CN1519346A - POlymorphism of 7th exon in AIRE gene - Google Patents

Abstract

A single nucleotide polymorphism (SNP) for the extron No.7 of AIRE gene and a method for analyzing the SNP and activity of said extron No.7 are disclosed. Said SNP is G->C polymorphism at the site No.168 in its sequence shown by SEQ ID No.1 and can cause the change R->S at the site No.12 of coding protein, so changing protein activity.

Description

No. seven exon polymorphism of AIRE gene

Technical field

The present invention relates to the single nucleotide polymorphism of No. seven exon of AIRE gene.The invention still further relates to the method for the allelic mutation of analyzing No. seven exon of AIRE gene.

Background technology

AIRE (autoimmune regulator) gene is a kind of autoimmunity regulatory factor, though concrete function also is not very clear, the zinc fingers that it comprised (zinc fmger motifs) shows that it is a transcription factor.Its encoded protein all has discovery in tenuigenin and nucleus.Lack this gene and can cause autosomal recessive autoimmune disease APECED (autoimmune polyendocrinopathy-candidiasis-ectodermaldystrophy).( http：//www.ncbi.nlm.nih.gov/LocusLink/LocRpt.cgi？l＝326)

Before the application, also there is not the relevant report of No. seven exon polymorphism of AIRE gene.

Summary of the invention

Purpose of the present invention just provides the polymorphism and the detection method thereof of No. seven exon of AIRE gene.

In a first aspect of the present invention, the method for the single nucleotide polymorphism of No. seven exon of a kind of people of detection AIRE gene is provided, it comprises step:

(a) determine the 168th Nucleotide in sequence shown in the SEQ ID NO:1 of No. seven exon of people AIRE gene;

(b) detect whether there is single nucleotide polymorphism in described position.

In a preference, described single nucleotide polymorphism is to have C at the 168th.

In a second aspect of the present invention, a kind of isolating nucleic acid is provided, it has the sequence shown in the SEQ ID NO:1, and the 168th is C.

In a third aspect of the present invention, a kind of allele specific nucleic acid primer is provided, its length is 15-50bp, and hybridizes specifically and amplify shown in the SEQ ID NO:1 that contains No. seven exon of people AIRE gene the amplified production of the 168th single nucleotide polymorphism in the sequence.

In a fourth aspect of the present invention, a kind of allele specific oligonucleotide probe is provided, its length is 15-50bp, and hybridizes specifically and detect shown in the SEQ ID NO:1 that contains No. seven exon of people AIRE gene the 168th single nucleotide polymorphism in the sequence.

A kind of test kit comprises:

(1) primer of No. seven exon of specific amplification people AIRE gene is right,

(2) detect No. seven exon of amplified production and normal AIRE gene and compare the reagent that whether exists variation required, the 168th single nucleotide polymorphism in the sequence shown in the described SEQ ID NO:1.

Another kind of diagnostic kit comprises: the oligonucleotide probe that the primer that the present invention is above-mentioned and/or the present invention are above-mentioned.

Embodiment

The inventor is by extensive and deep research, had been found that in the AIRE gene protein sequence that No. seven exon is coded the 12nd Arg (R)-Ser (S) polymorphic (be last 168 G-of mRNA〉C polymorphism), finished the present invention on this basis.

According to normal people AIRE gene sequencing result, found this SNP.Find that by analysis this SNP causes 12 amino acids by Arg (R)-Ser (S).Because this is the amino acid whose displacement of different properties, therefore, can cause No. seven coded proteic activity of exon of AIRE gene to change.

The eDNA sequence of No. seven exon of AIRE gene is listed in SEQ ID NO:1, and wherein open reading frame is the 134-214 position, and its coded aminoacid sequence is listed in SEQ ID NO:2.The genome sequence of No. seven exon of AIRE gene can obtain from GenBank.

Those skilled in the art will appreciate that a large amount of analytical technologies can be used for detecting whether the site exists single nucleotide polymorphism described in No. seven exon of AIRE gene.These technology comprise (but being not limited to): dna sequencing, sequencing by hybridization; Enzymatic mispairing cutting, heteroduple analysis, dot blot, oligonucleotide arrays (DNA chip), Mini-sequencing, Taqman technology, molecular beacon etc., sex change high performance liquid chromatography (DHPLC).

On the other hand, detection method of the present invention is used to assess the individual susceptibility of suffering from No. seven exon relative disease of AIRE gene.

Being used for specimen of the present invention and being not particularly limited, for detecting SNP, can be DNA or the mRNA that extracting goes out from samples such as blood, tissue.For detect No. seven exon of AIRE gene active for, can anyly contain the sample of No. seven exon of AIRE gene, as blood etc.

The primer and the probe that are used for the inventive method or detection kit design according to the cDNA sequence (sequence of SEQ ID NO:1) or the genome sequence of No. seven exon of AIRE gene, and the synthetic technology of available routine is synthesized and got final product.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1

The extracting of gene and order-checking

Extract DNA with conventional phenol chloroform method from people's blood, concentration correction is used for conventional pcr amplification to 20ng/ul.Primer is:

Adopted primer is arranged: 5 '-ggaacagcgt tgcctctgg-3 ' (SEQ ID NO:3)

Antisense primer: 5 '-gagctgtaccctgtgggtagg-3 ' (SEQ ID NO:4)

The product of the 426bp that amplifies carries out dna sequencing behind the purifying.

Embodiment 2

The acquisition of SNP

The AIRE gene is directly checked order.Each sample sequence of measuring is compared, thereby draw the difference of sequence, obtain SNP.

Embodiment 3

Detection kit

Preparation one detects the detection kit of AIRE gene-correlation disease susceptibility, and wherein, it is right to contain the following primer that amplifies 168 SNP:

Adopted primer is arranged: 5 '-ggaacagcgt tgcctctgg-3 ' (SEQ ID NO:3)

Antisense primer: 5 '-gagctgtaccctgtgggtagg-3 ' (SEQ ID NO:4)

Amplified production and normal control are carried out stratographic analysis with sex change high performance liquid chromatograph (DHPLC), can detect 168 G-easily C type SNP.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

＜110〉Research Center of Shanghai Human Genome

＜120〉No. seven exon polymorphism of AIRE gene

<130>030115

<160>4

<170>Patent?In?version?3.1

<210>1

<211>347

<212>DNA

<213>Homo?sapiens

<220>

<221>CDS

<222>(134)..(214)

<223>

<400>1

ggaacagcgt?tgcctctggg?ggaatggctc?tgctgggggc?tgggggctgc?tgccgagaga 60

cgcctggtgc?cacagccatg?tgcaccctcg?ctgctgagac?tgcccccatt?gctgacgccc 120

ctcttccttg?cag?ggt?gga?ggt?gag?gct?agg?ctg?ggc?cag?cag?ggc?agg 169

Gly?Gly?Gly?Glu?Ala?Arg?Leu?Gly?Gln?Gln?Gly?Arg

1 5 10

gtt?ccc?gcc?cct?ctg?gcc?ctc?ccc?agt?gac?ccc?cag?ctc?cac?cag 214

Val?Pro?Ala?Pro?Leu?Ala?Leu?Pro?Ser?Asp?Pro?Gln?Leu?His?Gln

15 20 25

gtaatgccct?agaccacagg?agaggcccct?gtctgccctt?gctcccctcg?ggtgggtcct 274

gctgcctctg?cctttacctg?ggcactcagg?gatgagcacc?ggggcctgag?cccctaccca 334

cagggtacag?ctc 347

<210>2

<211>27

<212>PRT

<213>Homo?sapiens

<400>2

Gly?Gly?Gly?Glu?Ala?Arg?Leu?Gly?Gln?Gln?Gly?Arg?Val?Pro?Ala?Pro

1 5 10 15

Leu?Ala?Leu?Pro?Ser?Asp?Pro?Gln?Leu?His?Gln

20 25

<210>3

<211>19

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>3

ggaacagcgt?tgcctctgg 19

<210>4

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>4

gagctgtaccctgtgggtagg 21

Claims (7)

1. method that detects the single nucleotide polymorphism of No. seven exon of people AIRE gene is characterized in that it comprises step:

(a) determine the 168th Nucleotide in sequence shown in the SEQ ID NO:1 of No. seven exon of people AIRE gene;

(b) detect whether there is single nucleotide polymorphism in described position.

2. the method for claim 1 is characterized in that, described single nucleotide polymorphism is to have C at the 168th.

3. an isolating nucleic acid is characterized in that, it has the sequence shown in the SEQ ID NO:1, and the 168th is C.

4. allele specific nucleic acid primer, it is characterized in that, its length is 15-50bp, and hybridizes specifically and amplify shown in the SEQ ID NO:1 that contains No. seven exon of people AIRE gene the amplified production of the 168th single nucleotide polymorphism in the sequence.

5. an allele specific oligonucleotide probe is characterized in that, its length is 15-50bp, and hybridizes specifically and detect shown in the SEQ ID NO:1 that contains No. seven exon of people AIRE gene the 168th single nucleotide polymorphism in the sequence.

6. diagnostic kit is characterized in that it comprises:

(1) primer of No. seven exon of specific amplification people AIRE gene is right,

(2) detect No. seven exon of amplified production and normal AIRE gene and compare the reagent that whether exists variation required, the 168th single nucleotide polymorphism in the sequence shown in the described SEQ ID NO:1.

7. a diagnostic kit is characterized in that it comprises: described primer of claim 4 and/or the described oligonucleotide probe of claim 5.