CN1537172A - Polynucleotide sequencing method - Google Patents
Polynucleotide sequencing method Download PDFInfo
- Publication number
- CN1537172A CN1537172A CNA028101456A CN02810145A CN1537172A CN 1537172 A CN1537172 A CN 1537172A CN A028101456 A CNA028101456 A CN A028101456A CN 02810145 A CN02810145 A CN 02810145A CN 1537172 A CN1537172 A CN 1537172A
- Authority
- CN
- China
- Prior art keywords
- enzyme
- polynucleotide
- fixed
- polysaccharase
- molecule
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B82—NANOTECHNOLOGY
- B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
- B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
- Investigating Or Analysing Materials By Optical Means (AREA)
- Immobilizing And Processing Of Enzymes And Microorganisms (AREA)
Abstract
Described is a method for determining the sequence of a polynucleotide comprising the steps of (i) contacting a polynucleotide processive enzyme immobilised in a fixed position, with a target polynucleotide under conditions sufficient to induce enzyme activity; (ii) detecting an effect consequent on the interaction of the enzyme and the polynucleotide, wherein the effect is detected by measurement of a non-linear optical signal or a linear signal coupled to a non-linear signal.
Description
Invention field
The present invention relates to a kind of method of measuring polynucleotide sequence.
Background of invention
As 3,000,000,000 base collection of illustrative plates drawing the coding human genome DNA the Human Genome Project showed, the ability of measuring polynucleotide sequence has very important scientific meaning.
The basic skills of generally using in extensive dna sequencing is a chain termination method.This method is at first by Sanger and Coulson grow up (Sanger etc., Proc.Natl.Aacd.Sci.USA, 1977; 74:5463-5467), this method depends on the dideoxy derivant that uses four kinds of nucleoside triphosphates, and these derivatives are incorporated in polymeric enzyme reaction in the newborn polynucleotide chain.In case mix, dideoxy derivant will stop polymeric enzyme reaction, with gel electrophoresis product is separated also and is analyzed, to disclose the position that specific dideoxy derivant mixes in chain.
Although this method is used widely, and can produce reliable result, but it is slow to be considered to speed, labour intensity is big and expense is expensive.
Fluorescent mark has been used in polymeric enzyme reaction mix (WO91/06678) of Nucleotide in the newborn polynucleotide chain that identification increases.But these technology have a shortcoming, promptly by the increase of the caused background interference of fluorophore.Along with the growth of dna molecular, background " noise " also can increase, and detects each Nucleotide and mixes the required time of situation and also need to increase.This has seriously limited the application of this method in the macromole nucleotide sequencing.Be the problem of photofading based on the maximum constraints of the polynucleotide sequencing system of fluorescence dye.
Photofading is a kind of by the phenomenon in the fluorescent dye systems of being present in of wide coverage, the result that it is caused when dyestuff is exposed to excitation wavelength.All fuel systems can both absorb the photon of limited quantity before photofading takes place.In case photofading generation fluorescence dye just can not be observed again, if therefore it combines a molecule, then this molecule also just can not be detected.
Therefore just be necessary that a kind of improved method that is used to measure polynucleotide sequence, this method can greatly increase speed and the clip size that detects polynucleotide, and preferably do not rely on fluorescent mark Nucleotide.And this method can be carried out by automated process, thereby reduced complicacy and the cost that links with existing method.
Summary of the invention
The present invention is based on following understanding: when the polynucleotide processive enzyme in conjunction with and when target polynucleotide is passed, the conformation of enzyme and/or quality and/or energy distribution can change, this variation can detect by using the nonlinear optics imaging technique, comprises the nonlinear optics imaging technique based on secondary or triple-frequency harmonics generation.
According to an aspect of the present invention, the method for mensuration polynucleotide sequence may further comprise the steps:
(i) be enough under the active condition of inducible enzyme, target polynucleotide is being contacted with polynucleotide processive enzyme on being fixed on a fixed position; With
(ii) detect the interactional effect of described enzyme and polynucleotide, described effect detects with the detection method of nonlinear optics signal or linear signal associating nonlinear properties.
The present invention has lot of advantages.Order-checking and can record the strand polynucleotide molecule as long as a spot of polynucleotide just can carry out, and can eliminate the amplification demand before beginning to check order.Can obtain long sequence and read length, and can consider secondary structure by minimally.Obtaining the long length that reads just no longer needs through calculating a large amount of segmental re-assemblying.In addition, because the present invention does not rely on the step of fluorescently-labeled Nucleotide or any measurement fluorescence, therefore can overcome owing to there is the restriction of reading length on single molecules level of photofading phenomenon or other uncertain fluorescent effects cause.The present invention allows sequentially to read long polynucleotide passage with same enzyme system equally.So just have following advantage, promptly allow when measuring numerous different polynucleotide template sequence, the single enzyme system is renewable and reuse.At last, use the secondary or the triple-frequency harmonics generation that can not bring light loss and photofading effect to possess lot of advantages, photochemical reaction can not take place yet on the focal plane even this will give the credit to, and this is the state of activation that does not comprise finite life because of the signal that is excited by the off-resonance ray.
According to second fermentation of the present invention, the solid support material comprises at least a polysaccharase and at least a be positioned on the polysaccharase or near the dipole molecule of the position of polysaccharase.
According to the 3rd fermentation of the present invention, a kind ofly comprise solid support for measuring the imaging system that non-linear optical signal sets up, be fixed with a kind of and the interactional enzyme of polynucleotide and a kind of be positioned on the enzyme or on it near the dipole molecule of the position of enzyme.
Description of drawings
With reference to appended accompanying drawing the present invention is described, wherein
Fig. 1. a kind of synoptic diagram that uses the imaging system of second harmonic generation.
Fig. 2. show that specific nucleotide is derived from the second harmonic generation of polysaccharase when mixing.
Detailed Description Of The Invention
The present invention determines with conventional nonlinear optics detection method, when polynucleotides processing Single base on enzyme and the target polynucleotide take place to interact or when newborn polynucleotide molecule whole During the synkaryon thuja acid, the variation that the conformation of enzyme and/or quality and/or Energy distribution take place.
Using the nonlinear optics method is to know in this area to the technology that molecule carries out imaging. But when using immovable or fixing enzyme, these methods can be applied to polynucleotides and survey The aspect of order then is unknown.
In an independent embodiment, except nonlinear properties have also generated linear signal, and This linear signal is also detected. The combined results of these two kinds of signals can strengthen the detection effect.
Term used herein " polynucleotides " should comprise DNA and RNA with extensive interpretation, comprises The DNA and the RNA that modify, the DNA/RNA hybrid molecule, and the nucleic acid sample molecule of other hybridization as Peptide nucleic acid (PNA).
Term used herein " polynucleotides processive enzyme " should be with extensive interpretation, relate to any can with Polynucleotides interact and can be along the enzymes of polynucleotides continuous moving. This enzyme is preferably polymerization Enzyme, and can be any known type. For example, polymerase can be that any DNA relies on Archaeal dna polymerase. If target polynucleotide is the RNA molecule, then polymerase can be that RNA complies with The archaeal dna polymerase that relies, i.e. the RNA polymerase that reverse transcriptase, or RNA relies on, namely RNA is multiple Enzyme processed. In a preferred embodiment of the present invention, polymerase is the T4 polymerase. At this Invent in the preferred embodiment, polymerase is the polymerization of Escherichia coli (E.Coli) III type Enzyme holoenzyme (McHenry, Ann.Rev.Biochem., 1988; 57:519); The T7 polymerase (Schwager etc., Methods in Molecular and Cellular Biology, 1989/90; 1 (4): 155-159), or be compounded with also egg of Escherichia coli sulphur oxygen White phage t7 gene 5 polymerases (Tabor etc., J.Biol.Chem., 1987; 262: 1612-1623). Every kind of polymerase can both be with high working ability (and informativeness) and target multinuclear The thuja acid combination, and so even can when effective polymerization does not take place, keep polymerase-multinuclear The thuja acid complex.
Can with the interactional alternative enzyme of polynucleotides comprise unwindase, primase, holoenzyme, Topoisomerase or gyrase. These enzymes can provide more advantage. For example, use unwindase Can lower and be present in the problem that the secondary structure in the polynucleotide molecule causes, because untwist Enzyme and its experience can overcome the structure that these exist in natural environment. The second, the unwindase energy Enough support the essential reaction of double-stranded DNA under the room temperature condition.
Do mutually the time spent when enzyme and the continuous base on the polynucleotides, the conformation of this enzyme will become Change, this variation depends on the base (or nucleotides) on the target spot contacted with it. Like this, The real-time order that base-pair increases in the course of reaction just can detect at the nucleic acid unimolecule, That is to say that the enzyme system activity on the template polynucleotides to be measured can be followed the tracks of in real time. By Base (the nucleosides in the complementary strand that target polynucleotide increases is mixed in discriminating by enzymatic activity Acid), can infer sequence.
A kind of importance of the present invention is for to be fixed in enzyme on the relative imaging system fixed position.Preferably enzyme is fixed on the solid support, and keeps its activity simultaneously.The method that suitable enzyme is fixed on solid support is to know in this area.For example, describe in detail among the WO-A-99/05315 polysaccharase is fixed on method on the solid support.Be the general method of proteopexy on upholder suitable.
The optical detecting method that uses among the present invention will imaging on single molecules level, promptly produces the clearly video/signal at an enzyme.A plurality of enzymes also can be fixed on the solid support with the density that allows single enzyme resolving power.Therefore, in one embodiment, promptly have a plurality of enzymes to be fixed on the solid support, and method of the present invention can be implemented simultaneously by these enzymes.This just allows different polynucleotide molecules to check order simultaneously.
For those of ordinary skills, be suitable for promoting that the method for imaging is conspicuous under the condition of enzymic activity.For example, about polysaccharase, carrying out other necessary components of polymeric enzyme reaction also needs, and this point is conspicuous.In this embodiment, polynucleotide primer molecule and every kind of nucleoside triphosphate dATP, dTTP, dCTP, dGTP is needed.Nucleoside triphosphate can order adding, and under adding, remove those unconjugated Nucleotide before a kind of nucleoside triphosphate.Optionally, all nucleoside triphosphates also can add at one time.The preferred nucleoside triphosphate with one or more blocking groups that uses, wherein blocking group to be coming with pulse modulated monochromatic ray selectively with its removal, thereby avoids the combination of non-controlling.Disclosed the nucleoside triphosphate of the protection that is suitable among the WO-A-99/05315.
High-resolution nonlinear properties imaging system is well known in the art.Usually, the nonlinear polarization to material can be expressed as:
P＝X
(1)E
1+X
(2)E
2+X
(3)E
3+.....
Wherein P represents inductive polarization, X
(n)Represent non-linear susceptibility n time, E is an electric vector.First normal absorption and luminous reflectance have been described; Having described second harmonic generation (SHG) and frequency and difference frequency for second produces; The 3rd scattering of light has been described, the Raman Process that excites, triple-frequency harmonics generates, and the absorption of two photons and three-photon.
The preferred imaging system of the present invention depends on the detection secondary or triple-frequency harmonics generates the signal that is produced.
The unit molecule scheme of using secondary or triple-frequency harmonics to generate (hereinafter being called SHG) is (Peleg etc., Proc.Natl.Acad.Sci.USA, 1999 known in the art; 95:6700-6704 and Peleg etc., Bioimaging, 1996; 4:215-224).
The general structure of imaging system is at Peleg etc., and 1996, be described among the supra, provide signal among Fig. 1.With reference to Fig. 1, laser (1) is as irradiating source, and the laser beam of generation is immediately by polarizer (2).The part of laser beam can directly be passed through nonlinear crystal (3) thereby produce green beam with auxiliary laser beams.Photodiode (4) places the position of approaching light path, so that the means of the near infrared intensity of monitoring generation are provided.Spectral filter (5) is placed in microscopical entrance end the place ahead, enters microscope to stop any second harmonic.Laser beam is focused on the solid support that comprises immobilized enzyme, and nonlinear properties are collected the back by lens (7) and detected with monochromator (8).With IR spectral filter shielding fundamental strength.Signal is exaggerated by photomultiplier cell, uses average pulse device (boxcar averager) and channel synthesizer (9) to average and sum up.Subsequently the signal that produces is conveyed into computer (10) to produce video.
In order to generate secondary or triple-frequency harmonics, suitable mark need placed on the immobilized enzyme or near it.The height dipole molecule is applicable to this purpose (.Chem.Phys. such as Lewis, 1999; 245:133-144).The example of a suitable molecule is dyestuff, particularly styryl dye (for example film staining agent JPW1259-is provided by Molecular Probes).Green fluorescent protein (GFP) is another example of " dyestuff " or " mark ", and it can be used for the imaging by SHG.When here using, GFP not only refers to wild-type protein but also refers to mutant (Tsien, Ann.Rev.Biochem., 1998 of spectral shift; 67:509 and US5,777,079 and US5,625,048).Other staining agents that are suitable for comprise di-4-ANEPPS, di-8-ANEPPS and JPW2080 (Molecular Probes).
Dipole molecule can be located on the single base of polynucleotide (or its complement is if this dipole molecule is connected in nucleoside triphosphate and is used in the polymeric enzyme reaction).
In a preferred embodiment of the present invention, enzyme, for example polysaccharase is prepared into the reorganization syzygy with GFP.GFP can be located in the N-end or the C-end (if polysaccharase is desired to put together use with " sliding clamp ", then preferably being positioned C-terminal) of enzyme.Selectable, as long as enzymic activity can be retained, GFP then can be positioned on the interior any position of enzyme.
Among independent embodiment of the present invention, the nonlinear optics imaging system is Raman spectroscopy or surperficial enhanced Raman spectroscopy (SERS), can be to the general introduction of Raman spectroscopy from McGlip, and Progress in Surface Science, 1995; 49 (1): obtain among the 1-106.
Be used to excite the optical radiation of Raman system to be preferably near-infrared radiation (NIR).NIR excites has the fluorescence that reduces in surrounding medium or the solvent and the advantage of Raman signal.
Among independent embodiment of the present invention, (Boyed etc., Phys.Rev., 1984 are strengthened in the metallic surface of nonlinear properties available metal nanoparticle and/or roughening; B.30:519-526, Chen etc., phys.Rev.Lett.1981; 46:1010-1012 and Peleg etc., 1996, the same).A signal enhancement type metal nanoparticle can be conjugated in that (for example nanoparticle is puted together antibody, Lewis etc., Proc.Natl.Acad.Sci., USA, 1999 on the enzyme; 96:6700-6704), be fixed near the enzyme of immobilization/localization or brought to very position near SHG staining agent/enzyme.
Metal nanoparticle strengthen with from the relevant light spectrum image-forming of the SHG in nano level zone, therefore on single molecules level, be modified into picture with regard to permission.Light spectrum image-forming based on Raman scattering also can be improved by using metal nanoparticle.The metal nanoparticle that is suitable for is known in the art, comprises gold and Nano silver grain.The diameter of this nanoparticle is 5nm to 100nm, is preferably 10nm to 60nm.This nanoparticle can be connected on the polynucleotide (or its complement, if this nanoparticle is connected in nucleoside triphosphate and is used in the polymeric enzyme reaction).
The roughening metallic surface can be improved the sensitivity (Chen etc., 1981, the same and Peleg etc., 1996, the same) of SHG process equally, and is that SERS is necessary.The metallic surface is generally silver or other precious metals.The first selective modification that carry out with sub-wavelength dimensions resolving power the metallic surface can be implemented with multiple technologies, comprises using atomic force microscopy (atomicforce microscopy) (AFM).Apply the afm tip of platinum, can be used to the terminal hydrogenation of catalysis trinitride to amino group, this amino group be suitable for further derivative reaction (Muller etc., Science, 1995; 268:272-273).Enzyme can be placed in " focus (hotspot) ", and wherein a large amount of local fields are present in the zone of optical mode (optical mode) localization (.Phys.Rep. such as Scalaev, 1996; 272:61).
Among independent embodiment of the present invention, nanoparticle can bring to very position near enzyme with AFM cantilever tip end/probe, thereby strengthens nonlinear properties.
AFM is considered to have recently and can be applicable to temporal resolution and sensitivity (Rousso etc., J.Struc.Biol., 1997 that protein conformation changes the kinetics imaging; 119:158-164).This is applied in the preferred embodiments of the present invention, wherein AFM probe/tip is located on the enzyme, associating nonlinear optics information (as SHG), its be used to detect when enzyme when target polynucleotide moves, the protein conformation variation that causes owing to the interaction of enzyme and described nucleotide sequence.This information can be collected in the far field with optical system, perhaps, if with total internal reflection (totalinternal reflection) coupling, also can collect with the reflection mode.
In embodiment further, nonlinear properties (for example SHG) can (NSOM) be monitored in the near field with near-field scan optical microscopy (Near-Field Scanning Optical Microscopy).NSOM is a kind of scanning probe microscopy, and it utilizes optical interaction between nanometer syringe needle (as used in AFM) and the sample to obtain spatial discrimination optical information.The combined utilization of summarization of Near-Field Optical Microscopy and SHG has obtained extensive studies, and has demonstrated the surface-sensitive that has on the atomic level (McGilp, 1995, the same).Use NSOM to be as the major advantage of an integral part of imaging system, it can allow resolving power significantly to be increased to time wavelength yardstick.Because the conformation when the present invention relates to monitor single enzyme (as polysaccharase) with the polynucleotide interaction is so sub-wavelength dimensions resolving power is in demand.Of the present invention about description in this respect in, it is preferred (Sangohdar etc., J.Opt.A:Pure Appl.Opt., 1999 that the AFM cantilever tip is used as the atresia near-field scan microscope; 523-530).Similarly, can use metal nanoparticle to strengthen the source as local fields.Preferably, syringe needle is prepared by any metal that can strengthen the local electromagnetic field of noble metal or other, or applies.Selectable, metal nanoparticle can be connected directly on the cantilever tip.Existing report shows that it can be applied to monitor the conformational change (Rousso etc., the same) of single molecules level.
The present invention another independently among the embodiment, independent surface plasma (Surface plasmon) (or polariton)/evanescent wave field (evanescent field) that generates can be used to strengthen the signal to noise ratio of nonlinear properties.This evanescent wave (evanescent wave) enhanced imaging technique has higher signal to noise ratio than other as the independent imaging technique of SHG.In this embodiment, gather in the near field in the time of can obtaining AFM conformation information data at the same time with a NSOM fiber from the enhanced SHG field signal that suddenly dies of marker enzyme, simultaneously, can monitor the radiation of suddenly dying of absorption to obtain the information of the amount of associating between evanescent wave field and labeled polymer enzyme/SHG field.
At this on the one hand in (NSOM drainage pattern), system is promptly as photon scanning tunneling microscope (PSTM), and evanescent wave field or surface plasma field are coupled to NSOM fiber probe tip.Anyly will be monitored to by the detector that is positioned the probe pinpoint end by the weakening all of intensity of field of polysaccharase to the signal that arrives probe tip.
Surface plasma resonance (Surface plasmon resonance) is to know in this area, and it depends on and uses an incident illumination to inject the evanescent wave that prism produces.The exemplary device of this application comprises the prism and the slide with metallic coating of optics coupling connection with it among this embodiment, is fixed with enzyme on the slide.This slide is an integral part of system of miniflow fluid chamber, has an inlet to import part (Nucleotide) to the fixed enzyme.Described enzyme also is labeled so that produce non-linear effect.Incoming beam acts on prism to produce the surface plasma field.Simultaneously, nonlinear properties (as the second harmonic field) have been produced in the following manner, promptly, with pulse modulated near-infrared laser by polarizer and half-wave plate, enter optical scanner, this optical scanner is by the filter disc control bundle, thus elimination optical second harmonic noise, and laser enters sample then.Use lens and spectral filter to gather nonlinear properties and it is sent into monochromator, enter the photomultiplier that detects usefulness again, signal is amplified and be recorded in the computer system.
When the nonlinear optics signal produced the coupling mutually of evanescent wave field with those, detected signal also can be linear (suddenly dying) signal.In this embodiment, NSOM can be used for gathering linear signal.
Aspect one of the present invention independently, the polynucleotide order-checking can be implemented in cell.
Verified, in its n cell environment, archaeal dna polymerase and the replication complex related with it are anchored (or by localization) (Newport etc., Curr.Opin.Cell Biol., 1996 on the suitable position in born of the same parents; 8:365; With Lemon etc., Science, 1998; 282:1516-1519).The replication complex of this natural grappling promptly is similar to the enzyme that is fixed on the solid support.
This just allows the variation variation relevant with template sequence of the replisome associated molecule conformation that monitoring in real time takes place on the single molecules level in vivo during dna replication dna and/or cell fission.
In order to implement this content, just need modifying enzyme so that can use the nonlinear optics detection technique to give imaging.This modification can by with enzyme and, carry out the mode of gene fusion as green fluorescent protein (GFP) and finish.In order to detect, cell also should be fixed.
The fusion rotein of expressing can obtain monitoring/detection on the position by nonlinear optics detection method (second harmonic generation) in the cell of its grappling.
The following example is explained the present invention
In this experiment, the fusion rotein for preparing green fluorescent protein (GFP) and polysaccharase by the recombinant technology of knowing in this area.
Quartz chip (diameter 14mm, thickness 0.3mm) rotation is coated with the thick gold with one deck 50nm, is coated with then with one deck planar dextran.These cover the fluid chamber that the gold quartz chip places traditional near-field scanning optical microscope (NSOM) immediately.This covers the gold quartz chip can finish optically-coupled by index machine oil (index matching oil) and quartz prism.Fluid chamber is sealed immediately, makes polymerase buffer flow through chip then.
Polysaccharase is fixed on chip surface can be according to being recorded in Jonsson etc., Biotechniques, 1991; Content among the 11:620-627 is implemented.Chip environments is with operating damping fluid (10mM hepes, 10mM MgCl
2, 150mM NaCl, 0.05% tensio-active agent P20 pH7.4) carries out balance.N-hydroxy-succinamide (0.1M is water-soluble) and N-ethyl-N '-(dimethylaminopropyl) carbodiimide (EDC) (0.1M is water-soluble) of equivalent are mixed, cross the surface of chip to activate Sensor Chip CM 5 through injection then.(100 μ l, pH5) mixing is crossed the chip surface that is activated through injection to polysaccharase-GFP fusion rotein (150 μ l) with the 10mM sodium-acetate.At last, with the residual N-hydroxy-succinamide on the chip surface and thanomin (35 μ l, 1M is water-soluble, pH8.5) reaction, unconjugated polysaccharase is just washed away from chip surface.Fixing step uses successive operation damping fluid stream (5 μ l/min) to finish in 25 ℃.
50 μ l antibodies damping fluids (10mM MES pH6.0,150mM NaCl, 3mM EDTA) flow through at chip surface fixed polysaccharase/GFP in 25 ℃, and flow velocity is 5 μ l/min.It is 1: 3000 that one anti-(GFP (B-2) B biotin-conjugated 200 μ l ml-1, Santa Cruz Biotechnology) dilutes with the antibodies damping fluid, then with flow through chip surface 30 minutes of the flow velocity of 5 μ l/min.Flow through chip surface 30 minutes to wash away unnecessary antibody with the antibodies damping fluid with the flow velocity of 5 μ l/min then.
It is 1: 1000 that two anti-(immune gold is puted together EM goat anti-mouse IgG (H+L) 40nm, British BiocellInternational) diluted with the antibodies damping fluid, then with flow through chip surface 30 minutes of the flow velocity of 5 μ l/min.Flow through chip surface 30 minutes to wash away unnecessary antibody with the antibodies damping fluid with the flow velocity of 5 μ l/min then.This damping fluid is back to the operation damping fluid immediately, its will be before the beginning next step with flow through chip surface 30 minutes of the flow velocity of 5 μ l/min.
The phosphoramidite biochemical method of use standard synthesizes two oligonucleotide.The oligonucleotide that is shown among the SEQ IDNO.1 is used as target polynucleotide, and the oligonucleotide that is shown among the SEQ ID NO.2 is used as primer.
SEQ?ID?NO.1
CAAGGAGAGGACGCTGCTTGTCGAAGGTAAGGAACGGACGAGAGAAGGGAGAG
SEQ?ID?NO.2
CTCTCCCTTCTCTCGTC
These two oligonucleotide react under hybridization conditions to obtain target sequence-primer complex.The DNA of this primerization is suspended in immediately and comprises damping fluid (20mM Tris-HCl, pH7.5, the 8mM MgCl that 150 μ l can form the β subunit of the sliding clamp that centers on primed DNA
2, 4% (v/v) glycerine, 5mM dithiothreitol (DTT) (DDT)).This process is commonly referred to as pre-initialize (pre-initiation).
For detecting the conformational change of polysaccharase, a kind of NSOM of the modification of the long fiber cantilever of the quartzy multi-modal 100 μ m of tractive that uses is used to branching pattern (tapping mode).Described cantilever is driven near its resonant frequency, then the chip surface that comprises immobilized antibody is done a prime area scanning.Second harmonic generates by the initial irradiation in pulse modulated near-infrared laser source and is produced by the immobilization polysaccharase in the fluid chamber.Then with the NSOM probe scanning chip surface in fluid chamber, to obtain in the fluid chamber image with polysaccharase bonded 40nm gold particle.Then probe is remained still-mode on polysaccharase.
The preceding primer mixture of pre-initialize injects fluid chamber with the flow velocity of 5 μ l/min immediately, thereby makes " pincers " around primer-template molecule form a mixture with immobilized enzyme.Use the cooling apparatus in the fluid chamber that fluid chamber is kept at 25 ℃ then.
Then with operating damping fluid with the continuous flush fluid of the flow velocity of 500 μ l/min chamber.The damping fluid that after 10 minutes 0.4mM dATP (8 μ l) is injected 500 μ l/min flow velocitys is to start sequencing reaction.Inject 0.4mM dTTP (8 μ l) in 4 minutes backward current body chambers.And then inject 0.4mM dGTP (8 μ l) after 4 minutes, inject 0.4mM dCTP (8 μ l) again after 4 minutes.This circulation is repeated 10 times.In this complete time period, the second harmonic signal that transmits by multi-modal fiber enters photomultiplier cell through monochromator.The signal that comes out from photomultiplier cell is exaggerated and is transfused to computer in order to analyzing and storage.
Each inject 10 seconds of beginning during in the intensity of the second harmonic signal that is derived from the polysaccharase complex body change and calculated subsequently, according to the Nucleotide of injection fluid chamber and graphing.The results are shown among Fig. 2 of sequencing reaction.As can be seen from the figure, big intensity changes the complementary sequence (right-to-left is read, and deducts that part with primer sequence hybridization) that (bigger intensity change illustrates the identical Nucleotide that is that adjoins mutually) meets SEQ ID NO.1.
Sequence table
<110>Medical?Biosystems?Ltd.
＜120〉polynucleotide sequence measurement
<130>REP06729WO
＜140〉the unknown
<141>2002-05-20
<150>0112238.1
<151>2001-05-18
<160>2
<170>PatentIn?Ver.2.1
<210>1
<211>53
<212>DNA
＜213〉artificial sequence
<220>
＜223〉artificial sequence description: synthetic oligonucleotide
<400>1
caaggagagg?acgctgcttg?tcgaaggtaa?ggaacggacg?agagaaggga?gag 53
<210>2
<211>17
<212>DNA
＜213〉artificial sequence
<220>
＜223〉artificial sequence description: synthetic oligonucleotide
<400>2
ctctcccttc?tctcgtc 17
Claims (25)
1. method of measuring polynucleotide sequence, this method may further comprise the steps:
(i) be enough under the active condition of inducible enzyme, target polynucleotide is being contacted with polynucleotide processive enzyme on being fixed on a fixed position; With
(ii) detect the interactional effect of described enzyme and polynucleotide,
Wherein, described effect detects with the detection method of nonlinear optics signal or linear signal associating nonlinear properties.
2. method according to claim 1, wherein said effect detects with the nonlinear properties detection method.
3. method according to claim 1 and 2, wherein said nonlinear optics detection method are that secondary or triple-frequency harmonics generate imaging technique.
4. method according to claim 1 and 2, wherein said nonlinear optics detection method are Raman spectrum analysis or surperficial enhanced Raman spectrum analysis.
5. according to the described method of aforementioned arbitrary claim, wherein a kind of dipole molecule is positioned on the enzyme or near the position of enzyme.
6. method according to claim 5, wherein said molecule are the styryl dye molecule.
7. method according to claim 5, wherein said molecule are green fluorescent protein.
8. according to claim 5 or 6 described methods, wherein said dipole molecule is connected on the single base of polynucleotide.
9. according to the described method of aforementioned each claim, wherein said enzyme is a polysaccharase.
10. according to each described method of claim 1-8, wherein said enzyme is helicase or primase.
11. method according to claim 10, wherein step (i) comprises adding nucleoside triphosphate dATP, dTTP, dGTP and dCTP.
12. method according to claim 11, wherein said nucleoside triphosphate comprise can be by one or more blocking groups of pulse modulated monochromatic ray selective removal.
13., wherein metal nanoparticle is positioned on the enzyme or near the position of enzyme according to the described method of aforementioned each claim.
14. method according to claim 13, wherein said nanoparticle are gold or Nano silver grain.
15. according to claim 13 or 14 described methods, wherein said nanoparticle is incorporated on the one or more single base of polynucleotide.
16. according to the described method of aforementioned each claim, wherein said enzyme is fixed on the solid support.
17. method according to claim 16 wherein is fixed on a plurality of enzymes on the solid support.
18. according to claim 16 or 17 described methods, wherein said solid support has coarse metallic surface.
19. according to each described method of claim 16-18, wherein said upholder is a gold or silver-colored.
20. according to the described method of aforementioned each claim, wherein said mensuration is finished with atomic force microscopy or near-field scan optical microscopy.
21., also comprise and use the localization surface plasma resonance according to the described method of aforementioned each claim.
22. according to each described method of claim 1-14, wherein said enzyme is fixed on the intracellular fixed position.
23. a solid support matter comprises at least a fixed polysaccharase and at least a be positioned on the polysaccharase or near the dipole molecule of the position of polysaccharase.
24. a solid support matter comprises cell fixed thereon, described cell comprises and is fixed on the locational polysaccharase of its internal fixing.
25. an imaging system device that detects non-linear optical signal comprises solid support, is fixed with the interactional enzyme of polynucleotide on it and is positioned on the enzyme or near the dipole molecule of the position of enzyme.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB0112238.1 | 2001-05-18 | ||
| GBGB0112238.1A GB0112238D0 (en) | 2001-05-18 | 2001-05-18 | Sequencing method |
| PCT/GB2002/002345 WO2002095070A2 (en) | 2001-05-18 | 2002-05-20 | Polynucleotide sequencing method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1537172A true CN1537172A (en) | 2004-10-13 |
| CN1537172B CN1537172B (en) | 2013-02-20 |
Family
ID=9914926
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN028101456A Expired - Lifetime CN1537172B (en) | 2001-05-18 | 2002-05-20 | Polynucleotide sequencing method |
Country Status (21)
| Country | Link |
|---|---|
| US (3) | US9476094B2 (en) |
| EP (1) | EP1389241B1 (en) |
| JP (2) | JP4094961B2 (en) |
| KR (1) | KR20030094412A (en) |
| CN (1) | CN1537172B (en) |
| AT (1) | ATE383442T1 (en) |
| AU (1) | AU2002257933B2 (en) |
| BR (1) | BR0209841A (en) |
| CA (1) | CA2447222C (en) |
| DE (1) | DE60224524T2 (en) |
| DK (1) | DK1389241T3 (en) |
| ES (1) | ES2299569T3 (en) |
| GB (1) | GB0112238D0 (en) |
| HK (1) | HK1061047A1 (en) |
| IL (1) | IL158743A0 (en) |
| IS (1) | IS7039A (en) |
| MX (1) | MXPA03010411A (en) |
| NZ (1) | NZ529349A (en) |
| PT (1) | PT1389241E (en) |
| RU (1) | RU2291197C2 (en) |
| WO (1) | WO2002095070A2 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101415839B (en) * | 2006-02-08 | 2012-06-27 | 亿明达剑桥有限公司 | Method for sequencing a polynucleotide template |
| CN110511991A (en) * | 2019-09-11 | 2019-11-29 | 胡志刚 | Extensive DNA chip technology |
| CN107849605B (en) * | 2015-07-21 | 2021-08-20 | 欧姆尼欧美公司 | Nucleic acid sequencing methods and systems |
Families Citing this family (37)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1017848B2 (en) * | 1997-07-28 | 2012-02-22 | Gen-Probe Incorporated | Nucleic acid sequence analysis |
| US7056661B2 (en) | 1999-05-19 | 2006-06-06 | Cornell Research Foundation, Inc. | Method for sequencing nucleic acid molecules |
| GB9923644D0 (en) * | 1999-10-06 | 1999-12-08 | Medical Biosystems Ltd | DNA sequencing |
| AU2002227156A1 (en) | 2000-12-01 | 2002-06-11 | Visigen Biotechnologies, Inc. | Enzymatic nucleic acid synthesis: compositions and methods for altering monomer incorporation fidelity |
| GB0112238D0 (en) * | 2001-05-18 | 2001-07-11 | Medical Biosystems Ltd | Sequencing method |
| US6852492B2 (en) * | 2001-09-24 | 2005-02-08 | Intel Corporation | Nucleic acid sequencing by raman monitoring of uptake of precursors during molecular replication |
| US7361313B2 (en) * | 2003-02-18 | 2008-04-22 | Intel Corporation | Methods for uniform metal impregnation into a nanoporous material |
| GB0317343D0 (en) | 2003-07-24 | 2003-08-27 | Medical Biosystems Ltd | Polynucleotide sequencing |
| US7054528B2 (en) | 2004-04-14 | 2006-05-30 | Lucent Technologies Inc. | Plasmon-enhanced tapered optical fibers |
| US7012687B2 (en) | 2004-05-04 | 2006-03-14 | Lucent Technologies Inc. | Spectral analysis with evanescent field excitation |
| GB0413082D0 (en) * | 2004-06-11 | 2004-07-14 | Medical Biosystems Ltd | Method |
| US7170050B2 (en) | 2004-09-17 | 2007-01-30 | Pacific Biosciences Of California, Inc. | Apparatus and methods for optical analysis of molecules |
| JP4890926B2 (en) * | 2006-04-28 | 2012-03-07 | キヤノン株式会社 | Detection method and kit |
| EP2029721A4 (en) | 2006-05-30 | 2011-01-26 | Univ Utah Res Found | Simultaneous amplification and detection if ribonucleic acid by an optical method using surface plasmon resonance |
| US8697138B2 (en) | 2007-03-28 | 2014-04-15 | Aker Biomarine As | Methods of using krill oil to treat risk factors for cardiovascular, metabolic, and inflammatory disorders |
| US20080241866A1 (en) * | 2007-03-30 | 2008-10-02 | Pacific Biosciences Of California, Inc. | Systems and methods for enhancing fluorescent signals |
| JP5222599B2 (en) * | 2007-07-20 | 2013-06-26 | 株式会社日立ハイテクノロジーズ | Nucleic acid analysis device and nucleic acid analysis apparatus using the same |
| CN101889074A (en) * | 2007-10-04 | 2010-11-17 | 哈尔西恩莫尔丘勒公司 | Sequencing nucleic acid polymers with electron microscopy |
| JP5175584B2 (en) * | 2008-03-13 | 2013-04-03 | 地方独立行政法人 東京都立産業技術研究センター | Local surface plasmon resonance imaging system |
| EP3269824A1 (en) | 2008-03-28 | 2018-01-17 | Pacific Biosciences Of California, Inc. | Compositions and methods for nucleic acid sequencing |
| US9182406B2 (en) | 2008-08-04 | 2015-11-10 | Biodesy, Inc. | Nonlinear optical detection of molecules comprising an unnatural amino acid possessing a hyperpolarizability |
| JP5854350B2 (en) * | 2010-12-08 | 2016-02-09 | 公立大学法人大阪府立大学 | Pressure detecting device, temperature detecting device, pressure detecting method, and temperature detecting method using metal nanoparticle integrated structure |
| US9428789B2 (en) | 2011-03-21 | 2016-08-30 | Biodesy, Inc. | Classification of kinase inhibitors using nonlinear optical techniques |
| US9279154B2 (en) | 2011-12-21 | 2016-03-08 | Illumina, Inc. | Apparatus and methods for kinetic analysis and determination of nucleic acid sequences |
| WO2013115867A1 (en) | 2012-02-05 | 2013-08-08 | Biodesy, Llc | Methods for identifying modulators of ras using nonlinear techniques |
| US9395358B2 (en) | 2012-02-05 | 2016-07-19 | Biodesy, Inc. | Methods for detecting allosteric modulators of protein |
| US20130288271A1 (en) | 2012-04-25 | 2013-10-31 | Biodesy, Llc | Methods for detecting allosteric modulators of protein |
| EP3575414B1 (en) | 2013-05-06 | 2023-09-06 | Pacific Biosciences of California, Inc. | Real-time electronic sequencing |
| US9989534B2 (en) | 2014-06-30 | 2018-06-05 | Biodesy, Inc. | Systems and methods for high throughput analysis of conformation in biological entities |
| EP3237906B8 (en) | 2014-12-23 | 2020-10-28 | Bluelight Therapeutics, Inc. | Attachment of proteins to interfaces for use in nonlinear optical detection |
| CN107615047A (en) | 2015-04-02 | 2018-01-19 | 比奥德赛公司 | The method for determining protein structure using surface selectivity nonlinear optical technique |
| US10077470B2 (en) | 2015-07-21 | 2018-09-18 | Omniome, Inc. | Nucleic acid sequencing methods and systems |
| WO2017196891A1 (en) | 2016-05-09 | 2017-11-16 | Biodesy, Inc. | Methods and devices for detection of peripheral membrane protein interactions using nonlinear optical techniques |
| CA3049142A1 (en) | 2017-01-06 | 2018-07-12 | Illumina, Inc. | Phasing correction |
| BR112019014683A2 (en) * | 2017-03-07 | 2020-02-18 | Illumina, Inc. | SEQUENCING WITH TWO OPTICAL CHANNELS, WITH SINGLE LIGHT SOURCE |
| CN107064106B (en) * | 2017-04-11 | 2019-07-05 | 北京航空航天大学 | A kind of two-dimensional surface plasma most preferably excites the high-precision recognition methods of Angle Position |
| GB2593729B (en) | 2020-03-31 | 2022-05-11 | Perkins Engines Co Ltd | Spacer for use in an air intake system of an internal combustion chamber |
Family Cites Families (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6048982A (en) * | 1986-04-18 | 2000-04-11 | Carnegie Mellon University | Cyanine dyes as labeling reagents for detection of biological and other materials by luminescence methods |
| WO1995006138A1 (en) * | 1993-08-25 | 1995-03-02 | The Regents Of The University Of California | Microscopic method for detecting micromotions |
| GB9508559D0 (en) | 1995-04-27 | 1995-06-14 | Polytech Transfer Ltd | Surface second harmonic and sum-frequency generation immuno and enzyme assays |
| US5814516A (en) * | 1995-10-13 | 1998-09-29 | Lockheed Martin Energy Systems, Inc. | Surface enhanced Raman gene probe and methods thereof |
| US6072043A (en) * | 1996-06-04 | 2000-06-06 | Polyprobe, Inc. | Optimally fluorescent oligonucleotides |
| US5866430A (en) * | 1996-06-13 | 1999-02-02 | Grow; Ann E. | Raman optrode processes and devices for detection of chemicals and microorganisms |
| CA2282418A1 (en) | 1997-03-05 | 1998-09-11 | Scriptgen Pharmaceuticals, Inc. | Screen employing fluorescence anisotropy to identify compounds with affinity for nucleic acids |
| US5958696A (en) | 1997-07-17 | 1999-09-28 | Boehringer Ingelheim Pharmaceuticals, Inc. | Quantitative solid phase helicase assay |
| EP1017848B2 (en) * | 1997-07-28 | 2012-02-22 | Gen-Probe Incorporated | Nucleic acid sequence analysis |
| FR2771028A1 (en) * | 1997-11-18 | 1999-05-21 | Total Sa | Device for separating components of a heterogeneous mixture |
| US5786389A (en) * | 1997-12-28 | 1998-07-28 | Lambert Technologies Inc. | Guerbet castor esters |
| WO1999044045A1 (en) * | 1998-02-27 | 1999-09-02 | Massachusetts Institute Of Technology | Single molecule detection with surface-enhanced raman scattering and applications in dna or rna sequencing |
| DE19816202A1 (en) * | 1998-04-09 | 1999-10-14 | Karl Seitz | Spaces for the erection of buildings |
| WO2000036151A1 (en) | 1998-12-14 | 2000-06-22 | Li-Cor, Inc. | A heterogeneous assay for pyrophosphate detection |
| US7270951B1 (en) * | 1999-03-10 | 2007-09-18 | Asm Scientific, Inc. | Method for direct nucleic acid sequencing |
| GB9907812D0 (en) | 1999-04-06 | 1999-06-02 | Medical Biosystems Ltd | Sequencing |
| US7056661B2 (en) * | 1999-05-19 | 2006-06-06 | Cornell Research Foundation, Inc. | Method for sequencing nucleic acid molecules |
| CA2377722A1 (en) * | 1999-07-16 | 2001-01-25 | Wm. Marsh Rice University | Metal nanoshells for biosensing applications |
| WO2001016375A2 (en) | 1999-08-30 | 2001-03-08 | The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | High speed parallel molecular nucleic acid sequencing |
| JP2003510607A (en) | 1999-09-27 | 2003-03-18 | アレイ バイオサイエンス コーポレイション | Addressable arrays using morphology-dependent resonance for analyte detection |
| US6908736B1 (en) * | 1999-10-06 | 2005-06-21 | Medical Biosystems, Ltd. | DNA sequencing method |
| GB9923644D0 (en) * | 1999-10-06 | 1999-12-08 | Medical Biosystems Ltd | DNA sequencing |
| US20020127563A1 (en) * | 2001-01-08 | 2002-09-12 | Salafsky Joshua S. | Method and apparatus using a surface-selective nonlinear optical technique for detection of probe-target interactions without labels |
| JP2004521323A (en) * | 2001-03-27 | 2004-07-15 | サラフスカイ，ジョシュア，エス． | Method and apparatus for detecting probe-target interactions using surface selective nonlinear optical techniques |
| GB0112238D0 (en) | 2001-05-18 | 2001-07-11 | Medical Biosystems Ltd | Sequencing method |
| GB0317343D0 (en) | 2003-07-24 | 2003-08-27 | Medical Biosystems Ltd | Polynucleotide sequencing |
| GB0413082D0 (en) | 2004-06-11 | 2004-07-14 | Medical Biosystems Ltd | Method |
-
2001
- 2001-05-18 GB GBGB0112238.1A patent/GB0112238D0/en not_active Ceased
-
2002
- 2002-05-20 AU AU2002257933A patent/AU2002257933B2/en not_active Ceased
- 2002-05-20 PT PT02727736T patent/PT1389241E/en unknown
- 2002-05-20 BR BR0209841-5A patent/BR0209841A/en not_active IP Right Cessation
- 2002-05-20 DK DK02727736T patent/DK1389241T3/en active
- 2002-05-20 IL IL15874302A patent/IL158743A0/en unknown
- 2002-05-20 WO PCT/GB2002/002345 patent/WO2002095070A2/en active IP Right Grant
- 2002-05-20 NZ NZ529349A patent/NZ529349A/en unknown
- 2002-05-20 CA CA2447222A patent/CA2447222C/en not_active Expired - Lifetime
- 2002-05-20 ES ES02727736T patent/ES2299569T3/en not_active Expired - Lifetime
- 2002-05-20 DE DE60224524T patent/DE60224524T2/en not_active Expired - Fee Related
- 2002-05-20 EP EP02727736A patent/EP1389241B1/en not_active Expired - Lifetime
- 2002-05-20 JP JP2002591533A patent/JP4094961B2/en not_active Expired - Fee Related
- 2002-05-20 US US10/478,036 patent/US9476094B2/en active Active
- 2002-05-20 RU RU2003136429/13A patent/RU2291197C2/en not_active IP Right Cessation
- 2002-05-20 AT AT02727736T patent/ATE383442T1/en not_active IP Right Cessation
- 2002-05-20 CN CN028101456A patent/CN1537172B/en not_active Expired - Lifetime
- 2002-05-20 KR KR10-2003-7014760A patent/KR20030094412A/en not_active Application Discontinuation
- 2002-05-20 MX MXPA03010411A patent/MXPA03010411A/en unknown
-
2003
- 2003-11-17 IS IS7039A patent/IS7039A/en unknown
-
2004
- 2004-05-17 HK HK04103458A patent/HK1061047A1/en not_active IP Right Cessation
-
2007
- 2007-11-14 JP JP2007295468A patent/JP4907498B2/en not_active Expired - Fee Related
-
2008
- 2008-09-08 US US12/206,536 patent/US20090029383A1/en not_active Abandoned
-
2016
- 2016-09-29 US US15/280,636 patent/US20170022556A1/en not_active Abandoned
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101415839B (en) * | 2006-02-08 | 2012-06-27 | 亿明达剑桥有限公司 | Method for sequencing a polynucleotide template |
| CN107849605B (en) * | 2015-07-21 | 2021-08-20 | 欧姆尼欧美公司 | Nucleic acid sequencing methods and systems |
| CN110511991A (en) * | 2019-09-11 | 2019-11-29 | 胡志刚 | Extensive DNA chip technology |
Also Published As
| Publication number | Publication date |
|---|---|
| EP1389241B1 (en) | 2008-01-09 |
| JP4907498B2 (en) | 2012-03-28 |
| US9476094B2 (en) | 2016-10-25 |
| IL158743A0 (en) | 2004-05-12 |
| AU2002257933B2 (en) | 2006-08-10 |
| WO2002095070A3 (en) | 2003-09-18 |
| RU2003136429A (en) | 2005-05-27 |
| CA2447222A1 (en) | 2002-11-28 |
| RU2291197C2 (en) | 2007-01-10 |
| DE60224524D1 (en) | 2008-02-21 |
| BR0209841A (en) | 2006-02-07 |
| EP1389241A2 (en) | 2004-02-18 |
| NZ529349A (en) | 2006-10-27 |
| HK1061047A1 (en) | 2004-09-03 |
| DE60224524T2 (en) | 2009-01-08 |
| US20090029383A1 (en) | 2009-01-29 |
| CA2447222C (en) | 2012-09-18 |
| WO2002095070A2 (en) | 2002-11-28 |
| JP2004535800A (en) | 2004-12-02 |
| PT1389241E (en) | 2008-04-17 |
| IS7039A (en) | 2003-11-17 |
| US20040241678A1 (en) | 2004-12-02 |
| MXPA03010411A (en) | 2004-06-25 |
| DK1389241T3 (en) | 2008-05-26 |
| GB0112238D0 (en) | 2001-07-11 |
| KR20030094412A (en) | 2003-12-11 |
| JP2008104463A (en) | 2008-05-08 |
| JP4094961B2 (en) | 2008-06-04 |
| US20170022556A1 (en) | 2017-01-26 |
| ATE383442T1 (en) | 2008-01-15 |
| CN1537172B (en) | 2013-02-20 |
| ES2299569T3 (en) | 2008-06-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1537172A (en) | Polynucleotide sequencing method | |
| US6524829B1 (en) | Method for DNA- or RNA-sequencing | |
| JP2004535800A5 (en) | ||
| US7888073B2 (en) | Method for sequencing nucleic acid molecules | |
| US6982146B1 (en) | High speed parallel molecular nucleic acid sequencing | |
| AU2002257933A1 (en) | Polynucleotide sequencing method | |
| US9778188B2 (en) | Apparatus and method for detection and discrimination molecular object | |
| WO2001016375A2 (en) | High speed parallel molecular nucleic acid sequencing | |
| US20020123050A1 (en) | Apparatus and method for analysis of nucleic acids hybridization on high density NA chips. | |
| KR20120030116A (en) | Single-molecule detection system and methods | |
| CN101033485B (en) | Method of carrying parallel real-time quantitative detection to varies nucleic acid molecule | |
| Rubens et al. | Schneider et al. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| ASS | Succession or assignment of patent right |
Owner name: GEN-PROBE COMPANY Free format text: FORMER OWNER: MOBIUS BIOLOGICAL SYSTEMS INC. Effective date: 20110614 Owner name: RUIZHUWEIZHEN CO., LTD. Free format text: FORMER OWNER: MEDICAL BIOSYSTEMS LTD. Effective date: 20110614 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| COR | Change of bibliographic data |
Free format text: CORRECT: ADDRESS; FROM: DEVON, THE UNITED KINGDOM TO: KENT, THE UNITED KINGDOM Free format text: CORRECT: ADDRESS; FROM: KENT, THE UNITED KINGDOM TO: CALIFORNIA, THE USA |
|
| TA01 | Transfer of patent application right |
Effective date of registration: 20110614 Address after: American California Applicant after: Gen Probe Inc. Address before: Kent England Applicant before: Mobius Biological Systems Co.,Ltd. Effective date of registration: 20110614 Address after: Kent England Applicant after: Virgin Ruizhu Co.,Ltd. Address before: Devon Applicant before: Medical Biosystems Ltd. |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CX01 | Expiry of patent term | ||
| CX01 | Expiry of patent term |
Granted publication date: 20130220 |