CN1412303A - Recombinant gland related virus expressing human kallikrein, its preparation method and application - Google Patents

Abstract

The present invention provides a recombinant glandular related virus capable of expressing human kallikrein, its preparation method and application, and medicine composition containing said recombinant glandular related virus. Said recombinant glandular related virus can drive the human kallikrein gene to make long-period expression in human body, and possesses good physiological and pathologic physiological action for effectively reducing blood pressure, improving renal function and preventing apoplexy, and can be used for clinical curing the above-mentioned diseases.

Description

Express recombinant adeno-associated virus and the method for making and the purposes of human kallikrein

Technical field

The present invention relates to gene recombination and field of gene, be specifically related to a kind of recombined glandulae correlation viral vectors and human kallikrein genetic recombinants, the preparation method of this recombinant chou and purposes, and the pharmaceutical composition that contains this recombinant chou.

Background technology

Essential hypertension is the chronic disease of a kind of multifactor impact, polygene origin, the effective ways of this disease of treatment can only be long-term at present, or even take antihypertensive drugs all the life, this is undoubtedly a kind of burden for patients with hypertension, take antihypertensive drugs for a long time and also can produce some detrimentally affects to machine.Therefore, the gene therapy method and the medicine of exploration essential hypertension become a current important topic.

(human kallikrein HK) is a class serine protease to human kallikrein, and the cleavable prokinin generates vasoactive peptide-kassinin kinin.Kassinin kinin can promote the transhipment of chlorion and glucose on cell levels, promote neurone to discharge mediator etc.But find its also release of EDRF/NO now, stimulate the renal secretion feritin, promote suprarenal gland to discharge vasopressing, promote the adrenal medulla catecholamine secretion.Its these effects be by with BK ₁(part is kallidin), BK ₂Bring into play after (part is bradykinin) receptors bind, find that now kassinin kinin may be that second messenger molecule plays a role with NO.The arginine of kassinin kinin molecule C-terminal can be used as NO synthetic raw material, and synthetic NO under the NOS effect by activating guanylate cyclase, promotes the formation of cGMP again; Increase intracellular free calcium; Promote PIP ₂And IP ₃Formation so that influence the expression of several genes, realize own vasodilator, increase vascular permeability, the contraction of regulating unstriated muscle and diastole, etc. multiple physiological action.Thereby can treat hypertension, improve renal function, preventing apoplectic.Clinical studies show, HK significantly reduces in the primary hypertension patient urine, and oral pig pancreas kallikrein can obviously reduce hyperpietic's blood pressure.In addition, also observing urine HK at SHR reduces.Experimental study proves, and the rat blood pressure that knocks out the HK gene raises, and the hypotensive effect that continues all appears in the different hypertensive rat model that imports the HK gene.The human kallikrein cDNA sequence of native state (record is from GENEBANK) is in the back of this specification sheets.

Adeno-associated virus is a kind of animal single-stranded DNA viruses, and it belongs to Parvoviridae, parvovirus subfamily, dependovirus, natural flaw, nothing bag quilt and the pathogenic originality of nothing.Natural adeno-associated virus (AAV) and recombinant adeno-associated virus (rAAV) carrier have following characteristics:

1.V genome is a linearity, strand (ssDNA) molecule, contains 4680 Nucleotide (sequence such as accompanying drawing 1), its characteristics are:

1) its genome is made up of 4 wide frames of open reading (ORF), divide to claim rep district, 1ip district, inf district and cap district (seeing adeno-associated virus sequence and the concrete partition table and the accompanying drawing 1 of this specification sheets back).Be positioned at a big ORF of genomic dna left end because phase shift mutation or disappearance can stop dna replication dna, thereby be called as the rep district.Synthetic 3 kinds of coat protein of a big ORF (cap) coding of right-hand member.Other has two little ORF to be positioned at the central area of genomic dna, i.e. inf district and lip district, and concrete function is still unclear.

2) contain one 145 base end tumor-necrosis factor glycoproteinss (ITR) (seeing the adeno-associated virus sequence and the concrete partition table of this specification sheets back) at each end of molecule strand.It is the required unique known cis-acting elements of infective virion (seeing accompanying drawing 2) as dna replication dna initial sum packing reorganization AAV genome that the ITR sequence is folded into hairpin structure.

3) adeno-associated virus duplicate with transcriptional regulatory quite complicatedly, by the cotransfection branch that non-auxiliary virus is arranged, two kinds of phraseologies of proliferative and latent (as shown in Figure 3) are arranged.

In the proliferative of AAV is expressed, can transcribe and generate 6 kinds of mRNA, start synthetic (as Fig. 4) by promotor P5, P19, P40 respectively.Under the situation of the cotransfection of adenovirus (Ad), the e1a gene of Ad is responsible for the trans-activation of AAV genetic expression; Ad E2A genes encoding single-stranded DNA binding protein can stimulate transcribing that the AAV promotor started, and also can promote the AAV transcript to transport to kytoplasm from karyon; It is initial that Ad VA1 RNA may also help AAV albumen synthetic in addition.And AAV also can just regulate and bear adjusting autogene and helper virus genetic expression.The rep gene of AAV can just be regulated and bear and regulate transcribing that P5, P19, P40 promotor started, and is having under the situation of Ad, and the rep gene product is exercised positive regulatory function, and this is that the AAV gene is synthetic necessary in a large number; And under the situation of non-auxiliary virus cotransfection, the rep gene product then plays down regulation.

Under the situation of non-auxiliary virus, AAV DNA is incorporated in the host cell gene group with double chain form, continues to exist with latent state there, forms the latent infection of AAV.The specific site that AAV integrates is on the 19q13.3-19q of human chromosome ter.The Rep gene product also can be discerned and in conjunction with special integration site except down regulation, i.e. GGTC sequence, and mediated the reorganization of ITR and integration site.And the infection of adenovirus can make it enter the propagation Infection Status.

AAV be at present known unique can be at the eukaryotic cell virus of host genome specific staining position point integration.This discovery has produced the new hope of gene therapy, the AAV gene therapy vector not only can be compared express transgenic more sustainedly and stably with nonconformity carrier (as the carrier of adenovirus for the basis), and can reduce theoretic because the insertion sudden change probability that genetically modified random integration causes.

Summary of the invention

The purpose of this invention is to provide the preparation method of a kind of recombinant adeno-associated virus of expressing human kallikrein and this recombinant adeno-associated virus and the recombinant adeno-associated virus that the present invention expresses human kallikrein is the pharmaceutical composition of activeconstituents, in order to realize gene therapy to essential hypertension, the recombinant adeno-associated virus of expressing human kallikrein is had to drive human kallikrein gene long-term expression in vivo, have for a long time and efficiently bring high blood pressure down, improve renal function, physiology that preventing apoplectic etc. are good and pathophysiological role, can be used for essential hypertension, the treatment of chronic renal insufficiency and other relative diseases, and the characteristics such as (no immunogenicity) and efficiency of infection height that have no side effect.

The recombinant adeno-associated virus of expression human kallikrein provided by the invention comprises the packaging plasmid pXX of encoding adenovirus correlated virus Rep albumen and Cap albumen coded sequence ₂, kept adenovirus E 1 A, E2A and VA through deleted adenovirus Disease-causing gene sequence ₁The helper plasmid pXX of rna gene gained ₆With the carrier for expression of eukaryon that has inserted the human kallikrein encoding sequence, at packaging plasmid pXX ₂Upstream and downstream a promoter sequence is respectively arranged, said carrier for expression of eukaryon is the pXXUF that contains the CMV promotor ₁Or pXXUF ₃, the human kallikrein gene that said human kallikrein gene is a native state perhaps is the mutant or the manually modified body of the human kallikrein gene of native state.

The carrier system that the present invention uses is that natural adeno-associated virus and adenovirus are formed through a series of shearings and modification with molecular biology method, they have kept adeno-associated virus and have duplicated and transcribed necessary part, the auxiliary composition of late gene that has also kept adenovirus, other unnecessary parts are all deleted, can realize the latent infection that virus is steady in a long-term, can avoid the pathogenic risk of adenovirus again, and the expression of adenovirus late gene can guarantee by the expression efficiency of clone gene.Being constructed as follows of carrier system of the present invention:

PXX ₂: (seeing accompanying drawing 5) kept cap gene and the rep gene (obtaining pACG-2 this moment) of AAV, and inserted a p5 promotor (downcut with XbaI and PstI in original zone, be connected to the appropriate location of pACG-2) again at downstream area.The employed reporter gene of our control group (1acZ) also is connected in pXX in addition ₂The downstream.Method is: earlier at pXX ₂The otch of a ClaI is made in the downstream, adds the joint (5 '-CGCCTGCAGG-3 ') of a Sse8387I again on its otch, is two ends that the lacZ fragment of PstI otch connects thereon.

PXX ₆: (see figure 5) is transformed plasmid pBHl0 (having cut away E1, E3 gene and packaging signal) in adenovirus and is gone up the fragment of cutting next 8kb with PmeI and SgfI and (obtain pXX ₅), and pXX ₆Then be by pXX ₅Upward downcut one section with ClaI and SalI and be cloned into and obtain among the pBS, only stay E2A, E4 and VA coding region.

PXXUF ₁And pXXUF ₃The plasmid pXXUF that (see figure 6): rAAV packing is used ₁And pXXUF ₃Contain the people gfp gene that CMV promotor (arrow) is driven, it is to be imported by the NotI site behind the encoding gene Delete All of adeno-associated virus again.And pXXUF ₃Contain an IRES promotor again.For the ease of gene clone and expression, be processed into ring-type.

The method that the recombinant adeno-associated virus of human kallikrein is expressed in preparation provided by the invention comprises:

(a) provide adeno-associated virus to pack necessary Rep albumen and the proteic encoding sequence-pXX of Cap ₂Plasmid and stimulation adeno-associated virus duplicate and transcribe necessary adenovirus E 1 A, E2A and VAI rna gene-pXX ₆Plasmid;

(b) provide and contain the genomic carrier for expression of eukaryon pXXUF of adeno-associated virus ₁, adeno-associated virus disappearance cap albumen and rep protein-coding region in this eukaryotic vector, and insert human kallikrein gene (human kallikrein), form recombinant plasmid pXXUF ₁-HK;

(c) with the pXX in the step a) ₂, pXX ₆With the pXXUF in the step b) ₁-HK cotransfection 293 cells;

(d) reclaim the separation and purification recombinant chou.

Pharmaceutical composition provided by the invention is made of the recombinant adeno-associated virus of the expression human kallikrein provided by the invention that contains significant quantity and pharmaceutically acceptable carrier or vehicle, said carrier can be a physiological saline, be carrier with physiological saline promptly, make according to a conventional method and contain the injection medicament that the present invention expresses the recombinant adeno-associated virus of human kallikrein.

Description of drawings

Fig. 1 is the genome structure figure of adeno-associated virus

Fig. 2 is sequence and the secondary structure figure of ITR

Fig. 3, Fig. 4 transcribing and translating for adeno-associated virus

Fig. 5 is pXX ₂, pXX ₆Plasmid constitutes

Fig. 6 is pXXUF ₁And pXXUF ₃Plasmid main composition part

Fig. 7 is pXXUF ₁The plasmid of-HK constitutes

Fig. 8 is rAAV hybridization and radioautograph result, and last row is a testing sample, and the two-fold dilution from left to right is followed successively by 10 μ l, 5 μ l, 2.5 μ l by volume Following row is standard substance, by the molecule number two-fold dilution, from left to right is followed successively by 10 ¹¹, 5 * 10 ¹⁰, 2.5 * 10 ¹⁰

Fig. 9 is the influence of rAAV-HK injection back to the SHR blood pressure

Figure 10,11 is the influence of rAAV-HK injection back to the SHR microdose urine protein

Embodiment

Embodiment 1

The clone of human kallikrein (HK) cDNA and with reorganization and the structure of rAAV.

1) clone of human kallikrein (HK) cDNA

Design primer: P1,5 '-GCAGAATTCATGTGGTTCCTGG-3 '; P2,5 '-GACAAGCTTTTACTGGGGGTA-3 '.Synthetic by Wuhan Synbiotics AB.In human liver's sample, extract total RNA with TRIZOL test kit (available from GIBCO company), carry out RT-PCR (test kit available from Japanese TAKARA company).The PCR instrument is available from Britain TECONE company.And with product and pXXUF ₁Link to each other.HKcDNA is with pXXUF ₁In the gfp gene replace pXXUF ₁The plasmid of-HK constitutes, as shown in Figure 7.

With HKcDNA order-checking, gained result and coming to the same thing from GeneBank.But according to Kozak sequence principle: at first be first ATG Chang Zuowei translation initiation codon of promotor downstream, next is normally A/G of ATG close on 3, + 4 is G, with any one 3 or+4 purine changes pyrimidine into, the translation amount can reduce 5～10 times, if all change pyrimidine into, then translation skill descends 20 times.In view of the above, proposing (GCC) GCCA/GCCATGG is near the conserved sequence of high eukaryotic gene initiator codon.Therefore, we have done modification to HKcDNA, and it is G that the 1st bit base after the codon ATG of the human kallikrein gene of native state is changed by T, and the HKcDNA after obtaining modifying sees the HKcDNA sequence table after the modification of this specification sheets back.

2, express the preparation of the recombinant adeno-associated virus of human kallikrein

1) packing and the recovery of rAAV-HK and rAAV-LacZ recombinant virus

PXX ₂, pXX ₆, pXXUF ₁A large amount of extractions of the plasmid of-HK, pdx-LacZ, used big extraction reagent kit is available from Promega company.Method is described according to specification sheets.

293 cells (the female embryo's tumor cell line of people's kidney) are imported in several 150mm culture plates, and going down to posterity to cultivate needs 0.25% trypsinase, high sugared DMEM substratum, newborn calf serum (available from Gibco company).When treating that cell grows into 60% to 70% concentration class, 1: 1: 1 in molar ratio with pXX ₂, pXX ₆, pXXUF ₁-HK (pdx-lacZ) changes 293 cells over to calcium phosphorus infection protocol.All substratum are abandoned in suction in 48-72 hour after the transfection, add a small amount of PBS damping fluid, scrape and get 293 cells in the dish, and-80 ℃ of backs are frozen.

2) AAV-HK and rAAV-LacZ reclaim the purifying of virus

For dispeling the paraprotein in the cell, must purify with cesium chloride gradient centrifugation, method is as follows: behind the regenerant multigelation three times, 3000 leave the heart, dispel precipitation, and supernatant liquor adds (NH4) 2SO4 of 1/3 volume, further dispel protein, remove supernatant behind 4 ℃, the 5000 rev/mins centrifugal 10min.(the NH that adds 2/3 volume ₄) ₂SO ₄, mixing, 4 ℃ of cultivation 20min, 4 ℃ again, 12000 rev/mins centrifugal 20min get precipitation and are dissolved in the cesium chloride solution of 20ml1.37g/ml.288,000 rev/mins of ultracentrifugations in back 48 hours.Divide 12-16 sections with the content in the centrifuge tube, each section inserts with the pin of 21-G type, therefrom collects the liquid about 10, all measures titre with spot hybridization.

3) mensuration-dot hybridization of rAAV-HK and rAAV-LacZ titre

A) mark of cDNA probe and purifying:

Isotope-labeled Nucleotide α-P ³²Available from the refined brightness in Beijing company.Downcut PCDNA with NotI _3.1HK fragment among the-HK is as the probe of known array.Random priming mark HK fragment and purifying (test kit is available from QIAGEN company, and the by specification method is operated).

B) preparation of receipts thing and quantitative criterion:

Regenerant is through an amount of DnaseI and RNAse digestion, the genomic DNA of peptic cell, RNA.Add ProteinseK behind the reaction terminating again, the protein enclosure of digestion virus (above reagent is all available from Japanese TAKARA company).Phenol: chloroform: primary isoamyl alcohol (25: 24: 1) extracting, dispel precipitation, in the supernatant DNA in the virus.With supernatant two-fold dilution by volume.Standard substance adopts target gene fragment, and promptly the HK fragment is pressed the molecule number two-fold dilution after the mensuration concentration, and work heats and alkaline denaturation is handled.

C) hybridization and radioautograph

Prepare the dot hybridization device, and press the nylon membrane that device size is settled one 0.45 μ m, with viral sample to be measured and standard model by volume gradient and molecule gradient go up sample respectively, behind the last sample 80 ℃ of films were done roasting 2 hours back 42 ℃ of prehybridizations 1 hour (prehybridization solution is available from INTERGEN company).The label probe that adds heat treated was again hybridized 12-16 hour for 45 ℃.Wash behind the film-80 ℃ radioautograph 2-3 days.Result such as Fig. 8.The rAAV-HK of this presentation of results the present invention preparation possesses enough titres (1 * 10 ¹¹P.f.u.), can be used for experimentation on animals and clinical treatment.

The recombinant adeno-associated virus of method for preparing is named as " recombinant adeno-associated virus (rAAV-HK) of expressing human kallikrein ", be preserved in the Chinese typical culture collection center that is positioned at Chinese Wuhan September 29 calendar year 2001, and deposit number is CCTCC No.V200109.

Embodiment 2

RAAV-HK is to the hypotensive effect of spontaneous hypertensive rat (SHR) model

Spontaneously hypertensive rat model is available from Shanghai essential hypertension institute, and totally 12 rats are divided two groups, and respectively through tail vein injection rAAV-HK and rAAV-LacZ virus, every institute's consumption is 1 * 10 ¹¹P.f.u.Measuring blood pressure weekly after the injection, every first quarter moon is received twenty-four-hour urine.Find that injection back 3-4 week experimental group rat blood pressure begins to descend, after five months, put to death all animals, the results are shown in Figure 9.

Embodiment 3

The effect of rAAV-HK preventing apoplectic

8-16 week behind the injection gene has 2 apoplexy (confirming through dissecting) takes place in 6 animals of control group (rAAV-lacZ group), wherein one is hematencephalon, and another is a multiple cerebral infarction.Experimental group does not then all have the apoplexy phenomenon.

Embodiment 4

RAAV-HK improves the effect of renal function

Survey microdose urine protein with the ELISA method simultaneously, find that the microdose urine protein amount of most experiments group rat is stepped appearance decline, the results are shown in accompanying drawing 10,11.

And with animal kidney fixing back section, all do HE dyeing and Van Gieson dyeing, then the nephron of the control animals kidney about 16 weeks obviously reduces than experimental group animal behind the discovery injection gene, and most renal tissues are by fibrous tissue replacement, and the experimental group animal kidney does not then have considerable change.

Embodiment 5

RAAV-HK reverses the reconstruct of cardiovascular systems

Get animal hearts, blood vessel fixing back section, all do HE and Van Gieson dyeing, relatively two treated animals are found: 1) heart of control animals obviously thickens from organizing the tangent plane ventricle wall, ventricular chamber then obviously reduces 2) mirror observation down, the ventricular muscles muscle bundle of experimental group animal increases slightly, and part is replaced by fibrous tissue.3) aortal V-G dyeing PRELIMINARY RESULTS proves, the collegen filament in the control animals vessel wall distribute and obviously Duo than the experimental group animal and wide model.

Above presentation of results rAAV-HK virus provided by the invention has and efficiently brings high blood pressure down, improves good physiology and pathophysiological roles such as renal function, preventing apoplectic for a long time, can be used for essential hypertension, chronic renal insufficiency and other diseases related clinical treatments.

Below nucleotides sequence tabulation for the present invention relates to

1. the sequence of adeno-associated virus and concrete subregion

The ITR district 61 cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg, 121 gccaactcca tcactagggg ttcctggagg ggtggagtcg tgacgtgaat tacgtcatag 241 gtggtcacgc tgggtattta agcccgagtg agcacgcagg gtctccattt tgaagcggga 301 ggtttgaacg cgcagccgcc atgccggggt tttacgagat tgtgattaag gtccccagcg 361 accttgacgg gcatctgccc ggcatttctg acagctttgt gaactgggtg gccgagaagg 421 aatgggagtt gccgccagat tctgacatgg atctgaatct gattgagcag gcacccctga 481 ccgtggccga gaagctgcag cgcgactttc tgacggaatg gcgccgtgtg agtaaggccc 541 cggaggccct tttctttgtg caatttgaga agggagagag ctacttccac atgcacgtgc 601 tcgtggaaac caccggggtg aaatccatgg ttttgggacg tttcctgagt cagattcgcg 661 aaaaactgat tcagagaatt taccgcggga tcgagccgac tttgccaaac tggttcgcgg 721 tcacaaagac cagaaatggc gccggaggcg ggaacaaggt ggtggatgag tgctacatcc 781 ccaattactt gctccccaaa acccagcctg agctccagtg ggcgtggact aatatggaac 841 agtatttaag cgcctgtttg aatctcacgg agcgtaaacg gttggtggcg cagcatctga 901 cgcacgtgtc gcagacgcag gagcagaaca aagagaatca gaatcccaat tctgatgcgc 961 cggtgatcag atcaaaaact tcagccaggt acatggagct ggtcgggtgg ctcgtggaca1021 aggggattac ctcggagaag cagtggatcc aggaggacca ggcctcatac atctccttca1081 atgcggcctc caactcgcgg tcccaaatca aggctgcctt ggacaatgcg ggaaagatta1141 tgagcctgac taaaaccgcc cccgactacc tggtgggcca gcagcccgtg gaggacattt1201 ccagcaatcg gatttataaa attttggaac taaacgggta cgatccccaa tatgcggctt1261 ccgtctttct gggatgggcc acgaaaaagt tcggcaagag gaacaccatc tggctgtttg1321 ggcctgcaac taccgggaag accaacatcg cggaggccat agcccacact gtgcccttct1381 acgggtgcgt aaactggacc aatgagaact ttcccttcaa cgactgtgtc gacaagatgg1441 tgatctggtg ggaggagggg aagatgaccg ccaaggtcgt ggagtcggcc aaagccattc1501 tcggaggaag caaggtgcgc gtggaccaga aatgcaagtc ctcggcccag atagacccga1561 ctcccgtgat cgtcacctcc aacaccaaca tgtgcgccgt gattgacggg aactcaacga1621 ccttcgaaca ccagcagccg ttgcaagacc ggatgttcaa atttgaactc acccgccgtc1681 tggatcatga ctttgggaag gtcaccaagc aggaagtcaa agactttttc cggtgggcaa1741 aggatcacgt ggttgaggtg gagcatgaat tctacgtcaa aaagggtgga gccaagaaaa1801 gacccgcccc cagtgacgca gatataagtg agcccaaacg ggtgcgcgag tcagttgcgc 1921 gttctcgtca cgtgggcatg aatctgatgc tgtttccctg cagacaatgc gagagaatga1981 atcagaattc aaatatctgc ttcactcacg gacagaaaga ctgtttagag tgctttcccg2041 tgtcagaatc tcaacccgtt tctgtcgtca aaaaggcgta tcagaaactg tgctacattc2101 atcatatcat gggaaaggtg ccagacgctt gcactgcctg cgatctggtc aatgtggatt2161 tggatgactg catctttgaa caataaatga tttaaatcag gtatggctgc cgatggttat

2281 cctggcccac caccaccaaa gcccgcagag cggcataagg acgacagcag gggtcttgtg2341 cttcctgggt acaagtacct cggacccttc aacggactcg acaagggaga gccggtcaac

2461 agacaacccg tacctcaagt acaaccacgc cgacgcggag tttcaggagc gccttaaaga2521 agatacgtct tttgggggca acctcggacg agcagtcttc caggcgaaaa agagggttct2581 tgaacctctg ggcctggttg aggaacctgt taagacggct ccgggaaaaa agaggccggt2641 agagcactct cctgtggagc cagactcctc ctcgggaacc ggaaaggcgg gccagcagcc2701 tgcaagaaaa agattgaatt ttggtcagac tggagacgca gactcagtac ctgaccccca2761 gcctctcgga cagccaccag cagccccctc tggtctggga actaatacga tggctacagg2821 cagtggcgca ccaatggcag acaataacga gggcgccgac ggagtgggta attcctccgg2881 aaattggcat tgcgattcca catggatggg cgacagagtc atcaccacca gcacccgaac2941 ctgggccctg cccacctaca acaaccacct ctacaaacaa atttccagcc aatcaggagc3001 ctcgaacgac aatcactact ttggctacag caccccttgg gggtattttg acttcaacag3061 attccactgc cacttttcac cacgtgactg gcaaagactc atcaacaaca actggggatt3121 ccgacccaag agactcaact tcaagctctt taacattcaa gtcaaagagg tcacgcagaa3181 tgacggtacg acgacgattg ccaataacct taccagcacg gttcaggtgt ttactgactc3241 ggagtaccag ctcccgtacg tcctcggctc ggcgcatcaa ggatgcctcc cgccgttccc3301 agcagacgtc ttcatggtgc cacagtatgg atacctcacc ctgaacaacg ggagtcaggc3361 agtaggacgc tcttcatttt actgcctgga gtactttcct tctcagatgc tgcgtaccgg3421 aaacaacttt accttcagct acacttttga ggacgttcct ttccacagca gctacgctca3481 cagccagagt ctggaccgtc tcatgaatcc tctcatcgac cagtacctgt attacttgag3541 cagaacaaac actccaagtg gaaccaccac gcagtcaagg cttcagtttt ctcaggccgg3601 agcgagtgac attcgggacc agtctaggaa ctggcttcct ggaccctgtt accgccagca3661 gcgagtatca aagacatctg cggataacaa caacagtgaa tactcgtgga ctggagctac3721 caagtaccac ctcaatggca gagactctct ggtgaatccg gccatggcaa gccacaagga3781 cgatgaagaa aagttttttc ctcagagcgg ggttctcatc tttgggaagc aaggctcaga3841 gaaaacaaat gtgaacattg aaaaggtcat gattacagac gaagaggaaa tcggaacaac3901 caatcccgtg gctacggagc agtatggttc tgtatctacc aacctccaga gaggcaacag3961 acaagcagct accgcagatg tcaacacaca aggcgttctt ccaggcatgg tctggcagga4021 cagagatgtg taccttcagg ggcccatctg ggcaaagatt ccacacacgg acggacattt4081 tcacccctct cccctcatgg gtggattcgg acttaaacac cctcctccac agattctcat4141 caagaacacc ccggtacctg cgaatccttc gaccaccttc agtgcggcaa agtttgcttc4201 cttcatcaca cagtactcca cgggacacgg tcagcgtgga gatcgagtgg gagctgcaga4261 aggaaaacag caaacgctgg aatcccgaaa ttcagtacac ttccaactac aacaagtctg4321 ttaatcgtgg acttaccgtg gatactaatg gcgtgtattc agagcctcgc cccattggca4381 ccagatacct gactcgtaat ctgtaattgc ttgttaatca ataaaccgtt taattcgttt4441 cagttgaact ttggtctctg cgtatttctt tcttatctag tttccatggc tacgtagata 4561 cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc cgacgcccgg4621 gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg gccaa

2.cDNA ( GENEBANK ) tcctccacctgctggcccctggacacctctgtcaccatgtggttcctggttctgtgcctcgccctgtccctgggggggactggtgctgcgcccccgattcagtcccggattgtgggaggctgggagtgtgagcagcattcccagccctggcaggcggctctgtaccatttcagcactttccagtgtgggggcatcctggtgcaccgccagtgggtgctcacagctgctcattgcatcagcgacaattaccagctctggctgggtcgccacaacttgtttgacgacgaaaacacagcccagtttgttcatgtcagtgagagcttcccacaccctggcttcaacatgagcctcctggagaaccacacccgccaagcagacgaggactacagccacgacctcatgctgctccgcctgacagagcctgctgataccatcacagacgctgtgaaggtcgtggagttgcccacccaggaacccgaagtggggagcacctgtttggcttccggctggggcagcatcgaaccagagaatttctcatttccagatgatctccagtgtgtggacctcaaaatcctgcctaatgatgagtgcgaaaaagcccacgtccagaaggtgacagacttcatgctgtgtgtcggacacctggaaggtggcaaagacacctgtgtgggtgattcagggggcccgctgatgtgtgatggtgtgctccaaggtgtcacatcatggggctacgtcccttgtggcacccccaataagccttctgtcgccgtcagagtgctgtcttatgtgaagtggatcgaggacaccatagcggagaactcctgaacgcccagccctgtcccctacccccagtaaaatcaaatgtgcatcc

3.HKcDNAtcctccacctgctggcccctggacacctctgtcaccatggggttcctggttctgtgcctcgccctgtccctgggggggactggtgctgcgcccccgattcagtcccggattgtgggaggctgggagtgtgagcagcattcccagccctggcaggcggctctgtaccatttcagcactttccagtgtgggggcatcctggtgcaccgccagtgggtgctcacagctgctcattgcatcagcgacaattaccagctctggctgggtcgccacaacttgtttgacgacgaaaacacagcccagtttgttcatgtcagtgagagcttcccacaccctggcttcaacatgagcctcctggagaaccacacccgccaagcagacgaggactacagccacgacctcatgctgctccgcctgacagagcctgctgataccatcacagacgctgtgaaggtcgtggagttgcccacccaggaacccgaagtggggagcacctgtttggcttccggctggggcagcatcgaaccagagaatttctcatttccagatgatctccagtgtgtggacctcaaaatcctgcctaatgatgagtgcgaaaaagcccacgtccagaaggtgacagacttcatgctgtgtgtcggacacctggaaggtggcaaagacacctgtgtgggtgattcagggggcccgctgatgtgtgatggtgtgctccaaggtgtcacatcatggggctacgtcccttgtggcacccccaataagccttctgtcgccgtcagagtgctgtcttatgtgaagtggatcgaggacaccatagcggagaactcctgaacgcccagccctgtcccctacccccagtaaaatcaaatgtgcatcc

Claims (10)

1. a recombinant adeno-associated virus of expressing human kallikrein is characterized in that, it comprises the packaging plasmid pXX of encoding adenovirus correlated virus Rep albumen and Cap albumen coded sequence ₂, kept adenovirus E 1 A, E2A and VA through deleted adenovirus Disease-causing gene sequence ₁The helper plasmid pXX of rna gene gained ₆With the carrier for expression of eukaryon that has inserted the human kallikrein encoding sequence, at packaging plasmid pXX ₂Upstream and downstream a promoter sequence is respectively arranged.

2. the recombinant adeno-associated virus of expression human kallikrein according to claim 1 is characterized in that, and is said at packaging plasmid pXX ₂The promoter sequence of upstream and downstream be the p5 promoter sequence.

3. according to the recombinant adeno-associated virus of claim 1,2 described expression human kallikreins, it is characterized in that said carrier for expression of eukaryon is the pXXUF that contains the CMV promotor ₁Or pXXUF ₃

4. according to the recombinant adeno-associated virus of claim 1,2 described expression human kallikreins, it is characterized in that the human kallikrein gene that said human kallikrein gene is a native state or its mutant or manually modified body.

5. the recombinant adeno-associated virus of expression human kallikrein according to claim 3 is characterized in that, human kallikrein gene mutation body that said human kallikrein gene is a native state or manually modified body.

6. the recombinant adeno-associated virus of expression human kallikrein according to claim 4, it is characterized in that the manually modified body of said human kallikrein gene is that the 1st bit base after the codon ATG of the human kallikrein gene of native state is changed by T is the nucleotide acid sequence that obtains behind the G.

7. the recombinant adeno-associated virus of expression human kallikrein according to claim 5, it is characterized in that the manually modified body of said human kallikrein gene is that the 1st bit base after the codon ATG of the human kallikrein gene of native state is changed by T is the nucleotide acid sequence that obtains behind the G.

8. according to the recombinant adeno-associated virus of claim 6,7 described expression human kallikreins, it is characterized in that, it is the recombinant adeno-associated virus rAAV-HK that is preserved in the expression human kallikrein at Chinese typical culture collection center, CCTCC No.V200109.

9. method for preparing the recombinant adeno-associated virus of expressing human kallikrein comprises:

(a) provide adeno-associated virus to pack necessary Rep albumen and the proteic encoding sequence-pXX of Cap ₂Plasmid and stimulation adeno-associated virus duplicate and transcribe necessary adenovirus E 1 A, E2A and VAI rna gene-pXX ₆Plasmid;

(b) provide and contain the genomic carrier for expression of eukaryon pXXUF of adeno-associated virus ₁, adeno-associated virus disappearance cap albumen and rep protein-coding region in this eukaryotic vector, and insert human kallikrein gene (human kallikrein), form recombinant plasmid pXXUF ₁-HK;

(c) with the pXX in the step a) ₂, pXX ₆With the pXXUF in the step b) ₁-HK cotransfection 293 cells;

(d) reclaim the separation and purification recombinant adeno-associated virus.

10. a pharmaceutical composition is characterized in that, this pharmaceutical composition contains recombinant adeno-associated virus and the pharmaceutically acceptable carrier or the vehicle of the described any expression human kallikrein of claim 1 to 8 of significant quantity.

Images