CN1438233A - Tomato 1-amino-cyclopropane-1-carboxylic-synthesized zyme gene chip and primer - Google Patents
Tomato 1-amino-cyclopropane-1-carboxylic-synthesized zyme gene chip and primer Download PDFInfo
- Publication number
- CN1438233A CN1438233A CN 02104558 CN02104558A CN1438233A CN 1438233 A CN1438233 A CN 1438233A CN 02104558 CN02104558 CN 02104558 CN 02104558 A CN02104558 A CN 02104558A CN 1438233 A CN1438233 A CN 1438233A
- Authority
- CN
- China
- Prior art keywords
- tomato
- primer
- dna
- seq
- cyclopropane
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a DNA segment obtained by peculiar PCR increase in tomato and PCR guide matter. The DNA segment and guide matter can peculiary identify DNA component of tomato.
Description
Technical field
The present invention relates to nucleic acid, specifically, the present invention relates to the specific nucleic acid of tomato.
Background technology
Polymerase chain reaction (PCR) is widely used in various analyses based on DNA.But for guaranteeing the success of pcr analysis, key is the quality of template DNA and the degrees of specificity of quantity and the primer.
The DNA of different sources is the DNA of various processed foods for example; usually can be subjected to the pollution of protein, fat, polysaccharide, poly-phenol and other materials; these materials may be with archaeal dna polymerase and nucleic acid interactions and are influenced pcr analysis, even also can cause false negative result in some cases.
Tomato is widely used on the food very much, as salad and tomato condiment miscellaneous tomato-sauce etc. for example.According to estimates, the processed food that contains tomato accounts for percent 1-2% of all food.Whether food contains the tomato composition in (comprising genetically modified food), and the measuring method of simple possible is not arranged at present as yet.
DNA analysis method based on polymerase chain reaction (PCR) can be used for detecting whether contain tomato DNA in the food.In tomato, 1-amino-cyclopropane-1-carboxylic acid synthetase (1-aminocyclopropane-1-carboxylate synthase) catalysis adenosylmethionine (AdoMet) generates ethene.Tomato 1-amino-cyclopropane-1-carboxylic acid synthetase dna sequence dna is different with 1-amino-cyclopropane-1-carboxylic acid synthetase of other farm crop.Therefore, can find out wherein distinctive one section sequence, design and synthesize primer in view of the above and be used for pcr amplification.
Summary of the invention
The objective of the invention is to find a kind of in tomato distinctive dna sequence dna, design the primer of one section peculiar dna fragmentation of described tomato that can be used for increasing specifically with this.Another object of the present invention is to provide the dna fragmentation that obtains by pcr amplification tomato DNA by described primer, thereby identify the existence of tomato DNA in the food.
The present inventor is according to the nucleotide sequence of tomato 1-amino-cyclopropane-1-carboxylic acid synthetase (being called for short the ACC synthetic enzyme) gene (Genbank goes into Tibetan AF043122), designed and synthesized one section specific dna sequence dna, used this primer successfully to amplify contained tomato DNA in tomato and the processed food thereof as primer.Specifically, the present invention includes following aspect:
On the one hand; The invention provides a kind of DNA, it comprises the sequence shown in the following SEQ ID NO:1 or has the sequence of at least 99% sequence homogeneity: cgaaagattt gggacttcca ggatttcgag ttggtgccat ttattccaac gacgatagggtcgtctctgc agccacaaaa atgtctagtt ttggattaat ttcatctcaa actcaataccttctttctgc tttgctatca gacaaaaagt tcacgaaaaa ttacgtgtct gaaaatcaaaagaggctgaa aaaacgacat gaaatgctag ttggtggtct taaacaaatt ggaataaggtgccttgagag caatgctggg ttg (SEQ ID NO:1) with sequence shown in the SEQ ID NO 1
On the other hand, the invention provides a kind of primer, it has at least 18 successive Nucleotide in the sequence shown in the following SEQ ID NO:2:
5’-cgaaagatttgggacttcca-3’(SEQ?ID?NO：2)。
These primers are to be used to increase the forward primer of tomato 1-amino-cyclopropane-1-1-carboxylic-synthesized zyme gene chip.Wherein, preferably this primer preferably has at least 19 successive Nucleotide in the sequence shown in the SEQ ID NO:2.Most preferably has the sequence shown in the SEQ ID NO:2: 5 '-cgaaagatttgggacttcca-3 '.
On the one hand, the invention provides a kind of primer again, it has at least 17 successive Nucleotide in the sequence shown in the following SEQ ID NO:3:
5’-caacccagcattgctctca-3’(SEQ?ID?NO：3)。
This primer is to be used to increase the reverse primer of tomato 1-amino-cyclopropane-1-1-carboxylic-synthesized zyme gene chip.Wherein, this primer preferably has at least 17 successive Nucleotide in the sequence shown in the SEQ ID NO:3.More preferably have at least 18 successive Nucleotide in the sequence shown in the SEQ ID NO:3.Most preferably this primer has sequence: 5 '-caacccagcattgctctca-3 '.
Above-mentioned primer of the present invention (hereinafter being sometimes referred to as " ACC primer ") has the specificity of height.In different plant variety (tomato, maize, potato and soybean), extract DNA.Be template and use primer of the present invention with gained DNA, carry out pcr amplification, determine the specificity of tomato ACC primer.The reaction result demonstration is only increased in tomato and has been obtained the dna fragmentation of 263bp.
Embodiment
Below the present invention will be further described in the mode of embodiment, but embodiment is not construed as limiting the present invention on which kind of meaning.
Embodiment
Synthesizing of ACC primer
Prepare primer according to ordinary method well known in the art.For example, upward synthesize at automatic dna synthesizer (for example at the full-automatic dna synthesizer of the ABI of U.S. PE company 3949 types) according to the explanation of manufacturers.Synthesize the forward primer 5 '-cgaaagatttgggacttcca-3 ' (SEQ ID NO:2) of tomato ACC synthase gene and the reverse primer 5 '-caacccagcattgctctca-3 ' (SEQ ID NO:3) of tomato ACC synthase gene respectively.
The amplification of the dna fragmentation of the 263bp of ACC gene
With Qiagen DNeasy Plant Mini test kit, extract tomato DNA and be dissolved in the 100 microlitre distilled waters according to the explanation of manufacturers.Get 5 microlitre DNA, add PCR premixed liquid (1 times of PCR damping fluid, 200 micromole dNTP, 200 micromole tomato ACC forwards and reverse primer and 0.25 Taq of unit archaeal dna polymerase).Described PCR damping fluid is: 10mM Tris-HCl (pH 8.6), 50mM KCl, 1.5mM MgCl
2With 0.1%Triton X-100.PCR is reflected on the Geneamp PCR System9700 instrument that Applied Biosystems produced and carries out, and response procedures is: 95 ℃ 2 minutes, be subsequently 94 ℃ 1 minute, 56 ℃ 1 minute, 72 ℃ 1 minute, react 35 circulations, add 10 minutes final extensions.The PCR product is separated by 1% agarose gel electrophoresis.Adopt Perkin Elmer ABI377 sequenator that the DNA that is amplified is checked order, result such as SEQ ID NO:1 are listed.
The specificity of tomato ACC primer
Extract DNA with the described method of Qiagen DNeasy Plant Mini test kit, in different plant variety (tomato, maize, soybean and potato), extract DNA and be dissolved in 100 microlitre distilled waters.Get 5 microlitre DNA, carry out pcr amplification by above PCR reaction conditions.The PCR product is separated by 1% agarose gel electrophoresis.Experimental result shows that only increasing has obtained the dna fragmentation of 263bp in tomato.By dna sequencing, the result confirms to increase its sequence of fragment of this 263bp of having obtained shown in the SEQ ID NO:1.
The tomato processed food is carried out pcr analysis
Extract the DNA of tomato-sauce, tomato juice and tomato soup respectively.Wherein adopt the DNA of QiagenDNeasy Plant Mini test kit, adopt ethane and guanidine thiocyanate method to extract the DNA of tomato juice and tomato soup according to manufacturer's explanation extraction tomato-sauce.In 2 gram liquid samples, add 10 milliliters of ethane and 1 milliliter of extracting solution (extracting solution consist of 100 mmole Tris-HCl, pH6.4; 500 mmole EDTA, pH8.0; 2.6 gram Triton X100 and 120 gram guanidine thiocyanates; Carry out sterile filtration by 0.2 micron microporous membrane), thoroughly mix.Then 5, centrifugal 20 minutes of 000Xg moves into new centrifuge tube with upper strata and middle layer; Add that to shake into milkiness behind the equal-volume chloroform aqueous, again 15,000Xg gets the upper strata after centrifugal 10 minutes, moves into new centrifuge tube; The Virahol that adds 2 microlitre glycogen solution (20 microgram glycogen/microlitre) and 400 to 600 microlitres, reaction is 30 minutes in the room temperature.Then 15, centrifugal 10 minutes deposit D NA of 000Xg, and wash twice with 70% ethanol.0.2 * the TE (10 mmole Tris-HCl, the pH8.0 that add 50 microlitres after the dry air; 1 mmole EDTA) damping fluid, this dna solution are crossed and are kept at 4 ℃ after PharmaciaMicrospin S300 post is removed residual RNA and desalination.
The DNA that extracts all carries out pcr amplification with following method from solid and liquid sample.Adopt ACC forward of the present invention and reverse primer that the DNA that is extracted is carried out pcr amplification and be the PCR negative control with the PCR damping fluid.Response procedures is: 95 ℃ 2 minutes, be subsequently 94 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ 1 minute, react 35 circulations, add 10 minutes final extensions.The PCR product separates with 2% agarose gel electrophoresis.The result shows, except that negative control, all increases in all tested materials and has obtained the fragment of 263bp.
The relation of the sequence identity of the length of ACC primer and PCR product
Synthetic respectively dna fragmentation and synthetic dna fragmentation with at least 17 continuous nucleotides among the SEQ ID NO:3 with at least 18 continuous nucleotides among the SEQ ID NO:2.The condition that repeats above PCR reaction increases to tomato DNA.The order-checking after 1% agarose gel electrophoresis separation of gained PCR product.And be reference sequences with SEQ ID NO:1, calculate the sequence identity that institute's amplification PCR products is compared with reference sequences.The result is as shown in table 1.
Table 1
| Primer length | The identity that the PCR product is compared with SEQ ID NO:1 |
| Forward primer 18/ reverse primer 19 | ?????99.8％ |
| Forward primer 19/ reverse primer 19 | ?????99.9％ |
| Forward primer 20/ reverse primer 17 | ?????99.8％ |
| Forward primer 20/ reverse primer 18 | ?????99.9％ |
| Forward primer 18/ reverse primer 17 | More than 99.0% |
| Forward primer 18/ reverse primer 18 | ?????99.7％ |
Annotate: the identical continuous nucleotide number of sequence of the digitized representation behind the primer and forward primer (SEQ ID NO:2) or reverse primer (SEQ ID NO:3).
More than the present invention is described in detail, those skilled in the art can make some modification that does not break away from the scope of the invention or changes to the present invention without departing from the premise in the spirit of the present invention.As long as within the scope of the appended claims, these modifications and change just are included in the present invention.
＜110〉 ( MolecularTaq Limited )＜120〉1--1-＜130〉SPI020272-09＜160〉3＜170〉PatentIn version 3.1＜210〉1＜211〉263＜212〉DNA＜213〉 ( Lycopersicon esculentum )＜400〉1cgaaagattt gggacttcca ggatttcgag ttggtgccat ttattccaac gacgataggg 60tcgtctctgc agccacaaaa atgtctagtt ttggattaat ttcatctcaa actcaatacc 120ttctttctgc tttgctatca gacaaaaagt tcacgaaaaa ttacgtgtct gaaaatcaaa 180agaggctgaa aaaacgacat gaaatgctag ttggtggtct taaacaaatt ggaataaggt 240gccttgagag caatgctggg ttg 263＜210〉2＜211〉20＜212〉DNA＜213〉＜400〉2cgaaagattt gggacttcca 20＜210〉3＜211〉19＜212〉DNA＜213〉＜400〉3caacccagca ttgctctca 19
Claims (9)
1. DNA, it comprises the sequence shown in the SEQ ID NO:1 or has the sequence of at least 99% sequence identity with sequence shown in the SEQ ID NO 1.
2. primer, it has at least 18 successive Nucleotide in the sequence shown in the SEQ ID NO:2.
3. the described primer of claim 2, it has at least 19 successive Nucleotide in the sequence shown in the SEQ ID NO:2.
4. the described primer of claim 2, it has sequence: 5 '-cgaaagatttgggacttcca-3 '.
5. each described primer among the claim 1-4, it is to be used to increase the forward primer of tomato 1-amino-cyclopropane-1-1-carboxylic-synthesized zyme gene chip.
6. primer, it has at least 17 successive Nucleotide in the sequence shown in the SEQ ID NO:3.
7. the described primer of claim 6, it has at least 18 successive Nucleotide in the sequence shown in the SEQ ID NO:3.
8. the described primer of claim 6, it has sequence: 5 '-caacccagcattgctctca-3 '.
9. according to each described primer among the claim 7-9, it is to be used to increase the reverse primer of tomato 1-amino-cyclopropane-1-1-carboxylic-synthesized zyme gene chip.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 02104558 CN1438233A (en) | 2002-02-11 | 2002-02-11 | Tomato 1-amino-cyclopropane-1-carboxylic-synthesized zyme gene chip and primer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 02104558 CN1438233A (en) | 2002-02-11 | 2002-02-11 | Tomato 1-amino-cyclopropane-1-carboxylic-synthesized zyme gene chip and primer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1438233A true CN1438233A (en) | 2003-08-27 |
Family
ID=27672086
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 02104558 Pending CN1438233A (en) | 2002-02-11 | 2002-02-11 | Tomato 1-amino-cyclopropane-1-carboxylic-synthesized zyme gene chip and primer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1438233A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109852725A (en) * | 2019-04-12 | 2019-06-07 | 山东农业大学 | A kind of method of fruit resistant storage properties that identifying apple plants and its primer pair that uses |
| CN113151232A (en) * | 2021-04-01 | 2021-07-23 | 江苏省中国科学院植物研究所 | 1-aminocyclopropane-1-carboxylic acid synthetase of michelia figo, and coding gene and application thereof |
-
2002
- 2002-02-11 CN CN 02104558 patent/CN1438233A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109852725A (en) * | 2019-04-12 | 2019-06-07 | 山东农业大学 | A kind of method of fruit resistant storage properties that identifying apple plants and its primer pair that uses |
| CN109852725B (en) * | 2019-04-12 | 2021-11-02 | 山东农业大学 | Method for identifying fruit storage tolerance of apple plants and specific primer pair used by method |
| CN113151232A (en) * | 2021-04-01 | 2021-07-23 | 江苏省中国科学院植物研究所 | 1-aminocyclopropane-1-carboxylic acid synthetase of michelia figo, and coding gene and application thereof |
| CN113151232B (en) * | 2021-04-01 | 2023-11-14 | 江苏省中国科学院植物研究所 | 1-aminocyclopropane-1-carboxylic acid synthetase of lycoris aurea, and coding gene and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hadidi et al. | Polymerase chain reaction technology in plant pathology | |
| AU723678B2 (en) | Target nucleic acid sequence amplification | |
| CN111733216B (en) | Method for improving detection efficiency of target nucleic acid | |
| WO2003100019A2 (en) | Nested pcr employing degradable primers | |
| JPH025864A (en) | Amplification of nucleic acid | |
| JP2002209594A (en) | Method for identifying nucleotide base | |
| KR101834565B1 (en) | CAPS Marker for Differentiation of Shiitake Mushroom Cultivar Sanmaru-1 and use thereof | |
| AU2008210279B2 (en) | Generation of nucleic acid molecules | |
| KR101906037B1 (en) | CAPS Marker for Differentiation of Shiitake Mushroom Cultivar Chunjang-3 and use thereof | |
| CN114959064A (en) | Molecular detection method for identifying recessive white feather genotype of chicken by anticoagulation whole blood method and application thereof | |
| WO2009140497A1 (en) | Enzyme reagents for amplification of polynucleotides in the presence of inhibitors | |
| Cross et al. | Endonucleolytic mutation analysis by internal labeling (EMAIL) | |
| CN1438233A (en) | Tomato 1-amino-cyclopropane-1-carboxylic-synthesized zyme gene chip and primer | |
| US11174511B2 (en) | Methods and compositions for selecting and amplifying DNA targets in a single reaction mixture | |
| CN1438232A (en) | Maize alcohol soluble protein gene chip and primer | |
| CN1438231A (en) | Soybean 1-amino-cyclopropane-1-carboxylic-synthesized zyme gene chip and primer | |
| EP4077661A1 (en) | Ngs library preparation using covalently closed nucleic acid molecule ends | |
| CN1438234A (en) | Potato 1-amino-cyclopropane-1-carboxylic-synthesized zyme gene chip and primer | |
| US20230407366A1 (en) | Targeted sequence addition | |
| KR102100938B1 (en) | Primer sets for diagnosing a disease by sweet potato yellow mottle virus and method for diagnosing the same | |
| JP4650420B2 (en) | Base determination method and base determination kit | |
| AU2013203278B2 (en) | Generation of nucleic acid molecules | |
| JP2007000040A (en) | Method for detecting b-type hepatitis virus | |
| WO2022112316A1 (en) | Targeted enrichment using nanopore selective sequencing | |
| JP6470662B2 (en) | Method for discriminating the presence or absence of stickiness and primer set for judgment of stickiness characteristics |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: DE Ref document number: 1058674 Country of ref document: HK |
|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: WD Ref document number: 1058674 Country of ref document: HK |