CN1410531A

CN1410531A - Culturing method of human peripheral blood vessel endothelial ancestry cell

Info

Publication number: CN1410531A
Application number: CN02145492A
Authority: CN
Inventors: 孙宝贵; 严轶文; 戴秋艳
Original assignee: Shanghai First Peoples Hospital
Current assignee: Shanghai First Peoples Hospital
Priority date: 2002-11-20
Filing date: 2002-11-20
Publication date: 2003-04-16
Anticipated expiration: 2022-11-20
Also published as: CN1181195C

Abstract

A method for culturing human peripheral blood vascular endothelial archeocyte features that the MNC cell is directly used for culturing in vitro to obtain EPCs. Its step are adding a growth factor to the culture liquid, implanting in culture bottle or on glass sheet by a certain density, and conventional culture. Its advantages are simple process, high output rate of EPCs, and low cost.

Description

A kind of cultural method of human peripheral endothelial progenitor cell

Technical field

The invention belongs to biological technical field, be specifically related to the cultural method of human peripheral endothelial progenitor cell.

Background technology

Stimulating angiogenesis artificially is a kind of novel method of treatment ischemic disease.Angiogenesis comprises two notions: brephic blood vessel take place (vasculogenesis, VG) and postnatal vasculogenesis (angiogenesis, AG).The VG of traditional sense refers to, do not having under the situation of vascular system, by endothelial progenitor cell (endothelial progenitor cells, EPCs) or angioblast (angioblasts) be divided into endotheliocyte, form vasoganglion in the mode of sprouting, and then form blood vessel.This process is that center, EPCs blood island around begins with hemopoietic stem cell (HSC) usually.The AG of traditional sense refers to, breaks through the migration of tube wall matrix at the adult blood vessel by the mature endothelial cell that has existed, and propagation and reconstruct make the blood vessel branch continue to prolong in the germination mode.In recent years, researchs such as Ashara report separation and Culture from peripheral blood goes out EPCs, and proves that EPCs has also participated in postnatal vasculogenesis, and the notion of AG has new change.

From people's peripheral blood, isolate CD with magnetic-type cell sorting method ³⁴⁺Mononuclearcell (MNC ^CD34+), vitro culture shows that it can be divided into endotheliocyte, feeds back for the ischemic animal model and shows that it has participated in birth back vasculogenesis (Angiogenesis, process AG).Thereby prove that first (endothelial progenitor cells EPCs) derives from MNC to endothelial progenitor cell ^CD34+After this report of isolating same EPCs from embryo, marrow, umbilical vein blood is arranged successively.

At present, traditional EPCs isolated culture is as follows: with known Ficoll density gradient centrifugation peripheral blood is isolated mononuclearcell (MNC) layer 1..2. CD chooses ³⁴⁺The immunomagnetic beads of antibody sandwich takes the magnetic bead sorting method to isolate MNC in MNC ^CD34+Then with MNC ^CD34+Plant in culture dish separately and cultivate.3.MNC ^CD34+Cultivation: nutrient solution: medium-199+20% foetal calf serum+Medulla Bovis seu Bubali extract+microbiotic, or EBM-2+5%FBS+ people VEGF-1+ people FGF-2+ people EGF+ people IGF-1+ xitix.(VEGF is a vascular endothelial growth factor, FGF is a fibroblast growth factor, EGF is an epithelical cell growth factor, and IGF is a rhIGF-1) culture dish employing people's Fiberonectin (fibronectin) or collagen I type (collagen typeI) bag quilt.

Traditional cultural method is comparatively loaded down with trivial details, unavoidably has the loss of MNC CD34+ in the process with the immunological magnetic bead sorting MNC of CD34+ antibody sandwich, causes the cell yield lower.In addition, external traditional method requires experiment condition higher, so its method is repeatable relatively poor.

Summary of the invention

The cultural method that the purpose of this invention is to provide a kind of new human peripheral endothelial progenitor cell.The inventive method obtains EPCs by external direct cultivation MNC after adopting separation of human peripheral blood MNC.Present method can be simplified the EPCs culturing step, improves the yield of cell.

Medical circle generally acknowledges that EPCs has following purposes: a. to promote the effect of angiogenesis, improve the dysfunction that the internal organs ischemic causes, feed back in the body of EPCs and can be used to treat the human body ischemic disease:, especially will in the therapeutic process of ischemic heart diseases such as myocardial infarction, stenocardia, play huge effect as a series of diseases such as ischemic heart disease, cerebral ischemia, renal ischaemia, acro-ischemia necrosis; B. help to repair the tunica intima of damage, as inevitable how many meeting arterial intima of the intervene operation of percutaneous tranluminal coronary angioplasty (PTCA) and other blood vessels, the feedback of EPCs will promote the reparation of damage inner membrance, reduce the vascular restenosis behind the interventional procedure that causes because of inner film injury; C. help to recover and rebuild atherosclerotic function of vascular endothelium, prevent atherosclerotic further deterioration, reduce the generation of myocardial infarction; D. aspect oncology,, take corresponding braking measure, for suppressing tumor-blood-vessel growth and suppressing tumor growth and open up new way by the effect of research EPCs in the tumor-blood-vessel growth process.

The cultural method of a kind of human peripheral endothelial progenitor cell of the present invention is realized by following step: 1, separation of human peripheral blood MNC: get HFA's anticoagulation 10-15ml, isolate MNC with the Ficoll density gradient centrifugation.2, vitro culture MNC: in the cell in vitro nutrient solution, add somatomedin; In the culturing bottle that is coated with gelatin or on the little slide, gelatin density is 5-10 μ l/cm with MNC cell kind ²Cell places 37 ℃, 5%CO ₂Incubator in, every 3-4 days half amount is changed liquid once.

The cell in vitro nutrient solution of above-mentioned MNC is M-199+20%FBS+ heparin 100U/ml+0.1mg/ml penicillin+0.1mg/ml Streptomycin sulphate; Somatomedin is Niu Chuiti extract (commercial), in the final concentration adding nutrient solution with 3-15 μ g/ml; Cell is by 10 ⁵-10 ⁶Cell/cm ²Plantation; Be coated with 2% gelatin in the culturing bottle or on the little slide, gelatin density is 5-10 μ l/cm ²3, endothelial progenitor cell CHARACTERISTICS IDENTIFICATION:

The morphocytology feature: every ml peripheral blood can obtain MNC 1-2 * 10 through Ficoll density gradient centrifugation ⁶, the adherent rate of cultivating a day is about 30%, and most cellular fories are circular.Fusiformis attached cell (attaching cell, AT cell) occurred in the 2nd day that cultivates, and the cluster phenomenon occurs, more the 4th day spindle cell is seen and is formed streak or tubulose distributes.

Cell function was identified: at the 7th day that cultivates; acetylizad low-density lipoprotein (DiI-Ac-LDL) the 10 μ g/ml of cell and DiI mark are incubated bath 24h at 37 ℃; the result is that 85% attached cell has all absorbed acetylizad LDL specifically, illustrates that described attached cell has the functional performance of endotheliocyte family.

Albumen and cell surface molecule are identified: at the 14th day that cultivates, the cell of cultivating on little slide is carried out immunohistochemical staining and the immunofluorescence dyeing of CD31 and CD34 and the flow cytometry detection of CD31, CD34 of vWF and Flk-1.The result shows that vWF, Flk-1 (VEGFR-2), CD31, CD34 all are positive in the AT cell endochylema, and flow cytometry result: CD31 is 70.24 ± 10.12% (n=5), and CD34 is 55.37 ± 14.85% (n=8).Described vWF, Flk-1, CD31, CD34 are endotheliocyte family specificity sign, and wherein Flk-1, CD34 are the specificity marker of EPCs.

Gene identification:,, detect the expression of cell Flt-1 (VEGFR-1) mRNA with the RT-PCR method with Tris extracting cell RNA at the 14th day that cultivates.Flt-1 is one of specific gene of endotheliocyte family, is necessary in the growth course of blood vessel.Present method has used different primers as follows: primer 1 (317bp)---Choi K, Development.1998; 125.sense, 5 ' CTCTGATGGTGATCGTGG3 '; Antisense, 5 ' CATGCGTCTGGCCACTTG3 '. primer 2 (1080bp)---Bellamy WT, Cancer Res.1999; 59.sense, 5 ' GAGAATTCACTATGGAAGATCTGATTTCTTACAGT '; Antisense, ' GAGCATGCGGTAAAATACACATGTGCTTCTAG 3 '. showed cell is expressed the Flt-1 gene as a result.

Agents useful for same of the present invention is commercial, and the used detection method of the present invention is conventional currently known methods.

The AT cell that derives from MNC that the present invention cultivates presents special morphological specificity in process of growth, be the fusiformis adherent growth, cluster phenomenon and streak or piped growth phenomenon are arranged as cell.The AT cell has endotheliocyte family characteristic simultaneously: a. function aspects: the AT cell can absorb Ac-LDL, has possessed the function of endotheliocyte; B. albumen and cell surface molecule aspect: the AT cell cytosol contains vWF, Flk-1, and the cell surface molecule CD31 and the CD34 positive illustrate that the AT cell has the specificity marker of endotheliocyte family; C. gene aspect: all show AT cell expressing endothelial cell specific gene Flt-1 with two kinds of RT-PCR detected results of carrying out from the primer of Flt-1 gene different fragments.In addition, because Flk-1 and CD34 are considered to the specificity marker of EPCs at present, proved that further the AT cell that the present invention cultivates gained is exactly EPCs.The present invention obtains EPCs by direct cultivation MNC, has simplified the experimental procedure of traditional cultural method, effectively avoids the unnecessary loss of MNC CD34+, improves the yield of EPCs, and is repeatable high, and saves a large amount of funds.The inventive method is that methodology has been set up in separation and the cultivation of human peripheral EPCs, for later research lays the foundation.Present method is also fully prepared for clinical application from now on, and the consumption of the corresponding minimizing peripheral blood of energy is for create conditions from body adoptive therapy ischemic disease in the future.

Description of drawings Fig. 1 be institute's culturing cell morphological specificity figure wherein: the cluster phenomenon of a. attached cell

B. spindle cell is streak distribution

C. spindle cell in a tubular form distribution plan 2 be cell function evaluation figure wherein: a. red fluorescence is the AT cell that has absorbed LDL

B. in the same visual field ordinary light microscopically scene Fig. 3 be immunofluorescence and immunohistochemical methods figure wherein: a. immunofluorescence detects and shows that green fluorescence is the CD31 positive cells, green

CD31 is positive, and part is positioned at cytoplasm

B. immunofluorescence detects and shows that green fluorescence is the CD34 positive cells, green

CD34 is positive, and part equally also is positioned at cytoplasm

C. immunohistochemical methods detects and shows the vWF positive staining, the positive part of brown vWF

Be distributed in the cytoplasm, the anti-back showed cell nuclear that dyes of Hematorylin is for blue

D. immunohistochemical methods detects and shows the Flk-1 positive staining, the positive part of brown Flk-1

Be distributed in the cytoplasm, the anti-back showed cell nuclear that dyes of Hematorylin is for blue.Fig. 4 be the flow cytometry analysis chart wherein: the negative contrast of black curve, green curve are CD31 (a) and CD34 (b)

Positive curve.Fig. 5 be Flt-1 the RT-PCR electrophorogram wherein: internal reference is the β actin of length 510bp.

Embodiment

Embodiment 1

1, separation of human peripheral blood MNC: get HFA's anticoagulation 10-15ml, be layered on the Ficoll parting liquid along tube wall with 1: 1 dilution back of D-Hanks balanced salt solution, after 2000rpm * 30min density gradient centrifugation with the sucking-off of white cloud and mist layer, use D-Hanks balanced salt solution 1000rpm * 10min to wash twice again, cell is resuspended in the nutrient solution and with trypan blue counts at last.

2, vitro culture MNC: nutrient solution is M-199+20%FBS+ heparin 100U/ml+0.1mg/ml penicillin+0.1mg/ml Streptomycin sulphate; Somatomedin is the Niu Chuiti extract, in the final concentration adding nutrient solution with 9 μ g/ml; Cell is pressed 10 ⁵/ cm ²Plant in the culturing bottle that is coated with 2% gelatin or on the little slide, gelatin density is 5 μ l/cm ²Cell places 37 ℃, 5%CO ₂Incubator in, every 3-4 days half amount is changed liquid once.

3, endothelial progenitor cell CHARACTERISTICS IDENTIFICATION: carry out as stated above.

Claims

1, a kind of cultural method of human peripheral endothelial progenitor cell, it is characterized in that adopting separation of human peripheral blood MNC after, obtain EPCs by external direct cultivation MNC.

2, by the cultural method of the described human peripheral endothelial progenitor cell of claim 1, it is characterized in that being undertaken by following step:

1) separation of human peripheral blood MNC: get HFA's anticoagulation 10-15ml, use Ficoll

Density gradient centrifugation is isolated MNC;

2) vitro culture MNC: add somatomedin in the nutrient solution; With MNC cell kind in

Be coated with in the culturing bottle of gelatin or on the little slide;

3) endothelial progenitor cell is identified: carry out morphocytology, function, albumen and cell table

Face molecule and gene identification.

3, by the cultural method of claim 1 and 2 described human peripheral endothelial progenitor cells, the vitro culture liquid that it is characterized in that described MNC is M-199+20%FBS+ heparin 100U/ml+0.1mg/ml penicillin+0.1mg/ml Streptomycin sulphate.

4, by the cultural method of claim 1 and 2 described human peripheral endothelial progenitor cells, it is characterized in that added somatomedin is the Niu Chuiti extract in the described nutrient solution, final concentration is 3-15 μ g/ml.

5, by the cultural method of claim 1 and 2 described human peripheral endothelial progenitor cells, it is characterized in that described MNC cell seeding density is 10 ⁵-10 ⁶Cell/cm ²

6, by the cultural method of claim 1 and 2 described human peripheral endothelial progenitor cells, it is characterized in that described bag is 2% by gelatin concentration, density is 5-10 μ l/cm ²

7, by the described method of claim 4, the final concentration that it is characterized in that described somatomedin Niu Chuiti extract is 9 μ g/ml.

8, by the described method of claim 5, it is characterized in that described MNC cell seeding density is 10 ⁵Cell/cm ²

9, by the described method of claim 6, it is characterized in that described bag is 5 μ l/cm by gelatin density ²