CN1498964A - Serial recombined gland related virus inducible path of RNAi, and utilized in gene therapy - Google Patents

Serial recombined gland related virus inducible path of RNAi, and utilized in gene therapy Download PDF

Info

Publication number
CN1498964A
CN1498964A CNA021493197A CN02149319A CN1498964A CN 1498964 A CN1498964 A CN 1498964A CN A021493197 A CNA021493197 A CN A021493197A CN 02149319 A CN02149319 A CN 02149319A CN 1498964 A CN1498964 A CN 1498964A
Authority
CN
China
Prior art keywords
sequence
gene
rnai
associated virus
recombinant adeno
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CNA021493197A
Other languages
Chinese (zh)
Inventor
吴小兵
鲁晓春
马鑫
董小岩
侯云德
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
AGTC Gene Technology Co Ltd
Original Assignee
AGTC Gene Technology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by AGTC Gene Technology Co Ltd filed Critical AGTC Gene Technology Co Ltd
Priority to CNA021493197A priority Critical patent/CN1498964A/en
Priority to AU2003284795A priority patent/AU2003284795A1/en
Priority to PCT/CN2003/000939 priority patent/WO2004063380A1/en
Publication of CN1498964A publication Critical patent/CN1498964A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/111—Antisense spanning the whole gene, or a large part of it
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Abstract

A recombinant adeno-associated virus (AAV) series able to induce RNAi pathway and used for gene therapy is disclosed. The policy and process for configuring the AAV carrier which can specifically suppress the gene associated with particular diseases by RNAi pathway and is used for gene therapy, and its application are also disclosed.

Description

Can induce the serial recombinant adeno-associated virus that is used for gene therapy of RNAi approach
Technical field the invention belongs to biological technical field, is specifically related to a series of construction strategy, method and purposes that suppress the adenopathy adjoint virus carrier that is used for field of gene of specified disease genes involved by the RNAi approach specifically.
Background technology the present patent application is the previous similar application for a patent for invention (number of patent application of applying at us: 02125762.0, denomination of invention: (Ma Xin on the basis gland relevant viral vector that utilizes the downward modulation of RNA interference phenomenon mediation functional gene), Lu Xiaochun, Wu Xiaobing etc.The luciferase shRNA of AAV vector plasmid mediation suppresses its expression in mammalian cell.China's experiment and clinical virology magazine, 2002,16 (3): 253-255) the further application of being done, simultaneously, also be further application (WU Zj, WU Xb, the CAO H of recombined glandulae correlation viral vectors, Deng, A novel and highly efficient productionsystem for recombinant adeno-associated virus vector. Chinese science C collects English 2002; 45 (1): 96-104.Wu Xiaobing, Dong XiaoYan, Wu Zhijian etc. the method for a kind of separation rapidly and efficiently and purification of Recombinant adenovirus accompanying virus carriers.Science Bulletin, 2000,45 (19): 2071-2075.Wu Zhijian, Wu Xiaobing, Cao Hui etc. a kind of production system of recombinant adeno-associated virus vector efficiently.Chinese science C collects, and 2001,31 (5): 423-430).
In number of patent application is 02125762.0 application for a patent for invention, we have described with recombined glandulae correlation viral vectors plasmid pSNAV plasmid and have carried the RNAi nucleotide fragments, to carry the plasmid transfection of RNAi to the cell of vitro culture or in the animal body, thereby make plasmid can be in cell or in the animal body replicated rna i nucleotide fragments continuously, reach the biological action that the RNAi nucleotide fragments should play.In addition, this RNAi nucleotide fragments also is packaged into the recombinant adeno-associated virus (carrier) that has carried the RNAi nucleotide fragments for a kind of, carry out the transgenosis and the gene replication of RNAi nucleotide fragments by this carrier of recombinant adeno-associated virus, reach the biological action that the RNAi nucleotide fragments should play.In number of patent application is 02125762.0 application for a patent for invention, as embodiment, we have used an above-mentioned thinking and construction of strategy bob clamp ring expression plasmid (pSNAV/U6/Luc), and make it in the BHK-21 cell, suppress the expression (Ma Xin of luciferase, Wu Xiaobing etc., the luciferase shRNA of AAV vector plasmid mediation suppresses its expression in mammalian cell.China's experiment and clinical virology magazine.2002，16(3)：253-255)。The concrete grammar of this embodiment is that the design primer accesses people U6 snRNA promotor with PCR from the human gene group DNA, with by 9bp sequence 21bp luciferase target sequence at interval oppositely repeat and AAV vector plasmid pSNAV is connected, be built into luciferase RNAi expression plasmid pSNAV/U6/Luc.With luciferase RNAi expression plasmid pSNAV/U6/Luc and pMAMneoLuc plasmid co-transfection BHK-21 cell, and independent transfection luciferase cell strain, inhibition effect detected respectively to luciferase expression.Experimental result shows the expression inhibiting 50% of pSNAV/U6/Luc to luciferase among the pMAMneoLuc of cotransfection, and to the expression inhibiting 70% of luciferase in the luciferase cell strain.The bob clamp ring luciferase that suppresses to transcribe out in the experiment confirm body can effectively suppress its expression in the BHK-21 cell.
Gene silencing (GENE SILENCING) phenomenon extensively is present in plant, fungi and animal (LeirdalM, Sioud M.Gene silencing in mammalian cells by preformed small RNA duplexes.Biochem Biophys Res Commun.2002 Jul 19; 295 (3): 744-8.), because the rise of transgenic technology, people have carried out more deep research to transgene silencing.About 30% transgenic experiments has all caused gene silencing in higher plant, is a kind of ubiquitous gene regulating mechanism.
Transgene silencing mainly is divided into two types: the one, the gene silencing on the transcriptional level (TranscriptionalGene Silencing, TGS), the 2nd, the gene silencing on the post-transcriptional level (Posttranscriptional GeneSilencing, PTGS).The former is the incident that occurs in the nuclear, and the latter occurs in the tenuigenin.The both is relevant with supermethylation (Hypermethylated), and in the TGS phenomenon, methylating mainly occurs in promoter region, and gene transcription is suppressed; And among the PTGS, methylate and mainly occur in the coding region of gene, gene can be transcribed, and produces mRNA, but mRNA is degraded in tenuigenin specifically.The two is not simple context in time, does not spatially isolate mutually because of the existence of nuclear membrane yet.
Post-transcriptional silencing shows as a kind of sequence-specific RNA degradation process, mainly acts on the higher transcription product of homology, comprises the transcription product of the native gene with homology.It extensively is present in the various biologies, people just find to be called as in plant to be called as in common inhibition (Cosuppression), the fungi and are called as RNA interference (RNA interference in (Quelling), the animal up to date, RNAi) phenomenon may have very big similarity, all relevant with the PTGS phenomenon (Hannon GJ.RNA interference.Nature.2002 Jul 11; 418 (6894): 244-51.).Generally believe that now PTGS is biology formed system of defense to virus, transposable element and other transferable nucleic acid in the long-term evolution process.Because the introducing of these exogenous nucleic acids makes the balancing in the host cell suffer fatal destruction probably.And transgene silencing is nothing but that host cell is considered as foreign gene to self deleterious sequence and with its inhibition.Cell has sequence-specific characteristics to this restraining effect of exogenous nucleic acid, so in case in the cell post-transcriptional silencing mechanism be activated, cell has just had " immunity " ability to the homologous sequence of the nucleic acid that changes over to.
Although PTGS (at first confirming in plant and fungi) and RNAi (at first observing in caenorhabditis nematode and fruit bat) are proved respectively, heredity and biochemical analysis disclose the contact in the evolution between the rapid approach of these multisteps.These approach have some common compositions, comprise them by double-stranded RNA (dsRNA) initiation, and the digested fragment that little length is 20-25 base, these fragments mediation sequence-specifics identification target single stranded RNAs (ssRNA) of being processed into of the dsRNA that causes.The enzyme that verified responsible cutting causes dsRNA is dsRNA specificity RNase, is called Dicer, produces the dsRNA degraded product.The interferential RNA s (siRNAs) of these little dsRNA or weak point is as the guide of the required combined enzyme agent of degraded target ssRNA, and it is included in corresponding to 21-23 base in the conventional gap in the zone of input dsRNA.Dicer also has helicase activity, and other regional function can not determine that still these are very important to the RNAi in fruit bat and the nematode.And Dicer has effect in the processing of the required transcript of normal development.Up to the present, only confirm many subunits complex body or RNA the mediation cutting target RNA silencing complex (RISC) in a kind of protein component Argonaute2.This non-specific inhibition that synthetic dsRNA that gene silencing in the dsRNA initiation mammalian somatic cell is little or siRNA can avoid genetic expression in the mammalian cell.Research RNAi is as the experiment regulate gene expression and explore a kind of method of gene function in genomic level.
It is that a kind of the evolution gone up the immune monitoring mechanism of conservative genomic level that RNA disturbs, it is the rapid process of multistep, the effect that relates to by RNaseIII endonuclease Dicer produces activated little 21-23nt interferential RNA (siRNA), mediates specificity degraded (the Hannon GJ.RNAinterference.Nature.2002 Jul 11 of its complementary homologous mRNA sequence; 418 (6894): 244-51.Sharp?PA.RNA?interference-2001.GENES?&?DEVELOPMENT，2001，15：485-490)。The RNAi phenomenon extensively is found in most of eukaryotes such as fungi, Arabidopis thaliana, hydra, turbellarian worm, trypanosome, zebra fish.The mechanism of RNAi is progressively illustrated, and meanwhile, as the strong instrument in the functional genome research field, RNAi is also more and more paid attention to by people.
The most interesting place of relevant RNAi is:
1.dsRNA be double-stranded RNA, but not the strand sense-rna is to disturb reagent.
2. its effect is a high special.
3. its action intensity is great (only needing several dsRNA molecules promptly can produce effective intervention in each cell)
4. intervening active (and hypothesis is dsRNA) can produce in away from the cell of introduction site and tissue and intervene.
Mammalian cell can activate two approach to the reaction of dsRNAs, surpass the degraded of non-widely sequence-specific mRNA and closing of translation that the dsRNAs of 30bp causes, dsRNA molecule 1 9-23bp (the short dsRNA molecules that external synthetic is short, siRNA) simulation RNAi approach intermediate, can in Mammals, cause inhibition (the Brummelkamp TR of sequence-specific genetic expression, BernardsR, Agami R.A system for stable expression of short interfering RNAi in mammaliancells.Science, 2002,296:550-553.Sui?G，Soohoo?C，Affar?EIB，et?al.A?DNA?vectorbased?RNAi?technology?to?suppress?gene?expression?in?mammaliancells.PNAS，2002，99：5515-5520。Yu?JY，DeRuiter?SL，Turner?DL.RNA?interferenceby?expression?of?short-interfering?RNAs?and?hairpin?RNAs?in?mammalian?cells.PNAS，2002，99：6047-6052)。
It is a kind of sequence specificity with height that RNA disturbs (RNAi), make the specific gene silence specifically, make a kind of RNA inductive post-transcriptional control mode of its afunction or reduction, it belong to gene silencing on the post-transcriptional level (Posttranscriptional Gene Silencing, PTGS).
The primary process of RNA interference (RNAi) in two steps, at first enter double-stranded RNA (the doublestrands RNA of cell, dsRNS) cut into long small RNA fragments (the small interfering RNAs of 21-23 Nucleotide by a kind of RNA enzyme III family member Dicer, siRNA), these siRNA fragments can combine with the dsRNA binding domains of this nuclease, be integrated into the reticent mixture (RISC) of RNA, as template identifying purpose mRNA, in the RISC mixture, the sense strand generation chain of mRNA and dsRNA exchanges, sense strand among original dsRNA is replaced by mRNA, discharges from enzyme-dsRNA mixture, and mRNA then is in the position of original sense strand.Nuclease cuts degraded in same position to mRNA, has produced the long dsRNA small segment of 21-23 Nucleotide so again, forms mixture with nuclease, continuation is cut purpose mRNA, thereby make the goal gene silence, (RNA disturbs, RNAinterference) to produce the RNAi phenomenon.Its advantage and characteristics are the sequence specificity of its height and the efficient of target gene inhibition efficiently.
The RNAi phenomenon extensively exists in the gene regulating mechanism of various biologies, be considered to the mechanism that a kind of cell RNA virus resisting is duplicated, compare with other several technology of afunction or reduction sudden change that cause, the RNAi technology has remarkable advantages, it suppresses more effective altogether than Antisense RNA Technique and homology, more is easy to generate afunction.Its height sequence specificity and the efficient target gene characteristics that suppress efficient attract tremendous attention it just, and the RNAi The Application of Technology expands to higher plant, Mammals rapidly from unicellular lower eukaryotes such as nematode, zebra fishs in the period of find short less than 5 so far.The RNAi technology is mainly as a kind of strong in order to determine the post genome project research tool of specific gene function at present, in order to specific gene carried out afunction or to reduce sudden change, thereby determine its function, and succeedd habronemic being close in whole 19000 gene function analysis of U.S..
1. early stage RNAi technology is that by injection or method such as immersion synthetic dsRNA directly to be imported target tissue intracellular, though these methods can suppress the expression of goal gene, but this gene silencing can not stable existence (Billy E, Brondani V, Zhang H, et al.Specific interference with geneexpression induced by long, double-stranded RNA in mouse embryonalteratocarcinoma cell lines.Proc Natl Acad Sci U S is Dec4 A.2001; 98 (25): 14428-33.Elbashir?SM，Harborth?J，Lendeckel?W，et?al.Duplexes?of21-nucleotide?RNAs?mediate?RNA?interference?in?cultured?mammalian?cells.Nature.2001?May?24；411(6836)：494-8。Fraser?AG，Kamath?RS，Zipperlen?P，et?al.Functional?genomic?analysis?of?C.elegans?chromosome?I?by?systematic?RNAinterference.Nature.2000?Nov?16；408(6810)：325-30。Schmidt?U，Monte?F，Miyamoto?MI，et?al.Restoration?of?diastolic?function?in?senescent?rat?heartsthrough?adenoviral?gene?transfer?of?sarcoplasmic?reticulum?Ca2+-ATPase.Circulation?2000；101：790-6)。Then scientists is improved the RNAi technology, and the target sequence of goal gene in reverse multiple mode, under specific promoter regulation, is expressed the dsRNA product that forms the tool hairpin ring structure, thereby made the goal gene silence in genetically modified organism.Enter 2002, mammalian expression vector about RNAi continues to bring out, initial carrier adopts long shoot hair clip spline structure (long hairpin RNA, lhRNA), goal gene is greatly suppressed, reach more than 90%, but because of its activator RNA dependent kinases (RNA-dependent protein kinase, PKR), cause non-degrade specifically of other mRNA and body ifn response, and use limited.Scientists (Miyagishi M, Taira K.U6 promoter driven siRNAs with four uridine 3 ' overhangs efficiently suppress targeted gene expression in mammalian cells.Nature Biotechnol.2002 May subsequently; 20 (5): 497-500.Paul CP, Good PD, Winer I, et al.Effective expression of small interfering RNA in human cells.Nat Biotechnol.2002 May; 20 (5): 505-8) utilize the extragenic promoter (comprising U6 snRNA, H1 RNA etc.) of the rna plymerase iii (TFIII) that instructs at DNA to make up and to form tool small segment (19-23 base stem) hairpin ring structure dsRNA (short hairpin RNA, shRNA) carrier of product, advantages such as the 21-23bp siRNA that cuts into of imitation Dicer succeeds, and this method is inhibited by force, do not activate PKR, do not cause other mRNA degradeds, expression product is stable, effect is lasting.At present existing several relevant report (Paddison PJ to this, Caudy AA, Bernstein E, et al.Short hairpinRNAs (shRNAs) induce sequence-specific silencing in mammalian cells.GenesDev.2002 Apr 15; 16 (8): 948-58.Paddison PJ, Caudy AA, Hannon GJ.Stablesuppression of gene expression by RNAi in mammalian
cells.PNAS.2002，99：1443-1448。Sui?G，Soohoo?C，Affar?EIB，et?al.A?DNA?vectorbased?RNAi?technology?to?suppress?gene?expression?in?mammaliancells.PNAS，2002，99：5515-5520。Wurl, P.; Kappler, M.; Meye, A.; Et al:Co-expression of survivin and TERT and risk of tumour-related death in patientswith soft-tissue sarcoma.Lancet 2002,359:943-945, .), and have the mammal cell line that utilizes such vector construction to produce.
In traditional Antisense gene therapy scheme, people are virus usually, modes such as plasmid, the antisense strand of particular target gene is expressed, or directly by non-virus carrier importing warp or without modified antisense DNA (EizemaK, Fechner H, Bezstarosti K, et al.Adenovirus-based phospholamban antisenseexpression as a novel approach to improve cardiac contractile dysfunction:comparison of a constitutive viral versus an endothelin-1-responsive cardiac promoter.Circulation.2000 May 9; 101 (18): 2193-9.).Though these methods can make the particular target gene get to a certain degree inhibition, suppress the requirement that the degree effect still can't reach clinical treatment mostly.Along with going deep into of RNAi research, the method that should dsRNA be produced in cell is emerged in large numbers in succession, on this basis, please number be in 02125762.0 the application for a patent for invention in patent, we have proposed application AAV is carrier, importing can produce induces the RNAi approach, makes the specified disease genes involved be able to the gene therapy scheme of height, specificity inhibition.
In addition, need to prove, in the foreign literature process of transcribing out a certain specific RNAi nucleotide fragments is referred to as to express.We think, expression is to illustrate that being transcribed into RNA by DNA translates into proteinic complete procedure then, and should be referred to as to transcribe by this specific process that DNA is transcribed into RNA, thereby, in description of the invention, we are generally described as and transcribe to relate to the related notion part, and finish Transcription functional unit we be referred to as transcriptional units.But also have by external colleague's convention and continue to use " expression " wording.
(adeno-associated virus AAV) is a kind of microvirus of non-virulent to adeno-associated virus, and genome is the single stranded DNA of 4680nt.There are latent infection and lytic infection dual mode the life cycle of AAV virus.The lytic replication of AAV virus needs helper virus such as adenovirus or hsv (herpes simplex virus, participation HSV).When not having helper virus to exist, AAV virus is incorporated in the host cell chromosome in the provirus mode.By AAV virus transform and the reorganization AAV virus vector that comes because of its safety, stable, both can infect somatoblast can infect not that but advantage such as somatoblast, efficiency of infection high long-term expression foreign gene receives publicity, and was that a kind of novel gene with extensive use shifts and gene therapy vector.
In the present invention, we have used the packing of our the previous reorganization AAV virus vector of inventing and the strategy (Wu Xiaobing etc. of production, application number: 99119039.4, denomination of invention: the recombinant adeno-associated virus production method and the purposes that can be used for scale operation; Wu Zhijian, Wu Xiaobing, Cao Hui etc. a kind of production system of recombinant adeno-associated virus vector efficiently.Chinese science C collects, and 2001,31 (5): 423-430), various RNAi nucleotide fragments with specific purpose are packed, become the various recombinant adeno-associated virus that carry the RNAi nucleotide fragments.And carry out the transgenosis and the gene replication of RNAi nucleotide fragments by this carrier of recombinant adeno-associated virus, to reach corresponding research and therapeutic purpose.
Summary of the invention the present invention utilized the invention of our previous application technology platform (number of patent application: 99119038.6, denomination of invention: the structure of serial universal adenovirus accompanying virus carriers and purposes; Number of patent application: 99119039.4, denomination of invention: the recombinant adeno-associated virus production method and the purposes that can be used for scale operation), by a series of RNAi approach of inducing that produce are provided, make the specified disease genes involved be able to the AAV carrier construction method of height, specificity inhibition, producing can be for the reorganization AAV virus of gene therapy research and clinical application.
RNAi technology of the present invention relates to the shRNA with 18-29 base stem, the dsRNA that contains longer 100-700 base stem and comprise or do not comprise the ring texture lhRNA of other genes involved sequence and do not have the hair clip spline structure.
The present invention relates to:
(1) determines the aim sequence that is used to induce RNAi of particular target gene, be structured in the AAV carrier of the formed shRNA product under the control of U6 snRNA or H1RNA promotor;
(2) be structured in the justice of U6 snRNA or the H1RNA promotor particular target gene under controlling respectively and the AAV carrier of antisense dna sequence;
(3) be structured in the AAV carrier of formed shRNA product of a plurality of aim sequences of a plurality of U6 snRNA or the H1RNA promotor particular target gene under controlling respectively;
(4) be structured in the AAV carrier of formed shRNA product of the single or multiple aim sequences of a plurality of U6 snRNA or the H1RNA promotor a plurality of particular target genes under controlling respectively;
(5) make up the AAV carrier that contains the formed tool lhRNA product under special regulating and controlling sequence (as single and a plurality of hypoxia response elements, blood glucose response element etc.) and/or tissue specificity or the control of potent promotor.
In the building process of the various reorganization AAV viruses that carry the lhRNA structure of the present invention, at first need to determine and obtain the aim sequence that is used to induce RNAi of particular target gene, be structured in the shRNA structure AAV vector plasmid under the control of U6 snRNA or H1RNA promotor then, structure contains the AAV vector plasmid of the formed lhRNA structure under special regulating and controlling sequence and/or tissue specificity or the control of potent promotor, the AAV of the corresponding reorganization of preparation afterwards virus, we are to common cardiovascular disorder at last, several target genes of tumour and autoimmune disorder have carried out suppressing experiment.
The method and the step determined of aim sequence that is used to induce RNAi at the particular target gene:
1. obtain particular target gene mRNA sequence;
2. as utilize U6 snRNA or H1RNA promotor, begin to seek with upper/lower positions,, generally choose 100-300 (empirical value) after the initiator codon to avoid the conjugated protein site of DNA at its initiator codon downstream 50-100bp;
2.1 method A: aim sequence should be beginning (PCR introduces method shRNAi transcription product elder generation antisense) with G, writes down 18-29 base backward, recommends 19-23bp; Method B: aim sequence should be beginning with C (PCR introduces method shRNAi transcription product justice earlier),
2.2 seek or test best aim sequence fragment 5 ' end as no G or the C that obtains, should add G or C, generally speaking adding 1-5 base pair RNAi restraining effect does not have obvious influence, and except that transcription initiation site should be G, it is stable that 1-3 A of 5 ' end has the shRNA of being beneficial to;
2.3 require no continuous 3 and above T in the sequence,, also require no continuous 3 and above A in the sequence as adopting the hair clip spline structure;
2.4 require sequence GC content at 20%-70%, recommend 30%-65%; Otherwise and can with in the primer with positive-sense strand complementary A be changed to G or, note not becoming with the antisense strand complementary portion, can form the UG pairing at transcription product after the change, may not influence the RNAi activity, still require no continuous 3 and above T in the just sequence;
2.5, should carry out sequence 2 level structure analyses as adopting the hair clip spline structure;
3. as utilizing the lsRNA structure, 50-700 base stem sequence should be most of in the coding region, recommends 200-600bp;
3.1 proposed sequence GC content is moderate, if comprise other gene, should select the gene of its coding region less than stem length 1/2 in the ring;
Select 3.2 present method is another kind of, seek two sequences, one of them sequence includes another sequence, and long segment has more part and mainly concentrates at one end, in order to form ring texture;
3.3 note the coding region is correctly transcribed;
4. the sequence that will seek is carried out the BLAST inquiry to NCBI, guarantees that this sequence only has a target sequence, otherwise repeating step 2 or 3;
5. suppress the very high sequence selection of efficient for requiring, can adopt following two kinds of methods:
5.1 a plurality of sequence artificial synthesis that will select or external dsRNA synthetic agent box are (as Dharmacon siACE-RNAi ) synthetic dsRNA;
5.2 between the extragenic promoter of two relative U6 snRNA promotors or other TFIII, insert double-stranded a plurality of sequences of selecting, make up plasmid library on a small scale, carry out transfection, albumen and or rna level detect, observe and suppress efficient, or the screening by methods such as affine, the immunomagnetic beads of antibody, flow cytometers, to select the best.
Be structured in the method for the shRNA structure AAV vector plasmid under the control of U6 snRNA or H1RNA promotor:
Method 1:PCR introduces method
1.1 upstream primer is in the near-end controlling element 5 ' outside of the extragenic promoter of U6 snRNA promotor or other three class TFIII, generally speaking pcr amplification product comprises the TATA box and the near-end controlling element can make the shRNA structure of introducing effectively be transcribed, in this scope, also can add specific regulating and controlling sequence, as: hypoxia response elements, tsiklomitsin can be induced element etc.The upstream primer that we test is positioned at U6 promotor-329--312 (GGTGTTTCGTCCTTTCCACAA), and for ease of operation, 5 ' adds the Xho1 site.
1.2 downstream primer is two portions, at first determines outside hair clip spline structure sequence, stem is used previous methods B or the definite fragment of A, and ring structure is the 5-9bp base, and general 9bp effect is the most desirable.In our experience and document, after transcribing 5 ' is just fragment, 3 ' is the inhibition effect height that the antisense fragment produces than opposite designing institute, adds terminator sequence TTTTT and used restriction endonuclease sites (we use Bgl II or BamH I) in its outside.Inside part is a 3 ' end of U6 promotor, and our applications-1--20 is (CCCCAGTGGAAAGACGCG) partly.Notice that this is an antisense primer.
1.3 we use the pTeasy-U6 plasmid that we extract structure template, this plasmid comprise the U6 gene-the 417-300 fragment.30 94 ℃ 45 of condition circulations ", 56 ℃ 45 ", 72 ℃ 45 ", product can be connected in shuttle plasmid after enzyme is cut, or makes up behind the T carrier again.
Method 2: big adapter method
2.1 determine hair clip spline structure sequence, stem is used the fragment that previous methods A determines, ring structure is the 5-9bp base, and general 9bp effect is the most desirable.In our experience and document, 5 ' after transcribing is just fragment, 3 ' for the antisense fragment than suppressing the effect height conversely.Add terminator sequence TTTTT and used restriction endonuclease sites (we with Bgl II or the BamH I) end after enzyme is cut constructs in its outside.The inboard base of adding is to guarantee hair clip spline structure sequence site behind the U6 promoter transcription.The big adapter that synthetic one flat glues, available synthetic two strands, use the annealing back, and attention flush end 5 ' is answered phosphorylation.
2.2 upstream primer the same (referring to " method 1:PCR introduces method, 1.1 ")
Downstream primer is: GAAGTGTTTCGGTGTTTCGTCCTTTCCACA, introduced the Xmn1 site, (use this downstream primer, need to add two base AC at hair clip spline structure sequence 5 ' end, to guarantee correctly transcribing of hair clip spline structure).
2.3 capable 3 fragments of big adapter, U6 promoter fragment and shuttle vector are connected structure purpose plasmid.
The AAV vector plasmid method that the extragenic promoter that is structured in a plurality of TFIII is controlled down a plurality of hairpin ring structures respectively is about to aforesaid method and is improved, and each cell string is got final product, but will guarantee the direction unanimity.
Structure contains the AAV vector plasmid of the formed lhRNA structure under special regulating and controlling sequence and/or tissue specificity or the control of potent promotor:
Enzyme is cut or the PCR method obtains stem and the ring plate section is connected the purpose promotor downstream of AAV vector plasmid pSNAV and is connected with the PolyA sequence.In our experience and document, it is high that this method product suppresses efficient, but may cause ifn response, activates PKR and RNaseL, other mRNA of non-degrade specifically, and may cause apoptosis.We adopt and introduce adenovirus VAI RNA in the ring in the hope of overcoming this pair effect to this.Universal AAV vector plasmid pSNAV makes up (Chinese patent application number: 99119038.6) for this chamber.
Can form the foundation and the preparation of reorganization AAV virus accordingly of the reorganization AAV virus vector cell strain of lhRNA structure:
Obtain the 37 ℃ of cultivations of RPMI1640 nutrient solution that contain 10% foetal calf serum of corresponding AAV virus vector cell strain BHK/pSNAV/lhRNA:BHK cell with the pSNAV recombinant plasmid transfection bhk cell that has carried the lhRNA structure through selecting cultivation.With having carried pSNAV recombinant plasmid liposome lipofectamine (GIBCO BRL) the transfection bhk cell of lhRNA structure, digest behind the 24hr, 1: 2～5 go down to posterity.Adding G418 800 μ g/ml selects to cultivate.Can form obvious resistant cell clone after 10 days.The observation of cell clone sees cell in order under inverted fluorescence microscope, and also enlarged culturing and frozen guarantor's kind are respectively mixed in its digestion back.Infect the cell of enlarged culturing with global function helper virus HSV1-rc, find to have produced reorganization AAV-lhRNA virus after testing.Measure the titre of reorganization AAV-lhRNA virus.The production of reorganization AAV virus, preparation method (Wu Xiaobing, Dong XiaoYan, Wu Zhijian etc. a kind of rapidly and efficiently the separation and the method for purification of Recombinant adenovirus accompanying virus carriers.Science Bulletin, 2000,45 (19): 2071-2075.Wu Zhijian, Wu Xiaobing, Cao Hui etc. a kind of production system of recombinant adeno-associated virus vector efficiently.Chinese science C collects, 2001,31 (5): 423-430) referring to our previous patented technology of applying for (number of patent application: 99119039.4, denomination of invention: the recombinant adeno-associated virus production method and the purposes that can be used for scale operation; Number of patent application: 99119038.6, denomination of invention: the structure of serial universal adenovirus accompanying virus carriers and purposes).
Embodiment we to common cardiovascular disorder, tumour and autoimmune disorder (Folkman, J:Angiogenesis in cancer, vascular, rheumatoid and other disease.Nature Med.1995, several target genes 1:27-31) suppress, provide the part embodiment below and to wherein part method and purposes have been done detailed description, but and do not mean that the scope of the invention only limits to following cited sequence, target gene and disease, also and do not mean that the restriction content of the present invention.
Embodiment 1
The recombinant adeno-associated virus that is used for the treatment of the induced RNAi approach of cardiovascular disorder:
By analysis to the relevant progress of cardiovascular disorder, the design below we have carried out.Is the relevant document of institute's reference as follows: (Baartscheer A.Adenovirus gene transfer of SERCA in heartfailure.A promising therapeutic approach? Cardiovasc Res.2001 Feb 1; 49 (2): 249-52.del Monte F, Harding SE, Dec GW, et al:Targeting phospholamban by gene transfer inhuman heart failure.Circulation.2002 Feb 26; 105 (8): 904-7.Gelband CH, Reaves PY, Evans J, et al.Angiotensin II type 1 receptor antisense gene therapy prevents alteredrenal vascular calcium homeostasis in hypertension.Hypertension.1999 Jan; 33 (1 Pt2): 360-5.Martens，J.R.；Reaves，P.Y.；et?al：Prevention?of?renovascular?and?cardiacpathophysiological?changes?in?hypertension?by?angiotensin?II?type?1?receptorantisense?gene?therapy.Proc.Nat.Acad.Sci.1998，95：2664-2669.Miyamoto?MI，Monte?F，Schmidt?U，et?al.Adenoviral?gene?transfer?of?SERCA2a?improvesleft-ventricular?function?in?aortic-banded?rats?in?transition?to?heart?failure.Pro?NatAcad?Sci?2000；97：793-8。Pachori?AS，Numan?MT，Ferrario?CM，et?al.Bloodpressure-independent?attenuation?of?cardiac?hypertrophy?by?AT(1)R-AS?gene?therapy.Hypertension.2002?May；39(5)：969-75.Paradis，P.；Dali-Youcef，N.；Paradis，F.W.；etal：Overexpression?of?angiotensin?II?type?I?receptor?in?cardiomyocytes?inducescardiac?hypertrophy?and?remodeling.Proc.Nat.Acad.Sci.2000，97：931-936。Periasamy?M，Huke?S.SERCA?pump?level?is?a?critical?determinant?ofCa(2+)homeostasis?and?cardiac?contractility.J?Mol?Cell?Cardiol.2001；Jun；33(6)：1053-63.Schmidt?U，Monte?F，Miyamoto?MI，et?al.Restoration?of?diastolicfunction?in?senescent?rat?hearts?through?adenoviral?gene?transfer?of?sarcoplasmicreticulum?Ca2+-ATPase.Circulation?2000；101：790-6)。
1.1 treatment is in heart failure, at target gene A be: phospholamban gene (phospholamban).
SHRNA1 at phospholamban gene (PHOSPHOLAMBAN): its coding region is the 59-79 of phospholamban gene, and sequence is GCCCCAGCAAGCGCGTCAGAA, and the code in the nucleotide sequence of electronic edition is sequence-1.
The sequence that adopts big adapter method designing institute to obtain on the basis of this coding region is: 5 '-CGCCCCAGCAAGCGCGTCAGAACTATCGTACTTCTGACGCGCTTGCTGGGGCTTTT TAGATC-3 ', the code in the nucleotide sequence of electronic edition are sequence-24.
ShRNA2 at phospholamban gene (phospholamban): its coding region is the 73-93 of phospholamban gene, and sequence is GTCAGAACCTCCAGAACCTCT, and the code in the nucleotide sequence of electronic edition is sequence-2.The loop ring is used GGACTCGAT.Downstream primer: 5 '-AAAAAGTCAGAACCTCCAGAACCTCTGGACTCGATAGAGGTTCTGGAGGTTCTGAC GGTGTTTCGTCCTTTCCACAA-3 ', the code in the nucleotide sequence of electronic edition are sequence-25.Below in each shRNAi method the loop ring all adopt TCAAGCTTC (including the HindIII site).
ShRNA3 at phospholamban gene (phospholamban): its coding region is the 59-78 of phospholamban gene, and sequence is GCCCCAGCAAGCGCGTCAGA, and the code in the nucleotide sequence of electronic edition is sequence-3.Downstream primer: 5 '-AAAAAGACATATCAAGATGAGACAGATCAAGCTTCTCTGTCTCATCTTGATATGTC GGTGTTTCGTCCTTTCCACAA-3 ', the code in the nucleotide sequence of electronic edition are sequence-26.
LhRNA at phospholamban gene (phospholamban):
Carry out pcr amplification with Short sence primer and two primers of Antisence primer, the short segmental length of the lhRNA at phospholamban gene (phospholamban) that obtains is 535bp.
Carry out pcr amplification with Long sence primer and two primers of Antisence primer, the length at the lhRNA long segment of phospholamban gene (phospholamban) that obtains is 652bp.
Carry out pcr amplification with Short sence primer and two primers of Antisence primer, the lhRNA that obtains at phospholamban gene (phospholamban), long and short fragment head, prime minister are connect, and the disconnected head and the tail that form new lhRNA of two tails are connected in carrier with the restriction enzyme site that designs.
Short sence primer:AAGT CCAATACCTT ACTCGC (coding region 7-26) short-movie section, the code in the nucleotide sequence of electronic edition is sequence-4.
Antisence primer:AAAA GTGGT GGCAA CGCAG, the code in the nucleotide sequence of electronic edition is sequence-5.
Long sence primer:TAAA AGGAG ACAGC TCGCG long segment, the code in the nucleotide sequence of electronic edition is sequence-6.
1.2 treatment hypertension, target gene B: the hypertensin 2 receptor type 1 (angiotensin receptor 1, ATR1)
ShRNA4:GCTGAAGACTGTGGCCAGTGT (coding region 174-194), the code in the nucleotide sequence of electronic edition is sequence-7.Downstream primer: 5 '-GGATCCAAAAACTGAAGACTGTGGCCAGTGTTCAAGCTTCACACTGGCCACAGTCT TCAGGGTGTTTCGTCCTTTCCACAA-3 ', the code in the nucleotide sequence of electronic edition are sequence-27.
Embodiment 2
The recombinant adeno-associated virus that is used for the treatment of the induced RNAi approach of tumour:
By the progress relevant to tumor disease 7,9,11,13,14,15,27,29,32,34Analysis, the design below we have carried out.
2.1 target gene C: VEGF-165 (vascular endothelial growth factor, VEGF)
ShRNA5:GTCTATCAGCGCAGCTACTGC (coding region 136-156), the code in the nucleotide sequence of electronic edition is sequence-7.Downstream primer: 5 '-GGATCCAAAAAGTCTATCAGCGCAGCTACTGCTCAAGCTTCGCAGTAGCTGCGCTG ATAGACGGTGTTTCGTCCTTTCCACAA-3 ', the code in the nucleotide sequence of electronic edition are sequence-28.
ShRNA6:GTGGACATCTTCCAGGAGTAC (coding region 175-195), the code in the nucleotide sequence of electronic edition is sequence-8.Downstream primer: 5 '-GGATCCAAAAAGTGGACATCTTCCAGGAGTACTCAAGCTTCGTACTCCTGGAAGAT GTCCACGGTGTTTCGTCCTTTCCACAA-3 ', the code in the nucleotide sequence of electronic edition are sequence-29.
ShRNA7:GCTACTGCCATCCAATCGAGACC (coding region 149-171), the code in the nucleotide sequence of electronic edition is sequence-9.Downstream primer: 5 '-GGATCCAAAAAGCTACTGCCATCCAATCGAGACCTCAAGCTTCGGTCTCGATTGGA TGGCAGTAGCGGTGTTTCGTCCTTTCCACAA-3 ', the code in the nucleotide sequence of electronic edition are sequence-30.
lhRNA：
Short sence primer:GAGGAGGGCAGAATCATCACGA (coding region 95-116), the code in the nucleotide sequence of electronic edition is sequence-10.
Antisence primer:GCCTTGCAACGCGAGTCTGT (coding region 502-521), the code in the nucleotide sequence of electronic edition is sequence-11.
Long sence primer:CAATGACGAGGGCCTGGAGTG (coding region 261-281), the code in the nucleotide sequence of electronic edition is sequence-12.Long segment 426bp short-movie section 260bp.
2.2 target gene D: cyclin D1 (cyclin D1)
ShRNA8:GAAGATCGTCGCCACCTGGAT (coding region 171-191), the code in the nucleotide sequence of electronic edition is sequence-13.Downstream primer: 5 '-GGATCCAAAAAGAAGATCGTCGCCACCTGGATTCAAGCTTCATCCAGGTGGCGACG ATCTTCGGTGTTTCGTCCTTTCCACAA-3 ', the code in the nucleotide sequence of electronic edition are sequence-31.
ShRNA9:GAGGTCTGCGAGGAACAGAAG (coding region 196-216), the code in the nucleotide sequence of electronic edition is sequence-14.Downstream primer: 5 '-GGATCCAAAAAGAGGTCTGCGAGGAACAGAAGTCAAGCTTCCTTCTGTTCCTCGCA GACCTCGGTGTTTCGTCCTTTCCACAA-3 ', the code in the nucleotide sequence of electronic edition are sequence-32.
ShRNA10:GAACAGAAGTGCGAGGAGGAG (coding region 208-228), the code in the nucleotide sequence of electronic edition is sequence-15.Downstream primer: 5 '-GGATCCAAAAAGAACAGAAGTGCGAGGAGGAGTCAAGCTTCCTCCTCCTCGCACTT CTGTTCGGTGTTTCGTCCTTTCCACAA-3 ', the code in the nucleotide sequence of electronic edition are sequence-33.
lhRNA
Short sence primer:CGCGCCCTCGGTGTCCTACTTCA (coding region 141-136) 510bp, the code in the nucleotide sequence of electronic edition is sequence-16.
Antisence primer:ACGCTCCCCGCTGCCACCAT (coding region 604-623), the code in the nucleotide sequence of electronic edition is sequence-17.
Long sence primer:GCTGCGGGCCATGCTGAAGG (coding region 81-100) 543bp, the code in the nucleotide sequence of electronic edition is sequence-18.Long segment 543bp short-movie section 510bp.
2.3 target gene E: the telomerase RNA composition (Telomerase RNA, TR)
We have adopted the serial arrangement of the two shRNAs of double-H groove weld 6 promotors under controlling respectively in vector construction.
ShRNA11:GCCTTCCACCGTTCATTCTAG (coding region 98-118), the code in the nucleotide sequence of electronic edition is sequence-19.Downstream primer: 5 '-GGATCCAAAAAGCCTTCCACCGTTCATTCTAGTCAAGCTTCCTAGAATGAACGGTG GAAGGCGGTGTTTCGTCCTTTCCACAA-3 ', the code in the nucleotide sequence of electronic edition are sequence-34.
ShRNA12:GAAGAGTTGGGCTCTGTCAGC (coding region 255-275), the code in the nucleotide sequence of electronic edition is sequence-20.Downstream primer: 5 '-GGATCCAAAAAGAAGAGTTGGGCTCTGTCAGCTCAAGCTTCGCTGACAGAGCCCAA CTCTTCGGTGTTTCGTCCTTTCCACAA-3 ', the code in the nucleotide sequence of electronic edition are sequence-35.
2.4 target gene F: Telomerase reverse transcription component (telomerase reverse transcriptase, TERT)
We have adopted the serial arrangement of the two shRNAs (shRNA11 and shRNA13) of double-H groove weld 6 promotors under controlling respectively in vector construction.
ShRNA13:GTGTCCTGCCTGAAGGAGCTG (coding region 220-240), the code in the nucleotide sequence of electronic edition is sequence-21.Downstream primer: 5 '-GGATCCAAAAAGTGTCCTGCCTGAAGGAGCTGTCAAGCTTCCAGCTCCTTCAGGCA GGACACGGTGTTTCGTCCTTTCCACAA-3 ', the code in the nucleotide sequence of electronic edition are sequence-36.
Embodiment 3
The recombinant adeno-associated virus that is used for the treatment of the induced RNAi approach of autoimmune disease:
The treatment rheumatoid arthritis, target gene tumour necrosis factor (tumor necrosis factor α, TNF-α).
ShRNA14:GTGGAGCTGAGAGATAACCAG (coding region 121-141), the code in the nucleotide sequence of electronic edition is sequence-22.Downstream primer: 5 '-GGATCCAAAAAGTGGAGCTGAGAGATAACCAGTCAAGCTTCCTGGTTATCTCTCAG CTCCACGGTGTTTCGTCCTTTCCACAA-3 ', the code in the nucleotide sequence of electronic edition are sequence-37.
ShRNA15:GATAACCAGCTGGTGGTGCCA (coding region 133-153), the code in the nucleotide sequence of electronic edition is sequence-23.Downstream primer: 5 '-GGATCCAAAAAGATAACCAGCTGGTGGTGCCATCAAGCTTCTGGCACCACCAGCTG GTTATCGGTGTTTTCGTCCTTTCCACAA-3 ', the code in the nucleotide sequence of electronic edition are sequence-38.

Claims (9)

1. the class recombinant adeno-associated virus that carried specific RNAi nucleotide fragments is made of following composition:
1) recombinant adeno-associated virus shell;
2) specific RNAi nucleotide fragments;
3) the specific RNAi nucleotide fragments that carries is transcribed, the regulation and control unit of expression regulation to wrapping up in the recombinant adeno-associated virus shell.
2. according to claim 1, the recombinant adeno-associated virus shell derives from 2 type adeno-associated viruses.
3. according to claim 1, the recombinant adeno-associated virus shell derives from 1 type adeno-associated virus.
4. according to claim 1, the entrained specific RNAi nucleotide fragments of recombinant adeno-associated virus is at cardiovascular disorder;
5. according to claim 1, the entrained specific RNAi nucleotide fragments of recombinant adeno-associated virus is at tumour;
6. according to claim 4, at the nucleotide sequence feature of the specific ShRNAi nucleotide fragments of cardiovascular disorder be: 5 '-GCCCCAGCAAGCGCGTCAGAA-3 '.
7. according to claim 5, be at the nucleotide sequence feature of the specific RNAi nucleotide fragments of tumor disease:
5’-GTCTATCAGCGCAGCTACTGC-3’。
8. according to claim 1, to specific RNAi nucleotide fragments transcribe, the unitary structure of regulation and control of expression regulation is: the AAV carrier of the formed shRNA product under U6 snRNA or the control of H1RNA promotor.
9. according to claim 1, the recombinant adeno-associated virus that has carried specific RNAi nucleotide fragments can be used for the treatment of various diseases.
CNA021493197A 2002-11-07 2002-11-07 Serial recombined gland related virus inducible path of RNAi, and utilized in gene therapy Pending CN1498964A (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CNA021493197A CN1498964A (en) 2002-11-07 2002-11-07 Serial recombined gland related virus inducible path of RNAi, and utilized in gene therapy
AU2003284795A AU2003284795A1 (en) 2002-11-07 2003-11-07 Series of recombinant adeno-associated virus useful for inducing rnai pathway and gene therapy
PCT/CN2003/000939 WO2004063380A1 (en) 2002-11-07 2003-11-07 Series of recombinant adeno-associated virus useful for inducing rnai pathway and gene therapy

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CNA021493197A CN1498964A (en) 2002-11-07 2002-11-07 Serial recombined gland related virus inducible path of RNAi, and utilized in gene therapy

Publications (1)

Publication Number Publication Date
CN1498964A true CN1498964A (en) 2004-05-26

Family

ID=32686813

Family Applications (1)

Application Number Title Priority Date Filing Date
CNA021493197A Pending CN1498964A (en) 2002-11-07 2002-11-07 Serial recombined gland related virus inducible path of RNAi, and utilized in gene therapy

Country Status (3)

Country Link
CN (1) CN1498964A (en)
AU (1) AU2003284795A1 (en)
WO (1) WO2004063380A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2225002A1 (en) * 2007-12-31 2010-09-08 NanoCor Therapeutics, Inc. Rna interference for the treatment of heart failure

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105251024A (en) 2004-08-23 2016-01-20 西伦蒂斯私人股份公司 Treatment of eye disorders
CN111235150B (en) * 2020-03-11 2020-10-27 苏州世诺生物技术有限公司 shRNA for inhibiting replication of African swine fever virus and application thereof

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6797505B2 (en) * 1998-05-27 2004-09-28 Cell Genesys, Inc. Recombinant AAV vectors for gene therapy of hemophilia A
AU3642601A (en) * 1999-11-05 2001-05-30 Avigen, Inc. Ecdysone-inducible adeno-associated virus expression vectors
WO2001075164A2 (en) * 2000-03-30 2001-10-11 Whitehead Institute For Biomedical Research Rna sequence-specific mediators of rna interference
WO2001094605A2 (en) * 2000-06-09 2001-12-13 University Of Florida Research Foundation, Inc. Recombinant aav vectors for gene therapy of obesity

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2225002A1 (en) * 2007-12-31 2010-09-08 NanoCor Therapeutics, Inc. Rna interference for the treatment of heart failure
EP2225002A4 (en) * 2007-12-31 2011-06-22 Nanocor Therapeutics Inc Rna interference for the treatment of heart failure

Also Published As

Publication number Publication date
AU2003284795A1 (en) 2004-08-10
WO2004063380A1 (en) 2004-07-29

Similar Documents

Publication Publication Date Title
Lu et al. Adenovirus VA1 noncoding RNA can inhibit small interfering RNA and MicroRNA biogenesis
An et al. Optimization and functional effects of stable short hairpin RNA expression in primary human lymphocytes via lentiviral vectors
Langlois et al. Cytoplasmic and nuclear retained DMPK mRNAs are targets for RNA interference in myotonic dystrophy cells
Ren et al. Two white spot syndrome virus microRNAs target the dorsal gene to promote virus infection in Marsupenaeus japonicus shrimp
CN101755049B (en) Primary micro RNA expression cassette
JP2004357708A (en) Inhibition of gene expression by delivery of specially selected double stranded or other form small interfering rna precursor enabling formation and function of small interfering rna in vivo and in vitro
CN1860127A (en) Inhibition of SyK kinase expression
Tchoubrieva et al. Vector-based RNA interference of cathepsin B1 in Schistosoma mansoni
Xue et al. Role of chymotrypsin-like serine proteinase in white spot syndrome virus infection in Fenneropenaeus chinensis
Garraway et al. Design and evaluation of small interfering RNAs that target expression of the N-methyl-D-aspartate receptor NR1 subunit gene in the spinal cord dorsal horn
Lin et al. Cellular Lnc_209997 suppresses Bombyx mori nucleopolyhedrovirus replication by targeting miR‐275‐5p in B. mori
Kajla et al. Anopheles stephensi heme peroxidase HPX15 suppresses midgut immunity to support Plasmodium development
EP1505152A1 (en) EXPRESSION SYSTEMS FOR STEM LOOP RNA MOLECULE HAVING RNAi EFFECT
JP6789513B2 (en) How to release the suppression of egg maturation of useful shrimp
Chen et al. Shrimp antiviral mja-miR-35 targets CHI3L1 in human M2 macrophages and suppresses breast cancer metastasis
Su et al. The cytomegalovirus promoter-driven short hairpin RNA constructs mediate effective RNA interference in zebrafish in vivo
CN1498964A (en) Serial recombined gland related virus inducible path of RNAi, and utilized in gene therapy
Jia et al. Regulation of VIH by miR-277 in the eyestalk of mud crab Scylla paramamosain
CN111808858B (en) siRNA sequence and application of target thereof in improving PEDV (porcine reproductive and respiratory syndrome Virus) toxicity
Liao et al. Effects of overexpression and inhibited expression of thymosin, an actin‐interacting protein from Bombyx mori, on BmNPV proliferation and replication
Sushma et al. In vitro silencing of Acetyl-CoA carboxylase beta (ACACB) gene reduces cholesterol synthesis in knockdown chicken myoblast cells
Qian et al. Bmo‐miR‐2780a regulates the expression of the sericin‐1 gene of Bombyx mori
WO2004016780A1 (en) Adeno-associated virus vector inhibiting gene's function by rnai
Zhu et al. Construction and identification of mouse RelB siRNA-expressing lentiviral vectors
CN1820074A (en) SiRNA expression system

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication