CN1493590A - Polypeptide-human cell disintegrate regulatory protein 27 and polynucleotide for coding said polypeptide - Google Patents
Polypeptide-human cell disintegrate regulatory protein 27 and polynucleotide for coding said polypeptide Download PDFInfo
- Publication number
- CN1493590A CN1493590A CNA02137726XA CN02137726A CN1493590A CN 1493590 A CN1493590 A CN 1493590A CN A02137726X A CNA02137726X A CN A02137726XA CN 02137726 A CN02137726 A CN 02137726A CN 1493590 A CN1493590 A CN 1493590A
- Authority
- CN
- China
- Prior art keywords
- polynucleotide
- polypeptide
- cell division
- human cell
- regulation protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
A novel polypeptide-human cell division regulating protein 27, the polynucleotide for coding it, the process for preparing said polypeptide by DNA recombination, the application of said polypeptide in treating diseases, such as cancer, HIV infection, immunopathy, etc. the antagonist of said polypeptide and its medical action, and the application of said polynucleotide are disclosed.
Description
Technical field
The invention belongs to biological technical field, specifically, the invention describes a kind of polypeptide-human cell division regulation protein 27, and the polynucleotide sequence of this polypeptide of encoding.The invention still further relates to the preparation method and the application of these polynucleotide and polypeptide.
Background technology
Studies have shown that for many years, golgi body is relevant with emiocytosis.In vivo, some secreted proteins are discharged cell by golgi body, and golgi body is the biosynthetic main place of carbohydrate, as finish the sulfation etc. of synthetic and glycosaminoglycan of synthetic, the polysaccharide of glycoprotein.
Golgi body also is the sorting and the sending station of endoplasmic reticulum (ER) product, and its institute's synthetic carbohydrate, significant proportion are to be connected on ER next protein and lipid as the oligosaccharides side chain.Some oligosaccharides group serves as a mark and instructs specific protein to lysosome or other positions.
A variety of glycosyltransferases, phosphoric acid (ester) enzyme, casein phosphokinase or the like are arranged in the golgi body.Wherein, glycosyltransferase is the feature enzyme that golgi body has, and it can be transferred to oligose and form glycoprotein on the protein.For example, cell division regulation protein, galactotransferase, N-acetylglucosamine transferase, galactosyl-N-acetylglucosamine transferase etc.
Experiment showed, that many glycoprotein have the oligonucleotide chain that N-connects, the oligosaccharides that also has tool O-to connect.Back one class glycoprotein mainly or all is synthetic in golgi body, and the OH group of these proteinic tyrosine, Serine, threonine residues side chain and oligosaccharides covalent attachment, glycosylation form the oligosaccharides glycoprotein that O-connects.And synthetic beginning of the oligosaccharides glycoprotein that N-connects is in the ER chamber, and finishing the synthetic of glycoprotein is in golgi body.In the ER chamber, on the N atom of the amino group that is attached to protein amino-succinamic acid residue side chain of the oligosaccharides covalency that forms by N-acetylglucosamine, seminose, glucose, form the oligosaccharides glycoprotein that N-connects.Be transported to the suitable face combination with it of golgi body then through vesicles by ER, a series of effects through mannosidase, N-acetylglucosamine transferase,, finished the synthetic of glycoprotein after galactotransferase, cell division regulation protein effect add semi-lactosi and sialic acid.This reaction process mensuration, the biochemical analysis of enzymic activity is confirmed.
Glycosphingolipid is a kind of ceramide that carbohydrate is arranged on primary hydroxyl, and often the part that links to each other with glycosphingolipid is called Sphingolipids,sialo, and these materials also contain one or more N-n acetylneuraminic acid ns (sialic acid) except other carbohydrates.Sphingolipids,sialo are at first separated from nervous tissue, in most animal tissuess discovery are arranged afterwards, and sphingolipid plays protection and isolates the vital role of nerve fiber.
In the building-up process of glycoprotein, cell division regulation protein can the following reaction of catalysis:
Cmp sialic acid+substrate---CMP+ substrate-sialic acid (product)
From people's melanoma cells, be cloned into a kind of cell division regulation protein, be called the GD3 synthase, be also referred to as NeuAc alpha 2-3Gal beta 1-4Glc beta 1-1 alpha 2,8-cell division regulation protein (GM3alpha 2, the 8-cell division regulation protein).Its effect substrate is a NeuAc alpha 2-3Gal beta 1-4Glcbeta 1-1 ceramide (hematoside), and the GD3 synthase plays main regulating and controlling effect in the biosynthetic process of Sphingolipids,sialo.This is one 341 amino acid whose albumen, at its N-terminal a special membrane spaning domain is arranged, it has the conserved domain that two cell division regulation protein family members are had jointly simultaneously, particularly it has the sialyl structural domain, and this is all members' of cell division regulation protein family feature structure territory.The encoding gene of a kind of GD3 synthase that is obtained is located in the p12.1-p11.2 place on people's the 12nd karyomit(e), and the description of concrete structure sees also pertinent literature.(Proc?Natl?Acad?Sci?USA1994?Aug?16;91(17):7952-6);(J?Biol?Chem?1994?Jun?3;269(22):15950-6);(Genomics?1996?Feb?15;32(1):137-9)
According to discovering, the activity of GD3 synthase may be restricted to growth course early stage, and clearly, it is formed with extremely important meaning for neural growth.(J Biol Chem 1985 Oct15; 260 (23): 12695-9) according to research to the GD3 synthase of from the tire brain cDNA library of mouse, being cloned into, find its mRNA in brain be expressed in fetal development to 15-18 days the time reach the highest, results of in situ hybridization shows that GD 3 synthase are expressed at brain and the retina camber of mouse embryonic stage.In the mouse that grows up, the GD3 synthase is found existence in tissues such as pallium, cerebellum, inferior colliculus chamber.(J?Biochem(Tokyo)1996Nov;120(5):1020-7)
Some tumor cell line and the nervous tissue cell in the existence of GD3 synthase is all arranged, such as, find all that in cells such as leukemia cell line, the strain of adult T cell relevant cell the level of mRNA of GD3 synthase is high especially.All experimental results show that the GD3 synthase has extremely important meaning with generation, development that the neural growth of regulation and control formed, kept protection and some tumour.(Glycoconj?J?1995Dec;12(6):894-900);(Glycoconj?J?1995?Dec;12(6):829-37)
According to amino acid homology result relatively, polypeptide of the present invention is accredited as a kind of new human cell division regulation protein 27 (HST27) by deduction, its homologous protein is a kind of NeuAc α 2-3Gal beta 1-4Glc β 1-1 α 2 that has found, 8-cell division regulation protein (GM3 α 2, the 8-cell division regulation protein), its albumen number is D26360.
Because human cell division regulation protein 27 albumen play an important role in regulating body critical functions such as cell fission and fetal development as mentioned above, and believe and relate to a large amount of albumen in these regulate processes, thereby need to identify human cell division regulation protein 27 albumen of more these processes of participation in this area always, particularly identify this proteic aminoacid sequence.The separation of new human cell division regulation protein 27 protein coding genes also provides the foundation for determining the effect of this albumen under healthy and morbid state.This albumen may constitute the basis of exploitation medical diagnosis on disease and/or curative, and it is very important therefore separating its coding DNA.
Summary of the invention
An object of the present invention is to provide isolating new polypeptide-human cell division regulation protein 27 with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of this polypeptide of coding.
Another object of the present invention provides the recombinant vectors of the polynucleotide that contain the human cell division regulation protein 27 of encoding.
Another object of the present invention provides the genetically engineered host cell of the polynucleotide that contain the human cell division regulation protein 27 of encoding.
Another object of the present invention provides the method for producing human cell division regulation protein 27.
Another object of the present invention provides the antibody at polypeptide-human cell division regulation protein 27 of the present invention.
The present invention relates to a kind of isolated polypeptide, this polypeptide is the people source, and it comprises: have<polypeptide or its examples of conservative variations, bioactive fragment or the derivative of 210〉2 aminoacid sequences.Preferably, this polypeptide is to have<polypeptide of 210〉2 aminoacid sequences.
The invention still further relates to a kind of isolating polynucleotide, it comprises a kind of nucleotide sequence or its variant that is selected from down group:
(a) coding has<polynucleotide of the polypeptide of 210〉2 aminoacid sequences;
(b) with polynucleotide (a) complementary polynucleotide;
(c) with (a) or polynucleotide sequence (b) have the polynucleotide of at least 70% homogeny.
More preferably, the sequence of these polynucleotide is be selected from down group a kind of: (a) have<210〉1 in the sequence of 91-834 position; (b) have<210〉1 in the sequence of 1-2008 position.
The present invention relates to a kind of carrier that contains polynucleotide of the present invention, particularly expression vector in addition; The host cell that this carrier of a kind of usefulness is genetically engineered comprises the host cell of conversion, transduction or transfection; A kind of method for preparing polypeptide of the present invention of cultivating described host cell and reclaiming expression product that comprises.
The invention still further relates to a kind of can with polypeptid specificity bonded antibody of the present invention.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
The invention provides isolating nucleic acid (polynucleotide), substantially by coding have<polynucleotide of the polypeptide of 210〉2 aminoacid sequences form.Polynucleotide sequence of the present invention comprises<210〉1 nucleotide sequence.Polynucleotide of the present invention are to find from the cDNA library of people's fetal brain tissue.The polynucleotide sequence total length that it comprises is 2008 bases, its open reading frame (91-834) 247 amino acid of having encoded.Relatively find according to amino acid sequence homologous, this polypeptide and GM3 α 2, the 8-cell division regulation protein has 46% homology, and deducibility goes out this human cell division regulation protein 27 and has GM3 α 2, the 26S Proteasome Structure and Function that the 8-cell division regulation protein is similar.
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in<210〉1 or the varient of degeneracy.As used herein, " varient of degeneracy " are meant that in the present invention coding has<210〉2 protein or polypeptide, but with the differentiated nucleotide sequence of coding region sequence shown in<210〉1.
The polynucleotide of the mature polypeptide of coding<210〉2 comprise: the encoding sequence that has only mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
The invention still further relates to the varient of foregoing description polynucleotide, its coding has the polypeptide of identical aminoacid sequence or segment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and the polynucleotide (have at least 50% between two sequences, preferably have 70% homogeny) of sequence hybridization described above.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time adds and to use denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 95%, be more preferably 97% and just hybridize when above.And, the polypeptide of interfertile polynucleotide encoding and<210〉and the mature polypeptide shown in 2 has identical biological function and activity.
The invention still further relates to nucleic acid fragment with sequence hybridization described above.As used herein, " nucleic acid fragment " length contain 10 Nucleotide at least, better be 20-30 Nucleotide at least, be more preferably 50-60 Nucleotide at least, preferably more than at least 100 Nucleotide.Nucleic acid fragment also can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding human cell division regulation protein 27.
Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.
The special polynucleotide sequence of coding human cell division regulation protein 27 of the present invention can obtain with several different methods.For example, separate polynucleotide with hybridization technique well known in the art.These technology including, but not limited to: 1) with probe and genome or the hybridization of cDNA library to detect homologous polynucleotide sequence and 2) antibody screening of expression library to be to detect the polynucleotide passage of the clone with common structure feature.
Sequence dna fragment of the present invention also can obtain with following method: 1) separate double chain DNA sequence from genomic dna; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of described polypeptide.
In the above-mentioned method of mentioning, isolation of genomic DNA is least commonly used.The direct chemical of dna sequence dna is synthetic to be the method for often selecting for use.The more frequent method of selecting for use is the separation of cDNA sequence.The standard method that separates interested cDNA is from the donorcells separating mRNA of this gene of high expression level and carries out reverse transcription, forms plasmid or phage cDNA library.Extract the existing multiple proven technique of method of mRNA, test kit also can obtain (Qiagene) from commercial channels.And the construction cDNA library also is usual method (Sambrook, et al., MolecularCloning, A Laboratory Manual, Cold Spring Harbor Laboratory.New York, 1989).Also can obtain the cDNA library of commercial offers, as the different cDNA library of Clontech company.When being used in combination the polymeric enzyme reaction technology, even few expression product also can be cloned.
Available ordinary method is screened gene of the present invention from these cDNA libraries.These methods include, but is not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) appearance of marker gene function or forfeiture; (3) level of the transcript of mensuration human cell division regulation protein 27; (4), detect the protein product of genetic expression by immunological technique or mensuration biologic activity.Aforesaid method can singly be used, but also several different methods combined utilization.
In (1) kind method, hybridizing used probe is and any a part of homology of polynucleotide of the present invention that at least 10 Nucleotide of its length better are at least 30 Nucleotide, are more preferably at least 50 Nucleotide, preferably at least 100 Nucleotide.In addition, within 2000 Nucleotide, preferable is within 1000 Nucleotide to the length of probe usually.Probe used herein is the dna sequence dna of chemosynthesis on the basis of gene order information of the present invention normally.Gene of the present invention itself or fragment are certainly as probe.The mark of dna probe can be used radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.
In (4) kind method, detect the protein product of human cell division regulation protein 27 genetic expressions and can use immunological technique such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA) etc.
Use method (Saiki, the et al.Science1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to polynucleotide sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The gene of the present invention that obtains as mentioned above, perhaps the polynucleotide sequence of various dna fragmentations etc. can with ordinary method such as dideoxy chain termination (Sanger et al.PNAS, 1977,74:5463-5467) measure.This class polynucleotide sequence is measured also available commercial sequencing kit etc.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, just can be spliced into the cDNA sequence of total length.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and with carrier of the present invention or directly with the host cell of human cell division regulation protein 27 encoding sequences through the genetically engineered generation, and the method that produces polypeptide of the present invention through recombinant technology.
Among the present invention, the polynucleotide sequence of coding human cell division regulation protein 27 can be inserted in the carrier, contains the recombinant vectors of polynucleotide of the present invention with formation.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on the T7 promotor of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier may be used to make up recombinant expression vector.A key character of expression vector is to contain replication origin, promotor, marker gene and translational control element usually.
Method well-known to those having ordinary skill in the art can be used to make up the dna sequence dna that contains the human cell division regulation protein 27 of encoding and the expression vector of suitable transcribing/translational control element.These methods comprise (Sambroook, et al.Molecular Cloning, aLaboratory Manual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; The PL promotor of lambda particles phage; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in prokaryotic cell prokaryocyte or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site that translation initiation is used and transcription terminator etc.Inserting enhancer sequence in carrier will make its transcribing in higher eucaryotic cells be enhanced.Enhanser is the cis acting factor that DNA expresses, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance etc.
Persons skilled in the art all know how to select appropriate carriers/transcriptional regulatory element (as promotor, enhanser etc.) and selected marker.
Among the present invention, the polynucleotide of coding human cell division regulation protein 27 or the recombinant vectors that contains these polynucleotide can transform or transduce into host cell, contain the genetically engineered host cell of these polynucleotide or recombinant vectors with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; Bacterial cell such as Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.
Can carry out with routine techniques well known to those skilled in the art with dna sequence dna of the present invention or the recombinant vectors transformed host cell that contains described dna sequence dna.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Alternative is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.
By the recombinant DNA technology of routine, utilize polynucleotide sequence of the present invention to can be used to express or produce human cell division regulation protein 27 (Science, 1984 of reorganization; 224:1431).In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention people human cell division regulation protein 27, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;
(2). in suitable medium, cultivate host cell;
(3). separation, protein purification from substratum or cell.
In step (2), according to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
In step (3), recombinant polypeptide can wrap and be expressed or be secreted into the extracellular in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.These methods include, but are not limited to: conventional renaturation is handled, protein precipitant is handled (salt analysis method), centrifugal, the broken bacterium of infiltration, the combination of ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
Polypeptide of the present invention (human cell division regulation protein 27) is a kind of cell division regulation protein, and its basic function is the transfer that helps sialic acids groups.Therefore, human cell division regulation protein 27 of the present invention can have effect in a lot of important vital processes, comprising: synthetic etc. significant for synthetic, the polysaccharide of finishing glycoprotein; In the biosynthetic process of Sphingolipids,sialo, play main regulating and controlling effect; Some tumour of generation, development form, keep protection and to(for) the neural growth of regulation and control have extremely important meaning; Polypeptide of the present invention has important effect in embryo development procedure; Polypeptide of the present invention plays an important role or the like to Progeroid and Ehlers-Danlos syndromes, the connective tissue disease etc. that cause that are affected of the biosynthesizing owing to protein-polysaccharide.
The present invention also provides SCREENED COMPOUND to identify the method that improves (agonist) or check the medicament of (antagonist) human cell division regulation protein 27.Agonist improves human cell division regulation protein 27 biological function such as stimulate cellular proliferation, and antagonist prevention disorder such as the various cancer relevant with cell hyperproliferation with treatment.For example, can in the presence of medicine, the film preparation of mammalian cell or expressing human cell division regulation protein 27 be cultivated with the human cell division regulation protein 27 of mark.Measure the medicine raising then or check this interactional ability.
The antagonist of human cell division regulation protein 27 comprises antibody, compound, acceptor disappearance thing and the analogue etc. that filter out.The antagonist of human cell division regulation protein 27 can combine and eliminate its function with human cell division regulation protein 27, or suppresses the generation of this polypeptide, or combines with the avtive spot of this polypeptide and to make this polypeptide can not bring into play biological function.
In screening during as the compound of antagonist, human cell division regulation protein 27 can be added in the bioanalysis mensuration, interactional influence between human cell division regulation protein 27 and its acceptor be determined whether compound is antagonist by measuring compound.With the same quadrat method of above-mentioned SCREENED COMPOUND, can filter out the acceptor disappearance thing and the analogue of antagonist action.Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with human cell division regulation protein 27 bonded peptide molecules obtains.During screening, generally tackle human cell division regulation protein 27 molecules and carry out mark.
The invention provides and use polypeptide, and fragment, derivative, analogue or their cell are as the method for antigen with production antibody.These antibody can be polyclonal antibody or monoclonal antibody.The present invention also provides the antibody at human cell division regulation protein 27 antigenic determinants.These antibody include, but is not limited to: the fragment that polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fab fragment and Fab expression library produce.
The method of the available human cell division regulation protein 27 direct injection immune animals of the production of polyclonal antibody (as rabbit, mouse, rat etc.) obtains, and multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.The technology of monoclonal antibody of preparation human cell division regulation protein 27 include but not limited to hybridoma technology (Kohler and Milstein.Nature, 1975,256:495-497), three knurl technology, people B-quadroma technology, EBV-hybridoma technology etc.With the variable region bonded chimeric antibody in human constant region and inhuman source can with existing technology production (Morrison et al, PNAS, 1985,81:6851).And the technology of existing manufacture order chain antibody (U.S.Pat No.4946778) also can be used for producing the single-chain antibody of anti-human cell division regulation protein 27.
The antibody of anti-human cell division regulation protein 27 can be used in the immunohistochemistry technology, detects the human cell division regulation protein 27 in the biopsy specimen.
With the also available labelled with radioisotope of human cell division regulation protein 27 bonded monoclonal antibodies, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.
Antibody also can be used for designing the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of human cell division regulation protein 27 high-affinities can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing human cell division regulation protein 27 positive cells.
The disease that antibody among the present invention can be used for treating or prevention and human cell division regulation protein 27 are relevant.The antibody that gives suitable dosage can stimulate or block the generation or the activity of human cell division regulation protein 27.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization human cell division regulation protein 27 levels.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.Human cell division regulation protein 27 levels that detected in the test can be with laying down a definition the importance of human cell division regulation protein 27 in various diseases and be used to the disease of diagnosing human cell division regulation protein 27 to work.
Polypeptide of the present invention also can be used as the peptide spectrum analysis, for example, the polypeptide available physical, chemistry or enzyme carry out the specificity cutting, and carries out the two-dimentional or three-dimensional gel electrophoresis analysis of one dimension, be more preferably and carry out mass spectroscopy.
The polynucleotide of coding human cell division regulation protein 27 also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the nothing expression of human cell division regulation protein 27 or the unusual/non-activity expression.The gene therapy vector (as virus vector) of reorganization can be designed for the human cell division regulation protein 27 of expressing variation, to suppress endogenic human cell division regulation protein 27 activity.For example, a kind of human cell division regulation protein 27 of variation can be the human cell division regulation protein 27 that shortens, lacked signal conduction function territory, though can combine with the substrate in downstream, lacks signaling activity.Therefore the gene therapy vector of reorganization can be used for treating the disease of human cell division regulation protein 27 expression or active caused by abnormal.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the polynucleotide of coding human cell division regulation protein 27 are transferred in the cell.The method of recombinant viral vector that structure carries the polynucleotide of coding human cell division regulation protein 27 is found in existing document (Sambrook, et al.).The polynucleotide of reorganization coding human cell division regulation protein 27 can be packaged in the liposome and be transferred in the cell in addition.
Polynucleotide import tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.
Suppress the oligonucleotide (comprising sense-rna and DNA) of human cell division regulation protein 27mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.
The polynucleotide of coding human cell division regulation protein 27 can be used for the diagnosis with the relative disease of human cell division regulation protein 27.The unconventionality expression of the expression that the polynucleotide of coding human cell division regulation protein 27 can be used for detecting human cell division regulation protein 27 human cell division regulation protein 27 whether or under morbid state.As the dna sequence dna of the human cell division regulation protein 27 of encoding can be used for biopsy specimen is hybridized to judge the expression situation of human cell division regulation protein 27.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (Microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect human cell division regulation protein 27 with human cell division regulation protein 27 special primers.
The sudden change that detects human cell division regulation protein 27 genes also can be used for diagnosing the relevant disease of human cell division regulation protein 27.The form of human cell division regulation protein 27 sudden change comprises that the point mutation compared with normal wild type human cell division regulation protein 27DNA sequence, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
Sequence of the present invention identifies it also is valuable to karyomit(e).This sequence can be specifically at certain bar human chromosome particular location and and can with its hybridization.At present, need to identify the concrete site of each gene on the karyomit(e).Now, have only chromosomal marker thing seldom to can be used for the marker chromosomes position based on actual sequence data (repetition polymorphism).According to the present invention, for these sequences are associated with disease related gene, its important the first step is positioned these dna sequence dnas on the karyomit(e) exactly.
In brief, prepare PCR primer (preferred 15-35bp), sequence can be positioned on the karyomit(e) according to cDNA.Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.
The PCR localization method of somatocyte hybrid cell is that DNA is navigated to concrete chromosomal quick method.Use Oligonucleolide primers of the present invention,, can utilize one group to realize inferior location from specific chromosomal fragment or a large amount of genomic clone by similar approach.Other the similar strategy that can be used for chromosomal localization comprises in situ hybridization, uses the karyomit(e) prescreen and the hybridization preliminary election of the airflow classification of mark, thereby makes up the special cDNA storehouse of karyomit(e).
The cDNA clone is carried out fluorescence in situ hybridization (FISH) with Metaphase Chromosome, can in a step, accurately carry out chromosomal localization.The summary of this technology is referring to Verma etc., Human Chromosomes:a Manualof Basic Techniques, Pergamon Press, New York (1988).
In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, MendelianInheritance in Man (can by with the online acquisition of Johns Hopkins University Welch MedicalLibrary).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.
Then, need to measure ill and not cDNA between diseased individuals or genome sequence difference.If observe certain sudden change in some or all of diseased individuals, and this sudden change is not observed in any normal individual, then this sudden change may be the cause of disease of disease.More ill and diseased individuals not is usually directed at first seek the variation of structure in the karyomit(e), as from the horizontal visible of karyomit(e) or use based on detectable disappearance of the PCR of cDNA sequence or transposition.Resolving power according to present physical mapping and assignment of genes gene mapping technology, being accurately positioned to the cDNA of the chromosomal region relevant with disease, can be a kind of (the supposing that 1 megabasse mapping resolving power and every 20kb are corresponding to a gene) between 50 to 500 potential Disease-causing genes.
Polypeptide of the present invention, polynucleotide and stand-in thereof, agonist, antagonist and inhibitor and suitable pharmaceutical carrier combination back can be used.These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination.Composition comprises the polypeptide or the antagonist of safe and effective amount and carrier and the vehicle that does not influence effect of drugs.These compositions can be used as medicine and are used for disease treatment.
The present invention also provides medicine box or the test kit that contains one or more containers, and one or more medicinal compositions compositions of the present invention are housed in the container.With these containers, can have by the given indicative prompting of government authorities of making, using or selling medicine or biological products, the government authorities that this prompting reflects production, uses or sells permits it to use on human body.In addition, polypeptide of the present invention can be used in combination with other treatment compound.
Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, the nose or the route of administration of intracutaneous.Human cell division regulation protein 27 comes administration with the amount that treats and/or prevents concrete indication effectively.The amount and the dosage range that are applied to patient's human cell division regulation protein 27 will depend on many factors, as administering mode, person's to be treated healthiness condition and diagnostician's judgement.
Description of drawings
Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.
Fig. 1 is inventor's cell division regulation protein 27 and GM3 α 2, the amino acid sequence homology comparison diagram of 8-cell division regulation protein.The top sequence is a human cell division regulation protein 27, and the below sequence is GM3 α 2, the 8-cell division regulation protein.Same amino acid represents with monocase amino acid that between two sequences similar amino acid is represented with "+".
Fig. 2 is the polyacrylamide gel electrophoresis figure (SDS-PAGE) of isolating human cell division regulation protein 27.27kDa is proteinic molecular weight.The arrow indication is isolated protein band.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold SpringHarbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1: the clone of human cell division regulation protein 27
Extract the total RNA of people's tire brain with guanidinium isothiocyanate/phenol/chloroform single stage method.From total RNA, separate poly (A) mRNA with Quik mRNA Isolation Kit (Qiegene company product).2ug poly (A) mRNA forms cDNA through reverse transcription.CDNA fragment orientation is inserted on the multiple clone site of pBSK (+) carrier (Clontech company product) with Smart cDNA clone's test kit (available from Clontech), transforms DH5 α, bacterium forms the cDNA library.Measure all clones' 5 ' and 3 ' terminal sequence with Dye terminate cycle reaction sequencing kit (Perkin-Elmer company product) and ABI 377 automatic sequencers (Perkin-Elmer company).CDNA sequence and the existing public dna sequence data storehouse (Genebank) measured are compared, found that the cDNA sequence of one of them clone 1018D01 is new DNA.By synthetic a series of primers the contained insertion cDNA fragment of this clone is carried out two-way mensuration.The result shows, the contained full-length cDNA of 1018D01 clone is 2008bp (as<210〉1 shown in), from 91bp to 834bp the open reading frame (ORF) of a 744bp arranged, the new protein of encoding (as<210〉2 shown in).We are with this clone's called after pBS-1018D01, encoded protein matter called after human cell division regulation protein 27.
Embodiment 2:cDNA clone's homology retrieval
With the sequence and the encoded protein sequence thereof of human cell division regulation protein 27 of the present invention, with Blast program (Basiclocal Alignment search tool) [Altschul, SF et al.J.Mol.Biol.1990; 215:403-10], carry out the homology retrieval at databases such as Genbank, Swissport.The gene the highest with human cell division regulation protein 27 homologys of the present invention is a kind of known GM3 α 2, the 8-cell division regulation protein, and its encoded protein number is D26360 in the access of Genbank.Protein homology the results are shown in Fig. 1, both height homologies, and its homogeny is 46%; Similarity is 66%.
Embodiment 3: with the gene of RT-PCR method clones coding human cell division regulation protein 27
Total RNA is a template with fetus brain cell, is that primer carries out the synthetic cDNA of reverse transcription reaction with oligo-dT, with behind the test kit purifying of Qiagene, carries out pcr amplification with following primer:
Primer1:5’-TATGCAAATTTTAGAGCCAAACTTG-3’(<210>3)
Primer2:5’-AACTATATGTAAGTTTTATTAAAAT-3’(<210>4)
Primer1 for to be positioned at<the forward sequence that begins of 1bp of 210〉15 ' end;
Primer2 be<210〉1 in 3 ' end reverse sequence.
The condition of amplified reaction: in the reaction volume of 50 μ l, contain 50mmol/L KCl, 10mmol/LTris-Cl, (pH8.5), 1.5mmol/L MgCl
2, 200 μ mol/L dNTP, 10pmol primer, the Taq archaeal dna polymerase of 1U (Clontech company product).Go up by 25 cycles of following conditioned response at PE9600 type DNA thermal cycler (Perkin-Elmer company): 94 ℃ of 30sec; 55 ℃ of 30sec; 72 ℃ of 2min.When RT-PCR, establish the blank negative contrast of positive contrast of β-actin and template simultaneously.Amplified production is connected to (Invitrogen company product) on the pCR carrier with the test kit purifying of QIAGEN company with TA clone test kit.The dna sequence analysis result shows the dna sequence dna and<210 of PCR product〉1-2008bp shown in 1 is identical.
Embodiment 4:Northern blotting analyst cell division regulation protein 27 expression of gene:
Extract total RNA[Anal.Biochem 1987,162,156-159 with single stage method].This method comprises acid guanidine thiocyanate phenol-chloroform extracting.Promptly use 4M guanidinium isothiocyanate-25mM Trisodium Citrate, 0.2M sodium acetate (pH4.0) carries out homogenate to tissue, adds the phenol of 1 times of volume and the chloroform-primary isoamyl alcohol (49: 1) of 1/5 volume, and is centrifugal after mixing.The sucking-off aqueous phase layer adds Virahol (0.8 volume) and with the centrifugal RNA precipitation that obtains of mixture.With RNA precipitation 70% washing with alcohol that obtains, dry and soluble in water.With 20 μ g RNA, on 1.2% sepharose that contains 20mM 3-(N-morpholino) propanesulfonic acid (pH7.0)-5mM sodium acetate-1mM EDTA-2.2M formaldehyde, carry out electrophoresis.Be transferred on the nitrocellulose filter then.With α-
32P dATP prepares by random priming
32The dna probe of P-mark.Used dna probe is human cell division regulation protein 27 coding region sequences (91bp to 834bp) of pcr amplification shown in Figure 1.Probe (about 2 * 10 with the 32P-mark
6Cpm/ml) spend the night in 42 ℃ of hybridization in a solution with the nitrocellulose filter that has shifted RNA, this solution comprises 50% methane amide-25mM KH
2PO
4(pH7.4)-5 * SSC-5 * Denhardt ' s solution and 200 μ g/ml salmon sperm DNAs.After the hybridization, filter membrane is washed 30min in 55 ℃ in 1 * SSC-0.1%SDS.Then, analyze with quantitative with Phosphor Imager.
Embodiment 5: the vivoexpression of recombinant human cell division regulation protein 27, separation and purifying
According to<210〉1 and coding region sequence shown in Figure 1, design a pair of specificity amplification primer, sequence is as follows:
Primer3:5’-CCCGCTAGCATGAGTTACGAGGTGGAAAGCAAA-3’(<210>5)
Primer4:5’-CATGGATCCTTAGGCGACTTCACATTTGCTAAA-3’(<210>6)
5 ' end of these two sections primers contains NheI and BamHI restriction enzyme site respectively, be respectively the encoding sequence of target gene 5 ' end and 3 ' end thereafter, Nhe I and BamHI restriction enzyme site are corresponding to expression vector plasmid pET-28b (+) (Novagen company product, Cat.No.69865.3) the selectivity restriction enzyme site on.With the pBS-1018D01 plasmid that contains the total length goal gene is template, carries out the PCR reaction.The PCR reaction conditions is: contain pBS-1018D01 plasmid 10pg, primer Primer-3 and Primer-4 among the cumulative volume 50 μ l and be respectively 10pmol, Advantage polymerase Mix (Clontech company product) 1 μ l.Loop parameter: 94 ℃ of 20s, 60 ℃ of 30s, 68 ℃ of 2min, totally 25 circulations.Respectively amplified production and plasmid pET-28 (+) are carried out double digestion with NheI and BamHI, reclaim big fragment respectively, and connect with the T4 ligase enzyme.Connect product and transform, after the dull and stereotyped overnight incubation of the LB that contains kantlex (final concentration 30 μ g/ml), use the colony polymerase chain reaction (PCR) method screening positive clone, and check order with the big enterobacterial DH5 of Calcium Chloride Method α.Select the correct positive colony of sequence (pET-1018D01) with Calcium Chloride Method with recombinant plasmid transformed e. coli bl21 (DE3) plySs (Novagen company product).In the LB liquid nutrient medium that contains kantlex (final concentration 30 μ g/ml), host bacterium BL21 (pET-1018D01) is cultured to logarithmic phase at 37 ℃, adds IPTG to final concentration 1mmol/L, continues to cultivate 5 hours.Centrifugal collection thalline, through the broken bacterium of ultrasonic wave, centrifugal collection supernatant with carrying out chromatography with 6 Histidines (6His-Tag) bonded affinity column His.Bind Quick Cartridge (Novagen company product), has obtained the target protein human cell division regulation protein 27 of purifying.Through the SDS-PAGE electrophoresis, obtain a single band (Fig. 2) at the 27kDa place.This band is transferred on the pvdf membrane carries out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 15 amino acid of N-end are identical with 15 amino-acid residues of N-end shown in<210〉2 as a result.
Embodiment 6 anti-human cell division regulation protein 27 production of antibodies
Synthesize following human cell division regulation protein 27 specific polypeptide with Peptide synthesizer (PE company product): NH2-Met-Ser-Tyr-Glu-Val-Glu-Ser-Lys-Lys-Glu-Ile-Pro-Ile-Lys-Lys-COOH.
Form compoundly with hemocyanin and bovine serum albumin coupling this polypeptide respectively, method is referring to Avrameas, et al.Immunochemistry, 1969; 6:43.Add the complete Freund's adjuvant immunizing rabbit with the above-mentioned hemocyanin polypeptide complex of 4mg, add the incomplete Freund's adjuvant booster immunization once with the hemocyanin polypeptide complex again after 15 days.Employing is done the titre that ELISA measures antibody in the rabbit anteserum through the titer plate of 15 μ g/ml bovine serum albumin polypeptide complex bag quilts.From the rabbit anteserum of antibody positive, separate total IgG with albumin A-Sepharose.Polypeptide is incorporated on the Sepharose4B post of cyanogen bromide-activated, from total IgG, separates anti-peptide antibody with affinity chromatography.Immuno-precipitation proof antibody purified can combine with human cell division regulation protein 27 specifically.
Sequence table
<110〉Bode Gene Development Co., Ltd., Shanghai
The polynucleotide of<a 120〉peptide species--human cell division regulation protein 27 and this peptide species of coding
<130>1018d01
<160>6
<170>PatentIn?version?3.1
<210>1
<211>840
<212>DNA
<213>Homo?sapiens
<220>
<221>CDS
<222>(91)..(834)
<223>
<400>1
tatgcaaatt?ttagagccaa?acttgcttcc?tgctgtgatgctgttcaaaa?ctttgttgtt 60
tctcagaata?acactccagt?tgggactaat?atg?agt?tac?gag?gtg?gaa?agc?aaa 114
Met?Ser?Tyr?Glu?Val?Glu?Ser?Lys
1 5
aaa?gaa?atc?cca?att?aag?aag?aac?att?ttt?cat?atg?ttt?cca?gtg?tcc 162
Lys?Glu?Ile?Pro?Ile?Lys?Lys?Asn?Ile?Phe?His?Met?Phe?Pro?Val?Ser
10 15 20
cag?cct?ttt?gtg?gac?tac?cct?tat?aat?cag?tgt?gca?gtg?gtc?gga?aat 210
Gln?Pro?Phe?Val?Asp?Tyr?Pro?Tyr?Asn?Gln?Cys?Ala?Val?Val?Gly?Asn
25 30 35 40
ggg?gga?att?ctg?aat?aag?tct?ctc?tgt?gga?act?gaa?ata?gat?aaa?tcc 258
Gly?Gly?Ile?Leu?Asn?Lys?Ser?Leu?Cys?Gly?Thr?Glu?Ile?Asp?Lys?Ser
45 50 55
gac?ttc?gtt?ttt?agg?tgt?aac?cta?ccc?cca?acc?aca?gga?gat?gtt?agt 306
Asp?Phe?Val?Phe?Arg?Cys?Asn?Leu?Pro?Pro?Thr?Thr?Gly?Asp?Val?Ser
60 65 70
aaa?gat?gtt?ggc?agt?aaa?aca?aat?ctt?gtg?act?ata?aat?cca?agc?atc 354
Lys?Asp?Val?Gly?Ser?Lys?Thr?Asn?Leu?Val?Thr?Ile?Asn?Pro?Ser?Ile
75 80 85
ata?act?ctg?aaa?tat?ggg?aac?tta?aag?gaa?aaa?aaa?gcc?cta?ttt?ctg 402
Ile?Thr?Leu?Lys?Tyr?Gly?Asn?Leu?Lys?Glu?Lys?Lys?Ala?Leu?Phe?Leu
90 95 100
gag?gac?att?gca?acc?tat?gga?gat?gca?ttt?ttt?ctt?ctg?cca?gca?ttt 450
Glu?Asp?Ile?Ala?Thr?Tyr?Gly?Asp?Ala?Phe?Phe?Leu?Leu?Pro?Ala?Phe
105 110 115 120
tcc?ttc?agg?gcc?aac?acg?ggt?acc?tct?ttc?aaa?gta?tac?tac?acg?ctc 498
Ser?Phe?Arg?Ala?Asn?Thr?Gly?Thr?Ser?Phe?Lys?Val?Tyr?Tyr?Thr?Leu
125 130 135
gaa?gag?tct?aaa?gca?aga?caa?aag?gtt?cta?ttt?ttc?cat?ccc?aag?tac 546
Glu?Glu?Ser?Lys?Ala?Arg?Gln?Lys?Val?Leu?Phe?Phe?His?Pro?Lys?Tyr
140 145 150
ctg?aaa?gat?ctg?gcc?ctt?ttc?tgg?aga?act?aaa?ggt?gtg?act?gca?tac 594
Leu?Lys?Asp?Leu?Ala?Leu?Phe?Trp?Arg?Thr?Lys?Gly?Val?Thr?Ala?Tyr
155 160 165
cgc?ttg?tcc?acc?ggc?ttg?atg?atc?aca?agt?gtt?gca?gtg?gaa?ctg?tgt 642
Arg?Leu?Ser?Thr?Gly?Leu?Met?Ile?Thr?Ser?Val?Ala?Val?Glu?Leu?Cys
170 175 180
aaa?aat?gtg?aag?ctg?tat?gga?ttc?tgg?ccc?ttc?tct?aaa?act?gta?gaa 690
Lys?Asn?Val?Lys?Leu?Tyr?Gly?Phe?Trp?Pro?Phe?Ser?Lys?Thr?Val?Glu
185 190 195 200
gac?ata?cct?gtc?agc?cat?cac?tat?tat?gac?aac?aag?cta?cct?aaa?cat 738
Asp?Ile?Pro?Val?Ser?His?His?Tyr?Tyr?Asp?Asn?Lys?Leu?Pro?Lys?His
205 210 215
ggt?ttc?cat?cag?atg?ccc?aaa?gaa?tac?agc?cag?atc?ctc?caa?ctt?cac 786
Gly?Phe?His?Gln?Met?Pro?Lys?Glu?Tyr?Ser?Gln?Ile?Leu?Gln?Leu?His
220 225 230
atg?aaa?gga?atc?ctc?aaa?ctg?caa?ttt?agc?aaa?tgt?gaa?gtc?gcc?taa 834
Met?Lys?Gly?Ile?Leu?Lys?Leu?Gln?Phe?Ser?Lys?Cys?Glu?Val?Ala
235 240 245
acaaag
840
<210>2
<211>247
<212>PRT
<213>Homo?sapiens
<400>2
Met?Ser?Tyr?Glu?Val?Glu?Ser?Lys?Lys?Glu?Ile?Pro?Ile?Lys?Lys?Asn
1 5 10 15
Ile?Phe?His?Met?Phe?Pro?Val?Ser?Gln?Pro?Phe?Val?Asp?Tyr?Pro?Tyr
20 25 30
Asn?Gln?Cys?Ala?Val?Val?Gly?Asn?Gly?Gly?Ile?Leu?Asn?Lys?Ser?Leu
35 40 45
Cys?Gly?Thr?Glu?Ile?Asp?Lys?Ser?Asp?Phe?Val?Phe?Arg?Cys?Asn?Leu
50 55 60
Pro?Pro?Thr?Thr?Gly?Asp?Val?Ser?Lys?Asp?Val?Gly?Ser?Lys?Thr?Asn
65 70 75 80
Leu?Val?Thr?Ile?Asn?Pro?Ser?Ile?Ile?Thr?Leu?Lys?Tyr?Gly?Asn?Leu
85 90 95
Lys?Glu?Lys?Lys?Ala?Leu?Phe?Leu?Glu?Asp?Ile?Ala?Thr?Tyr?Gly?Asp
100 105 110
Ala?Phe?Phe?Leu?Leu?Pro?Ala?Phe?Ser?Phe?Arg?Ala?Asn?Thr?Gly?Thr
115 120 125
Ser?Phe?Lys?Val?Tyr?Tyr?Thr?Leu?Glu?Glu?Ser?Lys?Ala?Arg?Gln?Lys
130 135 140
Val?Leu?Phe?Phe?His?Pro?Lys?Tyr?Leu?Lys?Asp?Leu?Ala?Leu?Phe?Trp
145 150 155 160
Arg?Thr?Lys?Gly?Val?Thr?Ala?Tyr?Arg?Leu?Ser?Thr?Gly?Leu?Met?Ile
165 170 175
Thr?Ser?Val?Ala?Val?Glu?Leu?Cys?Lys?Asn?Val?Lys?Leu?Tyr?Gly?Phe
180 185 190
Trp?Pro?Phe?Ser?Lys?Thr?Val?Glu?Asp?Ile?Pro?Val?Ser?His?His?Tyr
195 200 205
Tyr?Asp?Asn?Lys?Leu?Pro?Lys?His?Gly?Phe?His?Gln?Met?Pro?Lys?Glu
210 215 220
Tyr?Ser?Gln?Ile?Leu?Gln?Leu?His?Met?Lys?Gly?Ile?Leu?Lys?Leu?Gln
225 230 235 240
Phe?Ser?Lys?Cys?Glu?Val?Ala
245
<210>3
<211>25
<212>DNA
<213>Homo?sapiens
<400>3
tatgcaaatt ttagagccaa acttg
25
<210>4
<211>25
<212>DNA
<213>Homo?sapiens
<400>4
aactatatgt aagttttatt aaaat
25
<210>5
<211>33
<212>DNA
<213>Homo?sapiens
<400>5
cccgctagca tgagttacga gg?tggaaagc aaa
33
<210>6
<211>33
<212>DNA
<213>Homo?sapiens
<400>6
catggatcct taggcgactt cacatttgct aaa
33
Claims (10)
1, a kind of isolated polypeptide-human cell division regulation protein 27 is characterized in that it includes: the polypeptide of the aminoacid sequence shown in<210〉2 or the active fragments of its polypeptide, analogue or derivative.
2, polypeptide as claimed in claim 1, the aminoacid sequence that it is characterized in that described polypeptide, analogue or derivative has the homogeny with the aminoacid sequence at least 95% shown in<210〉2.
3, polypeptide as claimed in claim 2 is characterized in that it comprises and has<polypeptide of the aminoacid sequence shown in 210〉2.
4, a kind of isolating polynucleotide, it is characterized in that described polynucleotide comprise be selected from down the group in a kind of:
(a) coding have<210〉2 shown in the polynucleotide of the polypeptide of aminoacid sequence or its fragment, analogue, derivative;
(b) with polynucleotide (a) complementary polynucleotide; Or
(c) with (a) or the polynucleotide of at least 70% homogeny (b) are arranged.
5, polynucleotide as claimed in claim 4, it is characterized in that described polynucleotide comprise coding and have<210〉2 shown in the polynucleotide of aminoacid sequence.
6, polynucleotide as claimed in claim 4, it is characterized in that the sequence of described polynucleotide includes<210〉1 in the 91-834 position sequence or<210〉1 in the sequence of 1-2008 position.
7, a kind of recombinant vectors that contains exogenous polynucleotide is characterized in that it is the recombinant vectors that is formed by the described polynucleotide of arbitrary claim among the claim 4-6 and plasmid, virus or vehicle expression vector establishment.
8, a kind of genetically engineered host cell that contains exogenous polynucleotide is characterized in that it is to be selected from following a kind of host cell:
(a) host cell that transforms or transduce with the described recombinant vectors of claim 7; Or
(b) host cell that transforms or transduce with the described polynucleotide of the arbitrary claim among the claim 4-6.
9, a kind of preparation method with human cell division regulation protein 27 active polypeptide is characterized in that described method comprises:
(a) under expressing human cell division regulation protein 27 conditions, cultivate the described through engineering approaches host cell of claim 8;
(b) from culture, isolate and have human cell division regulation protein 27 active polypeptide.
10, a kind of can with polypeptide bonded antibody, it is characterized in that described antibody be can with human cell division regulation protein 27 specificity bonded antibody.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNA02137726XA CN1493590A (en) | 2002-10-30 | 2002-10-30 | Polypeptide-human cell disintegrate regulatory protein 27 and polynucleotide for coding said polypeptide |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNA02137726XA CN1493590A (en) | 2002-10-30 | 2002-10-30 | Polypeptide-human cell disintegrate regulatory protein 27 and polynucleotide for coding said polypeptide |
Publications (1)
Publication Number | Publication Date |
---|---|
CN1493590A true CN1493590A (en) | 2004-05-05 |
Family
ID=34231676
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNA02137726XA Pending CN1493590A (en) | 2002-10-30 | 2002-10-30 | Polypeptide-human cell disintegrate regulatory protein 27 and polynucleotide for coding said polypeptide |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1493590A (en) |
-
2002
- 2002-10-30 CN CNA02137726XA patent/CN1493590A/en active Pending
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1297999A (en) | Human glutaminyl s-RNA synthatase 58 as one new kind of polypeptide and polynucleotides encoding this polypeptide | |
CN1296974A (en) | Polypeptide-human histone H2A.21 and polynucleotide for coding said polypeptide | |
CN1493590A (en) | Polypeptide-human cell disintegrate regulatory protein 27 and polynucleotide for coding said polypeptide | |
CN1298005A (en) | Human sialic transferase 27 as one new kind of polypeptide and polynucleotides encoding this polypeptide | |
CN1296975A (en) | Polypeptide-human ribosomal protein L23 and polynucleotide for coding said polypeptide | |
CN1485423A (en) | Polypeptide-human galactosyltransferase 42 and polynucleotide encoding the polypeptide | |
CN1297907A (en) | Human acetylglactoside transferase 45 as one new kind of polypeptide and polynucleotides encoding this polypeptide | |
CN1493588A (en) | Polyepeptide-human transcription regulate and control protein 35 and polynucleotide for coding said polypeptide | |
CN1493585A (en) | Polypeptide-human tubulin monomer releasing factor 28 and polynucleotide for coding said polypeptide | |
CN1493586A (en) | Polypeptide-human transcription regulate and control protein 38 and polynucleotide for coding said polypeptide | |
CN1493584A (en) | New polypeptide-human tumour inhibiting factor 46 and polynucleotide for coding said polypeptide | |
CN1510044A (en) | Polypeptide-human beta-transductor 41 and polynucleotide for encoding said polypeptide | |
CN1510134A (en) | Polypeptide human protein tyrosine kinase 50 and polynucleotide for encoding it | |
CN1493583A (en) | New polypeptide-hyman glucoprotein 42 and polynucleotide for coding said polypeptide | |
CN1493587A (en) | Polypeptide-human protein regulatory protein s9 and polynucleotide for coding said polypeptide | |
CN1493593A (en) | Polypeptide-human transcription regulate and control protein 44 and polynucleotide for coding said polypeptide | |
CN1493591A (en) | Polypeptide-human protein synthetic protein L14, 22 and nucleotide for coding said polypeptide | |
CN1345838A (en) | Novel polypeptide-human protein 9.68 containing ribosomal protein S24e characteristic sequence fragment and polynucleotide for encoding said polypeptide | |
CN1517362A (en) | New Polypeptide-human ribosome protein s9 containing ATP/GTP conjugated structure domain and polynucleotide coding said polypetide | |
CN1303925A (en) | Novel polypeptide-arginyl tRNA synthetase 44 and polynucleotide coding said polypeptide | |
CN1301752A (en) | New polypeptide-PLP protein 10 and polynucleotide coding such polypeptide | |
CN1493595A (en) | Polypeptide-human tumour protein 20 and polynucleotide for coding said polypeptide | |
CN1381478A (en) | Polypeptide-ribosome S7 protein -11.77 and polynucleotide for coding it | |
CN1297904A (en) | Human cytokinin inducing-gene expressing protein 25 as one new kind of polypeptide and polynucleotides encoding this polypeptide | |
CN1493589A (en) | Polypeptide-human cell regulate and control protein 54 and polynucleotide for coding said polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |