CN1480210A - Usage of leptin for promoting healing of wound - Google Patents

Abstract

An application of leptin in promoting the healing of wound is disclosed. It can be made into the medicine in the form capsule, tablet or injection, or the additive of cosmetics.

Description

The purposes of leptin for promoting healing of wound

Technical field

The present invention relates to a kind of leptin that obtains with technique for gene engineering in the application aspect the promotion wound healing.

Background technology

Leptin (leptin) is the protein product of ob gene (ob), finds in mouse experiment first in 1994, and it is made up of 167 amino acid residues, is highly hydrophilic protein, and molecular weight is 16KD.Leptin enters blood by fatty tissue secretion, by combine the energy balance, depot fat and some endocrine function and the immunologic function of regulating body with central nervous system's leptin receptor (OB-R), and participation reproduction and hemopoietic function.The receptor of leptin is very extensive in the distribution of human body.In hypothalamus and choroid plexus, at nearly all internal organs such as the heart, liver, kidney, pancreas, thymus and spleens, the expression of leptin receptor is all arranged in various kinds of cell such as mononuclear cell, T lymphocyte, macrophages, and have the variant of multiple leptin receptor to exist in vivo, different tissues has different leptin receptors to express.Therefore, leptin has different metabolism at different tissues.The structure of leptin and receptor thereof belongs to the member of cytokine family, and this family member comprises: IL-6, IL-11, IL-12, leukaemia inhibitory factor (LIF), G-CSF, CNTF and cancer suppressor protein M etc.; And its signal transduction pathway also the approach with cytokine is identical.Therefore, also the regulative mode with cytokine is identical for the regulative mode of leptin in the immunne response process.

The discovery of leptin once made people see and disclosed the fat mechanism dawn fat with treatment.But human experimentation shows that human overweight people also has no lack of leptin, and the action effect of leptin fat-reducing is also not obvious.Studies show that leptin can stimulate the propagation and the differentiation of yolk sac cell and fetal liver cells effectively, and can directly act on ovary, influences reproduction and fertility; Also direct hemopoietic blast cell promotes the generation of blood vessel; The leptin regulating immunological function, when infection and inflammation, leptin level obviously raises, and can improve macrophage and granulocytic quantity.The hormonal readiness of leptin and receptor deficiency Mus thereof, reproductive function, skeletal structure and immunologic function are all unusual.

Summary of the invention

On the basis of existing technology, the present inventor is with experiment showed, that leptin has the effect that promotes growth and wound healing.Smear in wound location and to give the leptin preparation, can promote wound healing, improve the tension stress intensity of wound skin.According to purposes of the present invention, leptin can also be added into cosmetics, be used for the renewal of epidermis.

Leptin is the protein by the gene expression with following nucleotide sequences:

cggaattc?atg?gtt?cct?att?caa?aaa?gtc?caa?gat?gac?acc?aaa?acc?ctc?atc?aag?acaatt?gtc?acc?agg?atc?aat?gac?att?tca?cac?acg?tca?gtc?tcc?tcc?aaa?cag aaa?gtc?accggt?ttg?gac?ttc?att?cct?ggg?ctc?cac?ccc?atc?ctg?acc?tta?tcc?aag?atg gac?cag?acactg?gca?gtc?tac?caa?cag?atc?ctc?acc?agt?atg?cct?tcc?aga?aac?gtg?atc caa?ata?tccaac?gac?ctg?gag?aac?ctc?cgg?gat?ctt?ctt?cac?gtg?ctg?gcc?ttc?tct?aag agc?tgc?cacttg?ccc?tgg?gcc?agt?ggc?ctg?gag?acc?ttg?gac?agc?ctg?ggg?ggt?gtc?ctg gaa?gct?tcaggc?tac?tcc?aca?gag?gtg?gtg?gcc?ctg?agc?agg?ctg?cag?ggg?tct?ctg?cag gac?atg?ctgtgg?cag?ctg?gac?ctc?agc?cct?ggg?tgc?tga?gga?tcc?cg

The present inventor selects the winstar rat, under the aseptic condition at the back surgery otch, experimental group is smeared wound with leptin solution, twice of every day, the matched group normal saline, kill rat after one week, measure tensile strength, wound healing rate, wound skin hydroxyproline content, wound skin protein content, wound granulation tissue DNA and the rna content of wound, and observe the influence that leptin is cultivated fibroblast.Experimental result shows that leptin can obviously improve the wound healing rate of operation wound rat and the tension stress intensity of wound skin, increases traumatic wounds and represents the hydroxyproline content of collagen protein generating state and represent cell to generate DNA, the rna content of level.Simultaneously, leptin can improve the fibroblasts proliferation rate in close relations with wound healing.These show that all leptin can improve the healing of wound in the traumatology department and the burn plastic surgery operations.It can make capsule, tablet, injection or cosmetics as the additive of medicine or drug component or cosmetics.

The present invention can be widely used in the traumatology department and burn plastic surgery operations patient's external curing medicament or the component of medicament, the medicament component of external dressing and minor cut or wound wrapping dressing medicament component of domestic, one of the promoter of recovering as wound or promoter have broad application prospects aspect injury repairing.In addition, can be used for the renewal of epidermis, good application is also arranged aspect make-up and beauty.

Leptin of the present invention is that the reference literature reported method prepares by technique for gene engineering, come to the same thing (Zhang et al.Nature.1994,372:425～432) of the molecular weight of its product and biological activity and bibliographical information.Preparation method comprises obtaining, cloning of design of primers, cDNA and steps such as evaluation, prokaryotic expression, protein purification and determination of activity, and the activity of leptin is to measure by food ration of mice and body weight change thereof.

Description of drawings

The SDS-PAGE figure that Fig. 1 expresses in JM109 for leptin.A wherein, the positive clone of B C is the contrast antibacterial.

Fig. 2 is leptin purification SDS-PAGE figure, and wherein A is the leptin of the PBS eluting behind the chromatography, and B is the leptin of renaturation in PBS.

Fig. 3 is for after giving leptin, mice feed curve chart.

Further describe the present invention with embodiment below the specific embodiment.

The clonal expression of embodiment one, leptin and activity identification

1. the prokaryotic expression of leptin cDNA

1.1 design of primers is synthetic

Primer is removed leptin signal peptide partial sequence according to leptin cDNA upstream and downstream sequential design, promptly intends amplification mature peptide part.

Forward primer is: 5 ' cggaattcatggttcctattcaaaaagtcc 3 '.

Downstream primer is: 5 ' cgggatcctcagcacccagggctg 3 '.

1.2 cDNA obtains

Get about the acute ileus operation sick child of Tianjin Children's hospital subcutaneus adipose tissue 1 gram, extract its total RNA by the total RNA system approach of Promega company.Press the method for FBI reverse transcription system, carry out RT-PCR with high-fidelity pfu archaeal dna polymerase.Reclaim the target dna electrophoresis band.

1.3 clone and evaluation

Fetch the cDNA of receipts, with EcoRI and BamHI enzymes double zyme cutting, the T4 dna ligase is connected in it on prokaryotic expression carrier pBV220 plasmid of identical restriction endonuclease digestion, measures its sequence with automatic sequencer.The results are shown in Figure 1.

Sequencing result shows that the leptin cDNA of acquisition compares with the leptin cDNA of bibliographical information, lacks three base CAG, and these three bases are positioned at the starting point of second exon of ob gene.Thereby the mature polypeptide of mRNA translation thus to lack an aminoacid than the leptin molecule of bibliographical information be glutamine, it should be positioned at (Maffei M on the 28th amino acids residue of leptin mature peptide, Stoffel M, Barone M, et al.Absence of mutations in the human OB Gene in obese/diabetic subjects.Diabetes 1996,45:679.).Consistent (the Masuzaki H of results reported but the leptin molecule that we express and Japan go together, Ogarva V, Isse N, et al.Human obese gene expression.Diabetes1995,44:855.), illustrate that the leptin molecule has certain polymorphism.

1.4 prokaryotic expression

1.4.1 prokaryotic expression material

Prokaryotic expression plasmid is pBV220, and the host bacterium is JM109, and culture medium is conventional LB culture medium.

1.4.2 prokaryotic expression condition

Get 30 ℃ of joltings of positive strain and spend the night, increased bacterium about 3 hours with 30 ℃ of 1% inoculum concentrations, 42 ℃ of thermal inductions were expressed 4 hours.Get antibacterial and carry out SDS-PAGE.The results are shown in Figure 1.

Select different three time periods of 4,8,12 hours thermal induction time, understand of the influence of thermal induction time the target protein expression.From the result as seen, with the prolongation of thermal induction time, its expression raises, but 8 hours expression and 12 hours difference are little, and we select 8 hours is expression time.

2. leptin protein purification

The leptin of prokaryotic expression exists with the inclusion body form.For this reason, our the leptin purifying procedure of design is: ultrasonic broken bacterium-→ solubilization of inclusion bodies-→ renaturation-→ column chromatography.

According to documents and materials (Chehab FF, Lim ME and Lu RH.Correction of the sterilitydefect in homozygous obese female mice by treament with the humanrecombinant leptin.Nature Genetics 1996,12:318), with 4.6mol/L carbamide dissolving inclusion body, the method that progressively reduces urea concentration with dialysis makes the slow renaturation of leptin.The concentration of carbamide is followed successively by 4.6 → 4.0 → 3.0 → 2.0 → 1.0 → 0.5mol/L during dialysis, dialyses three times with the PBS solution of 20mmol/L at last, makes the slow renaturation of leptin.The leptin of renaturation is carried out gel filtration, and column packing is SephacrylS-200, the balance liquid PBS solution of 20mmol/L.Leptin protein in the effluent is accredited as single band through SDS-PAGE, shows that isolating leptin protein is that electrophoresis is pure, and protein electrophoresis the results are shown in Figure 2.

The reorganization leptin activity

The normal female Kunming mouse is about body weight 30g.The normal feedstuff of freely ingesting is freely taken the photograph water.The leptin 20 μ g of experimental group lumbar injection every day purification, matched group is then injected the normal saline of equivalent.Experiment periods is 4 days.The variation of mice food ration (see figure 3) and body weight during the observation experiment (seeing Table 1).

Table 1 leptin is to the influence of mice body weight (gram, χ ± s)

The experiment natural law

Group N starting weight

1 2 3 4

Matched group 10 29.4 ± 1.7 29.8 ± 1.8 29.5 ± 1.6 29.6 ± 1.5 29.2 ± 1.3

Experimental group 10 29.3 ± 1.8 28.1 ± 1.7 ^*27.6 ± 1.9 ^*27.9 ± 2.4 28.2 ± 2.1

Compare with matched group ^*P＜0.05

As known from Table 1, the injection leptin after the 1st day, the mice body weight promptly descend 1.7 the gram.Effect is the most obvious in the time of two days, and the mice body weight is like bottom out afterwards, but still is lower than normal control.

The experimentation of embodiment two, leptin for promoting healing of wound

1, experimental technique

(1) operation wound model: the male wistar rat about body weight 200 grams, by 20% body surface area cropping, use 5% Na in the back afterwards ₂The S depilation, under aseptic condition, 1 centimeters in the left and right sides, back apart from spinal column, cut a length respectively and be the square notch of 2.5 centimetres of 8 centimetres linear cuts and one 2 cm x, reach the flesh layer deeply, afterwards linear cuts is sewed up, treatment group rat is smeared wound with leptin solution, and matched group is then smeared wound with normal saline.Afterwards, smear wound twice every day, kill whole rats after the week.

(2) index of Guan Chaing

1. the tensile strength of wound is measured: after killing rat, get the skin of treatment group and control rats back otch, be cut into the wide flap of 1cm, measure the pulling force that wound can bear.

2. the healing rate of wound is measured: with the length and width of kind of calliper square notch wound surface, calculate the area of wound surface, the area of the wound surface during with operation is compared, and calculates the healing rate of wound surface.

3. wound skin hydroxyproline determination: get the skin of treatment group and control rats back wound, the hydroxyproline content of wound is measured in the back digestion of weighing.

4. wound skin protein assay: get the skin of treatment group and control rats back wound, the protein content of measuring wound is ground in the back of weighing.

5. wound granulation tissue DNA and rna content are measured: get and grind after the wound granulation tissue is weighed, with total nucleic acid, DNA and rna content in the EBr fluorescence spectrometry granulation tissue.

6. leptin influence that fibroblast is cultivated: under the aseptic condition, get rat skin and cultivate its fibroblast, the propagation of observation of cell, DNA and protein synthesis situation.

2, experimental result

(1), leptin is to the influence of operation rat wound tensile strength and healing rate

Table 2 provides the pulling force that back 7 days rat wounds of operation can bear and the measurement result of healing rate.Therefrom as seen, test after 7 days, the pulling force that the wound of use leptin group can bear obviously improves, and the healing rate of wound also obviously improves, and all has statistical significance.These results suggest: leptin has obvious facilitation to the recovery of experimental rat surgical wound.

Table 2 leptin is to the influence of operation rat wound tensile strength and healing rate

7 days healing rates (%) of the pulling force that group n wound bears (g/cm) wound

Wound matched group 9 310 ± 67 34.01 ± 5.31

The leptin treatment organizes 9 370 ± 60 ^*42.29 ± 4.13 ^*

Compare with matched group: ^*P＜0.05, ^*P＜0.01

(2), leptin is to the influence of trauma in rat granulation tissue DNA and rna content

Perform the operation after 7 days, DNA and rna content in the wound granulation tissue of two operation groups all raise to some extent than normal group, illustrate that wound recovers, cell proliferation and synthetic increasing; Wherein the rising of leptin group will be apparently higher than matched group, and the prompting leptin has the effect of tangible promotion wound healing, sees table 3 for details.

Table 3 normal rat skin and trauma in rat granulation tissue DNA and rna content

Group number of animals (n) DNA (mg/g) RNA (mg/g)

Normal group 9 0.96 ± 0.43 1.26 ± 0.49

Wound matched group 9 1.32 ± 0.48 1.87 ± 0.51 ^*

The leptin treatment organizes 9 1.37 ± 0.39 ^*2.40 ± 0.46 ^*#

Compare with normal group: ^*P＜0.05, ^*P＜0.01; Compare with matched group: #p＜0.01

(3), leptin is to the influence of trauma in rat granulation tissue protein and hydroxyproline content

Perform the operation after 7 days, the mensuration of the mark hydroxyproline content of protein in the wound granulation tissue of two operation groups and reflection skin wound healing degree collagen protein shows, leptin can obviously increase the protein and the hydroxyproline content of traumatic wounds tissue, this has the effect that promotes wound healing from another side illustration leptin, sees table 4 for details.

Table 4 normal rat skin and trauma in rat granulation tissue protein and hydroxyproline content

Group n protein (mg/g) n hydroxyproline (μ g/g)

Normal group 8 148.60 ± 7.68 8 80.41 ± 5.99

Wound matched group 10 104.01 ± 14.17 ^*8 29.55 ± 3.59 ^*

The leptin treatment organizes 10 114.98 ± 7.01 ^*# 8 33.92 ± 3.08 ^*#

Compare with normal group: ^*P＜0.01; Compare with matched group: #p＜0.05

(4), leptin is to the influence of fibroblast cultivation

Fibroblast is a most active cell in the repair in trauma, observes the fibroblastic influence of leptin to In vitro culture, can be from a side reflection leptin to promoting the effect of wound healing.In the experiment, we add the 200ng/ml leptin in culture fluid, observe the influence of its on cell proliferation, DNA and protein synthesis.Leptin is to the influence mtt assay of rat fibroblast propagation; Leptin is used respectively the influence of fibroblast DNA and protein synthesis ³The H-thymus pyrimidine and ³The H-proline mixes method.Experimental result sees Table 5, and therefrom as seen, leptin can obviously improve fibroblastic DNA and protein level.

Table 5 leptin is to the influence of fibroblast proliferation, DNA and the protein synthesis of cultivation

Group MTT (OD value) DNA (cpm) protein (cpm)

Contrast (0ng/ml) 0.0628 ± 0.0099 219.18 ± 55.91 679.43 ± 175.61

Experiment (200ng/ml) 0.0815 ± 0.0133 ^*378.67 ± 101.25 ^*910.64 ± 55.21 ^*

Compare with matched group ^*P＜0.05

＜110〉＜120〉＜130〉＜160〉1＜170〉PatentIn version 3.1＜210〉1＜211〉457＜212〉DNA＜213〉＜400〉1cggaattcat ggttcctatt caaaaagtcc aagatgacac caaaaccctc atcaagacaa 60ttgtcaccag gatcaatgac atttcacaca cgtcagtctc ctccaaacag aaagtcaccg 120gtttggactt cattcctggg ctccacccca tcctgacctt atccaagatg gaccagacac 180tggcagtcta ccaacagatc ctcaccagta tgccttccag aaacgtgatc caaatatcca 240acgacctgga gaacctccgg gatcttcttc acgtgctggc cttctctaag agctgccact 300tgccctgggc cagtggcctg gagaccttgg acagcctggg gggtgtcctg gaagcttcag 360gctactccac agaggtggtg gccctgagca ggctgcaggg gtctctgcag gacatgctgt 420ggcagctgga cctcagccct gggtgctgag gatcccg 457

Claims (3)

1. the purposes of leptin in the medicine of preparation promotion wound healing that has the gene expression of sequence shown in the sequence table.

2. purposes according to claim 1 is characterized in that said wound is operation wound, burn, scald or fracture.

3. the purposes of leptin in the cosmetics that preparation promotion human epidermal upgrades that has the gene expression of sequence shown in the sequence table.

Images