CN1445366A - New protein kinase specific to human cardiac muscle and its coded sequence - Google Patents
New protein kinase specific to human cardiac muscle and its coded sequence Download PDFInfo
- Publication number
- CN1445366A CN1445366A CN 02103737 CN02103737A CN1445366A CN 1445366 A CN1445366 A CN 1445366A CN 02103737 CN02103737 CN 02103737 CN 02103737 A CN02103737 A CN 02103737A CN 1445366 A CN1445366 A CN 1445366A
- Authority
- CN
- China
- Prior art keywords
- protein
- genes
- gene
- albumen
- heart
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A novel human cardiac muscle specific protein kinase gene/protein p93, its cDNA sequence, its amino acid sequence for coding protein, the tissue and cell localization, and kinase activity detection are disclosed. Said protein p93 takes part in heart development and heart disease generation, such as myocardiopathy and cardiac failure.
Description
Technical field:
The present invention be one with myocardial cell's contraction, energy metabolism, the relevant genes p93 of Dioxins (dioxin) receptor signal conduction path, relate to clone and the proteic exploitation and the Application Areas of biomedical Center Of Technical Excellence vascular disease relative new gene.
Background of invention:
The function of human body all cells, organ and system thereof all is by constituting 30 of human genome, 000-35, and 000 is gene-determined, and different tissues or the same difference of different developmental phases expressing gene of organizing have determined the specific function of this histoorgan.A series of processes such as the growth of cardiovascular systems, pathology, physiology are main all by the control of cardiovascular systems gene, and heart disease is first cause of the death in the whole world, so the clone identifies the critical function gene of these cardiovascular systemss and not only helps to illustrate the pathogenesis of cardiovascular system diseases, and can provide new thinking for these diseases of clinical treatment.
Myocardosis is to cause a dead important cause of the death by heart disease.Myocardosis is meant a class heart disease that only involves myocardial cell itself, can divide three classes on function: 1. 2. plumpness is 3. restricted for distensibility.Recent study finds that the disease gene of familial cardiomyopathy has following two classes: 1. relevant with energy metabolism of myocardial gene comprises the enzyme that participates in Fatty Acid Oxidation and plastosome oxidative phosphorylation.2. relevant with myocardium myo trifle contractile protein gene with cytoskeletal protein.And hypertrophic neuropathy is mainly relevant with the sudden change of sarcomere component, and DCM (dilated cardiomyopathy) is main relevant with the cytoskeleton component with sarcomere.
Most of myocardosis is insecondary, in the research to the secondary cardiomyopathy that caused by myocardial hypertrophy, has found to comprise a series of signal transduction pathway that cause myocardial hypertrophy of receptor,, MAPK cascade etc.Yet it is very crucial to further illustrating the Secondary cases myocardial hypertrophy to illustrate the myocardosis that is caused by sarcomere contractile protein and/or cytoskeleton defective, because being only, these mechanism cause the most important mechanism of typical myocardial hypertrophy, so research sarcomere, cytoskeleton, energy metabolism of myocardial signal transduction pathway defective cause focus, the difficult point that myocardial hypertrophy becomes current cardiovascular diseases molecular biology research.
Congenital heart disease is the other class congenital abnormality relevant with heart development.Discover that 90% congenital heart disease belongs to multifactor heredity (being the h and E factor interaction), remove foreign genetic element, such as rubella, drink, many environmental factorss (being so-called teratogenic factor) such as thalidomide, Trimethadione can cause the cardiovascular developmental malformation of fetus.The normal development of heart is subjected to the accuracy controlling of a series of signal conduction path, and any one link in its path-comprise transgenation of path own and the influence of extraneous teratogenic factor all might cause the generation of congenital heart disease.
Aryl hydrocarbon receptor (Aryl Hydrocarbon Receptor, AhR), claim Dioxins (dioxin) acceptor again, the transcription factor high conservative that is a class on evolving, that with growth regulatory factor Sim and the Per of fruit bat common trait is arranged on the structure, can induce a series ofly to comprise Cytochrome P450, the various drug metabolism enzyme expression of gene of aldehyde dehydrogenase (aldehyde dehydrogenase), quinone reductase (quinone reductase), and mainly participate in the signal transduction pathway of teratogenic factor reaction to external world.Genetics research to congenital heart disease finds that as the acceptor of environmental teratogen, the Dioxins acceptor has participated in heart development and myocardiac generation.Studies show that Embryo Gallus domesticus is cardiogenic, as AhR external source aglucon, environmental teratogen 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) can induce the generation of myocardial hypertrophy and heart septal defect; Knock out the mouse of AhR gene, all occur with myocardial hypertrophy and local Fibrotic cardiomyopathy.Yet, do not illustrate as yet by these signal transduction pathway of AhR mediation as orphan receptor.
Goal of the invention:
The clone identifies the crucial kinases p93 in the above-mentioned signal transduction pathway, illustrates its vital role in heart diseases such as heart development, myocardosis, thereby provides new thinking for the diagnosis and the treatment of cardiovascular diseases.Content and requirement:
Applying biological information science, cDNA library construction, determined dna sequence, molecular cloning, Northern Blot, Dot Blot, genetic immunization, protokaryon and eukaryotic protein expression and purification, kinase activity analyzed in vitro, yeast-two hybrid technique etc., the proteic new full length gene cDNA of clones coding p93, know its express spectra in nucleic acid level, obtain the rabbit source polyclonal antibody and the activated target protein of this gene, seek albumen interactional by yeast two-hybrid, with signal transduction pathway and the function of illustrating target protein with it.The technical indicator that this genes reaches is: the about 3400bp of cDNA total length of 1.p93, the protein of corresponding encoded has 845aa.2.p93 proteins encoded contain 3 protein structure domains, N end repeats (ankyrin repeats) structural domain for ankyrin, holding near C has a kinase domain, C-terminal is for being rich in ser structure territory (ser-rich).3. this gene is at myocardial cell's specifically expressing.4. the kinase domain of this gene coded protein has kinase whose self-phosphorylation activity.5. being rich in the ser structure territory and can interacting of this gene coded protein: 1. sarcomere albumen cTnI, MyBP-C, myocardium α-actin, adult's skeletal muscle α-actin with following three proteinoids; 2. the transcription factor aryl hydrocarbon receptor (Aryl Hydrocarbon Receptor, AhR) mixture component aryl hydrocarbon receptor interaction protein (aryl hydrocarbon receptor-interacting protein, ALP); 3. H-FABP 3 (H-FABP3) and myocardial mitochondria participate in the hydroxyl acyl CoA desaturase/3-ketoacyl-CoA thiolase/alkene acyl CoA hydratase three function synthase β subunits (hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase, beta subunit) of lipid acid β-Yang Hua.6. by the yeast two-hybrid results suggest, this gene and encoded protein thereof and myocardial cell's contraction, energy metabolism are relevant with Dioxins receptor signal conduction path, heart diseases such as this gene and proteins encoded thereof and heart development, myocardosis and heart failure are closely related, can be used for the gene diagnosis and the gene therapy of heart disease, also can be used for the design and development of new drug.
The full-length cDNA of description of drawings: Fig. 1: p93 and encoded protein matter Fig. 2: p93 thereof the distribution plan 4:p93 of distribution plan 3:p93 in 76 kinds of tissues of people in 6 kinds of the fetuses and the 8 kinds of tissues of being grown up be immunohistochemical methods Fig. 5 as a result in fetus and human adult heart tissue: p93 has kinase activity
Embodiment: the 1. extensive ESTs sequencing in human adult heart cDNA library.
Extract purifying normal adult heart mRNA, make up high-quality cDNA library.Shop, cDNA library dish (200-500 clone/150mm dish), the single plaque of picking changes in the sterilization centrifuge tube that contains 500 μ l SM damping fluids and 20 μ l chloroforms.Room temperature jolts after putting 2h, of short duration centrifugal after, get 5 μ l supernatants, the carrier primer that use to insert the fragment two ends carries out pcr amplification.The reaction cumulative volume is 50 μ l, and the amplification parameter is: 94 ℃, 3min, 94 ℃ of 5min again, 57 ℃ of 30sec, 72 ℃ of 3min, carry out 30 circulations altogether after, 72 ℃ of 3min again.Each PCR product is got the PCR product of 2 μ l behind the sepharose appraise quality, with fluorescein-labeled cDNA 5 ' the end carrier primer pcr amplification reaction that checks order.The reaction cumulative volume is 8 μ l, and the amplification parameter is: 94 ℃, and behind the 2min, 94 ℃ of 30sec, 50 ℃ of 15sec, 72 ℃ of 1min carry out 20 circulations, and 94 ℃ again, 30sec, 72 ℃ of 1min, 15 circulations, last 72 ℃ of 5min.PCR reacts end, gets 6 μ l and carries out the ESTs sequencing with automatic sequencer (PharmaciaALFDNA Sequencer).ESTs sequencing result (the NationalCenter for Biotechnology Information of the U.S. state-run biotechnology information center, NCBI) BLAST (Basic Local Alignment SearchTool) software, EST and GenBank/EMBL/DDBJ database that each cDNA is cloned carry out the homology comparative analysis.According to analytical results, be the pBK-CMV plasmid with the cyclisation of corresponding Z AP phage clone, " QIAprep Spin Miniprep Kit " that QIAGEN company is used in the amplification back extracts plasmid DNA, carries out sequencing on the ABI377 automatic sequencer.2. the full-length clone that separates coding p93
In the EST large scale sequencing, discovery contains the ankyrin similar to ILK from the est sequence of cloning H498 and repeats and kinase domain, and the pBK-CMV phage that will contain H498 cDNA subsequently cuts out from zap express vector by ExAssist/XLOLR helper phage system (Stratagene).Concrete steps: get 250 μ l ZAP phages, 1 μ l helper phage (ExAssist helper phage) the competent XL1-Blue MRF host of coinfection bacterium, behind 37 ℃ of cultivation 15min., add 3ml NZY liquid nutrient medium, cultivate 2.5-3hr again for 37 ℃, 65 ℃-70 ℃ the heating 20min., in 4 ℃ centrifugal (1000 * g, 15min.).Get the supernatant 100 μ l that contain pBluescript phagemid and transform the competent XLOLR of 200 μ l.Behind 37 ℃ of incubation 15min., add 300 μ l NZY liquid nutrient mediums, cultivate 45min. for 37 ℃ again, that resistance of coating card LB culture plate, 37 ℃ are spent the night.The picking mono-clonal, the alkaline lysis method of extracting plasmid, H498 cloned sequence total length is measured through the ABI377 automatic sequencer.3. the bioinformatic analysis of new full-length cDNA s
The homology of ESTs sequencing result relatively adopts the BLAST software of NCBI, and nucleic acid database is GenBank (Release124.0)/EMBL (Release 67)/DDBJ (Release 45).When after obtaining H498 clone full-length cDNA, doing further to analyze, by SRS (Version 6.0.7.3) inquiry SWISS-PROT (Release 39.22), TrEMBL (Release 17.0).Clustal X software is adopted in the multiple arrangement of aminoacid sequence.Domain analyses adopts the PROSITE database (Release 17.0) of Switzerland expert analysis of protein system (ExPASy) and the SMART software (version 3.3) of EMBL.The PCR design of primers adopts Informax, the Vector NTI of Inc
TMThe Suite software package.4. fetus, adult Northern blot and 76 kinds of tissues organizes the dot matrix distributional analysis more
Extract cyclisation plasmid pBK-CMV-p93, through NotI, EcoRI double digestion, with the p93 full-length cDNA that obtains as template, use " Prime-a-Gene Labeling System " (Promega) the random primer test kit carry out probe mark.Fetus is organized the preparation of Hybond membrane more: the total RNA that extracts 8 months 6 kinds of tissues such as aborted fetus skeletal muscle, brain, heart, liver, lung and kidney, after ultraviolet spectrophotometer is quantitative, each swimming lane applied sample amount is 30 μ g, the denaturing formaldehyde gel electrophoresis, shifts and be fixed to nylon membrane, with conventional.The adult organizes Hybond membrane (MTN more
TM) (Clontech) and contain 76 kinds of tissue MT E
TM(Clontech) carried out organizing the dot matrix distributional analysis, the operation by specification carries out more.5. Polyclonal Antibody Preparation and evaluation
Be prokaryotic expression p93, design 5 ' primer CTGGATCCAAATGGGAAATTATAAATCTAGACC, 3 ' primer CGTCGACTGTCGTAAGCCCGCCGGCGAT, wherein 5 ' and 3 ' primer contains BamH I and EcoR I restriction enzyme site respectively.With the pBK-CMV plasmid that contains p93 is template, with pfuTurboTM archaeal dna polymerase (Stratagene) the full encoder block of p93 is cloned into prokaryotic expression carrier pGEX-5X-1 (Amersham Pharmacia).Through sequence verification all to make up sub-reading frame correct, after PCR does not introduce new sudden change yet, pGEX-p93 imported carries out prokaryotic expression in the e. coli bl21, its expressing protein is used to detect the tiring and specificity of polyclonal antibody of nucleic acid immunization method preparation.
With BamH I and EcoR I the p93 encoder block is cut out from carrier pGEX-5X-1, directly subclone is built into carrier for expression of eukaryon pSecTag-p93 to pSecTag (Invitrogen).The about 3mg of alkaline lysis large quantity extracting plasmid, behind the PEG purifying, divide to mediate immunizing rabbit with acusector three times each about two weeks at interval, get antiserum(antisera) in immune for the third time back 8 days, detect the rabbit anteserum of immunity front and back with the total bacterial protein (containing p93 albumen) of Western blot method and prokaryotic expression.6. immunohistochemical methods
Get the normal adult heart tissue of 8 months aborted fetus heart tissues and sudden death and carry out paraffin section.Put the 10min in 3%H2O2 that cuts into slices, deactivating endogenous peroxydase.Antigen retrieval adopts two exposure methods, boils 30min with inflexible rafter acid repair liquid (pH8.0) in microwave oven earlier, reduce to room temperature after, digest 30min.10% serum with 0.1%Trypsin again and seal.With two step method row antibody labeling, with the p93 antiserum(antisera) covering section of antibody diluent (U.S. Zymed) with dilution in 1: 20,4 ℃ are spent the night, and directly add two anti-, three anti-blended PictureTM working fluids, room temperature 1hr, row DAB dyeing 8-10min.Hrarris Hematorylin understain nucleus, dehydration, mounting.7.p93 expression in the COS-7 eukaryotic cell and activation analysis thereof
With BamH I and EcoR I the full encoder block of p93 is cut out from carrier pGEX-5X-p93, directly subclone (Invitrogen) is built into carrier for expression of eukaryon pcDNA4-p93 to carrier for expression of eukaryon pcDNA4/HisMax (A).PcDNA4 contains 6 * His in order to purifying and Xpress
TMEpitope is with standby antibody test.The plasmid that is used for eukaryotic cell transfection is through CsCl ultracentrifugation purifying, and with liposome Lipofectamine (Gibco BRL) or DOSPER (Roche) mediation transfection COS-7 cell.In order to detect protein expression, cell is dissolved in the 10mM Tris damping fluid (pH7.4) that contains 1%SDS and 10mM EDTA.Antibody is Anti-Xpress
TMMonoclonal antibody (Stratagene).Detect Westernblot result with ECL method (enhanced chemiluminescence), Luminol reagent is available from Santa Cruz.
Behind the transient transfection 2-3 days, the trysinization of COS-7 cell, centrifugal (1000 * g, 1min) collecting cell.Per 10
6-10
7Individual cell is washed twice with 1 * binding buffer liquid of 1ml ice precooling.Being prepared as follows of binding buffer liquid: 0.5M NaCl, 20mMTrisHCl pH7.9,5mM imidazoles.Cell precipitation is stored in-70 ℃ of standby or preparation cracking.With 1 * 10
7Individual COS-7 cell is dissolved in the 1ml lysate.Being prepared as follows of lysis buffer: 0.5M NaCl, 20mM Tris HCl pH7.9, the 5mM imidazoles, 10% glycerine, 1%Triton X-100 does not contain thoroughness protease inhibitor cocktail a slice (Roche) (complete of EDTA, mini, EDTA-free Protease Inhibitor Cocktail Tablets), 1mM PMSF, 5mM beta-mercaptoethanol; Solution is stored in-70 ℃ of 1min or puts 30min in 4 ℃.Centrifugal (10,000 * g 30min), removes the cytoclasis thing, and supernatant is used for purifying protein in 4 ℃ subsequently.Get 50 μ l and contain 20% alcoholic acid 50%ProBond
TMResin (Invitrogen) suspension is prewetted with the lysate of 60 μ l earlier, after supernatant is added to Resin, in 4 ℃ of 1-3hr that vibrate.For analyzing kinase activity, in 30 μ l systems, purifying protein and kinase buffer liquid are reacted.Kinase buffer liquid is formulated as follows: 20mM Tris HCl, pH7.0,10mM MnCl
2, 10mM MgCl
2, 2mM NaF, 1mM Na
3VO
4, 1-2mM DTT, 10 μ Ci[γ-
32P] ATP, be reflected at 30 ℃ and carry out 30min.Response sample is added Laemmli ' s sample-loading buffer boil the 6%SDS-PAGE electrophoresis.Albumen is transferred to the NC film and through radioautograph.8. yeast two-hybrid screening
Make up the pGBKT7-Ser-rich bait carrier, at first prove conclusively it the yeast free of toxic effects, the subsequent analysis transformant in His, Ade the background growth and to the activation of MEL1, prove conclusively this structure and can not activate reporter gene.Cultivate 3-5 days so that diploid cell forms visible clone in 30 ℃ of inversions, the clone on the counting culture plate calculates mating efficient.
Sieve storehouse process: prepare spissated AH109[pGBKT7-Ser-rich] overnight culture, with its with 1ml pre-inversion heart cDNA library in 2-L sterilizes flask, in 30 ℃ of 30-50rpm 20-24hr that vibrates gently.Move to a 100ml centrifuge tube of sterilizing with the mating mixture next day, and the centrifugal 10min sedimentation cell of 1000 * g is used 2 * YPDA/kan flushing mating flask secondary, each 50ml subsequently.The cell mass that suspends and obtain at first with twice washing fluid, the centrifugal 10min sedimentation cell of 1000 * g once more.Suspension cell agglomerate in 10ml 0.5 * YPDA/kan, the cumulative volume of measurement cell+substratum.Get 5 μ l library mating mixtures, with back 1: 10 of spreading 100 μ l in SD/-Leu, SD/-Leu/-Trp culture plate respectively of 0.5 * YPDA/kan dilution
4, 1: 10
2The mating mixture of dilution is to predict mating efficient.Remaining mating mixture is laid on 50 big (150mm) SD/-Ade/-His/-Leu/-Trp (QDO) culture plates, every dish 200 μ l.Cultivate 8-21 days until clone's appearance in 30 ℃ of inversions.In 8-21 days yeast growth processes, progressively positive colony is chosen to QDO grid dish, 30 ℃ of growths are after 1-2 days, according to clone's number what, the establishing time point carries out die β-gal and detects primary dcreening operation, with positive colony in ruling once more on the SD/-Ade/-His/-Leu/-Trp dish after 2 times, positive colony is chosen to QDO grid dish, grew 2 days for 30 ℃, according to how much cloning number, the establishing time point carries out die β-gal detection and screens once more.
Library titration: with 5 μ l libraries dilution 10
4After coat the SD/-Leu plate, be inverted dull and stereotyped hatching and calculated contained clone's number and library titre thereof in 3-5 days in 30 ℃.
Calculate the efficient of yeast mating and clone's number of screening: according to growing in SD/-Leu, the clone's number in the SD/-Leu/-Trp culture dish calculates mating efficient, calculates the clone's number that is screened in conjunction with the library titre.
Positive colony is sorted out: isolated plasmid dna from yeast, and by transforming electroreception attitude DH5 α to obtain the positive colony plasmid, pcr amplification AD/library inserts son, and uses Alu I and Hae III single endonuclease digestion respectively, and electrophoretic analysis PCR and enzyme thereof are cut the product size.
Checking again in the yeast body: AD/library and AD plasmid that all desires are detected transform AH109, be laid on the SD/-Leu substratum, negative control plasmid pGBKT7-Lam transforms Y187, is laid on the SD/-Trp substratum, after treating above-mentioned clonal growth, choose respectively to the mating of ruling of SD grid dish.The clone chooses the culture plate to SD/-Leu/-Trp with feminine gender, and experimental group and positive control clone thereof choose the culture plate to SD/-Ade/-His/-Leu/-Trp, grow 4-5 days for 30 ℃, carry out die β-gal and detect.
Claims (8)
1. the present invention relates to the protein kinase p93 of a myocardium specifically expressing, comprise the cDNA sequence of this gene and the aminoacid sequence of coded protein thereof.It is characterized in that: the about 3400bp of cDNA total length of p93, corresponding encoded protein has 845aa.
2. the p93 genes according to claim 1, it is characterized in that: this albumen contains 3 protein structure domains, the N end repeats (ankyrin repeats) structural domain for ankyrin, near the C end one kinase domain is arranged, and C-terminal is for being rich in ser structure territory (ser-rich).
3. according to claim 1,2 described p93 albumen/genes, it is characterized in that: its kinase domain has kinase activity.
4. according to claim 1,2 described p93 albumen/genes, it is characterized in that: be rich in Serine the C-end can with sarcomere albumen cTnI, MyBP-C, cardiac muscle α-actin, adult's skeletal muscle α-actin, transcription factor aryl hydrocarbon receptor (ArylHydrocarbon Receptor, AhR) mixture component aryl hydrocarbon receptor interaction protein (aryl hydrocarbonreceptor-interacting protein, AIP), hydroxyl acyl CoA desaturase/3-ketoacyl-CoA thiolase/alkene acyl CoA hydratase three function synthase β subunits (hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase, β subunit) that H-FABP 3 (H-FABP3) and myocardial mitochondria participate in the lipid acid β-Yang Hua take place special and direct interaction.
5. according to claim 1,2,4 described p93 genes, it is characterized in that: p93 regulates myocardial cell's contraction by taking place to interact with sarcomere albumen cTnI, MyBP-C, myocardium α-actin, adult's skeletal muscle α-actin.
6. according to claim 1,2,4 described p93 genes, it is characterized in that: p93 is by participating in regulation and control to myocardial cell's allos vitamin H metabolism (xenobiotic metabolism) enzyme genetic transcription with aryl hydrocarbon receptor mixture component interaction.
7. according to claim 1,2,4 described p93 genes, it is characterized in that: p93 interacts by the hydroxyl acyl CoA desaturase/3-ketoacyl-CoA thiolase/alkene acyl CoA hydratase three function synthase β subunits that participate in the lipid acid β-Yang Hua with H-FABP 3 and myocardial mitochondria and participates in adjusting myocardial cell's energy metabolism.
8. according to claim 1,2,3,4,5,6,7 described p93 genes, it is characterized in that: many heart diseases such as this gene and proteins encoded thereof and heart development, myocardosis and heart failure are closely related, can be used for the gene diagnosis and the gene therapy of heart disease, also can be used for the design and development of new drug.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 02103737 CN1445366A (en) | 2002-03-15 | 2002-03-15 | New protein kinase specific to human cardiac muscle and its coded sequence |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 02103737 CN1445366A (en) | 2002-03-15 | 2002-03-15 | New protein kinase specific to human cardiac muscle and its coded sequence |
Publications (1)
Publication Number | Publication Date |
---|---|
CN1445366A true CN1445366A (en) | 2003-10-01 |
Family
ID=27810772
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 02103737 Pending CN1445366A (en) | 2002-03-15 | 2002-03-15 | New protein kinase specific to human cardiac muscle and its coded sequence |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1445366A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106018824A (en) * | 2016-05-18 | 2016-10-12 | 上海中医药大学 | Application of aromatic hydrocarbon receptor in preparation of drug-induced heart disease biomarker |
-
2002
- 2002-03-15 CN CN 02103737 patent/CN1445366A/en active Pending
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106018824A (en) * | 2016-05-18 | 2016-10-12 | 上海中医药大学 | Application of aromatic hydrocarbon receptor in preparation of drug-induced heart disease biomarker |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Kennedy | The postsynaptic density at glutamatergic synapses | |
Ribon et al. | A novel, multifunctional c-Cbl binding protein in insulin receptor signaling in 3T3-L1 adipocytes | |
Nelissen et al. | Dynamic changes in ANGUSTIFOLIA3 complex composition reveal a growth regulatory mechanism in the maize leaf | |
Hug et al. | Capping protein levels influence actin assembly and cell motility in Dictyostelium | |
Staiger et al. | The plant cytoskeleton | |
Wang et al. | Genome-wide systematic characterization of bZIP transcription factors and their expression profiles during seed development and in response to salt stress in peanut | |
CA2665489C (en) | Prrg4-associated compositions and methods of use thereof in methods of tumor diagnosis | |
EA038600B1 (en) | Interrogatory cell-based assays and uses thereof | |
Salamon et al. | Human MYO18B, a novel unconventional myosin heavy chain expressed in striated muscles moves into the myonuclei upon differentiation | |
Morse et al. | Post‐translational modification of an R2R3‐MYB transcription factor by a MAP Kinase during xylem development | |
CN103333233B (en) | Agapanthus praecox auxin receptor protein TIR1 and coding gene and probe thereof | |
US5610018A (en) | Substrate for the epidermal growth factor receptor kinase, antibodies thereto and methods of use thereof | |
Dalla Valle et al. | β‐keratins of differentiating epidermis of snake comprise glycine‐proline‐serine‐rich proteins with an avian‐like gene organization | |
CN1954071A (en) | Cell cycle genes and related use methods | |
Qu et al. | Plant casein kinases phosphorylate and destabilize a cyclin-dependent kinase inhibitor to promote cell division | |
González-Camacho et al. | The nucleolar structure and the activity of NopA100, a nucleolin-like protein, during the cell cycle in proliferating plant cells | |
Nigg et al. | Vertebrate cdc2 kinase: its regulation by phosphorylation and its mitotic targets | |
CN1445366A (en) | New protein kinase specific to human cardiac muscle and its coded sequence | |
CN103342741B (en) | Agapanthus praecox gibberellin receptor APGID1b protein, and encoding gene and probe thereof | |
Kotlikoff et al. | Methodologic advancements in the study of airway smooth muscle | |
Reddy et al. | Nuclear localization of Myomesin-1: possible functions | |
Marwedel et al. | Plant-specific regulation of replication protein A2 (OsRPA2) from rice during the cell cycle and in response to ultraviolet light exposure | |
Ly et al. | Identification of rat EMAP, a δ-glutamate receptor binding protein | |
Welch et al. | Cloning and characterization of βCAP73, a novel regulator of β-actin assembly | |
CN103333232A (en) | Agapanthus praecox gibberellin acceptor APGID1a protein and coding gene and probe thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |