths, hybridized 2-3 hour.(6) take out hybridization bag and cut off one jiao rapidly, hybridization solution is poured in the safety container, cut off sack, the filter membrane taking-up is put into one fills in 2 enough * SSC and the 0.5% sodium lauryl sulphate plastics casing soaking at room temperature along 3 limits.Filter membrane is transferred in the plastics casing of another 2 * SSC and 0.1% sodium lauryl sulphate after (7) 5 minutes, soaks 15 minutes in the room temperature jog.(8) filter membrane is transferred in the plastics casing of another 0.1 * SSC and 0.5% sodium lauryl sulphate, soaks 1 hour in 37 ℃ of jogs.(9) solution is changed to the 0.1 * SSC and 0.5% sodium lauryl sulphate of newly joining, and plastics casing was transferred to 68 ℃ of incubations 1 hour.(10) with 0.1 * SSC in room temperature rinsing filter membrane of short duration, inhale with paper and to remove most of liquid.(11) the packing film bag is by filter membrane, with filter membrane to X-ray sheet exposure 24-72 hour to obtain the radioautograph video.

5. relatively hybridize banding pattern and sepharose photo.

6. behind acquisition and expection band of the same size, from gel, reclaim DNA, the test below continuing.

(2) clone of PCR product and order-checking

1. reclaim possible purpose band in the sugared gel

(1) the 10M sodium iodide of 3-4 times of volume of adding.(2) 50 ℃ of dissolving gels.(3) silicon oxide of adding 40%.(4) mixing, 37 ℃ of water bath heat preservations 5 minutes.(5) centrifugal, and the cleaning buffer solution of 2 times of volumes of adding (50% alcohol, 0.1M sodium-chlor, 0.1M Tris-hydrochloric acid, pH7.5).(6) centrifugal, remove supernatant.(7) drying at room temperature is 3 minutes.(8) add the distilled water that 10 μ L sterilize.(9) centrifugal, supernatant liquor is transferred to new centrifuge tube, can will reclaim fragment cloning to carrier.

2. the recovery band is cloned on T/A type or the T type of carrier and (can be bought from Promega Corporation and Invitrogen Corporation).

(1) the DNA pipe is inserted in instantaneous centrifugal T carrier and contrast, component is concentrated on manage at the end.(2) according to the form below is provided with the ligation of reclaiming DNA and T carrier:

Standard connects the contrast of positive control background

T carrier (50ng) 1 μ L 1 μ L 1 μ L

The DNA 3-5 μ L that reclaims--

Contrast insertion DNA-1 μ L-

5 * T ₄Dna ligase damping fluid 2 μ L 2 μ L 2 μ L

T ₄Dna ligase (3 units/μ L) 1 μ L 1 μ L 1 μ L

Deionized water is to cumulative volume 10 μ L 10 μ L 10 μ L

(3) pipettor mixing, moment is centrifugal.Room temperature connects 1 hour or 4 ℃ of connections are spent the night.(4) transform the connection product: mix 5 μ L and connect product and 50 μ L competent escherichia coli cells; In placing 30 minutes on ice; 42 ℃ of heat shocks after 2 minutes immediately in placing 2 minutes on ice; Add 600 μ L, 2 * YT (1L contains: peptone 16g, yeast extract 10g, sodium-chlor 5g, pH7.0, high-pressure side bacterium 20 minutes) broth culture; 37 ℃ of wave and culture 1 hour; Add 100 μ L X-Gal (30mg/mL), 10 μ LIPTG (30mg/mL); Get 10 μ L, 50 μ L respectively, 100 μ L, 200 μ L are containing coated plate on the LB flat board of acillin, are inverted overnight incubation for 37 ℃; The individual white mono-clonal of picking 3-5 in 37 ℃ of overnight incubation, extracts plasmid in containing the LB liquid nutrient medium of acillin; (5), adopt " embodiment 2, expressed sequence tag order-checking and acquisition " similar method to measure the target DNA fragment sequence of inserting with the universal primer of T carrier.

3. adopt ³²The nido gene specific primer of P mark is probe hybridization or is the sequence that sequencing primer is measured 8-10 clone with gene specific primer, identifies the positive colony that contains the specific gene insertion.

(8) acquisition of full-length gene

After the PCR product is identified by partly or entirely order-checking, can be with the acquisition full-length gene of following method

1. be template with 5 ' cDNA,, adopt the long range PCR amplification to obtain full length gene with the primer of expressed sequence tag 5 ' or 3 ' design.

2. with the restriction enzyme site of gene overlap, clone 5 ' or 3 ' overlap, the full length gene of reentrying.

The sequence table of expressed sequence tag

(1) information of SEQ ID No.1:

(a) sequence signature:

Length: 600 bases

Type: nucleic acid

Chain: strand

Topological framework: line style

(b) molecule type: cDNA

(c) initial source: tea tree

(d) sequence description: SEQ ID No.1:

GGGGGCACTCAACTCAACTTCCTCCCCCCCCACCCCCAAGCTTTTTCTTATGTTCTTCAT

TTGAGAAGACTCTCCCTCAATCTCAATGAAAATGGGTGTTACTGTGTTTTTGTTGGTGG

GTTTTCTTTCAATGGTGTCCTTTGTTCATGGGTATGGAGGTTGGATCAATGCTCATGCCA

CCTTCTATGGTGGGGGTGATGCCTCTGGGACTATGGGAGGAGCATGTGGGTATGGGAA

TTTGTACAGCCAAGGGTATGGAACAAACACAGCAGCACTGAGCACAGCAATGTTCAAC

AGTGGATTAAGCTGTGGTTCTTGCTTTGAGATTAGGTGTGTCAATGACCGCAAATGGTG

CCTCCGTGGTTCCATTGTAGTCACTGCCACCAATTTCTGTCCCCCAAACAATGCCTTAC

CAAACAATGCTGGAGGATGGTGTAACCCTCCTCAGCACCACTTTGACCTCTCTCAGCCT

GTCTTCCAACACATTGCACAATCCAGAGCTGGTATTGTCCCTGTTTCTTACAGAAGGGT

ACCCTGCAGGAGGAGGGGAGGCATAAGTTCACCATCAATGGGCATTCCTACATTCAAC

TTGGTCCTTAT

(2) information of SEQ ID No.2:

(a) sequence signature:

Length: 396 bases

Type: nucleic acid

Chain: strand

Topological framework: line style

(b) molecule type: cDNA

(c) initial source: tea tree

(d) sequence description: SEQ ID No.2:

GGGCACATCAATGGCCATTCCTACTTCAACTGGTTCTTATAACCAACGTTGGTGGTGCT

GGTGATGTACATGCTGTGTGCCGTCAAAGGGTTCAGGACCCGTTGGCAGCCAATGTCA

AGGAATGGGGCCAGAATTGGCAAAGCAACACCTACCTCAACGGCCAAACCCTCTCCTT

CAAGGTCACCACTAGTGACGGTCGTAGCGTGGTCTCCTACAATGTTGCCCCAGCTAGCT

GGTCCTTTGGTCAGACCTTCAGTGGAGGACAGTACCGATAGTTGATAGAGACCTATTCC

CTTCGAGTTAAACTTAGTTGTCTGTACTTTAATAGTTGTACCCATATTTGGCTAGGTATA

TAGATACTATATAGTCACTTAATATTAGTATGGTGACTATTAC

Claims (10)

1. the sequence of the isolated tea tree swollenin of class specific expressino sequence label, it is characterized in that: expressed sequence tag has the sequence shown in SEQ ID No.1～SEQ ID No.2; Shown in one or several combination in 2 sequences; The complementary sequence of every sequence or homologous sequence; 8～100 sequence or its complementary sequences that continuous nucleotide is a probe in every sequence.

2. the sequence of the isolated tea tree swollenin of a class according to claim 1 specific expressino sequence label is characterized in that its preparation method is:

1) the total RNA of tea tree extracts;

2) mRNA isolation and purification;

3) adopt synthetic cDNA first chain of PCR method and second chain;

4) the cDNA enzyme cut, purifying, and be connected with carrier;

5) producing phage library and plasmid cDNA library transforms;

6) cultivation of recombinant plasmid and extraction;

7) mensuration of expressed sequence tag sequence;

8) reject carrier sequence, redundant sequence, internet database is retrieved, is classified, and obtains SEQ ID No.1～SEQID No.2 expressed sequence tag sequence.

3. a biochip of being made up of the described expressed sequence tag of claim 1 is characterized in that: be combined with the sequence shown in SEQ ID No.1～SEQ ID No.2 on carrier; The nucleic acid molecule of homologous sequence or its complementary sequence; Said nucleic acid molecule is a thymus nucleic acid; Yeast Nucleic Acid and poly oligonucleotide.

4. the biochip of a kind of expressed sequence tag according to claim 3 is characterized in that, said chip preparation method is:

1) SEQ ID No.1～SEQ ID No.2 expressed sequence tag is carried out pcr amplification again;

2) the PCR product purification is used for chip manufacturing after handling;

3) chip is made by chip point sample instrument point.

5. the biochip of a kind of expressed sequence tag according to claim 3, it is characterized in that: said carrier is solid phase carrier or liquid phase carrier.

6. the biochip of a kind of expressed sequence tag according to claim 3, it is characterized in that: said solid phase carrier is slide, silicon chip, nylon membrane, nitrocellulose filter, gel.

7. the analyzing and testing of tea tree swollenin genetic expression is characterized in that: utilize expressed sequence tag to have the sequence shown in SEQ ID No.1～SEQ ID No.2; The combination of one or several in the shown sequence; The complementary sequence of every sequence or homologous sequence; The probe that 8～100 continuous nucleotide sequences in every sequence or its complementary sequence detect as gene expression analysis.

8. the analyzing and testing of a kind of tea tree swollenin according to claim 7 genetic expression is characterized in that: the analysing and detecting method of said tea tree swollenin genetic expression, and its step is:

1) extraction of target gene total tissue RNA or mRNA;

2) formaldehyde gel sex change electrophoretic separation RNA;

3) RNA behind the sex change electrophoresis is transferred to nylon membrane or nitrocellulose filter;

4) utilize the sequence shown in SEQ ID No.1～SEQ ID No.2, homologous sequence, complementary sequence, a 8-100 nucleotides sequence to classify probe as, adopt isotope method to prepare probe;

5) probe and target gene hybridization, radioautograph, by qualitative, quantitative comparison hybridization collection of illustrative plates, the activity of can clear and definite gene whether expressing, expressing is to raise or downward modulation.

9. the clone of a tea tree swollenin gene is characterized in that: utilize expressed sequence tag have the sequence shown in SEQ ID No.1～SEQID No.2, shown in sequence in one or several the complementary sequence of combination, every sequence or the gene specific primer that synthesizes pcr amplification for sequence or its complementary sequence of probe of 30～100 continuous nucleotides in the homologous sequence, every sequence, 5 ' or 3 ' primer of amplification swollenin full length gene.

10. the clone of a kind of tea tree swollenin gene according to claim 9 is characterized in that: the cloning process of said tea tree swollenin gene, and its step is:

1) the total extraction of RNA and separating of mRNA;

2) synthetic 5 ' or the 3 ' cDNA of PCR method;

3) utilize expressed sequence tag to have the sequence shown in SEQ ID No.1～SEQ ID No.2, homologous sequence, complementary sequence or 30～100 continuous nucleotides and come the synthetic gene special primer, the terminal cDNA of PCR rapid amplifying;

4) Southern hybridization or cloning and sequencing are identified the characteristic of PCR product;

5) after the PCR product is identified by partly or entirely order-checking, be template,, adopt the long range PCR amplification to obtain full length gene with the primer of expressed sequence tag 5 ' or 3 ' design with 5 ' cDNA.