CN1544655A - Fluorescence quantitative reagent kit and detection method for human cytomegalovirus - Google Patents
Fluorescence quantitative reagent kit and detection method for human cytomegalovirus Download PDFInfo
- Publication number
- CN1544655A CN1544655A CNA2003101113812A CN200310111381A CN1544655A CN 1544655 A CN1544655 A CN 1544655A CN A2003101113812 A CNA2003101113812 A CN A2003101113812A CN 200310111381 A CN200310111381 A CN 200310111381A CN 1544655 A CN1544655 A CN 1544655A
- Authority
- CN
- China
- Prior art keywords
- disease virus
- fluorescent
- inclusion disease
- pcr
- cytomegalic inclusion
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a human cytomegalovirus fluorescent quantitative reagent box and detecting method, the reagent box including standard positive template, negative reference and control product, positive reference and control product, TaqDNA polyase, PCR initiator and specific fluorescent probe, fluorescent polyase chain reacting solution, and DNA extract. The reagent box extracts human cytomegalovirus DNA from blood serum, adopts a pair of specific initiators and a specific fluorescent marked probe to react on the quantitative PCR apparatus, and at the same time, making quantitative detection. By this reagent box and method, it can make qualitative and quantitative detection on the human cytomegalovirus, accurately, fast, effectively and conveniently, early diagnosis on virus infection, etc.
Description
Technical field
The present invention relates to the detection technique field of viral nucleic acid, more specifically relate to a kind of human cytomegalic inclusion disease virus fluorescence quantitative detection kit, simultaneously, the invention still further relates to a kind of detection method of human cytomegalic inclusion disease virus fluorescence quantitative kit, be applicable to the clinical of human cytomegalic inclusion disease virus or laboratory detection by quantitative, human cytomegalovirus infection's early diagnosis monitors and prediction cytomegalovirus popularity, and curative effect is monitored, assessed.
Background technology
HCMV infects very general in the crowd, but great majority are clinical inapparent infection or latent infection, at the immune normal individual of the overwhelming majority, often is symptomless infection; But immune deficiency individuality, fetus and infant obvious illness can appear.HCMV is one of important pathogenic micro-organism that causes newborn infant's congenital infection.The pregnant woman, former or new HCMV recurrent infection all can cause newborn infant's intrauterine infection or perinatal infection, can cause stillborn foetus, miscarriage and congenital abnormality, intelligence growth obstacle, serious caused cytomegalovirus infection.HCMV also can cause organ transplantation and bone marrow transplantation complication, and relevant with the generation of some tumours.Therefore, the early stage HCMV that accurately detects, significant to preventing its propagation.
The clinical detection of HCMV mainly adopts serological diagnostic method at present, be enzyme linked immunosorbent detection technology (ELISA detection), can detect anti-HCMV IgM and anti-HCMV IgG respectively, the former positive findings shows that reactivity infects, it is main reference index, as anti-HCMV IgG feminine gender simultaneously, then be indicated as primary infection; The latter is mainly used in and understands the population infection situation.Therefore the ELISA method fast, simply is most widely used clinically.But the neonatal immunity protection is low; do not produce or lag behind and produce IgM; easily cause false negative [Yan SS; Fedorko PF.Recent advances in laboratory diagnosis of humancytomegalovirus infection[J] .Clin.Applied Immunol Rev.2002; 2:155-167]; immune deficiency patient's immunity system is unsound, also easily causes false negative.Be subjected to the interference of IgG and Rheumatoid factors, polyclonal etc. in the infant body simultaneously, easily cause false positive again.This method detects antibody, has hysteresis quality on the time, just can detect when sufferer is produced antibody by pathogenic infection after for some time; And this method can only be qualitative, can not be quantitative, thereby need a kind of simpler, quick, highly sensitive and high special detection method.
Another kind of cmv infection detection method commonly used is the virus culture method.Traditional culture method needs 7-12 days, and the method after the improvement can obtain the result about 16 hours.This method decidable CMV reactivity infects, and be the standard method that diagnosis HCMV infects, but the cycle is longer, is not suitable for quick diagnosis.
Laboratory detection method commonly used is the PCR method, and this method is a kind of qualitative detection method, fast, cost is low, but because non-specific amplification human genome fragment very easily, so the false positive rate height, be difficult for clinically popularizing.
In a word, existing at present cytomegalovirus clinical detection method generally has false positive rate, false negative rate height, and sensitivity is low, the shortcoming that the operating time is long.
(Fluorogenetic Quantitative PCR, FQ-PCR) technical development goes out a plurality of branches to quantitative fluorescent PCR, with reference to quantivative approach, also can adopt the internal reference quantivative approach outside can adopting.The amplification after product adopts fluorescence to show, the quantivative approach variation, and algorithm is more accurate.Wherein most representative have Taqman technology and a fluorescence dye embedded technology.Other fluorescent quantitative PCR technique also has the sequence-specific fluorescent probe of double-tagging or energy signal to shift probe etc.
The fluorescence dye embedded technology utilizes fluorescence dye SYBR Green I to embed the characteristic that fluorescence intensity increases behind the double-stranded DNA, brings fluorescent signal into double-stranded DNA, shows the amount of amplified production with the velocity of variation of fluorescence intensity.Advantage is that wide spectrum is applicable to all double-stranded DNAs, and shortcoming is that specificity is not high.
The Taqman probe adopts two fluorescent mark technology, its 5 ' end mark reporter group (R), 3 ' end mark quenching group (Q).Wherein reporter group and quenching group can produce the fluorescence energy transfer phenomenon under the complete condition of probe, and promptly the reporter group fluorescence that produces that is stimulated can be absorbed fully by quenching group, can not produce the phenomenon of fluorescence after showing as reporter group and being stimulated.And if there is the specific target gene to exist in the pcr amplification process, label probe combines with the target gene specificity in annealing process, in the PCR extension process, when primer extension arrives probe location, the Taq enzyme just with the activity of its 5 '-3 ' excision enzyme with the probe enzymolysis, thereby make the reporter group of 5 ' end break away from the go out inhibition of group of 3 ' end quenching, recover fluorescent characteristic, its fluorescence intensity dynamically strengthens with amplification procedure, constitutes quantitative system in view of the above.In amplification procedure, or after amplification finishes,, realize the purpose that real-time follow-up automatization detection or end point analysis PCR detect as long as can extrapolate the amount of amplified production by the fluorescence intensity of suitable Equipment Inspection product.
On the method for quantitative Analysis, Martell etc. increase to the cycle number that amplification carried out preceding 10 times the time with fluorescence volume and are decided to be CT point [Maril Martell, et al.J Clin Microbiol, 1999; 37 (2): 327-332].When the PCR condition was identical, the template amount was high more, and the CT value is low more, and the logarithmic value of CT value and template amount is linear dependence, detected according to the DNA or the RNA production standard curve of CT value with concentration known.
Summary of the invention
The object of the present invention is to provide a kind of human cytomegalic inclusion disease virus fluorescence quantitative kit, this test kit accurately, sensitive, detect human cytomegalic inclusion disease virus fast.
Another object of the present invention has been to provide a kind of detection method of human cytomegalovirus fluorescence quantitative kit, and method is easy, and the operating time is short, to the early stage accurately diagnosis of virus infection.
In order to reach above-mentioned task, the present invention takes following technical measures: a kind of PCR kit for fluorescence quantitative that is used for the rapid detection human cytomegalic inclusion disease virus, and it comprises: a) standard positive template; B) negative ginseng control product; C) positive ginseng control product; D) Taq archaeal dna polymerase; E) PCR primer and specificity fluorescent probe; F) fluorescent quantitation reaction solution; G) DNA extraction liquid.
Standard positive template is to contain the pMD18-T vector plasmid that inserts 136 Nucleotide distinguished sequences of human cytomegalic inclusion disease virus.The pMD18-T carrier is formed through the reconstruction of pUC18 carrier by the said firm available from TaKaRa company, is a kind of dedicated carrier of high-efficient cloning PCR product, has with the identical function of pUC18 carrier, and can improve connection, the cloning efficiency of PCR product greatly.136 bases of human cytomegalic inclusion disease virus are cloned in this carrier, [concrete experiment condition and method are seen chief editors such as J. Sa nurse Brooker with alkaline lysis method of extracting in transformed into escherichia coli DH5 α propagation back, Science Press, 1992, molecular cloning experiment guide (second edition)], through DNA purification kit purifying (available from Clonetec company), with spectrophotometric instrumentation A
260Quantitatively and be diluted to 1 * 10
10Copy/μ l ,-20 ℃ of preservations.Wherein, 136 base sequences of the human cytomegalic inclusion disease virus of insertion are
1?GACTATCCCT?CTGTCCTCAG?TAATTGTGGC?TGAGAACAGT?GATCAGGAAG
51?AAAGTGAGCA?GAGTGATGAG?GAAGAGGAGG?AGGGTGCTCA?GGAGGAGCGG
101?GAGGACACTG?TGTCTGTCAA?GTCTGAGCCA?GTGTCT.
And selected one couple of PCR primers and a fluorescent probe therein, and probe is between one couple of PCR primers, and magnesium ion final concentration in each reaction system is 0.2-10mM in the fluorescent polyase chain reaction liquid, and the Taq enzyme dosage is 1-7 unit/reaction.
Negative ginseng control product are meant negative quality control standard product, and preferably through the negative serum of conclusive evidence, also available aseptic double-distilled water substitutes.
Positive ginseng control product are meant the positive quality control standard substance, are the culture lyophilized powder of human cytomegalic inclusion disease virus AD169 strain after human embryonic lung fibroblast propagation, dissolve with aseptic double-distilled water before using.
Magnesium ion final concentration in each reaction system is 0.2-10mM in the fluorescent polyase chain reaction liquid, and Taq enzyme (available from magnificent company) consumption is 1-7 unit/reaction.
PCR primer and fluorescent probe are that the upstream starts from 987 base places according to the design of human cytomegalic inclusion disease virus Towne strain Major IE gene exon4 sequence section, and the downstream ends at 1122 base places:
1?GACTATCCCT?CTGTCCTCAG?TAATTGTGGC?TGAGAACAGT?GATCAGGAAG
51?AAAGTGAGCA?GAGTGATGAG?GAAGAGGAGG?AGGGTGCTCA?GGAGGAGCGG
101?GAGGACACTG?TGTCTGTCAA?GTCTGAGCCA?GTGTCT.
Selected one couple of PCR primers and a fluorescent probe according to above-mentioned 136 base sequences, the fluorescence report group of fluorescent probe 5 ' end mark is FAM, and the fluorescent receptor group of 3 ' end mark is ROX.
In a preferred version of the present invention, the PCR primer sequence is:
Primer 1:5 ' GACTATCCCTCTGTCCTCAGTA 3 ',
Primer 2: 5 ' AGACACTGGCTCAGACTTGA 3 '.
In a preferred version of the present invention, fluorescent probe is:
5’cctcatcactctgctcactttcttc?3’.
In a preferred version of the present invention, the fluorescent quantitation reaction solution is by PCR 10 * buffer 2 μ l, and 10 μ mol/LPCR primers 1 and primer 2 be 0.5 μ l respectively, 25mmol/L MgCl
25 μ l, 2.5mmol/L dNTPs 1.2 μ l, aseptic double-distilled water 4.1 μ l form.
In a preferred version of the present invention, lysate comprises: 10mM urea, 6M Guanidinium hydrochloride, 10mMTrisHCl (pH4.4), 20%TritonX-100
In a preferred version of the present invention, the quantitative PCR condition is 1.95 ℃ of 0-20 seconds; 2.94 ℃ 15-20 second, 50 ℃ of 20-30 seconds, 72 ℃ 20 seconds, 40 circulations.
The detection method of this test kit may further comprise the steps:
A, the positive ginseng control of distilled water dissolving product;
B, use DNA extraction liquid extract human cytomegalic inclusion disease virus nucleic acid from sample to be measured, negative ginseng control product, the positive ginseng the control product of dissolved respectively;
C, get nucleic acid, standard positive template and distilled water among the step b respectively, join and contain Taq archaeal dna polymerase, PCR primer and specificity fluorescent probe, fluorescent quantitation reaction solution, purpose is to form the PCR reaction system:
D, use fluorescent quantitation detector carry out the PCR cycle detection to the reaction system among the c, and purpose is to measure the circulation thresholding;
E, the initial copy number by the circulation thresholding that compares testing sample and standard positive template to testing sample carry out quantitatively, and this step is finished automatically by instrument or the operator manually finishes.
The fluorescent quantificationally PCR detecting kit that is used to detect human cytomegalic inclusion disease virus provided by the invention, clinical or the laboratory that is applicable to human cytomegalic inclusion disease virus quantitatively reaches qualitative detection, human cytomegalovirus infection's early diagnosis, monitor and prediction cytomegalovirus popularity, and curative effect is monitored, assessed.
The present invention compared with prior art has the following advantages and effect:
1, quantitatively accurately.Compare with traditional qualitative methods such as ELISA method, virus culture method or PCR method, the advantage of this test kit is accurately detection by quantitative viral nucleic acid.
2, sensitivity and specificity height.Because adopted " double insurance " design of an a pair of Auele Specific Primer and a specific probe, sensitivity and specificity all improve greatly than conventional method.Use comparable virus culture method of this technology and ELISA method and more early detect virus infection, even before clinical symptom occurring, can detect.
3, detection speed is fast, and only 1 hour, add the extraction of nucleic acid, only need 3-4 hour altogether;
4, step is simple;
5, can carry out high-throughout sample detection simultaneously;
Embodiment
Unreceipted concrete experiment condition and method in the following example, usually according to normal condition as chief editors such as J. Sa nurse Brooker, Science Press, 1992, molecular cloning experiment guide (second edition); D.L. Spector etc., Science Press, 2001, cell experiment guide; Lv Hongsheng, Science Press, 1982, or connect the condition of advising according to manufacturer.
The fluorescent quantificationally PCR detecting kit of embodiment 1 human cytomegalic inclusion disease virus is formed and preparation
1.PCR primer sequence is:
Primer 1:5 ' GACTATCCCTCTGTCCTCAGTA 3 ', 22bases
Primer 2: 5 ' AGACACTGGCTCAGACTTGA3 ', 20bases
2. the fluorescent probe sequence is:
5’cctcatcactctgctcactttcttc?3’，25bases
Quantitative pcr amplification sheet segment length 136bp.
3.10 * PCR buffer:50mM Tris-HCl (pH8.0), 250mM KCl, 1mg/ml gelatin
4. fluorescent quantitation reaction solution (everyone part):
10×PCR?buffer 2μl
dNTPs(2.5mM) 1.2μl
MgCl
2(25mM) 5μl
PCR primer 1 (10 μ M) 0.5 μ l
PCR primer 2 (10 μ M) 0.5 μ l
Distilled water 4.1 μ l
Total amount 13.3 μ l
5. the preparation of standard positive template: laboratory cell proliferation HCMV type strain AD169, wait to occur tangible cytopathic effect after, extract DNA, select for use PCR primer 1, primer 2 to carry out the PCR reaction, reaction conditions is 95 ℃ of pre-sex change 3min; 95 ℃ of 15s, 50 ℃ of 25s, 70 ℃ of 30s, 30 circulations of increasing; 72 ℃ of 7min extend.Product cloning to pMD18-T carrier (available from TaKaRa company), is bred sequence verification in the bacillus coli DH 5 alpha.Extract plasmid, ultraviolet spectrophotometer is quantitative, is diluted to 1 * 10
10Copy/μ l ,-20 ℃ of preservations.Using the time series dilution is 1 * 10
5Copy/μ l, 1 * 10
4Copy/μ l, 1 * 10
3Copy/μ l.
6. negative ginseng control product: get the HCMV negative serum, be determined as feminine gender, adopt primer 1, primer 2 PCR to check also negative through ELISA.
7. positive ginseng control product: get the HCMV positive serum, be determined as the positive, adopt primer 1, primer 2 PCR to check also positive through ELISA.
8.DNA extracting solution: 1) lysate: 10mM urea, 6M Guanidinium hydrochloride, 10mMTrisHCl (pH4.4), 20%TritonX
-100
2) Proteinase K is dissolved as 20mg/ml available from Merk company
3) glass milk is available from Pharmarcia company
4) inhibitor is removed liquid: the 5M Guanidinium hydrochloride, 20mM TrisHCl (pH6.6) adds ethanol to 36% (V/V)
5) washings: 1mMEDTA, 20mM TrisHCl (pH6.6) adds ethanol to 70% (V/V)
The fluorescent quantificationally PCR detecting kit of embodiment 2 human cytomegalic inclusion disease viruss detects clinical serum
It is as follows that it detects step:
A, the positive ginseng control of distilled water dissolving product;
B, use DNA extraction liquid extract human cytomegalic inclusion disease virus nucleic acid from test serum sample, negative ginseng control product, the positive ginseng the control product of dissolved respectively;
DNA extraction: 1) the 1.5ml centrifuge tube add 200 μ l serum (or negative ginseng control product, again or positive ginseng control product), 200
μ l lysate and 50 μ l Proteinase K (20mg/ml), mixings immediately.
2) 72 ℃ of water-baths are 10 minutes.
3) add the glass 10 μ l that suckle, shake up, room temperature was placed 5 minutes.
4) 30 seconds maximum speed of revolution are centrifugal, remove supernatant.
5) add inhibitor and remove liquid 500 μ l, shake up.
6) 30 seconds maximum speed of revolution are centrifugal, remove supernatant.
7) add washing lotion 450 μ l, shake up.
8) 30 seconds maximum speed of revolution are centrifugal, remove supernatant.
9) repeating step 7), 8) once.
10) dry centrifuge tube, add 25 μ l lysates, shake up, room temperature was placed 5 minutes.
11) 1 minute maximum speed of revolution is centrifugal, collects supernatant.
C, get nucleic acid, standard positive template and distilled water among the step b respectively, join the PCR reaction system that contains Taq archaeal dna polymerase, PCR primer and specificity fluorescent probe, fluorescent quantitation reaction solution;
Reaction system:
Fluorescent quantitation reaction solution 13.3 μ l
Fluorescent probe (1uM) 1 μ l
Taq enzyme (3U/ μ l) 0.7 μ l
Handle sample supernatant/standard positive template/distilled water 5 μ l
Total amount 20 μ l
D, use fluorescent quantitation detector carry out the PCR cycle detection to the reaction system among the c, measure the circulation thresholding;
Setting program is on the fluorescent quantitation detector: 1.95 ℃ 0 second, 2.94 ℃ 18 seconds, 50 ℃ 20 seconds 72 ℃ 20 seconds, 35cycles; 3.40 ℃ 0 second.Carry out when the program of fluoroscopic examination is arranged on each round-robin second EOS, the detection wavelength is 530nm.Reaction tubes is put into the fluorescent quantitation detector begin reaction.
E, the initial copy number by the circulation thresholding that compares testing sample and standard positive template to testing sample carry out quantitatively.Quantitative result: computed in software draws quantitative result.According to extension rate conversion actual result.
SEQUENCE?LISTING
＜110〉Wuhan City children's hospital of Wuhan University
＜120〉human cytomegalic inclusion disease virus fluorescence quantitative kit and detection method
＜130〉human cytomegalic inclusion disease virus fluorescence quantitative kit and detection method
<160>4
<170>PatentIn?version?3.1
<210>1
<211>136
<212>DNA
＜213〉synthetic
<400>1
gactatccct?ctgtcctcag?taattgtggc?tgagaacagt?gatcaggaag?aaagtgagca 60
gagtgatgag?gaagaggagg?agggtgctca?ggaggagcgg?gaggacactg?tgtctgtcaa 120
gtctgagcca?gtgtct 136
<210>2
<211>22
<212>DNA
＜213〉synthetic
<400>2
gactatccct?ctgtcctcag?ta 22
<210>3
<211>20
<212>DNA
＜213〉synthetic
<400>3
agacactggc?tcagacttga 20
<210>4
<211>25
<212>DNA
＜213〉synthetic
<400>4
cctcatcact?ctgctcactt?tcttc 25
Claims (8)
1, a kind of human cytomegalic inclusion disease virus fluorescence quantitative kit, it is made up of standard positive template, negative ginseng control product, positive ginseng control product, Taq archaeal dna polymerase, PCR primer and specificity fluorescent probe, fluorescent polyase chain reaction liquid, DNA extraction liquid, and it is characterized in that: described cytomegalovirus specific nucleic acid sequence to be measured is 136 bases:
1?GACTATCCCT?CTGTCCTCAG?TAATTGTGGC?TGAGAACAGT?GATCAGGAAG
51?AAAGTGAGCA?GAGTGATGAG?GAAGAGGAGG?AGGGTGCTCA?GGAGGAGCGG
101 GAGGACACTG TGTCTGTCAA GTCTGAGCCA GTGTCT. have also selected one couple of PCR primers therein, with a fluorescent probe, probe is between one couple of PCR primers, magnesium ion final concentration in each reaction system is 0.2-10mM in the fluorescent polyase chain reaction liquid, and the Taq enzyme dosage is 1-7 unit/reaction.
2, a kind of human cytomegalic inclusion disease virus fluorescence quantitative kit according to claim 1, it is characterized in that: described PCR primer sequence is:
Primer 1:5 ' GACTATCCCTCTGTCCTCAGTA 3 ', 22 bases
Primer 2: 5 ' AGACACTGGCTCAGACTTGA, 3 ', 20 bases.
3, a kind of human cytomegalic inclusion disease virus fluorescence quantitative kit according to claim 1, it is characterized in that: the sequence of described fluorescent probe is:
5 ' cctcatcactctgctcactttcttc, 3 ', 25 bases.
4, a kind of human cytomegalic inclusion disease virus fluorescence quantitative kit according to claim 1 is characterized in that: standard positive template contains the pMD18-T vector plasmid that inserts the human cytomegalic inclusion disease virus distinguished sequence, and described specificity insertion sequence is 136 bases:
1?GACTATCCCT?CTGTCCTCAG?TAATTGTGGC?TGAGAACAGT?GATCAGGAAG
51?AAAGTGAGCA?GAGTGATGAG?GAAGAGGAGG?AGGGTGCTCA?GGAGGAGCGG
101?GAGGACACTG?TGTCTGTCAA?GTCTGAGCCA?GTGTCT.
5, a kind of human cytomegalic inclusion disease virus fluorescence quantitative kit according to claim 1 is characterized in that: negative ginseng control product are the HCMV negative serum.
6, a kind of human cytomegalic inclusion disease virus fluorescence quantitative kit according to claim 1 is characterized in that: positive ginseng control product are cytomegalovirus AD169 strain cell culture lyophilized powder.
7, a kind of human cytomegalic inclusion disease virus fluorescence quantitative kit according to claim 1, it is characterized in that: DNA extraction liquid comprises
I) lysate: urea, Guanidinium hydrochloride, the pH4.4 of TrisHCl, TritonX-100;
II) Proteinase K;
III) glass milk;
IV) inhibitor is removed liquid: Guanidinium hydrochloride, and the pH6.6 of TrisHCl adds ethanol to 36%;
V) washings: EDTA, the pH6.6 of TrisHCl adds ethanol to 70%.
8, a kind of described a kind of human cytomegalic inclusion disease virus fluorescence quantitative kit detection method of claim 1 of utilizing may further comprise the steps:
A, the positive ginseng control of distilled water dissolving product;
B, use DNA extraction liquid extract human cytomegalic inclusion disease virus nucleic acid from sample to be measured, negative ginseng control product, the positive ginseng the control product of dissolved respectively;
C, get nucleic acid, standard positive template and distilled water among the step b respectively, join the PCR reaction system that contains Taq archaeal dna polymerase, PCR primer and specificity fluorescent probe, fluorescent quantitation reaction solution;
D, use fluorescent quantitation detector carry out the PCR cycle detection to the reaction system among the c, measure the circulation thresholding;
E, the initial copy number by the circulation thresholding that compares testing sample and standard positive template to testing sample carry out quantitatively.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2003101113812A CN1544655A (en) | 2003-11-14 | 2003-11-14 | Fluorescence quantitative reagent kit and detection method for human cytomegalovirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2003101113812A CN1544655A (en) | 2003-11-14 | 2003-11-14 | Fluorescence quantitative reagent kit and detection method for human cytomegalovirus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1544655A true CN1544655A (en) | 2004-11-10 |
Family
ID=34336072
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2003101113812A Pending CN1544655A (en) | 2003-11-14 | 2003-11-14 | Fluorescence quantitative reagent kit and detection method for human cytomegalovirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1544655A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101538618B (en) * | 2009-04-15 | 2012-03-28 | 重庆医科大学附属儿童医院 | Fluorescence quantitative detection kit for human metapneumovirus |
| CN103882012A (en) * | 2014-04-21 | 2014-06-25 | 山东省农业科学院生物技术研究中心 | Method for rapidly and efficiently extracting DNA (Desoxvribose Nucleic Acid) from milk products such as liquid milk and milk powder |
| CN105779644A (en) * | 2014-12-22 | 2016-07-20 | 上海仁度生物科技有限公司 | Realtime fluorescent nucleic acid constant temperature amplification detection kit of human cytomegalovirus (HCMV) |
| CN116287434A (en) * | 2022-10-21 | 2023-06-23 | 深圳康美生物科技股份有限公司 | Respiratory tract syndrome pathogen nucleic acid detection kit |
-
2003
- 2003-11-14 CN CNA2003101113812A patent/CN1544655A/en active Pending
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101538618B (en) * | 2009-04-15 | 2012-03-28 | 重庆医科大学附属儿童医院 | Fluorescence quantitative detection kit for human metapneumovirus |
| CN103882012A (en) * | 2014-04-21 | 2014-06-25 | 山东省农业科学院生物技术研究中心 | Method for rapidly and efficiently extracting DNA (Desoxvribose Nucleic Acid) from milk products such as liquid milk and milk powder |
| CN103882012B (en) * | 2014-04-21 | 2016-10-05 | 山东省农业科学院生物技术研究中心 | A kind of quickly method of high efficiency extraction DNA from the milk product such as cattle and sheep liquid milk and milk powder |
| CN105779644A (en) * | 2014-12-22 | 2016-07-20 | 上海仁度生物科技有限公司 | Realtime fluorescent nucleic acid constant temperature amplification detection kit of human cytomegalovirus (HCMV) |
| CN105779644B (en) * | 2014-12-22 | 2019-10-11 | 上海仁度生物科技有限公司 | The real-time fluorescence nucleic acid isothermal amplification detection kit of human cytomegalovirus |
| CN116287434A (en) * | 2022-10-21 | 2023-06-23 | 深圳康美生物科技股份有限公司 | Respiratory tract syndrome pathogen nucleic acid detection kit |
| CN116287434B (en) * | 2022-10-21 | 2024-03-26 | 深圳康美生物科技股份有限公司 | Respiratory tract syndrome pathogen nucleic acid detection kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tao et al. | Application of CRISPR-Cas12a enhanced fluorescence assay coupled with nucleic acid amplification for the sensitive detection of African swine fever virus | |
| CN107299155B (en) | Primer and probe for real-time fluorescence quantitative PCR detection of goose astrovirus | |
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN106957927A (en) | African swine fever fluorescence PCR detection reagent, African swine fever fluorescence PCR detection reagent kit and its application | |
| CN113652505B (en) | Method and kit for detecting novel coronavirus and VOC-202012/01 mutant strain thereof | |
| Zeng et al. | Molecular detection of genotype II grass carp reovirus based on nucleic acid sequence-based amplification combined with enzyme-linked immunosorbent assay (NASBA-ELISA) | |
| CN111676328B (en) | Primer and probe for real-time fluorescent quantitative PCR detection of two genotypes of duck circovirus | |
| CN1164767C (en) | Fluorescent quantitative PCR kit for rapid and quantitative detecting hog choleravirus and hog cholera lapinized vaccine and its use | |
| CN112739833A (en) | Primer pair, probe and kit for detecting SARS-CoV-2 by utilizing nested RPA technology and application thereof | |
| CN114410844A (en) | Method for determining RCR negative and positive in CAR-T cell product by detecting GALV and ALB copy number through multiple qPCR (quantitative polymerase chain reaction) | |
| La Fauce et al. | TaqMan real-time PCR for detection of hepatopancreatic parvovirus from Australia | |
| CN108411041B (en) | Fluorescent quantitative RT-PCR kit for detecting novel chicken reovirus and application thereof | |
| CN101045939A (en) | HBV DNA gene subtype detecting method and kit | |
| Shen et al. | A Novel, Cleaved Probe-Based Reverse Transcription Loop-Mediated Isothermal Amplification Method for Specific and Sensitive Detection of Porcine Deltacoronavirus | |
| CN108060265A (en) | For detecting the primer sets of the oyster herpetovirus of infection blood clam and probe and its application | |
| CN1544655A (en) | Fluorescence quantitative reagent kit and detection method for human cytomegalovirus | |
| Li et al. | Rapid detection of grass carp reovirus type 1 using RPA-based test strips combined with CRISPR Cas13a system | |
| JP2006223180A (en) | Method for detecting herpes virus gene by using multiplex pcr | |
| KR101236197B1 (en) | Differential detection of West nile virus and Japanese encephalitis virus | |
| WO2021255787A1 (en) | Sars-cov-2 detection primer set, sars-cov-2 testing method, and sars-cov-2 test reagent and test kit | |
| De Falco et al. | Molecular Detection and Quantification of Ovine Papillomavirus DNA in Equine Sarcoid | |
| CN1932037A (en) | Method of screening transgenic wheat | |
| CN114381551A (en) | Real-time fluorescent RAA primer, probe and kit for detecting iridovirus of micropterus salmoides | |
| CN106521038A (en) | High-sensitivity BHV-2 (bovine herpes virus 2) quantitative real-time PCR (polymerase chain reaction) detection method and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |