CN1415203A - A kind of disinfection preparation and disinfecting wet towel its method of preparation and application - Google Patents
A kind of disinfection preparation and disinfecting wet towel its method of preparation and application Download PDFInfo
- Publication number
- CN1415203A CN1415203A CN 02137401 CN02137401A CN1415203A CN 1415203 A CN1415203 A CN 1415203A CN 02137401 CN02137401 CN 02137401 CN 02137401 A CN02137401 A CN 02137401A CN 1415203 A CN1415203 A CN 1415203A
- Authority
- CN
- China
- Prior art keywords
- xaa
- lys
- arg
- leu
- ile
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
A disinfectant and its disinfecting wet tissue for cleaning and disinfecting human face, hand, skin and mucose are disclosed. Said disinfectant contains antibacterial peptide GK, detergent, and skin-moistening agent. Its advantages are high bactericiding effect (over 99%) to colibacillus, staphylococcus aureus and Pseudomonas aeruginosa, and no irritation.
Description
Technical field
The present invention relates to a kind of disinfectant preparation and pasteurization material, relate in particular to a kind of disinfectant preparation and pasteurization towelette that contains antibacterial peptide.
Background technology
Wet tissue, the pasteurization towelette sold on the present domestic market, wherein contained disinfection composition all is a chemical composition, as bleaching powder, bromogeramine, Iodophor, Peracetic acid or glyoxal etc., though have certain bactericidal activity, but skin is had excitant even can be toxic, be unsuitable for especially damaged skin, baby tender and lovely skin.If stimulate and the content of minimizing chemical disinfection composition in order to reduce, can be again that the Disinfection Effect of wet tissue weakens, can not effectively suppress the growth of bacterium.The residual of chemical composition can pollute environment again simultaneously.Press at present a kind of can effective cleaning sterilization can not produce again and stimulate and the wet tissue of toxic and side effect.
Chinese patent application file 93103890.1 discloses a kind of sanitary wet towel for baby, adopt a kind of disinfectant for external use Chlorhexidine Acetate to replace the disinfectant that contains active chlorine and peroxide commonly used as fungicide active ingredient, this composition bactericidal activity is strong, effective dose is low, reduced excitant to baby's skin, but also belong to chemical composition, can't thoroughly overcome above-mentioned defective.
Summary of the invention
One of technical issues that need to address of the present invention provide a kind of disinfectant preparation that contains antibacterial peptide, to overcome the above-mentioned defective that prior art exists;
Two of the technical issues that need to address of the present invention provide a kind of pasteurization towelette that contains antibacterial peptide.
Three of the technical issues that need to address of the present invention provide a kind of preparation method of pasteurization towelette.
Another technical problem that the present invention need solve discloses the application of described pasteurization towelette.
Inventive concept of the present invention is such:
Antibacterial peptide is the micromolecule polypeptide of a kind of biologically active of organism through inducing generation, generally is made up of 20-60 amino acid, and molecular weight is about 2000-7000D.Along with Medical Immunology and molecular biological developing rapidly, the research of antibacterial peptide more and more becomes the heat subject in biotechnology and the biomedicine field.Up to now, found to surpass more than 200 kind of antibacterial peptide on many animals (especially insect), plant, microorganism and human body, this class small peptide not only has the bactericidal action of wide spectrum to bacterium, fungi, and virus, protozoon and cancer cell are also had attack function.Clinical testing also shows, maybe may cause under the situation of courses of infection the organism infection germ, and antibiotic Toplink is killed the germ of having invaded fast, and can stop germ continue infect.Because antibacterial peptide is a kind of biological products, when consumption is very little, also can produce very strong bactericidal activity, skin and mucosa stimulation and toxic and side effect to human body can not have any impact to environment yet, so be the extraordinary composition of preparation sterile products.
Technical scheme of the present invention is such:
A kind of disinfectant preparation comprises antibacterial peptide GK 0.00001～0.01wt%, detergent 0.01～2wt%, emollient 0.1～15wt%, water surplus.
GK：Arg Phe Arg Leu Val Arg Arg Ile Val Leu Ala ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Phe Arg Leu Val Arg Arg Ile Val Leu Ala ( A1-A2-A3-A4 ) ( Al′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Arg Phe Lys Leu Val Arg Arg Ile Val Leu Ala ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Phe Lys Leu Val Arg Arg Ile Val Leu Ala ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Arg Phe Lys Leu Val Lys Arg Ile Val Leu Ala ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Phe Lys Leu Val Lys Arg Ile Val Leu Ala ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Arg Phe Lys Leu Val Lys Lys Ile Val Leu Ala ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Phe Lys Leu Val Lys Lys Ile Val Leu Ala ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Lys Phe Lys Leu Val Lys Lys Ile Val Leu Ala ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Lys Phe Lys Leu Val Lys Lys Ile Val Leu Ala ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Arg Phe Arg Leu Phe Arg Arg Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Phe Arg Leu Phe Arg Arg Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Arg Phe Lys Leu Phe Arg Arg Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Phe Lys Leu Phe Arg Arg Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Arg Phe Lys Leu Phe Lys Arg Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Phe Lys Leu Phe Lys Arg Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Arg Phe Lys Leu Phe Lys Lys Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Phe Lys Leu Phe Lys Lys Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Lys Phe Lys Leu Phe Lys Lys Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Lys Phe Lys Leu Phe Lys Lys Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Arg Phe Arg Gly Val Arg Arg Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Phe Arg Gly Val Arg Arg Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Arg Phe Arg Gly Val Lys Arg Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Phe Arg Gly Val Lys Arg Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Arg Phe Arg Gly Val Lys Lys Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Phe Arg Gly Val Lys Lys Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Lys Phe Arg Gly Val Lys Lys Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Lys Phe Arg Gly Val Lys Lys Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Arg Trp Arg Ile Gly Arg Arg Ile Val Leu Ala ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Trp Arg Ile Gly Arg Arg Ile Val Leu Ala ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Arg Trp Arg Ile Gly Lys Lys Ile Val Leu Ala ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Trp Arg Ile Gly Lys Lys Ile Val Leu Ala ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Lys Trp Arg Ile Gly Lys Lys Ile Val Leu Ala ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Lys Trp Arg Ile Gly Lys Lys Ile Val Leu Ala ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Lys Trp Lys Ile Gly Lys Lys Ile Val Leu Ala ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Lys Trp Lys Ile Gly Lys Lys Ile Val Leu Ala ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Arg Trp Arg Leu Phe Arg Arg Ile Gly Ile Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Trp Arg Leu Phe Arg Arg Ile Gly Ile Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Arg Trp Arg Leu Phe Lys Arg Ile Gly Ile Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Trp Arg Leu Phe Lys Arg Ile Gly Ile Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Arg Trp Arg Leu Phe Lys Lys Ile Gly Ile Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Trp Arg Leu Phe Lys Lys Ile Gly Ile Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Arg Trp Lys Leu Phe Lys Lys Ile Gly Ile Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Trp Lys Leu Phe Lys Lys Ile Gly Ile Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Lys Trp Lys Leu Phe Lys Lys Ile Gly Ile Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Lys Trp Lys Leu Phe Lys Lys lle Gly Ile Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Arg Phe Arg Val Ile Arg Arg Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Phe Arg Val Ile Arg Arg Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Arg Phe Arg Val Ile Arg Lys Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Phe Arg Val Ile Arg Lys Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Arg Phe Arg Val Ile Lys Lys Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Arg Phe Arg Val Ile Lys Lys Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" ) Lys Phe Lys Val Ile Lys Lys Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) Lys Phe Lys Val Ile Lys Lys Ile Leu Val Gly ( A1-A2-A3-A4 ) ( A1′-A2′-A3′-A4′ ) ( A1"-A2"-A3"-A4" )
(A1-A2-A3-A4) (A1 '-A2 '-A3 '-A4 ') or (A1-A2-A3-A4) (A1 '-A2 '-A3 '-A4 ') (A1 " A2 "-A3 " A4 ") sequence be the core texture of antibacterial peptide sequence.Wherein A1, A1 ', A1 " being a kind of among Lys or the Arg; A2, A2 ', A2 " are a kind of among Gly, Ala, Val, Leu, Ile or the Phe, A3, A3 ', A3 " being a kind of among Gly, Ala, Val, Leu, Ile or the Phe, A4, A4 ', A4 " are a kind of among Lys or the Arg.(A1-A2-A3-A4) aminoterminal is connected with 11 amino acid, in 11 amino acid the 1st, 3,6,7 amino acids are a kind of in lysine or the arginine, the 2nd amino acids is a kind of in tryptophan or the phenyl alanine in 11 amino acid, in 11 amino acid the 4th, 5,8,9,10,11 amino acids are a kind of in leucine, isoleucine, alanine, valine or the glycine.
Antibacterial peptide GK comprises also that indivedual amino acid whose replacements in the above polypeptide, cyclisation, L-type amino acid become D-type amino acid, disappearance or adding and the polypeptide of the function equivalent that obtains.
The preparation method of antibacterial peptide GK can be a mechanochemical method, also the encoding gene of antibacterial peptide can be cloned on the carrier, expresses the back then and obtain in host cell.Wherein expression vector can be a kind of in plasmid or the virus; host cell can be a prokaryotic; comprise Escherichia coli, bacillus subtilis etc., host cell can be eukaryotic also, comprise yeast cells, plant cell, insect cell and mammalian cell etc.The antibacterial peptide of preparation can be identified by mass spectrum.
The detergent of being addressed comprises non-ionic surface active agent or zwitterionic surfactant, 20 〉=HLB 〉=6 preferably, as polysorbate series, comprise polysorbate20, polysorbate40, polysorbate60 or polysorbate80 etc. and betain etc., it mainly acts on is to remove dirt, make the active component in the preparation fully act on skin surface, help preventing the growth of bacterium.
The emollient of being addressed is to be selected from glycerine, wool grease, dimethicone, vaseline, Lauryl lactate, olive oil, isopropyl myristate, the grease wax one or more.
Above-mentioned disinfectant preparation can be carried on the carrier, make a kind of pasteurization towelette, carrier comprises non-woven material or cotton gauze.
The preparation method of the bactericidal wet tissue of being addressed comprises the steps:
1, take by weighing antibacterial peptide GK, emollient according to the above ratio, detergent and water under 30 ℃～65 ℃ condition, adopt conventional method to carry out emulsification, obtain emulsion;
2, with the solution spraying for preparing on the carrier of required specification or with carrier impregnation in solution, take out, promptly obtain pasteurization towelette of the present invention.
Preparation of the present invention can be used for into staff with pasteurization towelette, face, and the cleaning of skin and mucosa and the sterilization of wound surface keep skin moisturizing, can prevent the growth of bacterium again.
Preparation of the present invention and pasteurization towelette can be used for the cleaning and disinfection of baby's body surface, comprise wiping milk stain, sweat stain, urine stain, just dirt etc.
In order to further investigate the structure-function relationship of this quasi-biology active antibacterial peptide of the present invention, the Pioneer Peptide synthesizer that utilizes U.S. application system biotech firm to produce prepares one group of polypeptide, to study.With the GK-1 with following amino acid sequences of preparation, GK-2 and GK-3 antibacterial peptide are narrated as an example below:
GK-1：
Lys?Trp?Lys?Leu?Phe?Lys?Lys?Ile?Gly?Ile?Gly?Arg?Leu?Leu?Lys?Arg?Gly?Leu?Arg?LysLeu?Leu?Lys
GK-2：
Lys?Trp?Lys?Leu?Phe?Lys?Lys?Ile?Gly?Ile?Gly?Arg?Leu?Leu?Arg?Arg?Leu?Leu?Arg?ArgLeu?Leu?Arg
GK-3：
Arg?Trp?Arg?Leu?Phe?Lys?Arg?Ile?Gly?Ile?Gly?Arg?Leu?Leu?Lys?Arg?Gly?Leu?Arg
Utilize 96 well plate method to detect bactericidal activity (the In Yup Park etc of polypeptide; FEBS Letters; 437 (1998) 258-262) with synthetic in advance natural antibacterial peptide buforin II, cecropin A1 is contrast, carries out bactericidal activity and detects.The result shows that the bactericidal activity of synthetic antibacterial peptide of the present invention is better than the bactericidal activity of described two kinds of natural antibacterial peptides.
Antibacterial peptide function equivalent to amino acid deletions, cyclisation derivative in the polypeptide has also carried out preparation and biological activity determination equally, and measurement result shows that the bactericidal activity of these polypeptide also is better than the bactericidal activity of above-mentioned natural antibacterial peptide basically.
Antibacterial peptide also might act on high organism and comprise human body cell in efficient sterilizing, because the mode of action of antibacterial peptide all is that perforation makes the death of cell generation seepage on cell membrane.So can make red blood cell generation seepage as its virose standard whether antibacterial peptide, if antibiotic Toplink makes the haemoglobin generation seepage in the red blood cell, just can be by detecting OD
490Value is determined the size of toxicity.Therefore the present invention has also detected the hemolytic activity of synthetic antibacterial peptide to human erythrocyte, and experiment shows that antibacterial peptide hemolysis rate value is very low, confirms that the hemolytic toxicity of synthetic antibacterial peptide of the present invention is minimum.
Pasteurization towelette is tested by extracorporeal disinfecting, and prove that it is to some main pathogenic bacteria: the bactericidal effect of Escherichia coli, staphylococcus aureus, Pseudomonas aeruginosa is very good, and killing rate is all above 99%.
Pasteurization towelette shows that to the The acute toxicity tests of Kunming small white mouse the animal via intramuscular injection is after 7 days, and no abnormal reaction, activity are normally.Observed through 7 days, 60 small white mouses all survive.The proof free of toxic effects.
Pasteurization towelette is to the test of SD rat vagina mucosa irritation, and standards of grading scoring and skin irritatin strength grading with reference to skin irritatin response intensity in the disinfection technology standard (third edition) 1999.11 carry out the evaluation to the vaginal mucosa stimulus intensity.The result shows that pasteurization towelette is 0 to the highest total mark average of rat vagina mucosa irritation reaction, belongs to nonirritant.
Description of drawings
Fig. 1 is an antibacterial peptide GK-2 mass spectrometry results.
Embodiment
The preparation of antibacterial peptide and separation and purification
Prepare GK-1 by above-mentioned sequence, GK-2 and GK-3 prepare cecropin A1 and buforin II in contrast simultaneously.
The sequence of cecropin A1 (referring to Morishima, I., etc, Comp.Biochem.Physiol., 1990, B 95 (3), 551-554):
Arg?Trp?Lys?Leu?Phe?Lys?Lys?Ile?Glu?Lys?Val?Gly?Arg?Asn?Val?Arg?Asp?Gly
Leu?Ile?Lys?Ala?Gly?Pro?Ala?Ile?Ala?Val?Ile?Gly?Gln?Ala?Lys?Ser?Leu
The sequence of buforin II (referring to Park, C.B., Biochem.Biophys.Res.Commun.1996,218 (1), 408-413)
Thr?Arg?Ser?Ser?Arg?Ala?Gly?Leu?Gln?Phe?Pro?Val?Gly?Arg?Val?His?Arg?Leu
Leu?Arg?Lys
Present embodiment adopts mechanochemical method synthetic, the Pioneer Peptide synthesizer that used instrument is produced for u.s.a. applied biosystem company.Synthetic polypeptide is after the TFA of excessive concentrations shears, and with reverse post purifying, the polypeptide behind the purifying is identified by mass spectrum.Concrete test procedure is as follows:
1, the preparation of antibacterial peptide (GK-2 with preparation 0.1mmol amount is an example)
Below all the preparation antibacterial peptides reagent all purchase in u.s.a. applied biosystem company.
The GK-2 peptide sequence of preparation is
N-Lys?Trp?Lys?Leu?Phe?Lys?Lys?Ile?Gly?Ile?Gly?Arg?Leu?Leu?Arg?Arg?Leu?Leu
Arg?Arg?Leu?Leu?Arg-C
Preparation holds the N end to carry out one by one from C, is controlled automatically by synthesizer.At first weighing 0.1mmol's combines the resin that first amino acid is Arg (purchasing in u.s.a. applied biosystem company); the dress post; use 20% piperidines dimethyl formamide solution deprotection again; dimethyl formamide cleans; the free amino acid of 9-tablet held before the breast by officials methoxycarbonyl group (Fmoc) protection is dissolved in carbodiimide (DCC); hydroxybenzotriazole (HOBt)/diisopropyl ethyl amine (DIPEA); solution after the dissolving is post cocycle coupling reaction 30 minutes, dimethyl formamide clean repeat above deprotection to the coupling reaction step up to preparation end (the concrete operations step is seen pioneer Peptide synthesizer operating guidance).
Polypeptide after the preparation is sheared through following steps:
Take off reacted resin, add Type B and shear liquid (88% trifluoroacetic acid, 5% phenol, 5% water, 2% tri isopropyl silane), room temperature reaction 2 hours filters, the precooling absolute ether that adds 10 times of volumes in the filter liquor, 4000 rev/mins centrifugal 10 minutes, collecting precipitation and drying at room temperature.
2, antibacterial peptide purifying
The a certain amount of dried polypeptide of weighing is dissolved in 0.1% trifluoroacetic acid, and sample treatment is after eluting peak is collected in oppositely post separation (eluent is 0.1% trifluoroacetic acid that contains 80% second cyanogen).
3, the evaluation of antibacterial peptide
As shown in Figure 1, the antibacterial peptide GK-2 of preparation is through mass spectral analysis, and the molecular weight that GK-2 shows in mass spectrogram is calculated as follows: (1) 734.8 * 4=2939.2,2939.2-4=2935.2
(2)979.1×3＝2937.3，2937.3-3＝2934.3
The molecular weight that (3) 1468 * 2=2936,2936-2=2934 calculate GK-2 is 2934.The theoretical value that is calculated by peptide sequence is 2932.74.The polypeptide of proof preparation is the GK-2 antibacterial peptide of design.The antibacterial peptide product of accreditation is standby.
Antibacterial peptide GK-l and GK-3, natural antibacterial peptide cecropin A1 and buforin II can adopt the preparation method's preparation that is similar to the GK-2 antibacterial peptide.
The expression of antibacterial peptide GK-1 gene in Escherichia coli
At first design the GK-1 gene of composite coding antibacterial peptide, it is cloned into (available from AmershamPharmcia Biotech company) on the pGEX-4T1 carrier, and transformed into escherichia coli JM109 then is through IPTG abduction delivering GST-GK-1 fusion, after the fibrin ferment cutting, get antibacterial peptide GK-l again.
The ATP that uses among the embodiment, IPTG, T
4Polynueleotide kinase, T
4Dna ligase, Klenow enzyme, restriction enzyme are BIOLAB company product except that specializing, it is that worker company product is given birth in Shanghai that kit is reclaimed in rubber tapping, and oligonucleotide is that Shanghai Sangon Biological Engineering Technology And Service Co., Ltd is synthetic.Fibrin ferment is sheared kit and is purchased the company in SIGMA.
The separation of relative dna, purifying, pcr amplification, enzymolysis, plasmid transform host bacterium, fragment and reclaim, connect the equimolecular clone operations and all carry out according to " the molecular cloning experiment guide " that the husky nurse Brooker of J. etc. is write.E. coli jm109 is cultivated in the LB of liquid or solid medium.
Adopt the dna sequence dna of the preferred antibacterial peptide GK-1 gene of codon design coding of Escherichia coli preference, sequence is as follows.5 ' end at antibacterial peptide GK-1 gene is introduced restriction enzyme site BamHI (GGATCC), adds terminator (TAG) at 3 ' end, and the length that gained makes up gene is 78bp.
By directly synthetic this nucleotide fragment of dna synthesizer.At first gene is increased with PCR method.Design a pair of primer: 5 '-CCTAGGTTTACCT-3 ' and 3 '-CCGCCTGCTGAA-5 '.The PCR reaction condition is as follows: 94 ℃, and 30 seconds; 45 ℃, 45 seconds; 72 ℃, 30 seconds; React 30 circulations.After the PCR reaction this segment being mended flat back through the Klenow enzyme cuts with the BamHI enzyme, enzyme section cracked ends is crossed rubber tapping recovery back (rubber tapping reclaimer operation reference reagent box operating instruction) and is connected back transformed into escherichia coli JM109 with the BamHI of pGEX-4T1 carrier and the double digestion segment of SmaI, and transformant is cut evaluation, screening by the SmaI enzyme.Transformant is through IPTG abduction delivering GST-GK-1 fusion.Fusion with the GST affinity column purifying after obtain antibacterial peptide GK-1, concrete operations reference reagent box operating instruction after the fibrin ferment cutting.
The GK-1 protein sequence:
Lys?Trp?Lys?Leu?Phe?Lys?Lys?Ile?Gly?Ile?Gly?Arg?Leu?Leu?Lys?Arg?Gly?Leu?Arg
Lys?Leu?Leu?Lys
The nucleotide sequence of coding GK-1:
GGATCCAAATGGAAACTGTTTAAAAAAATTGGCATTGGCCGCCTGCTGAA
ACGCGGCCTGCGCAAGCTGCTGAAATAG
The expression of antibacterial peptide GK-1 gene in yeast cells
The ATP that uses in the present embodiment, IPTG, T
4Polynueleotide kinase, T
4Dna ligase, Klenow enzyme, restriction enzyme are BIOLAB company product except that specializing, it is that worker company product is given birth in Shanghai that kit is reclaimed in rubber tapping, and oligonucleotide is that Shanghai Sangon Biological Engineering Technology And Service Co., Ltd is synthetic.Fibrin ferment is sheared kit and is purchased the company in SIGMA.
The GK-1 gene of design composite coding antibacterial peptide, process BamHI enzyme is cut with the dna sequence dna of the GST that encodes and is connected, after be connected among the plasmid pBluescriptSKII (available from U.S. Stratagene company), transformed into escherichia coli DH5 α (available from DSMZ of Wuhan University), after the extraction plasmid proves that through order-checking sequence is correct, plasmid is through EcoRI, after cutting, the XhoI enzyme is connected in the pPIC9 carrier (available from American I nvitrogen company), the back transforms pichia yeast bacterial strain KM71 (available from American I nvitrogen company), methanol induction expressed fusion protein GST-GK-1.
The separation of relative dna, purifying, pcr amplification, enzymolysis, plasmid transform host bacterium, fragment and reclaim, connect the equimolecular clone operations and all carry out according to " the molecular cloning experiment guide " that the husky nurse Brooker of J. etc. is write.Pichia yeast bacterial strain KM71 cultivates in the BMGY of liquid or solid medium, and yeast strain is cultivated in the BMMY medium during methanol induction expressed fusion protein GST-GK-1, and adding methyl alcohol to final concentration every 24 hours is 1%.
Adopt the codon design preferred antibacterial peptide GK-1 of coding of saccharomycete preference and the dna sequence dna of GST, sequence is as follows.5 ' end at antibacterial peptide GK-1 gene is introduced restriction enzyme site BamHI (GGATCC), add terminator (TAG) and EcoRI restriction enzyme site (GAATCC) at 3 ' end, the length that gained makes up gene is 84bp, connect the dna sequence dna of coding GST simultaneously at GK-1 gene leading portion, the 5 ' end of while at the dna sequence dna of GST added an XhoI restriction enzyme site.
The preparation of GK-1 nucleotide fragment: by the direct composite coding GK-1 of dna synthesizer nucleotide fragment.With PCR method gene is increased then.Design a pair of primer 5 ' CCTAGGTTTACCT3 ' and 5 ' AAGTCGTCCGCC3 '.The PCR reaction condition is as follows: 94 ℃, and 30 seconds; 45 ℃, 45 seconds; 72 ℃, 30 seconds; React 35 circulations.
The coding GST dna sequence dna preparation: design a pair of primer
5’-CTCGAGATGTCCCCTATACTAGGTT-3’
5’-CAGTGCTACGCCGGCGAG-3’
With above primer amplification pGEX-4T1 carrier.The PCR reaction condition is as follows: 94 ℃, and 30 seconds; 45 ℃, 45 seconds; 72 ℃, 60 seconds; React 30 circulations.
Amplified fragments is connected with plasmid: the pcr amplification segment of GK-1 is mended flat back through the Klenow enzyme cut with BamHI and EcoRI enzyme, enzyme section cracked ends is crossed XhoI that BamHI that rubber tapping reclaims back (rubber tapping reclaimer operation reference reagent box operating instruction) and the DNA cloning sequence of the GST that encodes and XhoI enzyme cut back to close fragment and pBluescriptSKII and is cut back to close fragment with the EcoRI enzyme and be connected.Connect product transformed into escherichia coli DH
5 α, transformant further determines that through order-checking expressed sequence is correct after cutting evaluation through resistance, blue hickie, enzyme.The extraction plasmid cuts back to close small fragment through XhoI and EcoRI enzyme, cuts to be connected with XhoI and the EcoRI enzyme of pPIC9 to be built into expression plasmid pPIC9-gst-gkl, transformed into escherichia coli DH
5 αAfter amicillin resistance screening transformant.Press method (Clare JJ, etc., the Gene of bibliographical information, 1991, the 105:205-212) competent cell of preparation pichia yeast KM71, and the linearisation recombinant plasmid pPIC9-gst-gkl of SacI single endonuclease digestion transformed through electricity import competent cell, the condition that electricity transforms is 1.5KV, 22.5uF.In the YPD flat board, 30 ℃ of cultivations are screened the positive colony of expressed fusion protein two days later with electric transformed yeast cells coated plate.
Transformant is expressed the GST-GK-1 fusion through methanol induction.Fusion with the GST affinity column purifying after obtain antibacterial peptide GK-1, concrete operations reference reagent box operating instruction after the fibrin ferment cutting.
GST-GK-1 fusion sequence:
Leu?Glu?Met?Ser?Pro?Ile?Leu?Gly?Tyr?Trp?Lys?Ile?Lys?Gly?Leu?Val?Gln?Pro?Thr?Arg?Leu?Leu?Leu
Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn LysLys Phe Glu Leu Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys Leu The GlnSer Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn Met Leu Gly Gly Cys Pro Lys Glu Arg AlaGlu Ile Ser Met Leu Glu Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser LysAsp Phe Glu The Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu Met Leu Lys Met Phe Glu Asp ArgLeu Cys His Lys The Tyr Leu Asn Gly Asp His Val The His Pro Asp Phe Met Leu Tyr Asp Ala LeuAsp Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu Val Cys Phe Lys Lys ArgIle Glu Ala Ile Pro Gln Ile Asp Lys Tyr Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln GlyTrp Gln Ala The Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Val Pro Arg Gly Ser Lys TrpLys Leu Phe Lys Lys Ile Gly Ile Gly Arg Leu Leu Lys Arg Gly Leu Arg Lys Leu Leu LysGST-GK-l：TTAGAAATGTCTCCTATTTTAGGTTATTGGAAAATTAAAGGTTTAGTTCAACCTACTCGTTTATTATTAGAATATTTAGAAGAAAAATATGAAGAACATTTATATGAACGTGATGAAGGTGATAAATGGCGTAATAAAAAATTTGAATTAGGTTTAGAATTTCCTAATTTACCTTATTATATTGATGGTGATGTTAAATTAACTCAATCTATGGCTATTATTCGTTATATTGCTGATAAACATAATATGTTAGGTGGTTGTCCTAAAGAACGTGCTGAAATTTCTATGTTAGAAGGTGCTGTTTTAGATATTCGTTATGGTGTTTCTCGTATTGCTTATTCTAAAGATTTTGAAACTTTAAAAGTTGATTTTTTATCTAAATTACCTGAAATGTTAAAAATGTTTGAAGATCGTTTATGTCATAAAACTTATTTAAATGGTGATCATGTTACTCATCCTGATTTTATGTTATATGATGCTTTAGATGTTGTTTTATATATGGATCCTATGTGTTTAGATGCTTTTCCTAAATTAGTTTGTTTTAAAAAACGTATTGAAGCTATTCCTCAAATTGATAAATATTTAAAATCTTCTAAATATATTGCTTGGCCTTTACAAGGTTGGCAAGCTACTTTTGGTGGTGGTGATCATCCTCCTAAATCTGATTTAGTTCCTCGTGGTTCTAAATGGAAATTATTTAAAAAAATTGGTATTGGTCGTTTATTAAAACGTGGTTTACGTAAATTATTAAAATGAGAATTT
The bactericidal activity of synthetic antibacterial peptide detects
Employed various bacterial strains are purchased in Chinese biological goods calibrating institute in following examples.
Adopt 96 well plate method that the bactericidal activity of synthetic antibacterial peptide is detected, and in contrast with the synthetic antibacterial peptide cecropin A1 of mechanochemical method and buforin II, to estimate among the present invention three antibacterial peptide GK-1 as an example, the bactericidal activity of GK-2 and GK-3.
Measure the bactericidal activity of antibacterial peptide according to the following steps:
The bacterial classification recovery, the 37 ℃ of overnight incubation in inoculation inclined-plane are chosen bacterium in common LB medium, 37 ℃ of overnight incubation, it is 10 that dilution bacterium liquid makes bacteria concentration
4-10
5CFU/ml is inoculated in 96 orifice plates by every hole 100ul bacterium liquid, after polypeptide is diluted with certain proportion, adds 10ul in every hole, and 96 orifice plates are placed 37 ℃ of overnight incubation, and microplate reader detects OD
620Value (In Yup Park etc; FEBS Letters; 437 (1998) 258-262).Testing result sees Table 1.
Growth concentration (the OD that contains the bacterium of antibacterial peptide
620) be minimal inhibitory concentration (minimal inhibitory concentration (MIC) is defined as the minimum concentration of remarkable bacteria growing inhibiting) with the ratio of the growth concentration of the bacterium that does not add antibacterial peptide greater than 90% o'clock antibacterial peptide concentration.
Five kinds of antibacterial peptides of table 1 are to the comparison of the antibacterial activity minimal inhibitory concentration (MIC) of different bacterium
| The minimal inhibitory concentration of several antibacterial peptides (ug/ml) strain name cecropin A1 buforin II GK-1 GK-2 GK-3 | |
| The Ge Shi positive bacteria | Staphylococcus aureus CMCC26003 16 4 0.4 0.2 0.5 hay bacillus DB430 12 6445 bacillus pumilus CMCC63202 50 6 0.5 1 0.8 micrococcus lysodeikticus S1.634 50 8 0.8 1.2 1.0 micrococcus luteus CMCC28001 30 8243 |
| Gram-negative bacteria | Escherichia coli ATCC8099 20 16 0.5 1.6 1 Friedlanders bacillus CMCC46117 16 20 0.8 22 moscow' paratyphi B CMCC50094 12 14 164 Pseudomonas aeruginosa CMCC10104 18 20 10 12 1.8 |
| Fungi | Candida albicans ATCC10231 50 30 8 10 11 brewer's yeast ATCC9736 50 20 14 12 12 |
In the last table the minimal inhibitory concentration value more little, then represent antibacterial ability strong more.
Embodiment 6
External hemolytic activity detects
Present embodiment is used to detect synthetic antibacterial peptide whether human erythrocyte is had hemolytic activity, and with the synthetic antibacterial peptide cecropin A1 of mechanochemical method and buforin II in contrast.Use blood sample be taken at normal human blood.
The detection step of synthetic antibacterial peptide hemolytic activity is:
The release of fresh red blood cell suspension haemoglobin under 414nm of 4% detects.Human red blood cell is through PBS (PBS:35mM phosphate buffer/0.15MNaCl, PH7.0) washing, the 8% human red blood cell suspension of getting 100ul is in 96 orifice plates, add 100ul antibacterial peptide solution in every hole, 37 ℃ after one hour, centrifugal 5 minutes of 1500rpm shifts the 100ul supernatant in 96 new orifice plates, by the absorption under the microplate reader detection 414nm.Negative control PBS, positive control 0.1%TritonX-100.Testing result sees Table 2:
Five kinds of antibacterial peptide hemolytic activities of table 2 testing result
| Antibacterial peptide concentration (ug/ml) | Hemolysis rate (%) |
| cecropin?A1????buforin?II??GK-1????GK-2????GK-3 | |
| ????12.5 ????25 ????50 ????100 ????200 | ????0??????????0???????????0????????0???????0 ????0??????????0???????????0????????0???????0 ????0??????????0???????????0????????0???????0 ????1.2????????0???????????0.5??????0.2?????0.6 ????3??????????0.5?????????0.8??????1.0?????1.1 |
| ????500???????????10?????????1.7?????????1.5??????2???????1.9 | |
The adult uses the preparation of pasteurization towelette
1. preparation 100g is used for the preparation of pasteurization towelette, and wherein the content 0.001g (0.001wt%) of antibacterial peptide GK-1 gathers Mountain of Pear alcohol ester 20 content 0.2g (0.2wt%), glycerine 2g (2wt%), wool grease 0.5g (0.5wt%) essence 0.1g (0.1wt%).
2. to desktop, instrument, vessel, mixer sterilization.
3. on electronic balance, accurately take by weighing molten antibacterial peptide GK-10.001g, poly-Mountain of Pear alcohol ester 0.2g, glycerine 2g, wool grease 0.5g, essence 0.1g places mixer, adds water 97.199g in proportion, forms emulsion 60 ℃ of following stirring and emulsifying.
4. nonwoven is cut into 8cm * 8cm, after 20 minutes, immerses in the above-mentioned solution, pull out after waiting to soak into, drip and go redundant solution, can use through ultraviolet disinfection.
Embodiment 8
The preparation of pasteurization towelette for baby
1, preparation 100 is used for the preparation of pasteurization towelette, and wherein the content 0.0005g (0.0005wt%) of antibacterial peptide GK-2 gathers Mountain of Pear alcohol ester 40 content 0.15g (0.15wt%), wool grease 0.5g (0.5wt%), and asparagus juice 0.5 (0.5wt%), surplus is a water.
2, remaining step is finished with reference to embodiment 1.
The test of pasteurization towelette extracorporeal disinfecting
1, the preparation of test specimen:
(1) bactericidal wet tissue sample: press the method preparation of embodiment 1, the content 0.01g (0.01wt%) of antibacterial peptide GK-1, poly-Mountain of Pear alcohol ester 20 content 1g (1wt%), glycerine 2g (2wt%), wool grease 0.5g (0.5wt%), surplus is a water.
(2) contrast wet tissue: poly-Mountain of Pear alcohol ester 20 content 1g (1wt%), glycerine 2g (2wt%), wool grease 0.5g (0.5wt%), surplus is a water.
2, test strain: staphylococcus aureus CMCC26003, hay bacillus DB430, Escherichia coli ATCC8099, Friedlander CMCC46117, Pseudomonas aeruginosa CMCC10104, Candida albicans ATCC10231.(above bacterial strain comes from Chinese biological goods calibrating institute).
3, test procedure:
(1) cultured test strain is washed fresh inclined-plane with 1% peptone PBS, and be diluted to suitable concentration, 10
7～10
8Cfu/ml.
(2) sample wet tissue and contrast wet tissue are made 1 * 3cm size, and be placed in the aseptic plate.
(3) get 20ul bacterium drop and be added on the wet tissue, smear evenly and pick up counting simultaneously.
(4) the wet tissue input is contained in the test tube of 5ml neutralizer with aseptic nipper after affacting the scheduled time, mixing fully vibrates.
(5) the contrast wet tissue drops into the neutralizer test tube, fully does suitable dilution after the vibration.
(6) get whole liquid 0.5ml and carry out pour plate, 37 constant temperature are inverted and were cultivated 48 hours.
(7) calculate contrast and reclaim bacterium amount and sample recovery bacterium amount, draw killing rate.
4, result of the test
Table 3: bactericidal wet tissue extracorporeal disinfecting test killing rate test strain bactericidal wet tissue contrast as a result wet tissue staphylococcus aureus 99.92% 0CMCC26003,, hay bacillus DB430 99.98% 0 Escherichia coli ATCC8099 99.92% 0 Pseudomonas aeruginosa CMCC10104 99.97% 0 Candida albicans ATCC10231 99.56% 0 Friedlander 99.46% 0CMCC46117
Embodiment 10
Acute toxicity experience in the animal body
1, the preparation of sample: press the method preparation of embodiment 7, the content 0.01g (0.01wt%) of antibacterial peptide GK-1, poly-Mountain of Pear alcohol ester 20 content 1g (1wt%), glycerine 2g (2wt%), wool grease 0.5g (0.5wt%), surplus is a water.
2, experimental animal: adopt 60 of Kunming small white mouses, male and female half and half, body weight 33.5 ± 0.25g is provided by laboratory animal portion of Fudan University.
3, test method: observed animal toxic reaction under maximum dose through the intramuscular injection small white mouse in continuous once a day 7 days.Experimental result shows that the animal via intramuscular injection is after 7 days, and no abnormal reaction, activity are normally.Observed through 7 days, 60 small white mouses all survive.The proof free of toxic effects.
Embodiment 11
Pasteurization towelette is to experimental animal vaginal mucosa irritant test
1, sample preparation: press the method preparation of embodiment 7, the content 0.01g (0.01wt%) of antibacterial peptide GK-1, poly-Mountain of Pear alcohol ester 20 content 1g (1wt%), glycerine 2g (2wt%), wool grease 0.5g (0.5wt%), surplus is a water.
2, experimental animal: the SD rat, female, regular grade, 18, body weight 230 grams-250 grams divide three groups at random, and bactericidal wet tissue group, vehicle group and blank group, are provided by laboratory animal portion of Fudan University by 6 every group.
3, test method: with reference to 3.8 in the disinfection technology standard (third edition) 1999.11.Bactericidal wet tissue is put in the animal vagina, contacted 4 hours with vaginal mucosa.Vehicle group is soaked with sterile saline with sliver 0.01 gram and is done same test.The blank group is left intact.Put to death animal in 24 hours, take out local vagina tissue, observation has or not hyperemia, oedema phenomenon.Standards of grading scoring and skin irritatin strength grading with reference to skin irritatin response intensity in the disinfection technology standard (third edition) 1999.11 carry out the evaluation to the vaginal mucosa stimulus intensity.
4, result of the test:
Table 3: bactericidal wet tissue is to experimental animal vaginal mucosa irritant test
The irritant reaction scoring
Group number of animals (only)
Erythema oedema total points pasteurization towelette group 6000 vehicle group 6000 blank groups 6000
Bactericidal wet tissue is 0 to the highest total mark average of rat vagina mucosa irritation reaction, belongs to nonirritant.
Sequence table＜110〉Shanghai Hi-Tech United Biotechnology R ﹠ D Ltd＜120〉a kind of disinfectant preparation and pasteurization towelette and its production and application＜130〉SPI028296＜160〉54＜170〉PatentIn Version2.1＜210〉1＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉1Arg Phe Arg Leu Val Arg Arg Ile Val Leu Ala Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉2＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉2Arg Phe Arg Leu Val Arg Arg Ile Val Leu Ala Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉3＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉3Arg Phe Lys Leu Val Arg Arg Ile Val Leu Ala Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉4＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉4Arg Phe Lys Leu Val Arg Arg Ile Val Leu Ala Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉5＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉5Arg Phe Lys Leu Val Lys Arg Ile Val Leu Ala Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉6＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉6Arg Phe Lys Leu Val Lys Arg Ile Val Leu Ala Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?XaaXaa?Xaa?Xaa?Xaa?Xaa
20＜210〉7＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉7Arg Phe Lys Leu Val Lys Lys Ile Val Leu Ala Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉8＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉8Arg Phe Lys Leu Val Lys Lys Ile Val Leu Ala Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉9＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉9Lys Phe Lys Leu Val Lys Lys Ile Val Leu Ala Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉10＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉10Lys Phe Lys Leu Val Lys Lys Ile Val Leu Ala Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉11＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉11Arg Phe Arg Leu Phe Arg Arg Ile Leu Val Gly Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉12＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉12Arg Phe Arg Leu Phe Arg Arg Ile Leu Val Gly Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉13＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉13Arg Phe Lys Leu Phe Arg Arg Ile Leu Val Gly Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉14＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉14Arg Phe Lys Leu Phe Arg Arg Ile Leu Val Gly Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉15＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉15Arg Phe Lys Leu Phe Lys Arg Ile Leu Val Gly Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉16＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉16Arg Phe Lys Leu Phe Lys Arg Ile Leu Val Gly Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉17＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉17Arg Phe Lys Leu Phe Lys Lys Ile Leu Val Gly Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉18＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉18Arg Phe Lys Leu Phe Lys Lys Ile Leu Val Gly Xaa Xaa Xaa Xaa
5????????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉19＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉19Lys Phe Lys Leu Phe Lys Lys Ile Leu Val Gly Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉20＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉20Lys Phe Lys Leu Phe Lys Lys Ile Leu Val Gly Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉21＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉21Arg Phe Arg Gly Val Arg Arg Ile Leu Val Gly Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉22＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉22Arg Phe Arg Gly Val Arg Arg Ile Leu Val Gly Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉23＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉23Arg Phe Arg Gly Val Lys Arg Ile Leu Val Gly Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉24＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉24Arg Phe Arg Gly Val Lys Arg Ile Leu Val Gly Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉25＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉25Arg Phe Arg Gly Val Lys Lys Ile Leu Val Gly Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉26＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉26Arg Phe Arg Gly Val Lys Lys Ile Leu Val Gly Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉27＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉27Lys Phe Arg Gly Val Lys Lys Ile Leu Val Gly Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉28＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉28Lys Phe Arg Gly Val Lys Lys Ile Leu Val Gly Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉29＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉29Arg Trp Arg Ile Gly Arg Arg Ile Val Leu Ala Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉30＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉30Arg Trp Arg Ile Gly Arg Arg Ile Val Leu Ala Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉31＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉31Arg Trp Arg Ile Gly Lys Lys Ile Val Leu Ala Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉32＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉32Arg Trp Arg Ile Gly Lys Lys Ile Val Leu Ala Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉33＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉33Lys Trp Arg Ile Gly Lys Lys Ile Val Leu Ala Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉34＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉34Lys Trp Arg Ile Gly Lys Lys Ile Val Leu Ala Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉35＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉35Lys Trp Lys Ile Gly Lys Lys Ile Val Leu Ala Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉36＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉36Lys Trp Lys Ile Gly Lys Lys Ile Val Leu Ala Xaa Xaa Xaa Xaa
5??????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉37＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉37Arg Trp Arg Leu Phe Arg Arg Ile Gly Ile Gly Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉38＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉38Arg Trp Arg Leu Phe Arg Arg Ile Gly Ile Gly Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉39＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉39Arg Trp Arg Leu Phe Lys Arg Ile Gly Ile Gly Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉40＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉40Arg Trp Arg Leu Phe Lys Arg Ile Gly Ile Gly Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉41＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜22 3〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉41Arg Trp Arg Leu Phe Lys Lys Ile Gly Ile Gly Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉42＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉42Arg Trp Arg Leu Phe Lys Lys Ile Gly Ile Gly Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉43＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉43Arg Trp Lys Leu Phe Lys Lys Ile Gly Ile Gly Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉44＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉44Arg Trp Lys Leu Phe Lys Lys Ile Gly Ile Gly Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉45＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉45Lys Trp Lys Leu Phe Lys Lys Ile Gly Ile Gly Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉46＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉46Lys Trp Lys Leu Phe Lys Lys Ile Gly Ile Gly Xaa Xaa Xaa Xaa
Xaa?Xaa?Xaa?Xaa
5??????????????????10???????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉47＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉47Arg Phe Arg Val Ile Arg Arg Ile Leu Val Gly Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉48＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉48Arg Phe Arg Val Ile Arg Arg Ile Leu Val Gly Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉49＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉49Arg Phe Arg Val Ile Arg Lys Ile Leu Val Gly Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉50＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉50Arg Phe Arg Val Ile Arg Lys Ile Leu Val Gly Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉51＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉51Arg Phe Arg Val Ile Lys Lys Ile Leu Val Gly Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉52＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉52Arg Phe Arg Val Ile Lys Lys Ile Leu Val Gly Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20＜210〉53＜211〉19＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16)＜223〉Xaa=Lys or Arg＜222〉(13,17)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19)＜223〉Xaa=Lys or Arg＜400〉53Lys Phe Lys Val Ile Lys Lys Ile Leu Val Gly Xaa Xaa Xaa Xaa
5 10 15Xaa Xaa Xaa Xaa＜210〉54＜211〉23＜212〉PRT＜213〉artificial sequence＜220〉＜221〉CHAIN＜222〉(12,16,20)＜223〉Xaa=Lys or Arg＜222〉(13,17,21)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(14,18,22)＜223〉Xaa=Gly or Ala or Val or Leu or Ile or Phe＜222〉(15,19,23)＜223〉Xaa=Lys or Arg＜400〉54Lys Phe Lys Val Ile Lys Lys Ile Leu Val Gly Xaa Xaa Xaa Xaa
5???????????????????10??????????????????15Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20
Claims (13)
1. a disinfectant preparation is characterized in that comprising antibacterial peptide GK 0.00001～0.01wt%, detergent 0.01～2wt%, emollient 0.1～15wt%, water surplus.
2. disinfectant preparation according to claim 1 is characterized in that the antibacterial peptide GK that is addressed has one or more in the listed amino acid sequence in the sequence table.
3. disinfectant preparation according to claim 1 is characterized in that the detergent of being addressed is non-ionic surface active agent or zwitterionic surfactant.
4. disinfectant preparation according to claim 3 is characterized in that the non-ionic surface active agent of being addressed is the non-ionic surface active agent of 20 〉=hydrophilic lipophilic balance 〉=6.
5. disinfectant preparation according to claim 4 is characterized in that non-ionic surface active agent is a polysorbate series.
6. disinfectant preparation according to claim 3 is characterized in that the zwitterionic surfactant of being addressed is a betain.
7. disinfectant preparation according to claim 1 is characterized in that the emollient of being addressed is one or more in glycerine, wool grease, dimethicone, vaseline, Lauryl lactate, olive oil, isopropyl myristate, the grease wax.
8. a pasteurization towelette is characterized in that being made up of carrier and the arbitrary described disinfectant preparation of load claim 1～7 thereon.
9. pasteurization towelette according to claim 8 is characterized in that described carrier comprises non-woven material or cotton gauze.
10. the preparation method of pasteurization towelette according to claim 8 is characterized in that comprising according to step down:
1) take by weighing antibacterial peptide GK, emollient in proportion, detergent and water carry out emulsification, obtain emulsion;
2) with the solution spraying for preparing on the carrier of required specification or with carrier impregnation in solution, take out, promptly obtain pasteurization towelette of the present invention.
11. according to Claim 8 or the application of 9 described pasteurization towelettes, it is characterized in that being used for hand, the skin at face and other position and the cleaning and disinfection of mucous membrane.
12. the application of pasteurization towelette according to claim 11 is characterized in that being used for the sterilization of wound surface.
13. the application of pasteurization towelette according to claim 11 is characterized in that being used for the cleaning and disinfection of baby's body surface.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 02137401 CN1243475C (en) | 2002-10-11 | 2002-10-11 | A kind of disinfection preparation and disinfecting wet towel its method of preparation and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 02137401 CN1243475C (en) | 2002-10-11 | 2002-10-11 | A kind of disinfection preparation and disinfecting wet towel its method of preparation and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1415203A true CN1415203A (en) | 2003-05-07 |
| CN1243475C CN1243475C (en) | 2006-03-01 |
Family
ID=4748987
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 02137401 Expired - Lifetime CN1243475C (en) | 2002-10-11 | 2002-10-11 | A kind of disinfection preparation and disinfecting wet towel its method of preparation and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1243475C (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1541584A1 (en) * | 2002-09-02 | 2005-06-15 | Shanghai Hi-Tech United Bio-Technological Research & Development Co., Ltd. | A group of novel synthetic antibiotic peptides |
| CN100360016C (en) * | 2003-10-16 | 2008-01-09 | 上海高科生物工程有限公司 | Foot disinfectant |
| CN100365018C (en) * | 2003-10-17 | 2008-01-30 | 上海高科联合生物技术研发有限公司 | Antibiotic peptides and their prepn process and application |
| CN101869446A (en) * | 2010-06-29 | 2010-10-27 | 大连欧派科技有限公司 | Unscented wet tissue for hands and mouths of infants |
| CN102475514A (en) * | 2011-12-12 | 2012-05-30 | 浙江瑞邦日化有限公司 | Wipe and preparation method thereof |
| CN104524551A (en) * | 2014-12-26 | 2015-04-22 | 上海华新生物高技术有限公司 | Preparation and application of novel interferon alpha-2b wet tissue |
| CN111870560A (en) * | 2020-09-16 | 2020-11-03 | 杜传超 | Washing-free disinfection composition containing antimicrobial peptide and preparation method and application thereof |
-
2002
- 2002-10-11 CN CN 02137401 patent/CN1243475C/en not_active Expired - Lifetime
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1541584A1 (en) * | 2002-09-02 | 2005-06-15 | Shanghai Hi-Tech United Bio-Technological Research & Development Co., Ltd. | A group of novel synthetic antibiotic peptides |
| EP1541584B1 (en) * | 2002-09-02 | 2011-10-12 | Shanghai Hi-Tech United Bio-Technological Research & Development Co., Ltd. | A group of novel synthetic antibiotic peptides |
| CN100360016C (en) * | 2003-10-16 | 2008-01-09 | 上海高科生物工程有限公司 | Foot disinfectant |
| CN100365018C (en) * | 2003-10-17 | 2008-01-30 | 上海高科联合生物技术研发有限公司 | Antibiotic peptides and their prepn process and application |
| CN101869446A (en) * | 2010-06-29 | 2010-10-27 | 大连欧派科技有限公司 | Unscented wet tissue for hands and mouths of infants |
| CN102475514A (en) * | 2011-12-12 | 2012-05-30 | 浙江瑞邦日化有限公司 | Wipe and preparation method thereof |
| CN104524551A (en) * | 2014-12-26 | 2015-04-22 | 上海华新生物高技术有限公司 | Preparation and application of novel interferon alpha-2b wet tissue |
| CN111870560A (en) * | 2020-09-16 | 2020-11-03 | 杜传超 | Washing-free disinfection composition containing antimicrobial peptide and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1243475C (en) | 2006-03-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1151767C (en) | Methods of delivering materials into the skin, and compositions used therein | |
| CN1110557C (en) | LAG-3 protein soluble polypeptide fractions, method of production, therapeutic composition and anti-idiotype antibody | |
| CN86106181A (en) | The method and composition of cleaning and while disinfect contact lense | |
| CN1211278A (en) | Conjugation of polypeptides | |
| CN1845877A (en) | Oxidative reductive potential water solution, processes for producing same and methods of using the same | |
| CN1072723A (en) | Tri-arginine insulins | |
| CN101068563A (en) | Novel antimicrobial peptides | |
| CN1352691A (en) | Human complement C3-degrading polypeptide from i(streptococcus pneumoniae) | |
| CN1398897A (en) | Serial synthetic antibacterial peptide | |
| CN1271386A (en) | Amino-terminally trancated RANTES as chemokine antagonists | |
| CN1415203A (en) | A kind of disinfection preparation and disinfecting wet towel its method of preparation and application | |
| CN1899600A (en) | Antibiotic peptide spray film forming agent and its preparing method | |
| TW201018401A (en) | Polypeptides having antimicrobial activity | |
| CN1735428A (en) | Chaperonin 10 immunosuppression | |
| CN1476332A (en) | Skin external preparation containing pine pollen or pine pollen extract | |
| CN1227566A (en) | T cell epitope peptide | |
| CN1766110A (en) | Miniaturized Staphylococcus aureus polypeptide of against drug resistance and application thereof and preparation method | |
| CN1061605A (en) | The synthetic method of luteinizing hormone-releasing hormone antagonistic analogs, product and application | |
| CN1043263A (en) | Biologically active peptide and some anionic compositions and therapeutical effect thereof | |
| CN1329500A (en) | Anti-dandruff composition comprising antifungal polypeptide | |
| CN1660889A (en) | Low hemolytic antibacterial peptide and its application | |
| CN1609121A (en) | Antibiotic peptides and their prepn process and application | |
| CN1245418C (en) | Novel cynthetic antibiotic peptide and its preparing method and use | |
| CN1944650A (en) | Maitake hydrophobic protein and its gene | |
| CN1565614A (en) | Externally applied medicinal composition for resisting inflammation and repressing and killing bacteria and preparing method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CX01 | Expiry of patent term |
Granted publication date: 20060301 |
|
| CX01 | Expiry of patent term |