CN1536086A - PCR method using genome DNA as template and its reaction liquor - Google Patents

Abstract

The present invention provides a PCR method by using genomic DNA hydrolyzed by restriction endonuclease as template and its reaction liquid. It utilizes the selection of 1-5 endonucleases having no cleavage site for target amplification sequence, specially uses the enzyme capable of identifying 4-6 base sequences to digest the template DNA, then directly continuous PCR method, so that it can prevent the introduction of indeterminate error factor in the process of using the methods of electrophoretic separation or probe hybridization to identify and detect product after PCR. It utilizes PCR instrument to implement reaction, its step is simple and easy to control, its detection specificity can be greatly raised, it is applicable to quickly analysis of nucleic acid sample and detection of micropathogen.

Description

A kind of genomic dna is the PCR method and the reaction solution thereof of template

Technical field

The present invention relates to Protocols in Molecular Biology, particularly relate to method and reaction solution thereof the polymerase chain reaction of genomic dna.

Technical background

Polymerase chain reaction (PCR) is a kind of simple, fast, and the method for the sensitive and single-minded specific DNA of amplification.Finishing the PCR reaction only needs common biochemical reagents and energy to get final product at three differing temps round-robin instruments, and comparing with the molecular biology other technologies is the simple utmost point.Each circulation of PCR reaction only needs 2-3 minute usually, can finish total overall reaction in 1-2 hour, and required time is 1/tens of other gene amplification methods.The PCR reaction product is the exponential manner accumulation, can amplify 8,000,000 times (2 through 25 circulations in theory ²³) only to detect the gene of several copies be very sensitive.Three advantages of this of PCR almost find no fault with also non-additive method can a ratio.PCR can amplify specific dna fragmentation and also deserve to be called single-minded really from thousands of genes.But standard P GR method is often followed in amplification target gene product and is formed non-single-minded product, sometimes seriously to stronger than target product even suppressed the formation of target product.So from the homogeneity angle of amplified production, standard pcr also exists severe problem aspect specificity.Just because of non-single-minded amplified production exists quite at large, just make behind PCR and to differentiate and to detect the target amplification product with methods such as electrophoretic separation or probe hybridizations and become routine and necessity.Detect step behind the PCR of this complexity and often expend much more time and labor, greatly influenced the widespread use of PCR on the medical science detection of nucleic acids than PCR itself.

The formation of non-single-minded amplified production is owing to be not very rigorous temperature, for example under the optimum temperuture that primer-design software is recommended, anneal, primer is not only annealed with the To Template that mates fully, thereby also can cause archaeal dna polymerase and start with some mispairing being arranged or even have the non-target mould of serious mispairing to anneal in proper order, form non-single-minded partly increase chain and initial non-single-minded amplified production.Because two sides of the initial non-single-minded amplified production that forms are mated fully with primer, non-single-minded product just can continue amplification with the efficient the same even higher with the target amplification product in circulation subsequently.Test shows under lower annealing temperature, even hold first Nucleotide generation mispairing still can finish amplification at 3 ' of primer; There are successive or at interval 2,3,4,5 or more mispairing also can finish amplification at the primer different sites.Scott etc. (Protocols for GeneAnalysis, Methods in Molecular Biology, 1991, P307) report comprises that when the primer base has 50% mispairing the mispairing of 3 ' end the 4th and 10-14 position also can finish amplification.In order to reduce and to eliminate non-single-minded amplified production and improve the PCR specificity, thereby can simplify the application that detection step behind the PCR and product sepn process enlarge PCR, develop multiple technologies and method, but bigger limitation and defective are all arranged.

Various primer-design softwares can be according to Theoretical Calculation, and various experiences and testing data are sought out those 3 ' end base internal stabilities from the order of input suitable, is lower than the primer of certain numerical value with the false combination rate of template order.But, various softwares can only compare and screen in the template successive range of thousands of bases, and total order of people and other higher organism genomic dnas is up to tens bases, the base number of the order that Input Software is analyzed be primer in reaction the actual order of facing 100,000/.So, the high preciseness primer that primer software is selected has overcome the primer 3 ' drawback that end is complementary and hairpin structure causes really, but often can not avoid higher coupling being arranged, say that from amplified production specificity angle the preferred primer of various primer-design software screenings has sizable randomness and blindness with non-target sequences.It is the problem that any original paper can not solve the non-single-minded product of Standard PC R.

Many investigators carry out homology analysis with BLAST to designed primer and the stored order of whole gene pool, in order to further judgement primer in the quality aspect combining with non-target sequences is false.But for the oligonucleotide about 20 bases order, the pointed DNA sequence homologous of BLAST be less than far away in fact may with the order of primer annealing, greatly influenced the actual use value of this method.

Various heat start PCR technology comprise prepares reaction soln at low temperatures, other compositions of archaeal dna polymerase etc. and reaction solution are separated with low melt point paraffin, with the Taq enzyme that contains antibody and with methods such as hot activation enzyme can effectively prevent those at room temperature primer combine initiation reaction with non-target sequences and the non-single-minded product that is directed at, but can not overcome under PCR reaction annealing temperature usually still the interference with the non-target sequences of primer bonded.

Determine the highest permission annealing temperature that PCR reacts with the gene-amplificative instrament that the thermograde function is arranged, being chosen in then increases under the annealing temperature that can efficiently highly increase and don't form non-single-minded band usually can obtain the ideal effect.But the optimum temperature range that Fu Nenghe requires is often very narrow, then can not find the formation that a suitable annealing temperature can be eliminated non-single-minded product fully sometimes.

Above method all is from improving the specificity that design of primers and reaction conditions angle improve PCR.The present invention has then adopted and diverse thinking of top the whole bag of tricks and angle.It is the restriction endonuclease of 4 bases that the present invention uses one or more restriction endonuclease, particularly recognition sequence that the amplified production order is not cut, genomic dna is cut into short-movie Duan Houzai carry out PCR.This method is the energy widespread usage simply, can effectively reduce or eliminate fully the non-single-minded amplified production that forms under common PCR reaction conditions, and application prospect is extensive.

Inventive concept

The present invention is based on following some principle and the fact:

1. one of prerequisite that non-single-minded amplified production forms is the coupling that higher degree is arranged respectively at the upstream and downstream of one section nucleic acid sequence and positive anti-primer.If between the false combining site of positive anti-primer, this nucleic acid sequence is cut into two or more fragment with restriction endonuclease, though it can not be that template is finished amplification with this nucleic acid sequence but that then positive anti-primer can be annealed respectively, the non-single-minded product that may form originally is miscarriage just.

2. another prerequisite that non-single-minded amplified production forms is to finish the extension of amplification chain in the set extension time.The extension time of Standard PC R is generally 30 seconds to 2 minutes kinds, no matter uses that a kind of archaeal dna polymerase multipotency in this time to extend about 2000 bases.Occur with just anti-primer matched probability in proper order is directly relevant with the length of order, order is than weak point as less than 500 bases, and the downstream has the possibility of matched just quite low with positive anti-primer simultaneously thereon.Order is long as surpass several thousand even several ten thousand bases, and the downstream has the possibility of matched just higher with positive anti-primer simultaneously thereon, but because the oversize extension that can not in 30 seconds to 2 minutes, finish chain of distance that positive anti-primer is separated by.So the non-single-minded product length of Standard PC R in fact mainly drops in the scope of 500 to 2000 bases.If the chance that genomic dna is cut into less than the long fragment of 500-2000 base then form non-single-minded product just reduces greatly.

3. be 4 to each specified recognition sequence, the restriction endonuclease of 5 or 6 bases, on average every 256,1024 or 4096 bases will occur once, in other words, genomic dna can be cut into the fragment that mean length is 256,1024 or 4096 bases with an above-mentioned restriction endonuclease in theory.Use simultaneously two or more restriction endonuclease particularly recognition sequence be the restriction endonuclease of 4 bases, just can make total order is that tens base pair mean lengths are that the DNA primary template of 50,000 bases cuts into the fragment that mean length is lower than the hundreds of base.Suppose that the total enzyme cutting average energy that is 3,000,000,000 base pairs are 4 bases with a recognition sequence then in proper order of genomic dna produces the small segment more than 1,000 ten thousand, those original upstream and downstream two sides exist and positive anti-primer matched order in this 1,000 ten thousand fragment, thereby the chance that may form non-single-minded product has been blocked by restriction endonuclease cutting because of order.

4. the different restriction endonuclease of business-like so far recognition specificity has kind more than 200, wherein, recognition sequence be 4 bases kind more than 20 also arranged, probability calculation and actual test all show in standard pcr amplification product length is 150-800 base scope, almost can both to find one or more recognition sequences be that the restriction endonuclease of 4 bases does not cut this amplification order to each amplified fragments, uses these restriction endonucleases just can keep the target gene complete segment when genomic dna is cut into small segment.

5. the condition that technically restriction endonuclease is reacted and PCR reacts has the compatible property of certain degree, so, genomic dna can be directly used in the PCR reaction after restriction endonuclease is handled, even can carry out enzyme earlier and cut and be converted to the PCR reaction then and can finish total overall reaction with the single tube operation in the PCR reaction tubes.Easy characteristics of the present invention make him have broad practice to be worth.

Summary of the invention

Invent technical problem to be solved

Technical problem to be solved by this invention provides the PCR method of making template with the genomic dna of restriction endonuclease hydrolysis, in amplification target gene product, often follow and form non-single-minded product, suppress the defective that target product forms to overcome standard pcr, avoid behind PCR differentiating and detect in the process of target amplification product and introduce uncertain error component with methods such as electrophoretic separation or probe hybridizations.

Technical scheme

Of the present invention is the polymerase chain reaction method of template with the genomic dna, in turn includes the following steps:

(1) selecting do not have the restriction enzyme of cleavage site that template DNA is carried out enzyme to the target amplification order cuts;

(2) template sex change;

(3) primer annealing;

(4) synthetic complementary dna chain is extended in archaeal dna polymerase catalysis down;

(5) step (2)-(4) circulation carrying out amplified reaction;

It is the enzyme of 4-6 base that above-mentioned restriction enzyme adopts recognition sequence, and preferred recognition sequence is the enzyme of 4 bases.Can in same endonuclease reaction, use 1-5 kind restriction enzyme, preferably use 2-4 kind restriction enzyme simultaneously.

Shift out template DNA after endonuclease reaction is finished, in another pipe, carry out PCR, also can in same reaction tubes, directly proceed the PCR reaction.

The method deactivation restriction enzyme of heating can be adopted after endonuclease reaction is finished,, also the PCR that directly continues can be do not heated such as 65-95 ℃ of heating 20 minutes.

Finish enzyme of the present invention in employing single reaction tube side method and cut in the technical scheme of reacting with PCR, endonuclease reaction liquid is identical with the PCR reaction solution; The 1-10% that total consumption volume of enzyme is a reaction volume.

Carry out enzyme of the present invention and cut the reaction solution of template DNA and polymerase chain reaction, it comprises following component: PCR damping fluid, 4 kinds of deoxyribonucleotides, hot resistant DNA polymerase, restriction enzyme and template DNAs, wherein total consumption volume of restriction endonuclease 1-10% that is reaction volume.

Be operating process and the principle thereof of understanding technique scheme, now be described as follows with regard to several committed steps:

The first, determine that at first it is the enzyme of 4 bases that the target amplification order is not had all restriction enzymes, particularly recognition sequence of cleavage site.

, order known amplified production definite for each primer, list those enzymes that the enzyme that target sequences is not cut, particularly recognition sequence are 4 bases with analysis of Restriction Endonuclease Profile software such as WebCutter2.0 (www.firstmarket.com/cutter/cut2.html) or NEBcutter1.0 (www.neb.com) etc.Table 1 is listed the principal character that 16 kinds of recognition sequences are the commercial restriction enzyme of 4 bases.The average frequency that occurs in nucleotide sequence according to any one specified 4 base sequence of probability is 1/256.To restriction endonuclease and specified 256 base nucleic acid sequences that a specified recognition sequence is 4 bases, maximum may be that a point of contact is arranged, but also may not have the point of contact or 2,3 or more point of contact are arranged.The software that we provide with New-England-Labs (www.neb.com) test chart 1 listed 16 kinds of enzymes are to 9 nucleic acid fragments that length is 128 bases from people actomyosin gene (gene pool numbering BC016045) picked at random, 9 nucleic acid fragments that length is 256 bases of picked at random from second exon (gene pool numbering AF136270) of human tumor suppressor gene P53, test with the nucleic acid fragment that 9 length of picked at random from the full mRNA of human RNA binding protein 2 genes (gene pool numbering NM 006267) are 512 bases, the statistics example of cutting situation is in table 2.

Table 1.16 kind of recognition sequence is the restriction enzyme of 4 bases

Sequence number	Title	Recognition sequence	Cleavage site
					In the order	Outside the order
			??1	??Aci?I			????CCGC		??-3/-1
??2	??Alu	????AGCT			????2
			??3	??Bfa?I			????CTAG	????1
??4	??BstU?I	????CGCG			????2
			??5	??Fat?I			????CATG	????2
??6	??Hae?III	????GGCC			????2
			??7	??Hha?I			????GCGC	????3
??8	??Hpa?II	????CCGG			????1
			??9	??HpyCH4?IV			????ACGT	????1
??10	??HpyCH4?V	????TGCA			????2
			??11	??Mbo?I			????GATC	????0
??12	??Mnl?I	????CCTC				??7/6
			??13	??Mse?I			????TTAA	????1
??14	??Rsa?I	????GTAC			????2
			??15	??Taq?I			????TCGA	????1
??16	??Tsp509?I	????AATT			????0

Table 2.16 kind of enzyme is to the cutting situation of the nucleic acid fragment selected at random

Test nucleic acid fragment length	Quantity with incision superius or the enzyme that do not cut is arranged
					Whether cut	Schwellenwert	Maximum	9 fragment mean values
	??128	Cutting	????2	??10					?5.8
Do not cut					????6	??14	?10.2
		??256	Cutting	????6				??11	?8.7
Do not cut	????5				??10	?7.3
			??512	Cutting			????8	??14	?10.2
Do not cut	????2	??8			?5.8

Table 2 explanation has at least 2 restriction endonucleases of listing in table 1 that testing sequence is not cut when testing nucleic acid sequence length when 500 bases are following, on average has the enzyme more than 5 that testing sequence is not cut.The enzyme of the short more not cutting sequence of nucleic acid sequence is just many more.

The second, with above-mentioned restriction endonuclease particularly recognition sequence be that the enzyme of 4 bases decomposes template DNA.

With one or several enzyme that target amplification order is not cut or their isozyme and template DNA insulation about 2 hours.Target amplification order DNA then is cut into the small segment that differs in size by complete other positions that remain genomic dna.The software test that we provide with NEB the listed 16 kinds of enzymes of table 1 the cutting situation analysis of Lamda phage be the results are shown in table 3, each data of perpendicular are that sequence goes out with the size of numerical value all in the table.

Table 3.16 kind of enzyme is to the cutting of Lamda phage

The statistical value sequence	The fragment sum	Maximum cutting fragment length (base)	Minimum cut fragment length (base)	Greater than 512 base fragments (%)	Greater than 1024 base fragments (%)
						??1	??14	??1086	??2	??1.9	??0.00
??2	??114	??1103	??2	??4.3	??0.19
						??3	??117	??1463	??2	??5.7	??0.36
??4	??122	??1596	??2	??6.3	??1.10
						??5	??144	??1669	??4	??6.6	??1.15
??6	??144	??2010	??5	??8.3	??1.85
						??7	??150	??2196	??5	??10.0	??2.13
??8	??158	??2225	??5	??11.5	??3.06
						??9	??182	??2234	??6	??14.7	??3.16
??10	??190	??2293	??6	??14.8	??3.33
						??11	??196	??2308	??6	??15.8	??5.26
??12	??216	??3042	??6	??16.7	??6.94
						??13	??262	??3386	??8	??23.8	??10.26
??14	??274	??4092	??12	??27.2	??10.66
						??15	??329	??5142	??12	??29.1	??12.28
??16	??517	??23947	??32	??57.1	??14.00
						Mean value	??196	??3737	??7	??15.9	??4.73

Table 3 explanation recognition sequence is that the Lamda phage that the enzyme of 4 bases can will contain 50,000 base pairs cuts into tens to a hundreds of fragment, and mean value is 196 fragments, and is very approaching with the segments 189 (48,506/256) of pressing randomly assigne calculating.With the people's gene group is that the 3000000000 base pairs restriction endonuclease enzyme that to calculate then a recognition sequence be 4 bases can on average resolve into genomic dna 1 over thousands of ten thousand fragment in proper order.Cut by enzyme and to have blocked those and all had higher complementary order to form the chance of non-single-minded product in these segmental upstream and downstream and positive and negative primer originally.Residual fragment great majority after the genomic dna enzyme is cut are short-movie sections, all have higher complementary possibility just quite low with positive anti-primer.Table 3 shows that the fragment greater than 500 bases on average accounts for 15% of total segments in the residual fragment, and on average only accounts for 5% greater than the fragment of 1000 bases.

The 3rd, determine to use simultaneously the restriction enzyme more than 2 kinds or 2 kinds.

From the appearance of the cleavage site of the various restriction endonucleases of macroscopic view is independently of one another unrelated.So, if use 2 simultaneously, 3,4 or 5 kind above-mentioned restriction endonuclease cut genomic dna, the target amplification order still can not be subjected to any enzyme cutting and keep it complete, but the non-target sequences in the genomic dna then is cut into more substantial shorter fragment, and the possibility of template that these small segments become non-single-minded amplification is just littler.If calculate by mathematics and to use 2 to 5 kinds of enzymes to decompose genomic dna, will be greater than the fragment ratio of 500 bases much smaller than 0.1%, and will be less than 0.001% greater than the segmental ratio of 1000 bases.Usually use 2-5 kind restriction endonuclease in order to reach preferably effect, these enzymes can effect successively under its optimum condition respectively.Easy and simple to handle in order to make, preferably use several enzymes to mix the method for effect simultaneously.The following fact is used several enzymes to have general real feasibility simultaneously.1. many restriction enzymes have the identical various isozyme (table 1) of recognition sequence, and the suitableeest effect damping fluid kind between the isozyme may be different, and this just provides more choice.2., in other kind damping fluids, often also show 100% vigor or quite high vigor (table 4) though each restriction endonuclease all has its suitableeest damping fluid kind.3. also finish cutting fully by increasing enzyme concentration or prolong enzyme that the reaction times can make some act in the suitableeest non-damping fluid to template.

The technical data that it is the restriction endonuclease of 4 bases that table 4 is listed 16 kinds of recognition sequences.

The main technical data of table 4.16 kind of enzyme

The enzyme title	Relative vigor in different damping fluids				Optimum temperature	The maximum vigor (U/ul) of commodity	The quantity of the enzyme that recognition sequence is identical
								NEB damping fluid label
	??1	??2	??3	??4
								??Aci?I	??25	??50	??100	??50	??37	??10	??1
??Alu	??100	??100	??75	??100	??37	??10	??8
								??Bfa?I	??75	??50	??10	??100	??37	??5	??0
??BstU?I	??100	??100	??50	??100	??37	??10	??5
								??Fat?I	??10	??100	??50	??50	??37	??10	??2
??Hae?III	??50	??100	??25	??75	??37	??50	??4
								??Hha?I	??75	??100	??100	??100	??37	??20	??6
??Hpa?II	??100	??50	??10	??100	??37	??50	??3
								??HpyCH4?IV	??100	??25	??10	??100	??37	??10	??3
??HpyCH4?V	??50	??50	??25	??100	??37	??5	??1
								??Mbo?I	??75	??100	??100	??100	??37	??25	??8
??Mnl?I	??75	??100	??50	??75	??37	??5	??0
								??Mse?I	??75	??100	??75	??75	??37	??20	??2
??Rsa?I	??100	??100	??50	??100	??37	??10	??2
								??Taq?I	??50	??75	??75	??75	??65	??100	??1
??Tsp509?I	??100	??100	??100	??NR	??65	??10	??3

Table 4 explanation to any one specified amplified production by selecting enzyme and their isozyme, be not difficult to find a kind of damping fluid make employed 2,3,4 or the enzyme of 5 kind of different recognition sequence all show maximum or higher vigor.Even see that from principle of the present invention a certain or several enzymes fail to have given play to best effect when the hydrolysis template DNA, in fact negative impact also not necessarily arranged to overcoming and eliminating non-single-minded product.

The 4th, mix the restriction of the quantity of the enzyme that uses.

In theory without limits, but consider from aspects such as necessity, accessibility and effects to the quantity of the enzyme that mix to use, general mix the enzyme that uses should not be above 5 kinds.In order to keep the stability of restriction endonuclease between the shelf lives, commercialization restriction endonuclease solution all contains 50% glycerine, and cut the liquid glycerol concentration greater than 5% the time when enzyme, a part of restriction enzyme may cut the site beyond the normal point of contact, so-called " star vigor " promptly occur.Be directed at and may no matter use a kind of or several restriction endonuclease to the cutting of To Template for fear of this phenomenon, total consumption volume of enzyme should be no more than 10% of reaction volume.Table 5 is listed the preparation when the enzyme that uses reaction solution during from the 1-5 kind.Wherein the dosage of DNA is according to the concentration and the decision of PCR reaction solution desired concn of template DNA.When being template with the higher organism genomic dna, the dosage of template DNA is generally per 50 microlitre PCR reaction solution 0.2-1 micrograms.Table 5 is listed the preparation that enzyme is cut solution when using 1-5 kind restriction endonuclease.

The preparation of table 5. restriction endonuclease reaction solution

Restriction enzyme enzymatic hydrolysis reaction liquid composition	Use the kind number of restriction endonuclease
						????1	????2	????3	????4	????5
	Restriction endonuclease damping fluid (ul)	????1	????1	????1	????1						????1

Template DNA (ul)	??1-5	??1-5	??1-5	??1-5	??1-5
						Each restriction endonuclease (ul)	??0.2-1	??0.2-0.5	??0.2-0.33	??0.2-0.25	??0.2
Deionized water (ul)	??3-7.8	??3-7.6	??3-7.4	??3-7.2	??3-7
						Cumulative volume (ul)	??10	??10	??10	??10	??10

The 5th, the template that can directly react after endonuclease reaction liquid is finished as PCR.

The reaction solution that contains the genomic dna endonuclease bamhi can make enzyme deactivation in 20 fens kinds of 65 ℃ of insulations, perhaps directly adds the PCR reaction solution and starts reaction.Table 6 lists that representational PCR reaction buffer is formed and 4 kinds of damping fluids of NEB are made, and when pressing table 5 and operating to the influence of PCR reaction solution.

Table 6.PCR and endonuclease reaction liquid are formed

Endonuclease reaction liquid composition	Concentration in hydrolysis reaction				Bring to the concentration of PCR reaction				The PCR reaction solution concentration
										The damping fluid label				The damping fluid label
	??1	??2	??3	??4	??1	??2	??3	??4
										Buffer concentration (mM)	??10	??10	??50	??20	??2	??2	??10	??4	??40
PH of buffer	??7	??7.9	??7.9	??7.9	??7	??7.9	??7.9	??7.9	??8.7
										Magnesium ion concentration (mM)	??10	??10	??10	??10	??2	??2	??2	??2	??3.5
Mercaptoethanol (mM)	??1	??1	??1	??1	??0.2	??0.2	??0.2	??0.2	??0
										Potassium ion (mM)	??0	??0	??0	??50	??0	??0	??0	??10	??15

The strong 4-20 that the strength ratio that table 6 shows the PCR reaction buffer is brought into from endonuclease reaction doubly, pH can not be subjected to detectable or remarkable influence.Enzyme cut anti-with magnesium ion, potassium ion and mercaptoethanol concentration low and PCR do not had negative impact.The composition and the table 6 of the various damping fluids that company such as Promega and Roche is recommended are described similar, also all can be directly used in the PCR reaction behind endonuclease reaction.The potassium or the sodium salt that also contain 50-300mM in the restriction endonuclease solution of different company's product, 10mM damping fluid, the albumin of 0.1mMEDTA and 200-500ng/ml.Be no more than at the total consumption of enzyme under the situation of endonuclease reaction liquid long-pending 10%, reaction does not have negative impact to PCR.

The 6th, endonuclease reaction can directly carry out in the PCR reaction solution.

In the research of PCR clone and PCR-restriction enzyme length polymorphism (PCR-RFLP) etc., usually after PCR reacts, directly add restriction enzyme and decompose amplified fragments, illustrate restriction endonuclease also can be in the PCR reaction solution decomposing D NA.The research of NEB company is pointed out to contain 1 micrograms of DNA at 20 microlitres, 1 Vent-DNA of unit polysaccharase, the restriction enzyme that adds 5U in the PCR reaction solution of dNTPs and damping fluid various compositions such as (pH8.8), comprise in 13 kinds of enzymes of listing in table 1 having 8 kinds DNA is decomposed fully at after measured nearly hundred kinds of restriction endonucleases, 5 kinds of enzymes also can decompose about 50% DNA in addition.Comprise genomic dna containing various compositions, primer adds one or more selected restriction endonucleases with the PCR reaction solution kind that contains the TaqDNA polysaccharase of antibody, earlier 37 ℃ of insulations switched to common PCR response procedures in 2 hours then in gene-amplificative instrament, can finish enzyme and cut with PCR and react.

Beneficial effect

1. reagent required for the present invention has that commodity selling is simple to operate not to need to grope reaction conditions yet, but can effectively reduce or eliminate the non-single-minded product that standard pcr can form usually.

2. the present invention can extensively generally be employed, and both can use in the 150-800 base of standard pcr amplification product length range, can extend to shorter or longer product again.Should consider that selection of primers makes amplified production include the restriction endonuclease of the not cutting sequence of some amount in proper order when being applied to long amplified production.

3. the present invention does not have particular requirement to design of primers and PCR reaction conditions, only adds enzyme and cut step and get final product under original primer and PCR condition.

4. the present invention couple variously improves narrow spectrum technology of Standard PC R such as warm start with other, and nested PCR etc. are compatible fully.Application the present invention does not influence other The application of new technique can increase present technique again on every new technology.

5. the present invention improves the principle that the PCR specificity is based on a kind of randomness, except needs are known the order of target amplification product, and other diversity of settings and the data of the object that do not need to consider to increase.

6. length is that the macromole DNA of several ten thousand bases becomes single stranded DNA behind denaturing step, and primer annealing or self-annealing between have complicated sterie configuration.Between the annealing position of archaeal dna polymerase and primer and target dna, may exist steric hindrance that the initial of amplification is suppressed at the beginning of the PCR reaction.Though but archaeal dna polymerase can not exclusively mate at some and primer but not have sterically hindered non-target sequences combining site and cause amplification.Restriction enzyme cuts into small segment with macromole nucleic acid, makes the target of primer and fully exposes with the combining site of non-target sequences, thereby give full play to primer and matching order bonded advantage fully.

Embodiment

Embodiment 1.

Non-single-minded product forms relevant with the complicacy of template DNA.

Present embodiment uses the special primer that finds from people actomyosin gene (1841 base pairs, gene pool numbering BC016045) to test.The positive identical primer of anti-primer is 5 ' GCCCAGCGGGTGACGATGCC 3 ' in proper order, 82.9 ℃ of the melting temperature(Tm)s of primer, and 3 ' end base complementrity is 2 Nucleotide, and energy is every mol-3.1 kilocalorie, and primer 3 ' end base internal stability degree is 9.6.The 134-153 of the moving ball protein-2 genes of primer and people's flesh has 16 coupling bases and 4 base mismatch in proper order, and the joint efficiency of primer and template is 349 points.This primer has 17 coupling bases and 3 base mismatch with the complementary order of the 295-314 position of the moving ball protein-2 genes of people's flesh again simultaneously, and the joint efficiency of primer and template is 356 points.The amplified production length of using this primer to obtain with complementary DNA is 181 bases, because the amplified production order is in same exon, so be the amplified production that template can obtain equal length with genomic dna.Present embodiment is that the complementary DNA that the primer reverse transcription obtains is a template with the human gene group DNA with by people's total tissue RNA with poly (dT) respectively with this primer, does the formation of the more non-single-minded product of PCR under identical condition.The human gene group DNA is every microlitre 0.2 microgram of Roche company product.Total RNA is every microlitre 1.0 micrograms of ClonTech product, with the synthetic complementary DNA of the reverse transcription test kit of the said firm.No matter genomic dna still is a complementary DNA is all increased with the Advantage2-PCR test kit of ClonTech company.Per 50 microlitre reaction solution gene mentation group DNA or complementary DNA 5 microlitres.The primer final concentration is 0.8uM.The PCR reaction parameter: 94 ℃ of sex change first 1 minute, 94 ℃ of circulation sex change 10 seconds, anneal 52-72 ℃ 1 minute, extend 72 ℃ 1 minute, cycle number 30, every tube reaction volume is 5 microlitres.Test-results is listed in table 7.

Table 7. embodiment 1 test-results

Template DNA	Annealing temperature (℃)	52.0	??55.2	??57.5	??60.4	??63.8	??66.6	??68.8	??70.4	??72.0
											Complementary DNA	Target product	## #	??## ??#	??## ??#	??## ??#	??## ??#	??## ??#	??## ??#	??## ??#	??## ??#
Non-single-minded product	+++	??+++	??++	??++	??+	??-	??-	??-	??-
										Genomic dna		Target product	-	??-	??-	??-	??#	??##	??#	??-	??-
Non-single-minded product	+++	?+++	??+++	??+++	??+++	??++	??++	??+	??-

How many #:# represents the intensity of target stripe

+ :+what of non-single-minded band number how much represented

-: expression does not have band

Complementary DNA does not contain the gene order of not expressing, and does not contain the intron order yet, and its total order amount is about 1/10th of genomic dna.When being template with the complementary DNA, table 7 explanation, all can effectively increase wide the reaching in 20 ℃ the annealing region of being tried because template DNA is more higher again than genomic dna simple target template relative abundance.Non-single-minded product raises with temperature and reduces, when annealing temperature non-single-minded product completely dissolve during greater than about 67 ℃.Though a large amount of non-single-minded products arranged when annealing temperature is low but all do not compete the amplification that suppresses target product.Non-single-minded product is synthetic under same reaction part when being template with the genomic dna wants much serious.Than the formation of non-single-minded products a large amount of under the low temperature thermal oxidation even suppressed the amplification of target product fully, non-single-minded product amplification decreases under higher anneal temperature, but still is better than the target amplification product.The complicacy of this results suggest reduction genomic dna might be improved the specificity of PCR.

Embodiment 2.

Various restriction enzymes are cut test to the enzyme of genomic dna.

Some kinds of enzyme independent, 2 kinds or 3 kinds of enzyme mixed decomposition genomic dnas that recognition sequence is the 4-6 base have been selected, each reaction tubes total reaction volume 10 microlitre, every pipe gene mentation group DNA2 microlitre includes people and each 0.5 microgram of mouse gene group DNA, deionized water 6 microlitres, damping fluid 1 microlitre.The dosage of damping fluid kind and restriction endonuclease is listed in table 8.Be incubated 2 hours at 37 ℃ and use ethidium bromide staining then with the 1%Agarose gel electrophoresis, with the scanning intensity distribution of Quantimet mensuration different zones, test and calculation result the results are shown in table 9.

Table 8. restriction enzyme decomposes the reaction solution of genomic dna and forms

Numbering	The enzyme title	Recognition sequence	Product company	The damping fluid kind	Enzyme dosage (microlitre)
						??1	??BamH?I	????GGATCC	??Roche	??B	??1
??2	??Hinf?I	????GANTC	??Roche	??H	??1
						??3	??Mbo?I	????GATC	??Promega	??C	??1
??4	??Hae?III	????GGCC	??Promega	??C	??1
						??5	??Alu?I	????AGCT	??NEB	??2	??1
??6	??HpyCH4?V	????TGCA	??NEB	??4	??1
						??7	??Mbo?I	????GATC	??Promega	??C	??0.5
??Hae?III	????GGCC	??Promega	??C	??0.5
					??8		??HpyCH4?V	????TGCA	??NEB	??4	??0.33
??Hha?I	????GCGC	??NEB	??4	??0.33
						??Sac?II	????CCGCGG	??NEB	??4	??0.33
??9	??HpyCH4?V	????TGCA	??NEB	??4							??0.25
					??Hha?I	????GCGC	??NEB	??4	??0.25
	??Sac?II	????CCGCGG	??NEB	??4						??0.25
					??Alu	????AGCT	??NEB	??4	??0.25

Table 9. embodiment 2 test-results

	Test number	The length nucleic acid of scanning area (is unit with 1000 bases)
										????＞50 *	????10-50	??5-10	???2-5	??1-2	????0.5-1	????0.25-0.5	??＜0.25
		Relative scanning intensity	??1	????10	????25	??21	???20	??15	????6.0									????2.0	??1.7
??2	????5.8									????11	??6.2	???9.4	??24	????22	????12	??9.4
			??3	????5.4	????11	??6.3	???11	??24	????21								????13	??9.4
??4	????5.2									????8.8	??5.8	???12	??24	????21	????12	??12
			??5	????6.0	????11	??6.7	???7.2	??19	????20								????15	??15
??6	????1.9									????8.2	??6.0	???6.2	??19	????25	????18	??16
			??7	????4.3	????8.3	??5.5	???4.0	??18	????24								????17	??20
??8	????1.1									????3.0	??4.5	???0.7	??17	????26	????22	??26
			??9	????1.1	????0.5	??4.8	???0.0	??7.4	????13								????25	??48
Be calculated as relative mole number**	??1									????0.4	????1.8	??5.9	???12	??21	????17	????11			??30
		??2	????0.1	????0.2	??0.5	???1.7	??10	????19	????21								??48
	??3									????0.1	????0.2	??0.5	???1.9	??10	????18	????21		??48
		??4	????0.1	????0.2	??0.4	???1.9	??9.2	????16	????18								??54
	??5									????0.1	????0.2	??0.4	???1.0	??6.4	????13	????20		??59
		??6	????0.0	????0.1	??0.4	???0.8	??5.8	????15	????21								??58
	??7									????0.0	????0.1	??0.3	???0.5	??4.8	????13	????18		??63
		??8	????0.0	????0.0	??0.2	???0.1	??3.5	????11	????18								??67
	??9									????0.0	????0.0	??0.1	???0.0	??1.0	????3.6	????14		??81

^*Nucleic acid near point sample groove zone

^*Calculate with the intensity of scanning area arithmetical av divided by this zone length nucleic acid

Table 9 explanation is that the BamHI of 6 bases decomposes genomic dna with recognition sequence, and degradation production mainly is than macromole DNA, and segmental scanning intensity accounts for 90% of total intensity more than 1000 bases.With recognition sequence is the restriction endonuclease decomposing D NA of 4 bases, mainly is small molecule DNA after the cutting then, accounts for the 40-60% of total intensity less than the scanning intensity of the DNA of 1000 alkali.The fragment that several enzymes act on then simultaneously and produced is littler, with Sacll (6 bases of recognition sequence) and 3 enzyme combined action that recognition sequence is 4 bases, accounts for 95% of total segments less than the segments of 500 bases.

Embodiment 3.

The genomic dna enzyme is cut back pcr amplification people glyceraldehyde-3-phosphate dehydrogenase gene.

(1283 base pairs, gene pool numbering XM 006959) obtains the good primer of a pair of preciseness by primer-design software from people's glyceraldehyde-3-phosphate dehydrogenase gene, and its order and characteristic are listed in table 10 and 11, and the length of amplified production is 348 bases.

Table 10. embodiment 3 primers order

Primer	The position	(5 ' to 3 ') in proper order
			Positive primer	??573-591	????CAA?CTT?TGG?TAT?CGT?GGA?A
Anti-primer	??904-920	????ACC?ACC?TGG?TGC?TCA?GT

Table 11. embodiment 3 primer characteristics

Primer	Length	Melting temperature(Tm) (℃)	The primer joint efficiency		3 ' end complementary base radix		Hairpin structure base number	The internal stability degree
									Combine with target	Maximum false combination	Self	With another primer
			Positive primer	??19	??63.0	??383							?134	??2	??2	??＜2	??8.5
Anti-primer	??17	??63.2					??353	?117	??2	??2	??3	??6.5

The recognition sequence that obtains that this amplified production is not cut with NEBCutter1.0 is that the restriction endonuclease of 4 bases has Bfal, Taql, Hhal, Mbol, Rsal, and Tru9l.The back 4 kinds of enzymes of this example use mix and decompose the human gene group DNA, and enzyme decomposed solution composition is listed in table 12.

Table 12. embodiment 3 enzyme decomposed solution are formed

NEB damping fluid 2	Human gene group DNA's (0.2 microgram/microlitre)	Hha I (20 units/microlitre)	Mbo I (10 units/microlitre)	Rsa I (10 units/microlitre)	Tru9 I (10 units/microlitre)	Deionized water	Cumulative volume
								2 microlitres	10 microlitres	0.5 microlitre	0.5 microlitre	0.5 microlitre	0.5 microlitre	6 microlitres	20 microlitres

37 ℃ of insulations 2 hours, 65 ℃ of heating made enzyme deactivation in 20 minutes then with above-mentioned reaction solution, the per 50 microlitre PCR reaction solution gene mentation group DNA5 microlitres of control group, and test group adds above-mentioned enzyme decomposed solution 10 microlitres, includes the genomic dna that is equivalent to 5 microlitres.The composition of PCR reaction solution is identical with embodiment 1 with reaction conditions, and positive and negative primer concentration is 0.4uM.PCR uses polyacrylamide gel electrophoresis after finishing, and with the intensity of using image reading apparatus evaluating objects band and non-single-minded band behind the ethidium bromide staining, test-results is listed in table 13.

Table 13. embodiment 3 test-results

Template DNA	Scanning intensity rate (target product/non-single-minded product)	Annealing temperature (℃)
											??52.0	??55.2	??57.5	??60.4	??63.8	??66.6	??68.8	??70.4	??72.0
		Control group	??348bp/ ??1-1.5kb	??0.27	??0.31	??0.26	??0.32	??1.27	??1	??-										??-	??-
??348bp/ ??0.5-1.0Kb	??0.19										??0.18	??0.19	??0.23	??0.44	??0.62
			Test group	??348bp/ ??1-1.5Kb	??1.8	??2.8	??3.8	??4.8	??9.8	??194									??-	??-	??-
??348bp/ ??0.5-1.0Kb	??0.32	??0.42									??0.44	??0.47	??0.68	??0.90	??-	??-	??-

-: there is not the target amplification band

The above results explanation reduces with the annealing temperature non-single-minded product that raises, and when annealing temperature does not have non-single-minded product band during greater than 69 ℃, but the target product band also disappears.When annealing temperature is 52-67 ℃, the control group of ordinary method has serious non-single-minded product to form in the 500-1500 base zone, under low temperature thermal oxidation, the total amount of non-single-minded product or even target product several times, genomic dna through after the restriction endonuclease hydrolysis in the examination annealing region non-single-minded product relative quantity all than the remarkable minimizing of control group.When annealing temperature was higher, length was that the non-single-minded product of 1000-1500 base almost completely disappears, and has highlighted the restriction endonuclease hydrolysis to blocking the effect of the non-single-minded product of this section length.

Embodiment 4.

The genome enzyme is cut the amplification of back amplification people beta-2-adrenergic receptor gene.

Obtain the good primer of a pair of preciseness from people's beta-2-adrenergic receptor gene (3451 base pairs, gene pool numbering M15169) by primer-design software, its order and characteristic are listed in table 14 and 15, and the length of amplified production is 252 bases.

Table 14. embodiment 4 primers order

Primer	The position	(5 ' to 3 ') in proper order
			Positive primer	??1574-1589	??CCA?GAC?TGC?GCG?CCA?T
Anti-primer	??1805-1825	??GAT?CAG?CAC?AGG?CCA?GTG?AAG

Table 15. embodiment 4 primer characteristics

Primer	Length	Melting temperature(Tm) (℃)	The primer joint efficiency		3 ' end complementary base radix		Hairpin structure base number	The internal stability degree
									With target	Maximum false combination	Self	With another primer
			Positive primer	??16	??72.0	??495							??132	??2	??2	??＜2	??9.6
Anti-primer	??21	??71.8					??437	??113	??＜2	??2	??3	??7.0

Do not cut the zymogram of target sequences with WebCutter2.0, select for use 2-5 kind enzyme to decompose genomic dna respectively.Table 16 is listed in the preparation of enzyme decomposed solution.

The preparation of table 16. embodiment 4 enzyme decomposed solution

	Test A	Test B	Test C
				Genomic dna (0.2 microgram/microlitre)	10 microlitres	10 microlitres	10 microlitres
NEB damping fluid 2	2 microlitres	2 microlitres	2 microlitres
				Alu I (10 units/microlitre)	0.5 microlitre	0.5 microlitre	0.4 microlitre
Rsa I (10 units/microlitre)	0.5 microlitre	0.5 microlitre	0.4 microlitre
				Hinf I (10 units/microlitre)	??-	0.5 microlitre	0.4 microlitre
Fok I (10 units/microlitre)	??-	??-	0.4 microlitre
				Tru9 I (10 units/microlitre)	??-	??-	0.4 microlitre
Water	7 microlitres	6.5 microlitre	5.5 microlitre
				Cumulative volume	20 microlitres	20 microlitres	20 microlitres

The enzyme decomposition condition, test group is formed all identical with embodiment 3 with reaction conditions with the PCR reaction solution of control group.Test-results is listed in table 17.

Table 17. embodiment 4 results

Annealing temperature (℃)	Enzyme is not cut contrast		Test A		Test B		Test C
									Target stripe intensity	Non-single-minded band number	Target stripe intensity	Non-single-minded band number	Target stripe intensity	Non-single-minded band number	Target stripe intensity	Non-single-minded band number
	??52.0	??+	??20	??+++	??14	??+++	??6	??+++									??4
??55.2									??+	??20	??+++	??14	??+++	??6	??+++	??4
	??57.5	??++	??20	??+++	??14	??+++	??6	??+++									??4
??60.4									??+++	??16	??+++	??14	??+++	??1	??+++	??0
	??63.8	??+++	??13	??+++	??12	??+++	??1	??+++									??0
??66.6									??+++	??6	??+++	??8	??+++	??1	??+++	??0
	??68.8	??+++	??1	??+++	??3	??+++	??1	??+++									??0
??70.4									??+++	??1	??+++	??0	??+++	??0	??+++	??0
	??72.0	??+++	??1	??+++	??0	??+++	??0	??+++									??0

No matter control group still is a test group to table 17 presentation of results under the 52-72 that is tried ℃ annealing temperature amplified production all, but control group all has detectable non-single-minded band under arbitrary test temperature, under low temperature thermal oxidation, a large amount of non-single-minded products are to the competition of primer even obviously influenced the intensity of target amplification product.The quantity of non-single-minded product raises with annealing temperature and reduces in each test group, also reduce with mixing the restriction endonuclease kind increase of using, when using 5 kinds of enzymes such as Alul, in 60-72 ℃ annealing region, all obtain strong target product band and do not have any non-single-minded product band.

Embodiment 5.

Restriction endonuclease hydrolysis reaction and PCR carry out at same pipe.

The PCR primer of embodiment 5 is identical with embodiment 4 with reaction conditions, but every reaction tubes volume is 10 microlitres.The kind of the enzyme of decomposition genomic dna is identical with the test C of embodiment 4, i.e. the restriction endonuclease that is 5 or 4 bases with 5 kinds of different recognition sequences.Restriction endonuclease directly is added in the PCR reaction solution, and per 100 microlitre PCR reaction solutions add each restriction endonuclease 1 microlitre, and the concentration of other moietys of PCR reaction solution is all constant.37 ℃ of insulations of elder generation are 2 hours on gene-amplificative instrament, change conventional PCR program then over to.Test-results is listed in table 18.

Table 18. embodiment 5 results

Annealing temperature (℃)	??52.0	??55.2	??57.5	??60.4	?63.8	??66.6	??68.8	??70.4	??72.0
										Target product	??++	??++	??++	??+++	?+++	??+++	??+++	??+	??-
Non-single-minded product	??-	??-	??-	??-	?-	??-	??-	??-	??-

+: positive band, its quantitaes intensity

-: feminine gender

Table 18 explanation restriction endonuclease in the PGR reaction solution still exhibits vigour, and is formed with positive effect to overcoming non-single-minded product.

Claims (10)

1. one kind is the polymerase chain reaction method of template with the genomic dna, in turn includes the following steps:

(1) selecting that the restriction enzyme that the target amplification order does not have a point of contact is carried out enzyme to genomic dna cuts;

(2) template sex change;

(3) primer annealing;

(4) synthetic complementary dna chain is extended in archaeal dna polymerase catalysis down;

(5) set by step (2)-(4) circulation carrying out amplified reaction.

2. polymerase chain reaction method according to claim 1 is characterized in that restriction enzyme is that recognition sequence is the enzyme of 4-6 base.

3. polymerase chain reaction method according to claim 1 and 2 is characterized in that restriction enzyme is that recognition sequence is the enzyme of 4 bases.

4. polymerase chain reaction method according to claim 1 is characterized in that using 1-5 kind restriction enzyme in same reaction.

5. according to claim 1,2 or 4 described polymerase chain reaction methods, it is characterized in that in same reaction, using 2-4 kind restriction enzyme.

6. according to each described polymerase chain reaction method in the claim 1,2 or 4, it is characterized in that shifting out after endonuclease reaction is finished that template DNA carries out PCR or directly carry out the PCR reaction in same reaction tubes.

7. according to each described polymerase chain reaction method in the claim 1,2 or 4, it is characterized in that endonuclease reaction finishes post-heating deactivation restriction enzyme.

8. according to each described polymerase chain reaction method in the claim 1,2 or 4, it is characterized in that endonuclease reaction liquid is identical with the PCR reaction solution.

9. according to claim 1 or 8 described polymerase chain reaction methods, the 1-10% that the total consumption volume that it is characterized in that restriction endonuclease is a reaction volume.

10. carry out the reaction solution of the described polymerase chain reaction of claim 1, comprise following component:

PCR damping fluid, 4 kinds of deoxyribonucleotides, hot resistant DNA polymerase, restriction enzyme and template DNAs, the 1-10% that the total consumption volume that it is characterized in that restriction endonuclease is a reaction volume.