CN1523107A

CN1523107A - Gene sequence of luteolin biosynthetic regulatory factor in pseudomonas M18

Info

Publication number: CN1523107A
Application number: CNA031509053A
Authority: CN
Inventors: 许煜泉; 黄显清
Original assignee: Shanghai Jiaotong University
Current assignee: Shanghai Jiaotong University
Priority date: 2003-09-11
Filing date: 2003-09-11
Publication date: 2004-08-25

Abstract

The present invention relates to a gene sequence of pyoluteorin biosynthetic regulatory factor in pseudomonad M18, belonging to the field of gene technology. Said gene sequence is characterized by that the proximity to N end of amino acid sequence of biosynthetic regulatory factor gene coded protein has the characteristic sequence of bacterial regulatory protein TetR family; G-[LIVFYS)-x(2,3-)-[TS]-[LIVMT]-x(2)-[LIVM]-x(5)- [LIVQS]-[STAGENQH]-x-PA[GPAR]-x-[LIVMF]-[FYST]-x-[HFY]-[FV]-x- [DNST]-K-x(2)-[LIVM]. Said conservative region contains helix-turn-helix (HTH) motif with combined DNA activity, and said gene belongs to a member of bacterial regulatory protein TetR family, 5' leader region 92 bp, SD sequence containing said gene and promotor region (-35 sequence and -10 sequence). Said invention can be used for constructing high-yield engineering strain of PIt so as to raise biological control capacity of M18.

Description

The gene order of the pyoluteorin biosynthetic controlling factor in the pseudomonas M 18

Technical field

The present invention relates to a kind of gene order of the biosynthetic controlling factor, the gene order of the pyoluteorin biosynthetic controlling factor belongs to the gene engineering field in especially a kind of pseudomonas M 18.

Background technology

(Gaeamauuomyces gramiais var.tritici Ggt) has significant inhibitory effect to PCA, and Plt has very strong prevention effect to cotton, the black leg of beet that ultimate corruption mould (Pythium ultimum) causes to gaeumannomyces graminis.The M18 bacterial strain is secreted the different microbiotic of two classes, has enlarged the antimicrobial spectrum of this biocontrol microorganisms, through exsomatize, potted plant inoculation and field experiment result for many years show that M18 has significant preventive and therapeutic effect to gummy stem blight of melon and cucumber fusarium axysporum plant pathogenic fungi.Brian Nowak-Thompson and Joyce E.Loper etc. have reported Plt biological synthesis gene cluster (" the bacteriology magazine " 1999 of AAM of Pseudomonas fluorescens strain Pf-5,181:2166-2174), the Plt output of Pf-5 wild type strain only is 5.3 ± 1.2ug/ml (" using and the environmental microbiology magazine " 2000 of AAM, 66:2718-2725), Plt output is low is the biological control ability of restriction Pseudomonas fluorescens strain Pf-5 and the important factor of widespread use thereof.The related pltZ gene of this patent is to be positioned at M18 bacterial strain Plt gene cluster downstream, new negative regulator gene of inhibition Plt synthetic, the mutant strain of this gene up to 150ug/ml, is 30 times of Pf-5 bacterial strain Plt output of bibliographical information 72 hours Plt output.Therefore, the discovery of negative regulator gene pltZ provides an important techniques approach to improving Plt output and biological control ability thereof.

Summary of the invention

The object of the present invention is to provide the gene order of the pyoluteorin biosynthetic controlling factor in a kind of pseudomonas M 18, pseudomonas M 18 (Pseudomonas sp.M18) is to separate a kind of plant growth-promoting rhizosphere bacteria (PGPR) that obtains from the beet rhizosphere soil, it can secrete two kinds of dissimilar antimycotic secondary metabolites, phenazine-1-carboxylic acid (PCA, azophenlyene class microbiotic) and pyoluteorin (Plt, polyketide).In a pseudomonas strain, secrete the different microbiotic of this two class simultaneously, this gene provides a technological approaches for improving pyoluteorin output and biological control ability, and similar report is at home and abroad also never arranged in the document.

The present invention realizes according to following technical scheme, near the characteristic sequence that has bacterium modulin TetR family the aminoacid sequence N end of biosynthetic controlling factor gene coding protein of the present invention: G-[LIVMFYS]-x (2,3)-[TS]-[LIVMT]-x (2)-[LIVM]-x (5)-[LIVQS]-[STAGENQH]-x-PA[GPAR]-x-[LIVMF]-[FYST]-x-[HFY]-[FV]-x-[DNST]-K-x (2)-[LIVM], this conservative region comprises one and has the motif in conjunction with the active helix-turn-helix of DNA (HTH), this gene belongs to a member of bacterium modulin TetR family, 5 ' leader 92bp comprises the SD sequence of this gene and promoter region (35 sequences and-10 sequences).Described gene is a new gene of finding from M18 genomic library screening plt gene cluster and sequencing analysis process.This gene 743bp has the open reading frame of a 651bp, 216 amino acid of encoding, and 5 ' leader 92bp comprises the SD sequence and the promoter region (35 sequences and-10 sequences) of this gene.In GenBank, carry out the protein sequence homology and search element, near members such as TetR, the AcrR in discovery pltZ proteins encoded and the bacterium modulin family, PsrA sequence N ' end has certain homology, in Pfam (protein families database) and PROSITE database, carry out homology and search element, find that near the sequence of pltZ proteins encoded N ' end has the characteristic sequence of bacterium modulin TetR family.Therefore the pltZ gene belongs to the new gene of bacterium modulin TetR family (Pfam accession number PF00440, Prosite accession number PS01081).

The dna sequence dna of pltZ gene is:

Promoter sequence

ACAGACAATCGCCCTTATCAAC

The SD sequence

CCCCTGACAG TCCC

AGCACACGACGCCGCACCCCACGAAGCGACGGCGAAAGTACCCGCGCAC

GGATTCTCGAAGTCGCCGGCCGGCTGTTCGCCCAGCACGGTTATGCCAATACCGCCAGCAAGGCCATCTGCG

AGGAAGCTGGGGCCGACCTTGCCGCGATCAACTACCATTTCGGTAGCCGCGACGCCTTGTACAAGGCGGTGC

TGGTCGAAGGACACAAGCAGTTCGTCAGCCTGCACGACCTCCGCGAACTGGCGGATAGCGCTCTTCCGCCGG

AAACCAAGCTGGAGCGTTTCATCAATGCCATTGTTTCCCGCCTGCTCGACGACCGCAGTTGGCAGAGCAAGG

TCTGCGCTCGCGAAATCCTCGCGCCGACGGCGCACTTCGCCAGCCTGATCCGCGAGGAGGTGATGCCCAAGT

TCGAAGCCTTGGAGCGGATCATCGGCGAGATCACCGGCCTGCCCCGCCACGACCCCGCCCTGTCGCGCTGCG

TCATAAGCATCATCGCGCCCTGCCTGATGCTGATGGTCATCGATCGCGACCAGTCGAGCCCGATGCAAGCGA

TCCTGCTGCACGACGCCGACGCCCTGAAGAACCACCTGAACCTCTTCGCCCGCAGCGGACTGGAAGCCATAC

GCCGGCACCACGACCCCTCC

The aminoacid sequence of PltZ gene coded protein is:

MSTRRRTPRSDGESTRARILEVAGRLFAQHGYANTASKAICEEAGADLAAINYHFGSRDALYKAVLVEGHKQFVSLHDLRELADSALPPETKLERFINAIVSRLLDDRSWQSKVCAREILAPTAHFASLIREEVMPKFEALERIIGEITGLPRHDPALSRCVISIIAPCLMLMVIDRDQSSPMQAILLHDADALKNHLNLFARSGLEAIRRHHDPS

Utilization Kan ^RThe resistance box inserts inactivation to the orientation that pltZ carries out on the karyomit(e), has made up the pltZ mutant strain (M18-pltZ-) of pseudomonas M 18.Comparative studies wild type strain M18 and pltZ mutant strain M18-pltZ Plt synthetic kinetics (Fig. 2) in the KMB substratum.The result shows that the Plt output of pltZ mutant strain M18-pltZ-is significantly higher than wild type strain M18 in whole growth process, reaches as high as 5 times, and this shows that the pltZ gene has had strong inhibitory effects in the Plt of M18 is synthetic.

In order to further specify the effect of pltZ gene pairs M18 Plt synthetic negative regulation, under the background of wild type strain M18, introduce pltZ and cross expression shuttle plasmid pBBRZ.Comparative studies M18 (pBBR1MCS) and M18 (pBBRZ) Plt synthetic kinetics (Fig. 3) on the KMB substratum, the result shows: the synthetic expression because of crossing of pltZ of Plt is subjected to intensive and suppresses, and Plt output has reduced by 60%.

Simultaneously, utilization betagalactosidase activity analytical technology has been studied the expression level (Fig. 4) of the translation fusion (pltA '-' lacZ) of Plt biosynthesis gene pltA and lacZ at wild type strain M18 and derivative strain thereof.The result shows: pltA ' in the M18 whole growth process-' expression level of lacZ translation fusion has obtained significant raising (having improved 1～3 times approximately) because of the sudden change of pltZ; At pltZ mutant strain (M18-pltZ ^-), pltA '-' expression level of lacZ translation fusion has descended 98% approximately owing to the complementation decline that pltZ crosses the expression shuttle plasmid is more remarkable.These have shown that all pltZ prevents the expression of Plt biosynthesis gene.

Advantage of the present invention:,, can make up the high-yielding engineering bacterial strain of Plt, to improve the biological control ability of M18 by sudden change negative regulator gene pltZ according to the negative regulation mechanism that pltZ is synthetic to Plt and the Plt biosynthesis gene is expressed.

Description of drawings

Fig. 1 shows wild-type M18 and pltZ mutant strain M18-pltZ ^-Plt synthetic kinetics in the KMB substratum

Fig. 2 shows that the expression of crossing of pltZ suppresses the Plt synthetic

Fig. 3 shows the negative regulation that the sudden change of pltZ is expressed the Plt biosynthesis gene

Embodiment

Related bacterial isolates and plasmid sees the following form in concrete the enforcement:

Bacterial strain and plasmid characteristic source

Pseudomonas M 18

The wild-type rhizosphere separates; PLT ⁺PCA ⁺Ap ^rSp ^RThis patent

Mutant strain PltZ ^-PLT ⁺PCA ⁺Ap ^RSp ^RKan ^RThis patent

Intestinal bacteria

LE392 F-hsdR514 supE44 supF58 lacY1 galk2 Promega public affairs

GalT22 metB1 trpR55 department

Collect in DH5a supE44 Δ lacU169 (Ψ 80 lacZ Δ M15) hsdR17 laboratory

recA1?endA1?gyrA96?thi-1?relA1

Collect in SM10 thi-1 thr leu tonA lacY supE laboratory

recA∷RP4-2-Tc∷Mu?Kan ^R

Plasmid

PLAFR-5 is used to make up the coemid (cosmid) of genomic library, and collect in the laboratory

Tc ^R

PLAFR-k uses from that resistance fragment of card of pDSK519 and inserts the inactivation this patent

The tetracyclin resistance box of pLAFR-5, Kan ^R

The source of that resistance box of pDSK519 card, Kan ^RCollect in the laboratory

The pUC18 cloning vector, Ap ^RCollect in the laboratory

PEX18Gm gene replacement vector, its multiple clone site are from pUC18, and collect in the laboratory

oriT ⁺sacB ⁺Gm ^R

The cloning vector of the extensive host range of pBBR1MCS, IncP IncQ Cm ^RCollect in the laboratory

PME6015 is used to make up pVS1-p15A that translation lacZ merges and shuttles back and forth and carry the laboratory and collect

Body, Tc ^R

Comprise in the pUCZ Shotgun order-checking plasmid pUC18 and have the pltZ basic patent

The 2.48kb fragment of cause, Amp ^R

That resistance fragment of pUCZK card is inserted the pltZ gene of inactivation pUCZ, this patent

Kan ^R?Ap ^R

PEXZK from the 4.18kb EcoRI-BamHI fragment of pUCZK by inferior this patent

Be cloned into pEX18Gm, Gm ^ROriT ⁺SacB ⁺Kan ^R

PBBRZ from the 1kb EcoRV-PvuII fragment of pUCZ by the subclone this patent

SmaI site to pBBR1MCS

PMEAZ comprises the long 733bp this patent of PpltLA-pltL-pltA '

The BamHI-PstI pcr amplified fragment is cloned into pME6015

Bacterial isolates, plasmid and culture condition

The routine of pseudomonas M 18 and derivative strain thereof cultivates usually that (prescription is seen Sambrook at 28 ℃ and Luria-Bertani (LB) substratum, J., E.F.Fritsch, " the molecular cloning experiment guide " of and T.Maniatis) carry out in, and King ' s medium (KMB) helps the synthetic of Plt, so the Plt fermenting experiment need carry out in the KMB substratum.Intestinal bacteria are cultured in the LB substratum under 37 ℃.The prescription of KMB substratum is: peptone 20g, K ₂HPO ₄0.3g, MgSO ₄H ₂O 1.5g, glycerine 15ml, distilled water 1000ml, PH7.0.In pltZ mutant strain building process, the sucrose of interpolation 5% is negative in substratum selects single cross to change mutant.When needs were wanted, microbiotic was by following concentration (μ g ml ^-1) add: for pseudomonas, kantlex (Kan) 50, tsiklomitsin (Tc) 75, paraxin (Cm) 200, gentamicin (Gm) 40, penbritin (Amp) 100, spectinomycin (Sp) 100, Rifampin (Rif) 20; For intestinal bacteria, kantlex (Kan) 50, tsiklomitsin (Tc) 25, paraxin (Cm) 40, gentamicin (Gm) 10, penbritin (Amp) 100.

DNA operation and sequential analysis

DNA separation, restriction enzyme digestion, agarose gel electrophoresis, connection and conversion are all undertaken by the standard method of molecular cloning experiment guide (Sambrook, J., E.F.Fritsch, and T.Maniatis, 1989).Adopt the shot-gun sequence measurement to be checked order in Plt biosynthesis gene zone.The distribution situation of sequencing result open reading frame (ORF) adopts Gene Mark.HMM program (http://opal.biology.gatech.edu/GeneMark/hmmchoice.html) to predict earlier, the result finds the new regulatory gene of a reverse transcription, called after pltZ in Plt biological synthesis gene cluster pltLABCDEFG operon downstream.Then utilize BLASTX program (http://www.ncbi.nlm.nih.Gov/BLAST/) the pltZ proteins encoded to be carried out the database search of similar protein sequence, find the TetR/AcrR (gene pool sequence number BAC55323) of pltZ proteins encoded and Pseudomonas stutzeri, the TetR and PsrA of Pseudomonas putida KT2440 (the gene pool sequence number is NP744293 and CAC17801), the PsrA of Pseudomonas.chlororaphis. bacterium modulins such as (gene pool sequence number AAM52309) is in the certain similarity of nearly N ' terminal sequence tool.The homology search of pltZ proteins encoded possibility structural domain adopts Pfam (Protein Family Database, http://www.sanger.ac.uk/software/pfam/) and PROSITE (http://us.expasy.org/prosite/) to carry out.The multiple ratio of PltZ and its homologous protein sequence is to being undertaken by program CUSTAWL (http://www.ebi.ac.uk/clustalw/).Analytical results finds to have at the nearly N ' end of pltZ coding protein sequence the characteristic sequence of TetR family, this characteristic sequence comprises a HTH die body with dna binding activity, therefore, pltZ gene and its similar protein belong to a new member of bacterium modulin TetR family, and many member's major parts of this family work as the bacterium repressor.

The Plt resultant quantity is measured

200 microlitre zymocyte liquids add 200 microlitre ethyl acetate extractings, centrifuging and taking 100 microlitre supernatants, vacuum-drying, be dissolved in 100 microliter methanol, get 2 μ l and carry out C18 RPLC (HPLC) analysis, testing conditions is: Plt detects wavelength 308nm, and retention time is 3.1min, moving phase is 70% methyl alcohol, flow velocity 1ml min ^-1, investigative range is 0.01.

PltZ transgenation bacterial strain (M18-pltZ ^-) structure and the Plt synthetic influenced

Downcut the kalamycin resistance fragment (Kan of 1.7kb from pDSK519 with PvuII ^RBox), be inserted among the pltZ (pUCZ comprises for the order-checking plasmid) and mend flat terminal Bsp119I site with the big fragment of klenow, the result produces the recombinant plasmid pUCZK of the external sudden change of pltZ.Then downcut from pUCZK and comprise pltZ ∷ km with EcoRI and BamHI ^rThe 4.18kb fragment of mutant, subclone produce recombinant plasmid pEXZK to suicide plasmid pEX18Gm (having sucrose lethal gene sacB).Subsequently pEXZK is converted into E.coli SM10 as donor, carries out biparent cross, containing 100 μ g ml with acceptor M18 ^-1Spectinomycin and 50 μ g ml ^-1Connexon is changeed in screening on the LB agar plate of kantlex, and wherein spectinomycin is used for bearing selection acceptor E.coli SM10.After experience reorganization for the second time, can obtain anti-kantlex (Km ^R), gentamicin sensitivity (Gm ^S), sucrose sensitivity (Sac ^S) the pltZ of M18 ^-Mutant strain is hybridized with Southern and to be verified the mutant strain M18-pltZ that is obtained ^-

Wild type strain M18 and pltZ mutant strain M18-pltZ ^-Plt synthetic kinetics more as shown in Figure 2 in the KMB substratum.The result shows: pltZ mutant strain M18-pltZ ^-Plt output in whole growth process, be significantly higher than the Plt output of wild type strain M18, pltZ mutant strain M18-pltZ ^-Plt output at 72 hours up to 150 μ g ml ^-1, and wild type strain M18 is at the underproduce 30 μ g ml of 72 hours Plt ^-1, the sudden change of pltZ gene makes Plt output improve nearly 4.36 times fully on the basis of wild-type level, and this has great importance to improving the bacteriostasis of M18 bacterial strain in biological control.

PltZ crosses the structure of expression vector and the Plt synthetic is influenced

Downcut the 1.04kb EcoRV-PvuII fragment that comprises pltZ and pltZ promoter region from pUCZ, be inserted into the SmaI site of E.coli-pseudomonas shuttle plasmid pBBR1MCS, produce the expression vector pBBRZ excessively of pltZ, be transformed to M18 and derivative strain thereof subsequently.M18 (pBBR1MCS) sees Fig. 3 with M18 (pBBRZ) Plt synthetic dynamic analysis on the KMB substratum, the result shows that synthetic the expression because of crossing of pltZ of Plt is subjected to the intensive inhibition, at 72 hours, the M18 bacterial strain Plt output that only contains empty plasmid pBBR1MCS was 38 μ g ml ^-1And contain the Plt output that pltZ crosses the M18 bacterial strain of expression vector this moment only is 16 μ g ml ^-1, reduced by 60%.This result further illustrates the effect of pltZ gene pairs Plt synthetic negative regulation, illustrates that simultaneously it is that part suppresses and is not to suppress fully that pltZ gene pairs Plt synthetic suppresses.

PltA '-' structure of lacZ translation fusion plasmid and mensuration of betagalactosidase activity

With plt cosmid 8H12 is template, with P1 (5 ' TACGAT GGATCCGGCAGATA CTTTAGG 3 ') and P2 (5 ' AGAATT CTGCAGGCCTACGTCGAAATC 3 ') is primer, pcr amplification comprises a 733bp fragment of pltLA promotor, complete pltL and preceding 9 codons of pltA, the PCR product is cut rear clone to pME6015 through BamHI and PstI enzyme, and the result produces pltA '-' lacZ translation fusion vector pMEAZ.

Pseudomonas M 18 and its derivative strain are cultured in 50 milliliters of KMB substratum of 250 milliliters of Erlenmeyer flasks, add suitable microbiotic and 0.05%Triton X-100 to substratum, 28 ℃ of culture temperature, shaking speed 220rpm is in the bacterium liquid that spends the night of the ratio of 1: 100 (V/V) inoculation KMB culture medium culturing.Measure betagalactosidase activity at different point in time sampling respectively, go up the Miller method of describing according to molecular cloning experiment guide (Sambrook, J., E.F.Fritsch, and T.Maniatis, 1989) and measure.

The influence that PltZ expresses the Plt biosynthesis gene

With pltA '-' lacZ translation fusion plasmid pMEAZ is incorporated into wild type strain M18 respectively, pltZ mutant strain M18-pltZ ^-, M18-pltZ ^-(pBBR1MCS) and M18-pltZ ^-(pBBRZ), further specify the negative regulation effect (Fig. 3) that pltZ expresses the Plt biosynthesis gene by measuring the LacZ activity of each recombinant bacterial strain in the KMB substratum respectively.The result shows: pltA ' in whole growth process-' expression level of lacZ translation fusion has improved 1～3 times, pltZ mutant strain M18-pltZ because of the sudden change of pltZ has obtained significant raising on the basis of wild-type level ^-LacZ activity at 24 hours reaches maximum value 1443 Miller units, and wild type strain M18 only is a 358Miller unit 24 hours LacZ activity.Be more significantly, at pltZ mutant strain (M18-pltZ ^-), pltA '-' expression level of lacZ translation fusion is owing to the complementation decline that pltZ crosses the expression shuttle plasmid is more remarkable, and the active peak value of 24 hours LacZ is from M18-pltZ ^-(pBBR1MCS) 1761Miller unit drops to M18-pltZ ^-(pBBRZ) 33 Miller units have descended 98% approximately.These have shown that all pltZ prevents the expression of Plt biosynthesis gene strongly, and then suppress the synthetic of Plt.

Claims

1, the gene order of the pyoluteorin biosynthetic controlling factor in a kind of pseudomonas M 18, it is characterized in that, near the characteristic sequence that has bacterium modulin TetR family the aminoacid sequence N end of biosynthetic controlling factor gene coding protein: G-[LIVMFYS]-x (2,3)-[TS]-[LIVMT]-x (2)-[LIVM]-x (5)-[LIVQS]-[STAGENQH]-x-PA[GPAR]-x-[LIVMF]-[FYST]-x-[HFY]-[FV]-x-[DNST]-K-x (2)-[LIVM], this conservative region comprises one and has the motif in conjunction with the active helix-turn-helix of DNA (HTH), this gene belongs to a member of bacterium modulin TetR family, 5 ' leader 92bp comprises the SD sequence of this gene and promoter region (35 sequences and-10 sequences).

2, the gene order of the pyoluteorin biosynthetic controlling factor in the pseudomonas M 18 according to claim 1 is characterized in that the dna sequence dna of biosynthetic controlling factor gene and leader thereof: ACAGACAATCGCCCTTATCAACCCCCTGACAG TCCC

AGCACACGACGCCGCACCCCACGAAGCGACGGCGAAAGTACCCGCGCACGGATTCTCGAAGTCGCCGGCCGGCTGTTCGCCCAGCACGGTTATGCCAATACCGCCAGCAAGGCCATCTGCGAGGAAGCTGGGGCCGACCTTGCCGCGATCAACTACCATTTCGGTAGCCGCGACGCCTTGTACAAGGCGGTGCTGGTCGAAGGACACAAGCAGTTCGTCAGCCTGCACGACCTCCGCGAACTGGCGGATAGCGCTCTTCCGCCGGAAACCAAGCTGGAGCGTTTCATCAATGCCATTGTTTCCCGCCTGCTCGACGACCGCAGTTGGCAGAGCAAGGTCTGCGCTCGCGAAATCCTCGCGCCGACGGCGCACTTCGCCAGCCTGATCCGCGAGGAGGTGATGCCCAAGTTCGAAGCCTTGGAGCGGATCATCGGCGAGATCACCGGCCTGCCCCGCCACGACCCCGCCCTGTCGCGCTGCGTCATAAGCATCATCGCGCCCTGCCTGATGCTGATGGTCATCGATCGCGACCAGTCGAGCCCGATGCAAGCGATCCTGCTGCACGACGCCGACGCCCTGAAGAACCACCTGAACCTCTTCGCCCGCAGCGGACTGGAAGCCATACGCCGGCACCACGACCCCTCC

3, the gene order of the pyoluteorin biosynthetic controlling factor in the pseudomonas M 18 according to claim 1 is characterized in that the aminoacid sequence of biosynthetic controlling factor gene coding protein: