CN1483816A - Colibacillns strain for recombination producing lectin of snowdrop and method thereof - Google Patents
Colibacillns strain for recombination producing lectin of snowdrop and method thereof Download PDFInfo
- Publication number
- CN1483816A CN1483816A CNA031543057A CN03154305A CN1483816A CN 1483816 A CN1483816 A CN 1483816A CN A031543057 A CNA031543057 A CN A031543057A CN 03154305 A CN03154305 A CN 03154305A CN 1483816 A CN1483816 A CN 1483816A
- Authority
- CN
- China
- Prior art keywords
- gna
- strain
- coli strain
- snowdrop
- lectin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The present invention relates to the colibacillus strain transformed expression plasmid, p22bMG3 or its derivative and method for recombination production of Galanthus Nivalis Aggulutinin (GNA) protein.
Description
Technical field
The present invention relates to be used for the coli strain and the method for recombinant production Snowdrop lectin.More particularly, the present invention relates to transform the coli strain of expression plasmid p22bMG3 and utilized this bacterial strain recombinant production Snowdrop lectin (Snowdrop lectin, Galanthus nivalis agglutinin, method GNA).
Background technology
Vegetable lectin is the Buchner's bodies of plant, plant there is very important physical effect, become very valuable new tool in bio-science and the medical research, as separating and evaluation glycoprotein and glycolipid, histological chemistry's novel agent of research cell and tissue, cell typing, isolated lymphocytes and medullary cell, assess disease patient's immunological status, chromosome analysis etc.Snowdrop (Galanthus nivalis) Sugar receptors (GNA) has seminose specific combination activity.Except such use, to human and animal's cytomegalovirus and retrovirus, have the strong optionally restraining effect that reaches, just becoming an important tool of acquired immune deficiency syndrome (AIDS) research.In addition, GNA is all toxic to pierce-suck type and some chewing type insect and nematode, has broad application prospects aspect preventing and treating in insect and oxyuriasis.
At present the preparation method of GNA extracts from the snowdrop bulb, and, raw material few because of content lacks, separation method is loaded down with trivial details, cause natural GNA the cost height, cost an arm and a leg, only U.S. Sigma company has commodity GNA to sell, and usually occurs in short supply.This has seriously restricted the development and use of GNA.
The gene of Snowdrop lectin is cloned, its nucleotide sequence and amino acid sequence corresponding are disclosed (referring to van Damme, E.J.M., Kaku, H., Perini, F., Goldstein, I.J., Peeters, B., Yagi, F., Decock, B.and Peumans, W.1993.Biosynthesis, primary structure and molecular cloning ofsnowdrop (Galanthus nivalis L.) lectin.GenBank, 1993, (Protein), ACCESSION AAA33346. (Nucleotide) Locus GAAL2A accession
M55556.1).Yet, still not fast, easy at present, the method for recombinant production GNA efficiently and economically.The present invention provides a kind of approach for satisfying these needs of the prior art.
Summary of the invention
An object of the present invention is to provide the coli strain that can be used for recombinant production Snowdrop lectin (GNA).
Another object of the present invention provides the method for recombinant production Snowdrop lectin (GNA).
Description of drawings
Fig. 1 is the structural representation of pC1300UG plasmid.
Fig. 2 is the structural representation of recombinant plasmid pMGT42.
Fig. 3 is the structural representation of coli expression carrier pET22b (+).
Fig. 4 is the structural representation of recombinant expression plasmid p22bMG3.
Fig. 5 is the complete amino acid sequence (SEQ ID NO:1) and the respective coding nucleotide sequence (SEQ ID NO:2) of reorganization GNA polypeptide.
Embodiment
The present invention relates to transform multiple coli strain or its derivative strain of p22bMG3 or its derivative, they can be used for producing Snowdrop lectin.
In the context of the present invention, " derivative " of recombinant plasmid is meant the additional sequences that can exist some not influence this exogenous gene expression outside the position of foreign gene in plasmid, perhaps can exist some not change coded amino acid whose sudden change in the encoding sequence of Snowdrop lectin.Those of ordinary skill is known, and there is the relatively codon usage of preference in different host living beings.Preferably, the GNA encoding gene has carried out codon optimized at host cell to be selected for use, expresses therein being suitable for.In one embodiment, described additional sequences can be other foreign genes.In another embodiment, described additional sequences can be the flag sequence that helps Snowdrop lectin purifying of the present invention, for example six histidine mark sequences.In another enforcement side, described additional sequences can also be the joint sequence that inserts wherein, so that the clone of other genes for example.
In the context of the present invention, " derivative strain " of e. coli host bacteria strain is meant the bacterial strain that forms in the culturing process of host strain, comprise the bacterial strain that for example forms by its mono-clonal, change has taken place because of form, outward appearance or some physicochemical property but compares with parent strain and to produce for example bacterial strain that weakened of the ability of Snowdrop lectin of exogenous protein in what perhaps may form in the secular culturing process that goes down to posterity, comprises the mutant strain that has for example lacked some endogenous protease gene.
Host strain can be any e. coli host bacteria strain that heterologous protein is produced that is used for known in the art among available the present invention, comprises commercially available those.
In one embodiment, described e. coli host bacteria strain is BL21 (U.S. Novagen company product).In another embodiment, the described e. coli host bacteria strain derivative strain BL21 (DE3) that is BL21 or B834 (DE3) (U.S. Novagen company product) etc.
The recombinant escherichia coli strain that the present invention has comprised expression plasmid p22bMG3 or its derivative can be used for genetically engineered production Snowdrop lectin.This production method comprises the steps:
(1) in suitable nutritional medium, is being suitable for cultivating above-mentioned recombinant escherichia coli strain of the present invention under the condition that Snowdrop lectin expresses;
(2) from the gained cell culture, reclaim expressed reorganization Snowdrop lectin.
In the methods of the invention, utilize means known in the art, culturing cell in the nutritional medium that is suitable for producing the reorganization Snowdrop lectin.For example; can be in laboratory or industrial fermentor tank, in suitable medium, allow to express and/or separate under the condition of this polypeptide through shake-flask culture, small-scale or large scale fermentation (comprise continuously, in batches, batch feeding or solid phase ferment) and cultivate this cell.Cultivation is to utilize means known in the art (referring to compiling More Gene Manipulations in Fungi, academic press, CA, 1991 as Bennett J.W. and LaSure L.), carries out in the suitable nutritional medium of carbon containing, nitrogenous source and inorganic salt.Suitable substratum is commercially available, or formulated according to disclosed composition (in the catalogue as American type culture collection), comprise well known in the art those, LB substratum for example, the TB substratum, the SOB substratum, the NZCYM substratum, or the like.
Recombinant bacterial strain of the present invention can for example be cultivated down for 18-37 ℃, to express Snowdrop lectin in any suitable temperature.Preferably, can be at normal temperatures, for example 18-30 ℃, more preferably 20-28 ℃, especially cultivate under 22-25 ℃ of temperature and ferment.
During the fermentation, the IPTG that can add any suitable concn in culture induces, and for example the IPTG final concentration is 0.1-1.0mmol/L, preferably 0.2-0.8mmol/L, more preferably 0.2-0.5mmol/L.Those of ordinary skill can be easy to the corresponding conditions in definite various zymotechniques according to conventional procedure of the prior art.
Fermentation time is decided according to particular case, can be several hours to tens of hours.Preferably 2-10 hour, more preferably 5-8 hour.
After the fermentation, from culture, reclaim expressed protein with conventional protein separation and purification process.Known purification process comprises filtering separation cell from substratum, adopt the ultrasonic disruption method, the freezing-thawing and cracking method, bacteriolyze enzyme process and the broken recombinant Bacillus coli cells of high speed pearl mill method, adopt dissolving inclusion bodys such as urea or sarcosyl, and chromatography method is (as ion exchange chromatography, affinity chromatography, hydrophobic chromatography, chromatofocusing, and size exclusion chromatography), electrophoresis method (as the isoelectrofocusing (IEF) of preparation property), difference solvability (as ammonium sulfate precipitation), perhaps extract (referring to, as " protein purification ", J.-C.Janson and Lars Ryden write, VCHPublishers, New York, 1989).
The invention will be further described below with reference to embodiment.
Embodiment
The establishment of 1 recombinant expression plasmid
With reference to " Russell orchid etc., the subclone of GNA mature protein gene and the structure of coli expression carrier thereof.Biotechnology, 2002 (6): 1-2 " operation of describing makes up recombinant expression plasmid.Specifically, comprise following flow process:
(1) clone of GNA gene
With pC1300UG (accompanying drawing 1 is given by professor Tang Kexuan of Fudan University) is template, with P4 (5 ' GC
CCATGGACAATATTTTGTACTCC 3 ', SEQ ID NO:3, the NcoI restriction enzyme site of underscore for adding) and P2 (5 ' TG
GTCGACTCATCCAGTAGCCCAACGATC 3 ', the SalI restriction enzyme site of SEQ ID NO:4 underscore) carry out pcr amplification for adding.The PCR condition is as follows: carry out on PE company 2400 type PCR instrument, cycling program is 94 ℃, 5min; 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 40s (30cycles); 72 ℃ of 5min.Electrophoresis detection shows the DNA band that has obtained a 330bp.DNA Clean-up test kit with Promega company reclaims the PCR product, be cloned on the T-vector (Promega company), the competence intestinal bacteria XL1 bacterial strain that conversion was handled through CaCl2, and the LB agar plate that has been coated with IPTG (8mg/mL) and X-gal (20mg/mL) carried out bed board.After 37 ℃ of following overnight incubation, utilize blue white bacterium colony to select recon.Prepare plasmid DNA in a small amount through alkaline process, check order.Being checked sequence confirms to have inserted the MGNA gene in the recombinant plasmid, and additional restriction enzyme site and termination codon sequence are entirely true.With recombinant plasmid called after pMGT42.
(2) make up the GNA recombinant expression plasmid
With NcoI/SalI double digestion pMGT42, reclaim the insertion fragment of about 300bp, and be inserted into equally in the pET22b of NcoI/SalI double digestion (+) (Novagen, accompanying drawing 3), obtain the GNA prokaryotic expression carrier p22bMG3 (accompanying drawing 4) that merges with the pelB signal peptide.Cut with checking order by enzyme and to have confirmed the exactness (accompanying drawing 5) that is connected.
2 transformed into escherichia coli host strains
The GNA prokaryotic expression carrier p22bMG3 of above-mentioned structure is imported among the host strain E.coli bacterial strain BL21 (Novagen company), obtained recombinant escherichia coli strain E22bMG3.This bacterial strain is deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center (Zhong Guan-cun, Haidian District, BeiJing, China city north one No. 13,100080) on June 5th, 2003, and preserving number is CGMCC0935.
Fermentative production and the purification process of 3 reorganization GNA
(1) the single colony inoculation of picking E22bMG3 is in the 5mL LB substratum of (containing Amp 100mg/L), in 37 ℃ of incubated overnight.
(2) get overnight culture 1mL and be inoculated in the 500mL LB substratum and cultivate 2-3h, to OD
600, add 250 μ L 1mol/L IPTG storage liquid at about 0.3～0.6 o'clock.Continue to cultivate 5h to induce the expression of GNA in 22 ℃.
(3) through the centrifugal results bacterial sediment of 3000rpm, use the sonioation method smudge cells, and cell lysate is centrifugal in 8000rpm speed.The gained supernatant is the soluble proteins sample, is precipitated as insoluble protein aggregate (inclusion body).
(4) with stain remover 0.2%SKL ((the sarcosyl aqueous solution)) room temperature dissolving inclusion body 20min.
(5) with dialyzate Buf A (containing 50mmol/L Tris-HCl (pH7.9), 0.5mmol/LEDTA, 50mmol/L NaCl) room temperature dialysis 6-8h, remove SKL, make the reorganization GNA refolding proteins of sex change.With the Buf A+50% glycerine room temperature 6h that dialyses again, concentrate reorganization GNA solution to 10 times.Predicting purity through SDS-PAGE and UVI gel analysis system reaches more than 98%.
(6) with the soluble proteins sample of E22bMG3 and refolding GNA albumen through seminose agarose column (U.S. SIGMA Co. product) chromatography.Earlier with 6 times of volume NaCl/Pi (1.5mmol/L KH
2PO
4, 8mmol/L Na
2HPO
4, 2.7mmol/L KCl, 137mmol/L NaCl pH7.4) washes post and removes not conjugated proteinly, uses 20mmol 1 again, and 3-diaminopropanes wash-out obtains GNA albumen.Obtain highly purified active GNA thus.Lyophilize gets pure product GNA.Its productive rate is about 15mg reorganization GNA.
The active testing of 4 reorganization GNA
(1) recombinant protein that is obtained with SDS-PAGE and Western Blot analytical proof really is GNA.Reorganization GNA SDS-PAGE electrophoretic analysis, separation gel is polyacrylamide gel, 5% spacer gel of 15-20%, the result obtains the band of a treaty 12.5KD size, and is the same with natural GNA (SIGMA Co.).With the antiserum(antisera) of the anti-natural GNA of rabbit is one anti-, and the goat anti-rabbit igg of coupling horseradish peroxidase (Bio-Rad) is that the two anti-Western Blot that carry out analyze.The result show reorganization GNA can with the antibody specific combination of natural GNA, and show hybridization signal.
(2) blood coagulation activity of reorganization GNA is measured according to (hair snow, peak, Koryo, Li Caixia, Li Runzhi such as Mao Xue.Phytohemagglutinin is to the antibiosis effect of aphid.Agricultural University Of Shanxi's journal 1999,19 (2); 122-124,144.) method measure different concns gradient reorganization GNA and natural GNA agglutination activity to 2% rabbit erythrocyte suspension.The result shows that the 0.1-0.2mg/L recombinant protein promptly has blood coagulation activity, and is consistent with the 0.2mg/L aggegation minimum concentration of natural GNA.Illustrate that reorganization GNA has identical blood coagulation activity with natural GNA.
(3) reorganization GNA anti-insect activity is measured [Li Caixias such as pressing Li Caixia, the peak, Koryo, Li Runzhi, hjolomorphism artificial nutrient liquid is raised aphid research, Agricultural University Of Shanxi's journal, 1997,17 (3): 217～221] method artificial breeding cotten aphid (Aphis gossypii Glover) and radish aphid (Rhopalosiphum pseudobrassicae Davis), different concns gradient reorganization GNA and natural GNA are added in the artificial foodstuff of aphid, and observation is to the antibiosis effect of aphid.The result shows that 0.1g/L reorganization GNA promptly has toxicity to cotten aphid and radish aphid, does not have significant difference with natural GNA.Directly spray the method test anti-insect activity of raising on the aphid on the potted plant Plantula Brassicae chinensis [B.campestvis ssp.chinensis (L.) Makino] and inoculation aphid blade with different concns gradient reorganization GNA at spray cloth reorganization GNA in advance.The result shows that concentration has tangible toxicity to aphid in the 0.2-0.5g/L scope, and toxicity intensity strengthens with the rising of concentration.
Therefore can draw, gained reorganization GNA of the present invention and natural GNA are just the same, and have all biological activitys of natural GNA.
The foregoing description is just in order to illustrate rather than limit the present invention.Those skilled in the relevant art know clearly, can do other suitable modification and variation to content as herein described, and can carry out this modification and variation in the scope of the present invention or its any embodiment.Such modification and variation all fall into protection scope of the present invention.
＜110〉 ＜120〉 ＜130〉＜160〉 4＜170〉 PatentIn version 3.1＜210〉 1＜211〉 333＜212〉 DNA＜213〉 ＜400〉 1gcccatggac aatattttgt actccggtga gactctctct acaggggaat ttctcaacta 60cggaagtttc gtttttatca tgcaagagga ctgcaatctg gtcttgtacg acgtggacaa 120gccaatctgg gcaacaaaca caggtggtct ctcccgtagc tgcttcctca gcatgcagac 180tgatgggaac ctcgtggtgt acaacccatc gaacaaaccg atttgggcaa gcaacactgg 240aggccaaaat gggaattacg tgtgcatcct acagaaggat aggaatgttg tgatctacgg 300aactgatcgt tgggctactg gatgagtcga cca 333＜210〉 2＜211〉 105＜212〉 PRT＜213〉 ＜400〉 2Asp Asn Ile Leu Tyr Ser Gly Glu Thr Leu Ser Thr Gly Glu Phe Leu1 5 10 15Asn Tyr Gly Ser Phe Val Phe Ile Met Gln Glu Asp Cys Asn Leu Val
20 25 30Leu?Tyr?Asp?Val?Asp?Lys?Pro?Ile?Trp?Ala?Thr?Asn?Thr?Gly?Gly?Leu
35 40 45Ser?Arg?Ser?Cys?Phe?Leu?Ser?Met?Gln?Thr?Asp?Gly?Asn?Leu?Val?Val
50 55 60Tyr?Asn?Pro?Ser?Asn?Lys?Pro?Ile?Trp?Ala?Ser?Asn?Thr?Gly?Gly?Gln65 70 75 80Asn?Gly?Asn?Tyr?Val?Cys?Ile?Leu?Gln?Lys?Asp?Arg?Asn?Val?Val?Ile
85 90 95Tyr?Gly?Thr?Asp?Arg?Trp?Ala?Thr?Gly
100 105＜210〉3＜211〉25＜212〉DNA＜213〉artificial sequence＜400〉3gcccatggac aatattttgt actcc 25＜210〉4＜211〉29＜212〉DNA＜213〉artificial sequence＜400〉4tggtcgactc atccagtagc ccaacgatc 29
Claims (10)
1. transformed the coli strain of expression plasmid p22bMG3 or its derivative.
2. according to the coli strain of claim 1, it is coli strain BL21 or its derivative strain.
3. according to the coli strain of claim 1, its preserving number is CGMCC No:0935.
4. the method for a recombinant production Snowdrop lectin, be included in the coli strain of in suitable medium, cultivating claim 1 under the condition that is suitable for expressing Snowdrop lectin, and from culture, reclaim the Snowdrop lectin of expressing.
5. according to the method for claim 4, wherein said coli strain is BL21 or its derivative strain.
6. according to the method for claim 5, wherein said coli strain is that preserving number is the coli strain of CGMCC No:0935.
7. according to the method for claim 4, wherein adding final concentration in culture is that 0.1～1.0mmol/L IPTG is to induce the expression of Snowdrop lectin.
8. according to the method for claim 7, wherein adding final concentration in culture is that 02-0.5mmol/L IPTG is to induce the expression of Snowdrop lectin.
9. according to the method for claim 4, wherein said coli strain is cultivated 5～8 hours to induce the expression of Snowdrop lectin under 18～30 ℃ temperature.
10. according to the method for claim 9, wherein said coli strain is cultivated to induce the expression of Snowdrop lectin under 20～28 ℃ temperature.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031543057A CN100339475C (en) | 2003-08-14 | 2003-08-14 | Colibacillns strain for recombination producing lectin of snowdrop and method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031543057A CN100339475C (en) | 2003-08-14 | 2003-08-14 | Colibacillns strain for recombination producing lectin of snowdrop and method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1483816A true CN1483816A (en) | 2004-03-24 |
| CN100339475C CN100339475C (en) | 2007-09-26 |
Family
ID=34156814
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB031543057A Expired - Fee Related CN100339475C (en) | 2003-08-14 | 2003-08-14 | Colibacillns strain for recombination producing lectin of snowdrop and method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100339475C (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107266527A (en) * | 2017-06-12 | 2017-10-20 | 秦小波 | Hickory chick, sealwort and snowdrop active polysaccharide albumen and its preparation method and application |
| WO2020074977A1 (en) * | 2018-09-07 | 2020-04-16 | Unichem Laboratories Limited | An improved process for the preparation of recombinant lectin protein |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1162542C (en) * | 2000-11-03 | 2004-08-18 | 中国科学院微生物研究所 | Vegetable lectin gene |
| CN1406956A (en) * | 2001-09-06 | 2003-04-02 | 复旦大学 | Polypeptide-exogenous agglutinin protein-21.45 and polynucleotide for encoding it |
-
2003
- 2003-08-14 CN CNB031543057A patent/CN100339475C/en not_active Expired - Fee Related
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107266527A (en) * | 2017-06-12 | 2017-10-20 | 秦小波 | Hickory chick, sealwort and snowdrop active polysaccharide albumen and its preparation method and application |
| CN107266527B (en) * | 2017-06-12 | 2021-04-20 | 秦小波 | Morchella, polygonatum and snowdrop active polysaccharide protein and preparation method and application thereof |
| WO2020074977A1 (en) * | 2018-09-07 | 2020-04-16 | Unichem Laboratories Limited | An improved process for the preparation of recombinant lectin protein |
| CN113286809A (en) * | 2018-09-07 | 2021-08-20 | 联合化学实验室有限公司 | Improved recombinant lectin protein preparation method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100339475C (en) | 2007-09-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Andrews et al. | The yeast SWI4 protein contains a motif present in developmental regulators and is part of a complex involved in cell-cycle-dependent transcription | |
| Grebanier et al. | Comparison of the molecular weights of proteins synthesized by isolated chloroplasts with those which appear during greening in Zea mays | |
| CN109750054A (en) | A kind of Mycoplasma bovis protein gene MbovGdpP and its application | |
| CN108559739A (en) | The mannase PMan5A mutant and its gene and application that heat resistance improves | |
| CN110438111A (en) | A kind of algin catenase and its application | |
| CN109957555A (en) | A kind of glycosyl transferase mutant and its application in catalysis Gastrodin biosynthesis | |
| CN110257410A (en) | A kind of gene encoding algin catenase | |
| CN105695340B (en) | Aspergillus oryzae and application thereof | |
| CN109929778B (en) | Efficient aroma-enhancing strain and application thereof in improving tobacco quality | |
| CN109207460A (en) | Recombinate muscardine Proteinase K mutant PK-M2 and preparation method | |
| KR101756769B1 (en) | Protease of sequence number 1 having algicidal activity, gene encoding the same and algicidal formulation comprising the same | |
| KR20080003904A (en) | Methods for producing strains of overproductive staphylococcus aureus | |
| CN103059117A (en) | High throughput screening of important schistosoma japonicum antigens and application of antigens in schistosomiasis diagnosis | |
| CN1483816A (en) | Colibacillns strain for recombination producing lectin of snowdrop and method thereof | |
| AU2007350619B2 (en) | A purified recombinant batroxobin with high specific activity | |
| CN110468143A (en) | The preparation method and application of antibacterial peptide NZX | |
| CN101555485B (en) | Non-fusion expression of recombinant human parathyroid hormone (1-84) and large-scale preparation method | |
| Murphy et al. | Determination of Corynebacterium diphtheriae toxigenicity by a colorimetric tissue culture assay | |
| CN102776161A (en) | Preparation and use of high-glyphosate-resistance EPSP (5-enolpyruvylshikimate-3-phosphate) synthase separated from soil and coding sequence thereof | |
| CN109402095A (en) | A kind of protease and its method for preparing the low big mpd polypeptide of cadmium | |
| CN112480219B (en) | Sip1Aa soluble insecticidal protein mutant | |
| DK2582810T3 (en) | Ulvanlyase, method of producing it and uses thereof | |
| AU2019329357A1 (en) | Mutant strain of trichoderma reesei and method for producing protein using same | |
| CN112877312B (en) | Preparation method and application of recombinant serine protease | |
| CN105400756B (en) | A kind of Fixedpoint mutation modified rat dipeptidyl peptidase II I |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |